#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACACA	31	genome.wustl.edu	37	17	35563786	35563786	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr17:35563786C>G	ENST00000394406.2	-	32	3938	c.3748G>C	c.(3748-3750)Gat>Cat	p.D1250H	ACACA_ENST00000360679.3_Missense_Mutation_p.D1192H|ACACA_ENST00000353139.5_Missense_Mutation_p.D1287H|ACACA_ENST00000335166.5_Missense_Mutation_p.D1172H	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1250					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.D1192H(1)|p.D1287H(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ATCACTTCATCAAAGATCCTA	0.443																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	dbGAP											2	Substitution - Missense(2)	breast(2)											94.0	84.0	87.0					17																	35563786		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.3748G>C	17.37:g.35563786C>G	ENSP00000377928:p.Asp1250His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.D1287H	ENST00000394406.2	37	c.3859	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331520	0.60853	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.85	5.85	0.93711	Acetyl-CoA carboxylase, central domain (1);	0.337248	0.35320	N	0.003298	T	0.69468	0.3114	M	0.79475	2.455	0.80722	D	1	D;P;P	0.56968	0.978;0.749;0.9	P;P;P	0.61201	0.885;0.61;0.594	T	0.70142	-0.4953	10	0.56958	D	0.05	-8.776	20.1736	0.98170	0.0:1.0:0.0:0.0	.	1287;1250;1192	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	H	1287;1192;1250;1274;1172	ENSP00000344789:D1287H;ENSP00000353898:D1192H;ENSP00000377928:D1250H;ENSP00000335323:D1172H	ENSP00000335323:D1172H	D	-	1	0	ACACA	32637899	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.447000	0.66606	2.767000	0.95098	0.557000	0.71058	GAT	ACACA	-	pfam_AcCoA_COase_cen	ENSG00000132142		0.443	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	255	0.00	0	C	NM_198836		35563786	35563786	-1	no_errors	ENST00000353139	ensembl	human	known	69_37n	missense	122	44.09	97	SNP	1.000	G
ADCY8	114	genome.wustl.edu	37	8	132051962	132051962	+	Silent	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr8:132051962G>C	ENST00000286355.5	-	1	2710	c.618C>G	c.(616-618)gcC>gcG	p.A206A	ADCY8_ENST00000377928.3_Silent_p.A206A	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	206					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.A206A(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GGTCCATGGGGGCCGAGGCCA	0.587										HNSCC(32;0.087)																												dbGAP											1	Substitution - coding silent(1)	breast(1)											68.0	72.0	71.0					8																	132051962		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.618C>G	8.37:g.132051962G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A206	ENST00000286355.5	37	c.618	CCDS6363.1	8																																																																																			ADCY8	-	NULL	ENSG00000155897		0.587	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	137	0.00	0	G			132051962	132051962	-1	no_errors	ENST00000286355	ensembl	human	known	69_37n	silent	117	13.33	18	SNP	0.347	C
AMPD1	270	genome.wustl.edu	37	1	115216584	115216584	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:115216584T>A	ENST00000520113.2	-	14	2034	c.2019A>T	c.(2017-2019)aaA>aaT	p.K673N	AMPD1_ENST00000369538.3_Missense_Mutation_p.K669N|AMPD1_ENST00000353928.6_Missense_Mutation_p.K640N			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	673					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.K673N(1)|p.K640N(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TCATTAGCCCTTTCTGAAGGA	0.393																																						dbGAP											2	Substitution - Missense(2)	breast(2)											107.0	105.0	105.0					1																	115216584		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.2019A>T	1.37:g.115216584T>A	ENSP00000430075:p.Lys673Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.K673N	ENST00000520113.2	37	c.2019	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	T	16.50	3.141497	0.57044	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.95482	-3.72;-3.72;-3.72	6.07	4.96	0.65561	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.95890	0.8662	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.99	D	0.96132	0.9093	10	0.87932	D	0	-15.4259	9.7636	0.40548	0.0:0.1839:0.0:0.8161	.	669;640	Q5TF02;P23109	.;AMPD1_HUMAN	N	673;669;640	ENSP00000430075:K673N;ENSP00000358551:K669N;ENSP00000316520:K640N	ENSP00000316520:K640N	K	-	3	2	AMPD1	115018107	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	0.825000	0.27393	1.126000	0.42016	0.533000	0.62120	AAA	AMPD1	-	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.393	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	71	0.00	0	T			115216584	115216584	-1	no_errors	ENST00000520113	ensembl	human	known	69_37n	missense	46	36.11	26	SNP	1.000	A
ARHGAP30	257106	genome.wustl.edu	37	1	161018344	161018344	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:161018344G>A	ENST00000368013.3	-	12	2787	c.2467C>T	c.(2467-2469)Cca>Tca	p.P823S	USF1_ENST00000368021.3_5'Flank|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.P646S|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Intron	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	823	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.P823S(1)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GCTGCTTCTGGGCTTCTGCTG	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											185.0	176.0	179.0					1																	161018344		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2467C>T	1.37:g.161018344G>A	ENSP00000356992:p.Pro823Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P823S	ENST00000368013.3	37	c.2467	CCDS30918.1	1	.	.	.	.	.	.	.	.	.	.	G	8.153	0.787770	0.16258	.	.	ENSG00000186517	ENST00000368013;ENST00000368015	T;T	0.29655	3.09;1.56	4.43	-6.59	0.01830	.	1.050320	0.07565	N	0.917674	T	0.07908	0.0198	M	0.67953	2.075	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.33317	-0.9873	10	0.22706	T	0.39	.	1.3875	0.02243	0.1751:0.3158:0.2819:0.2273	.	823	Q7Z6I6	RHG30_HUMAN	S	823;646	ENSP00000356992:P823S;ENSP00000356994:P646S	ENSP00000356992:P823S	P	-	1	0	ARHGAP30	159284968	0.000000	0.05858	0.002000	0.10522	0.966000	0.64601	-0.474000	0.06607	-0.823000	0.04301	0.455000	0.32223	CCA	ARHGAP30	-	NULL	ENSG00000186517		0.557	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	HGNC	protein_coding	OTTHUMT00000077090.2	187	0.00	0	G	NM_181720		161018344	161018344	-1	no_errors	ENST00000368013	ensembl	human	known	69_37n	missense	291	17.33	61	SNP	0.000	A
ASAP1	50807	genome.wustl.edu	37	8	131140243	131140243	+	Silent	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr8:131140243C>G	ENST00000518721.1	-	16	1538	c.1311G>C	c.(1309-1311)ctG>ctC	p.L437L	ASAP1_ENST00000357668.1_Silent_p.L437L	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	437					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.L437L(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TGGCTTTTGTCAGGTCTTCCA	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											134.0	115.0	122.0					8																	131140243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1311G>C	8.37:g.131140243C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.D258H	ENST00000518721.1	37	c.772	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254016	0.22965	.	.	ENSG00000153317	ENST00000524124	.	.	.	5.88	5.0	0.66597	.	.	.	.	.	T	0.72366	0.3451	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71978	-0.4429	4	.	.	.	.	15.7377	0.77859	0.137:0.8629:0.0:0.0	.	.	.	.	H	258	.	.	D	-	1	0	ASAP1	131209425	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.361000	0.34136	1.458000	0.47871	0.655000	0.94253	GAC	ASAP1	-	superfamily_ArfGAP	ENSG00000153317		0.488	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	129	0.00	0	C	NM_018482		131140243	131140243	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524124	ensembl	human	novel	69_37n	missense	99	11.61	13	SNP	1.000	G
ATMIN	23300	genome.wustl.edu	37	16	81078489	81078489	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr16:81078489G>T	ENST00000299575.4	+	4	2410	c.2386G>T	c.(2386-2388)Gat>Tat	p.D796Y	ATMIN_ENST00000566488.1_Missense_Mutation_p.D640Y|ATMIN_ENST00000539819.1_3'UTR|ATMIN_ENST00000564241.1_Missense_Mutation_p.D640Y	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	796					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)	p.D796Y(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						TCTTCTGGCTGATCTGGCCTG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	78.0	78.0					16																	81078489		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.2386G>T	16.37:g.81078489G>T	ENSP00000299575:p.Asp796Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4H8|Q68DC9	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.D796Y	ENST00000299575.4	37	c.2386	CCDS32494.1	16	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490483	0.64074	.	.	ENSG00000166454	ENST00000299575;ENST00000539819	T	0.59364	0.27	6.02	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.73265	0.3565	M	0.76002	2.32	0.58432	D	0.999991	D	0.76494	0.999	D	0.69142	0.962	T	0.76038	-0.3105	10	0.87932	D	0	-20.7829	12.6877	0.56956	0.1327:0.0:0.8673:0.0	.	796	O43313	ATMIN_HUMAN	Y	796;567	ENSP00000299575:D796Y	ENSP00000299575:D796Y	D	+	1	0	ATMIN	79635990	1.000000	0.71417	0.006000	0.13384	0.979000	0.70002	9.742000	0.98846	0.886000	0.36113	0.655000	0.94253	GAT	ATMIN	-	NULL	ENSG00000166454		0.488	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATMIN	HGNC	protein_coding	OTTHUMT00000432140.1	58	0.00	0	G	NM_015251		81078489	81078489	+1	no_errors	ENST00000299575	ensembl	human	known	69_37n	missense	94	22.31	27	SNP	0.972	T
C1orf210	149466	genome.wustl.edu	37	1	43748740	43748740	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:43748740C>G	ENST00000523677.1	-	3	291	c.58G>C	c.(58-60)Gtg>Ctg	p.V20L	C1orf210_ENST00000423420.1_Missense_Mutation_p.V20L	NM_001164829.1|NM_182517.2	NP_001158301.1|NP_872323.1	Q8IVY1	CA210_HUMAN	chromosome 1 open reading frame 210	20						integral component of membrane (GO:0016021)		p.V20L(1)		breast(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCAGGGGCCACAGCAGACGCT	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											28.0	30.0	29.0					1																	43748740		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041633	CCDS481.1	1p34.2	2006-03-22			ENSG00000253313	ENSG00000253313			28755	protein-coding gene	gene with protein product						12477932	Standard	NM_182517		Approved	MGC52423	uc001cit.4	Q8IVY1	OTTHUMG00000007289	ENST00000523677.1:c.58G>C	1.37:g.43748740C>G	ENSP00000430918:p.Val20Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPX2	Missense_Mutation	SNP	NULL	p.V20L	ENST00000523677.1	37	c.58	CCDS481.1	1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513909	0.27123	.	.	ENSG00000253313	ENST00000523677;ENST00000423420	T;T	0.41758	0.99;0.99	4.96	-8.89	0.00785	.	3.233710	0.00531	N	0.000212	T	0.29783	0.0744	L	0.35723	1.085	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08452	-1.0721	10	0.20046	T	0.44	.	11.4146	0.49945	0.1113:0.6055:0.0:0.2832	.	20	Q8IVY1	CA210_HUMAN	L	20	ENSP00000430918:V20L;ENSP00000429399:V20L	ENSP00000429399:V20L	V	-	1	0	C1orf210	43521327	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-1.225000	0.02956	-1.789000	0.01264	-0.367000	0.07326	GTG	C1orf210	-	NULL	ENSG00000253313		0.627	C1orf210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf210	HGNC	protein_coding	OTTHUMT00000019035.2	103	0.00	0	C	NM_182517		43748740	43748740	-1	no_errors	ENST00000423420	ensembl	human	known	69_37n	missense	93	31.11	42	SNP	0.000	G
C20orf85	128602	genome.wustl.edu	37	20	56735726	56735727	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr20:56735726_56735727insC	ENST00000371168.3	+	4	323_324	c.262_263insC	c.(262-264)tccfs	p.S88fs		NM_178456.2	NP_848551.1	Q9H1P6	CT085_HUMAN	chromosome 20 open reading frame 85	88										kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	13	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			GGTCTTTCCATCCCCCCCAGTC	0.579																																						dbGAP											0										5,4259		0,5,2127						5.1	0.2		dbSNP_126	44	5,8249		0,5,4122	no	frameshift	C20orf85	NM_178456.2		0,10,6249	A1A1,A1R,RR		0.0606,0.1173,0.0799				10,12508				-	-	-	SO:0001589	frameshift_variant	0			AL354776	CCDS13465.1	20q13.32	2012-10-29			ENSG00000124237	ENSG00000124237			16216	protein-coding gene	gene with protein product	"""Low in Lung Cancer 1"""						Standard	NM_178456		Approved	bA196N14.1, LLC1	uc002xyv.3	Q9H1P6	OTTHUMG00000032836	ENST00000371168.3:c.269dupC	20.37:g.56735733_56735733dupC	ENSP00000360210:p.Ser88fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	NULL	p.V91fs	ENST00000371168.3	37	c.262_263	CCDS13465.1	20																																																																																			C20orf85	-	NULL	ENSG00000124237		0.579	C20orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf85	HGNC	protein_coding	OTTHUMT00000079866.2	29	0.00	0	-	NM_178456		56735726	56735727	+1	no_errors	ENST00000371168	ensembl	human	known	69_37n	frame_shift_ins	25	13.79	4	INS	0.675:0.687	C
CACNA1B	774	genome.wustl.edu	37	9	140938303	140938303	+	Missense_Mutation	SNP	C	C	T	rs201227447		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr9:140938303C>T	ENST00000371372.1	+	21	3509	c.3364C>T	c.(3364-3366)Cgg>Tgg	p.R1122W	CACNA1B_ENST00000371355.4_Missense_Mutation_p.R1123W|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R1123W|CACNA1B_ENST00000277549.5_Missense_Mutation_p.R314W|CACNA1B_ENST00000277551.2_Missense_Mutation_p.R1122W|CACNA1B_ENST00000545473.1_Missense_Mutation_p.R148W|CACNA1B_ENST00000371363.1_Missense_Mutation_p.R1122W	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1122					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.R1122W(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGCGGCCCCCGGCCTATCGT	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											255.0	289.0	278.0					9																	140938303		2127	4223	6350	-	-	-	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3364C>T	9.37:g.140938303C>T	ENSP00000360423:p.Arg1122Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.R1123W	ENST00000371372.1	37	c.3367	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	C	18.25	3.582710	0.65992	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355;ENST00000545473	T;T;T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09;1.09;1.09	4.95	1.7	0.24286	.	0.267208	0.34268	N	0.004105	T	0.57725	0.2073	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.98;0.973;0.973	T	0.59810	-0.7384	10	0.72032	D	0.01	.	12.1827	0.54221	0.685:0.3149:0.0:0.0	.	1122;1123;1122	B1AQK4;B1AQK7;B1AQK6	.;.;.	W	1122;1122;314;1122;1123;1123;148	ENSP00000360423:R1122W;ENSP00000277551:R1122W;ENSP00000277549:R314W;ENSP00000360414:R1122W;ENSP00000360408:R1123W;ENSP00000360406:R1123W;ENSP00000441232:R148W	ENSP00000277549:R314W	R	+	1	2	CACNA1B	140058124	0.870000	0.30015	0.998000	0.56505	0.943000	0.58893	1.610000	0.36869	0.408000	0.25621	0.561000	0.74099	CGG	CACNA1B	-	NULL	ENSG00000148408		0.602	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	175	0.00	0	C	NM_000718		140938303	140938303	+1	no_errors	ENST00000371355	ensembl	human	known	69_37n	missense	83	31.97	39	SNP	0.997	T
CAMTA2	23125	genome.wustl.edu	37	17	4875737	4875738	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr17:4875737_4875738insG	ENST00000348066.3	-	16	2720_2721	c.2597_2598insC	c.(2596-2598)cctfs	p.P866fs	CAMTA2_ENST00000572543.1_Frame_Shift_Ins_p.P871fs|RP5-1050D4.2_ENST00000430920.1_RNA|CAMTA2_ENST00000381311.5_Frame_Shift_Ins_p.P868fs|CAMTA2_ENST00000361571.5_Frame_Shift_Ins_p.P865fs|CAMTA2_ENST00000414043.3_Frame_Shift_Ins_p.P889fs|CAMTA2_ENST00000358183.4_Frame_Shift_Ins_p.P866fs	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	866					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GCAGAGGTGCAGGGGGGGGACT	0.614																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.2598dupC	17.37:g.4875745_4875745dupG	ENSP00000321813:p.Pro866fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Frame_Shift_Ins	INS	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.A890fs	ENST00000348066.3	37	c.2667_2666	CCDS11063.1	17																																																																																			CAMTA2	-	NULL	ENSG00000108509		0.614	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	61	0.00	0	-	NM_015099		4875737	4875738	-1	no_errors	ENST00000414043	ensembl	human	known	69_37n	frame_shift_ins	47	12.96	7	INS	0.999:1.000	G
CECR1	51816	genome.wustl.edu	37	22	17690423	17690424	+	Frame_Shift_Ins	INS	-	-	C	rs199614299		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr22:17690423_17690424insC	ENST00000399839.1	-	2	414_415	c.144_145insG	c.(142-147)gggcggfs	p.R49fs	CECR1_ENST00000262607.3_Frame_Shift_Ins_p.R49fs|CECR1_ENST00000449907.2_Frame_Shift_Ins_p.R7fs|CECR1_ENST00000399837.2_Frame_Shift_Ins_p.R49fs	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	49	Dimerization.				adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				AGCACCAGCCGCCCCCCCAGCC	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.145dupG	22.37:g.17690430_17690430dupC	ENSP00000382733:p.Arg49fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Frame_Shift_Ins	INS	pfam_A/AMP_deaminase_dom,pfam_A_deaminase_N,tigrfam_Ad_deam-like	p.R48fs	ENST00000399839.1	37	c.145_144	CCDS13742.1	22																																																																																			CECR1	-	pfam_A_deaminase_N,tigrfam_Ad_deam-like	ENSG00000093072		0.540	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CECR1	HGNC	protein_coding	OTTHUMT00000316079.1	49	0.00	0	-			17690423	17690424	-1	no_errors	ENST00000262607	ensembl	human	known	69_37n	frame_shift_ins	59	11.94	8	INS	0.036:0.052	C
CKMT2	1160	genome.wustl.edu	37	5	80553589	80553589	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr5:80553589G>C	ENST00000424301.2	+	8	1031	c.793G>C	c.(793-795)Gag>Cag	p.E265Q	CKMT2-AS1_ENST00000500148.2_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2_ENST00000254035.4_Missense_Mutation_p.E265Q|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2_ENST00000437669.1_Missense_Mutation_p.E265Q	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	265	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.E265Q(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	CTGGATAAATGAGGAGGATCA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	114.0	117.0					5																	80553589		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.793G>C	5.37:g.80553589G>C	ENSP00000404203:p.Glu265Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.E265Q	ENST00000424301.2	37	c.793	CCDS4053.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.244387	0.95272	.	.	ENSG00000131730	ENST00000254035;ENST00000437669;ENST00000424301	T;T;T	0.17213	2.29;2.29;2.29	5.71	5.71	0.89125	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.046191	0.85682	D	0.000000	T	0.64757	0.2627	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80786	-0.1227	10	0.87932	D	0	-11.5132	19.8475	0.96716	0.0:0.0:1.0:0.0	.	265	P17540	KCRS_HUMAN	Q	265	ENSP00000254035:E265Q;ENSP00000410289:E265Q;ENSP00000404203:E265Q	ENSP00000254035:E265Q	E	+	1	0	CKMT2	80589345	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.373000	0.97168	2.699000	0.92147	0.650000	0.86243	GAG	CKMT2	-	pfam_ATP-guanido_PTrfase_cat	ENSG00000131730		0.353	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CKMT2	HGNC	protein_coding	OTTHUMT00000369600.1	155	0.00	0	G	NM_001825		80553589	80553589	+1	no_errors	ENST00000254035	ensembl	human	known	69_37n	missense	63	20.25	16	SNP	1.000	C
CLIP2	7461	genome.wustl.edu	37	7	73790923	73790923	+	Missense_Mutation	SNP	G	G	A	rs557831596	byFrequency	TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr7:73790923G>A	ENST00000395060.1	+	9	2192	c.2192G>A	c.(2191-2193)cGt>cAt	p.R731H	CLIP2_ENST00000361545.5_Missense_Mutation_p.R696H|CLIP2_ENST00000223398.6_Missense_Mutation_p.R731H			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	731						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)		p.R696H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GCCGAGCTGCGTGTGCACGAG	0.667													G|||	2	0.000399361	0.0	0.0	5008	,	,		15122	0.002		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											26.0	34.0	32.0					7																	73790923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2192G>A	7.37:g.73790923G>A	ENSP00000378500:p.Arg731His	Somatic		WXS	Illumina GAIIx	Phase_IV	O14527|O43611	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.R731H	ENST00000395060.1	37	c.2192	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125473	0.77436	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.65364	-0.15;-0.09;-0.15	4.9	4.9	0.64082	.	0.055885	0.64402	D	0.000001	T	0.70422	0.3222	L	0.34521	1.04	0.47037	D	0.999299	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.981;0.998;0.996	T	0.70680	-0.4805	10	0.41790	T	0.15	-28.8892	16.6849	0.85302	0.0:0.0:1.0:0.0	.	696;696;731	A7E2F7;Q9UDT6-2;Q9UDT6	.;.;CLIP2_HUMAN	H	731;731;696;731	ENSP00000223398:R731H;ENSP00000355151:R696H;ENSP00000378500:R731H	ENSP00000223398:R731H	R	+	2	0	CLIP2	73428859	1.000000	0.71417	0.965000	0.40720	0.953000	0.61014	7.363000	0.79516	2.276000	0.75962	0.449000	0.29647	CGT	CLIP2	-	NULL	ENSG00000106665		0.667	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	47	0.00	0	G	NM_003388		73790923	73790923	+1	no_errors	ENST00000223398	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	1.000	A
CNTNAP2	26047	genome.wustl.edu	37	7	148112562	148112562	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr7:148112562C>T	ENST00000361727.3	+	24	4366	c.3850C>T	c.(3850-3852)Cgg>Tgg	p.R1284W	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.R343W|CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1284					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.R1284W(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTTCCTGATCCGGTACATGTT	0.577										HNSCC(39;0.1)																												dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	70.0	75.0					7																	148112562		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3850C>T	7.37:g.148112562C>T	ENSP00000354778:p.Arg1284Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R1284W	ENST00000361727.3	37	c.3850	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033186	0.93575	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	T;T	0.56103	0.48;0.48	5.42	5.42	0.78866	Neurexin/syndecan/glycophorin C (1);	0.000000	0.85682	D	0.000000	T	0.71576	0.3356	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.73206	-0.4056	10	0.59425	D	0.04	.	17.8137	0.88624	0.0:1.0:0.0:0.0	.	1284	Q9UHC6	CNTP2_HUMAN	W	1284;343	ENSP00000354778:R1284W;ENSP00000440732:R343W	ENSP00000354778:R1284W	R	+	1	2	CNTNAP2	147743495	1.000000	0.71417	0.977000	0.42913	0.976000	0.68499	5.946000	0.70234	2.534000	0.85438	0.655000	0.94253	CGG	CNTNAP2	-	smart_Neurexin-like	ENSG00000174469		0.577	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	70	0.00	0	C			148112562	148112562	+1	no_errors	ENST00000361727	ensembl	human	known	69_37n	missense	86	23.89	27	SNP	1.000	T
CRYGA	1418	genome.wustl.edu	37	2	209025576	209025577	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:209025576_209025577insC	ENST00000304502.4	-	3	495_496	c.476_477insG	c.(475-477)ggtfs	p.G159fs		NM_014617.3	NP_055432.2	P11844	CRGA_HUMAN	crystallin, gamma A	159	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			endometrium(1)|kidney(3)|large_intestine(1)|lung(7)	12				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		TGGCATCTGCACCCCCCCAGTC	0.53																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS33367.1	2q34	2013-02-14			ENSG00000168582	ENSG00000168582			2408	protein-coding gene	gene with protein product	"""gamma crystallin 5"""	123660		CRYG1			Standard	NM_014617		Approved	CRYG5, CRY-g-A		P11844	OTTHUMG00000154796	ENST00000304502.4:c.477dupG	2.37:g.209025583_209025583dupC	ENSP00000302105:p.Gly159fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53ST5	Frame_Shift_Ins	INS	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.A160fs	ENST00000304502.4	37	c.477_476	CCDS33367.1	2																																																																																			CRYGA	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000168582		0.530	CRYGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGA	HGNC	protein_coding	OTTHUMT00000337096.1	38	0.00	0	-	NM_014617		209025576	209025577	-1	no_errors	ENST00000304502	ensembl	human	known	69_37n	frame_shift_ins	62	10.14	7	INS	0.408:0.651	C
DNAH3	55567	genome.wustl.edu	37	16	20966319	20966319	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr16:20966319G>C	ENST00000261383.3	-	55	10886	c.10887C>G	c.(10885-10887)atC>atG	p.I3629M	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3629	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.I3629M(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGGTCATTTTGATTCCATTCT	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(2)											103.0	101.0	102.0					16																	20966319		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10887C>G	16.37:g.20966319G>C	ENSP00000261383:p.Ile3629Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.I3629M	ENST00000261383.3	37	c.10887	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170778	0.57584	.	.	ENSG00000158486	ENST00000261383	T	0.10477	2.87	5.43	2.09	0.27110	Dynein heavy chain (1);	0.234275	0.38663	N	0.001613	T	0.26122	0.0637	M	0.89414	3.03	0.80722	D	1	D	0.56287	0.975	P	0.58454	0.839	T	0.02070	-1.1219	10	0.87932	D	0	.	2.3802	0.04352	0.15:0.1233:0.4757:0.251	.	3629	Q8TD57	DYH3_HUMAN	M	3629	ENSP00000261383:I3629M	ENSP00000261383:I3629M	I	-	3	3	DNAH3	20873820	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.629000	0.37071	0.573000	0.29400	0.655000	0.94253	ATC	DNAH3	-	pfam_Dynein_heavy	ENSG00000158486		0.488	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	129	0.00	0	G	NM_017539		20966319	20966319	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	128	16.88	26	SNP	0.998	C
DZIP1L	199221	genome.wustl.edu	37	3	137781705	137781705	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr3:137781705C>G	ENST00000327532.2	-	16	2619	c.2257G>C	c.(2257-2259)Ggc>Cgc	p.G753R		NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	753					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)	p.G753R(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						GGACCAGTGCCAAACTTCTCT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	88.0	87.0					3																	137781705		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.2257G>C	3.37:g.137781705C>G	ENSP00000332148:p.Gly753Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JUG5|Q96M38	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.G753R	ENST00000327532.2	37	c.2257	CCDS3096.1	3	.	.	.	.	.	.	.	.	.	.	C	9.554	1.116647	0.20795	.	.	ENSG00000158163	ENST00000327532	T	0.10960	2.82	4.9	3.11	0.35812	.	0.105066	0.39083	N	0.001465	T	0.07818	0.0196	L	0.32530	0.975	0.19945	N	0.999945	P	0.45348	0.856	B	0.41988	0.372	T	0.27088	-1.0084	10	0.16420	T	0.52	-3.6222	7.6761	0.28486	0.0:0.8034:0.0:0.1966	.	753	Q8IYY4	DZI1L_HUMAN	R	753	ENSP00000332148:G753R	ENSP00000332148:G753R	G	-	1	0	DZIP1L	139264395	0.107000	0.21998	0.063000	0.19743	0.070000	0.16714	1.351000	0.34022	0.477000	0.27464	-0.251000	0.11542	GGC	DZIP1L	-	NULL	ENSG00000158163		0.582	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP1L	HGNC	protein_coding	OTTHUMT00000357548.1	86	0.00	0	C	NM_173543		137781705	137781705	-1	no_errors	ENST00000327532	ensembl	human	known	69_37n	missense	86	13.13	13	SNP	0.060	G
EPS15L1	58513	genome.wustl.edu	37	19	16528786	16528786	+	Silent	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr19:16528786C>T	ENST00000248070.6	-	11	1219	c.1080G>A	c.(1078-1080)ccG>ccA	p.P360P	EPS15L1_ENST00000602009.1_Silent_p.P206P|EPS15L1_ENST00000455140.2_Silent_p.P360P|EPS15L1_ENST00000535753.2_Silent_p.P360P|EPS15L1_ENST00000594975.1_Silent_p.P360P|EPS15L1_ENST00000597937.1_Silent_p.P360P	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	360	EH 3. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P360P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TCTCCGAAGGCGGGACCATGT	0.587											OREG0025334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											123.0	103.0	110.0					19																	16528786		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1080G>A	19.37:g.16528786C>T		Somatic	711	WXS	Illumina GAIIx	Phase_IV	A2RRF3|A5PL29|B4DKA3	Silent	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.P360	ENST00000248070.6	37	c.1080	CCDS32944.1	19																																																																																			EPS15L1	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000127527		0.587	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	59	0.00	0	C	NM_021235		16528786	16528786	-1	no_errors	ENST00000455140	ensembl	human	known	69_37n	silent	36	41.94	26	SNP	0.010	T
EXD2	55218	genome.wustl.edu	37	14	69704442	69704442	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr14:69704442C>G	ENST00000409018.3	+	8	1571	c.1443C>G	c.(1441-1443)ttC>ttG	p.F481L	EXD2_ENST00000409949.1_Missense_Mutation_p.F356L|EXD2_ENST00000312994.5_Missense_Mutation_p.F481L|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000409014.1_Missense_Mutation_p.F356L|EXD2_ENST00000449989.1_Missense_Mutation_p.F356L|EXD2_ENST00000409242.1_Missense_Mutation_p.F356L|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409675.1_Missense_Mutation_p.F356L	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	481							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)	p.F481L(1)|p.F356L(1)		breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CCAAGGAGTTCCAGGCCCCCA	0.627																																						dbGAP											2	Substitution - Missense(2)	breast(2)											43.0	34.0	37.0					14																	69704442		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1443C>G	14.37:g.69704442C>G	ENSP00000387331:p.Phe481Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.F481L	ENST00000409018.3	37	c.1443	CCDS53902.1	14	.	.	.	.	.	.	.	.	.	.	C	10.92	1.486566	0.26686	.	.	ENSG00000081177	ENST00000409018;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000449989	T;T;T;T;T;T;T	0.64618	0.28;-0.11;-0.11;-0.11;-0.11;0.28;-0.11	5.24	4.28	0.50868	.	0.139642	0.64402	D	0.000003	T	0.57213	0.2038	M	0.61703	1.905	0.50313	D	0.999863	B;B;B	0.18610	0.029;0.006;0.002	B;B;B	0.31946	0.138;0.007;0.007	T	0.61417	-0.7067	10	0.56958	D	0.05	-14.7921	4.2754	0.10806	0.0:0.7149:0.0:0.2851	.	481;356;356	G5E947;B3KP95;Q9NVH0	.;.;EXD2_HUMAN	L	481;356;356;356;356;481;356	ENSP00000387331:F481L;ENSP00000386915:F356L;ENSP00000386762:F356L;ENSP00000386632:F356L;ENSP00000386839:F356L;ENSP00000313140:F481L;ENSP00000392177:F356L	ENSP00000313140:F481L	F	+	3	2	EXD2	68774195	0.997000	0.39634	1.000000	0.80357	0.859000	0.49053	0.712000	0.25779	2.720000	0.93068	0.557000	0.71058	TTC	EXD2	-	NULL	ENSG00000081177		0.627	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	HGNC	protein_coding	OTTHUMT00000335504.1	50	0.00	0	C			69704442	69704442	+1	no_errors	ENST00000312994	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	1.000	G
CCSER1	401145	genome.wustl.edu	37	4	91230078	91230078	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr4:91230078C>T	ENST00000509176.1	+	2	931	c.643C>T	c.(643-645)Cag>Tag	p.Q215*	CCSER1_ENST00000333691.8_Nonsense_Mutation_p.Q215*|CCSER1_ENST00000432775.2_Nonsense_Mutation_p.Q215*	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	215								p.Q215*(2)									GGAAGTTACACAGTACCAAGA	0.403																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											60.0	57.0	58.0					4																	91230078		1867	4103	5970	-	-	-	SO:0001587	stop_gained	0				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.643C>T	4.37:g.91230078C>T	ENSP00000425040:p.Gln215*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5M0|Q86V57	Nonsense_Mutation	SNP	NULL	p.Q215*	ENST00000509176.1	37	c.643	CCDS47099.1	4	.	.	.	.	.	.	.	.	.	.	C	39	7.306982	0.98200	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	.	.	.	4.66	3.81	0.43845	.	0.542672	0.19372	N	0.115896	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-10.0021	7.2131	0.25945	0.0:0.6831:0.1942:0.1227	.	.	.	.	X	215	.	ENSP00000329482:Q215X	Q	+	1	0	FAM190A	91449101	0.985000	0.35326	0.898000	0.35279	0.973000	0.67179	0.960000	0.29253	1.251000	0.43983	0.655000	0.94253	CAG	FAM190A	-	NULL	ENSG00000184305		0.403	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM190A	HGNC	protein_coding	OTTHUMT00000363109.3	56	0.00	0	C	NM_001145065		91230078	91230078	+1	no_errors	ENST00000333691	ensembl	human	known	69_37n	nonsense	49	51.49	52	SNP	0.121	T
FAM219B	57184	genome.wustl.edu	37	15	75197529	75197529	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr15:75197529G>A	ENST00000357635.5	-	3	666	c.346C>T	c.(346-348)Cca>Tca	p.P116S	FAM219B_ENST00000563706.1_5'UTR|FAM219B_ENST00000457294.2_Missense_Mutation_p.P116S|FAM219B_ENST00000563119.1_Missense_Mutation_p.P116S|FAM219B_ENST00000565772.1_Missense_Mutation_p.P30S	NM_020447.3	NP_065180.1	Q5XKK7	F219B_HUMAN	family with sequence similarity 219, member B	116								p.P116S(1)									TTTTCATCTGGACTCTGGCTA	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	75.0	80.0					15																	75197529		2197	4295	6492	-	-	-	SO:0001583	missense	0			AK000005	CCDS32295.1	15q23	2012-03-06	2012-03-06	2012-03-06	ENSG00000178761	ENSG00000178761			24695	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 17"""	C15orf17		11214971	Standard	NM_020447		Approved	FLJ00005	uc002azh.4	Q5XKK7	OTTHUMG00000172715	ENST00000357635.5:c.346C>T	15.37:g.75197529G>A	ENSP00000350260:p.Pro116Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Q5|B4DK57|Q9NXY0	Missense_Mutation	SNP	NULL	p.P116S	ENST00000357635.5	37	c.346	CCDS32295.1	15	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066235	0.55539	.	.	ENSG00000178761	ENST00000357635;ENST00000457294	.	.	.	5.68	4.75	0.60458	.	0.232106	0.42420	D	0.000713	T	0.42359	0.1199	L	0.49350	1.555	0.35181	D	0.772449	P;P	0.38597	0.639;0.639	B;B	0.34652	0.155;0.187	T	0.58470	-0.7631	9	0.59425	D	0.04	-5.9603	7.6041	0.28093	0.0954:0.2562:0.6483:0.0	.	116;116	D3DW69;Q5XKK7	.;CO017_HUMAN	S	116	.	ENSP00000350260:P116S	P	-	1	0	C15orf17	72984582	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.856000	0.39389	2.704000	0.92352	0.555000	0.69702	CCA	FAM219B	-	NULL	ENSG00000178761		0.512	FAM219B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM219B	HGNC	protein_coding	OTTHUMT00000420165.1	37	0.00	0	G	NM_020447		75197529	75197529	-1	no_errors	ENST00000357635	ensembl	human	known	69_37n	missense	28	36.36	16	SNP	1.000	A
FARSB	10056	genome.wustl.edu	37	2	223505642	223505643	+	Frame_Shift_Ins	INS	-	-	AT	rs147487059	byFrequency	TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:223505642_223505643insAT	ENST00000281828.6	-	4	540_541	c.277_278insAT	c.(277-279)gctfs	p.A93fs	FARSB_ENST00000536361.1_5'UTR	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	93					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	ATACACTGGAGCCTTTATCCTA	0.243																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.277_278insAT	2.37:g.223505642_223505643insAT	ENSP00000281828:p.Ala93fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Frame_Shift_Ins	INS	pfam_B3/B4_tRNA-bd,pfam_tRNA_synthase_B5-dom,superfamily_DNA-bd_dom_put,superfamily_Phe-tRNA_synthase_B3/B4,smart_B3/B4_tRNA-bd,smart_tRNA_synthase_B5-dom,tigrfam_Phe-tRNA-synth_IIc_bsu_arc	p.A93fs	ENST00000281828.6	37	c.278_277	CCDS2454.1	2																																																																																			FARSB	-	superfamily_DNA-bd_dom_put,tigrfam_Phe-tRNA-synth_IIc_bsu_arc	ENSG00000116120		0.243	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARSB	HGNC	protein_coding	OTTHUMT00000256855.2	146	0.00	0	-	NM_005687		223505642	223505643	-1	no_errors	ENST00000281828	ensembl	human	known	69_37n	frame_shift_ins	68	43.80	53	INS	0.981:0.908	AT
FAT3	120114	genome.wustl.edu	37	11	92534655	92534655	+	Missense_Mutation	SNP	G	G	T	rs368173363		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr11:92534655G>T	ENST00000298047.6	+	9	8493	c.8476G>T	c.(8476-8478)Ggg>Tgg	p.G2826W	FAT3_ENST00000525166.1_Missense_Mutation_p.G2676W|FAT3_ENST00000409404.2_Missense_Mutation_p.G2826W			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2826	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G2826W(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TATAATGGAAGGGATGCCTGT	0.443										TCGA Ovarian(4;0.039)																												dbGAP											2	Substitution - Missense(2)	breast(2)											48.0	48.0	48.0					11																	92534655		1919	4125	6044	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8476G>T	11.37:g.92534655G>T	ENSP00000298047:p.Gly2826Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.G2826W	ENST00000298047.6	37	c.8476		11	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654052	0.67472	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.21734	1.99;1.99;1.99	6.07	6.07	0.98685	.	.	.	.	.	T	0.56171	0.1967	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59418	-0.7458	9	0.72032	D	0.01	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	2826	Q8TDW7-3	.	W	2826;2826;2676	ENSP00000298047:G2826W;ENSP00000387040:G2826W;ENSP00000432586:G2676W	ENSP00000298047:G2826W	G	+	1	0	FAT3	92174303	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.984000	0.88150	2.884000	0.98904	0.655000	0.94253	GGG	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165323		0.443	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		57	0.00	0	G	NM_001008781		92534655	92534655	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	87	24.35	28	SNP	1.000	T
FGF6	2251	genome.wustl.edu	37	12	4553382	4553382	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr12:4553382C>T	ENST00000228837.2	-	2	410	c.367G>A	c.(367-369)Gtg>Atg	p.V123M		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	123					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CCTCGCTCCACAGTGGAAATT	0.532																																						dbGAP											0													73.0	62.0	66.0					12																	4553382		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.367G>A	12.37:g.4553382C>T	ENSP00000228837:p.Val123Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAE1	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.V123M	ENST00000228837.2	37	c.367	CCDS8527.1	12	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254754	0.59212	.	.	ENSG00000111241	ENST00000543077;ENST00000228837	D;T	0.88046	-2.33;1.28	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.95204	0.8445	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95531	0.8603	10	0.66056	D	0.02	.	19.6704	0.95910	0.0:1.0:0.0:0.0	.	123	P10767	FGF6_HUMAN	M	2;123	ENSP00000445479:V2M;ENSP00000228837:V123M	ENSP00000228837:V123M	V	-	1	0	FGF6	4423643	1.000000	0.71417	0.965000	0.40720	0.608000	0.37181	7.794000	0.85869	2.659000	0.90383	0.561000	0.74099	GTG	FGF6	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd	ENSG00000111241		0.532	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF6	HGNC	protein_coding	OTTHUMT00000398939.1	88	0.00	0	C	NM_020996		4553382	4553382	-1	no_errors	ENST00000228837	ensembl	human	known	69_37n	missense	48	31.43	22	SNP	1.000	T
FNDC4	64838	genome.wustl.edu	37	2	27717516	27717517	+	Frame_Shift_Ins	INS	-	-	G	rs375116041		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:27717516_27717517insG	ENST00000264703.3	-	2	421_422	c.30_31insC	c.(28-33)cccagcfs	p.S11fs	GCKR_ENST00000264717.2_5'Flank|GCKR_ENST00000424318.2_5'Flank	NM_022823.2	NP_073734.1	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4	11						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S11fs*28(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|prostate(1)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					CGGAGTCCGCTGGGGGGGGAAC	0.649																																						dbGAP											1	Insertion - Frameshift(1)	liver(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK026015	CCDS1756.1	2p23.3	2013-02-11			ENSG00000115226	ENSG00000115226		"""Fibronectin type III domain containing"""	20239	protein-coding gene	gene with protein product		611905				12384288	Standard	NM_022823		Approved	FLJ22362, FRCP1	uc002rkx.3	Q9H6D8	OTTHUMG00000097787	ENST00000264703.3:c.31dupC	2.37:g.27717524_27717524dupG	ENSP00000264703:p.Ser11fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W560	Frame_Shift_Ins	INS	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S10fs	ENST00000264703.3	37	c.31_30	CCDS1756.1	2																																																																																			FNDC4	-	NULL	ENSG00000115226		0.649	FNDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC4	HGNC	protein_coding	OTTHUMT00000215031.1	37	0.00	0	-	NM_022823		27717516	27717517	-1	no_errors	ENST00000264703	ensembl	human	known	69_37n	frame_shift_ins	38	13.64	6	INS	0.989:0.915	G
GADL1	339896	genome.wustl.edu	37	3	30892434	30892434	+	Splice_Site	SNP	C	C	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr3:30892434C>A	ENST00000282538.5	-	5	579		c.e5-1		GADL1_ENST00000454381.3_Splice_Site	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1						carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)	p.?(1)		breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						ATACGTATAACTAGATAGATA	0.378																																						dbGAP											1	Unknown(1)	breast(1)											150.0	117.0	127.0					3																	30892434		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.429-1G>T	3.37:g.30892434C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e5-1	ENST00000282538.5	37	c.429-1	CCDS2649.2	3	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131927	0.77662	.	.	ENSG00000144644	ENST00000282538;ENST00000454381	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4857	0.90828	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GADL1	30867438	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.872000	0.75536	2.434000	0.82447	0.655000	0.94253	.	GADL1	-	-	ENSG00000144644		0.378	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADL1	HGNC	protein_coding	OTTHUMT00000253106.2	278	0.00	0	C	NM_207359	Intron	30892434	30892434	-1	no_errors	ENST00000282538	ensembl	human	known	69_37n	splice_site	151	35.47	83	SNP	1.000	A
GART	2618	genome.wustl.edu	37	21	34897279	34897279	+	Silent	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr21:34897279C>T	ENST00000381831.3	-	11	1358	c.1095G>A	c.(1093-1095)ctG>ctA	p.L365L	GART_ENST00000543717.1_5'Flank|GART_ENST00000381815.4_Silent_p.L365L|GART_ENST00000361093.5_Silent_p.L365L|GART_ENST00000381839.3_Silent_p.L365L	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	365					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)	p.L365L(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	GGAACACCTCCAGTCCTAGAG	0.443																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											80.0	69.0	73.0					21																	34897279		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.1095G>A	21.37:g.34897279C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Silent	SNP	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C,superfamily_PurM_N-like,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.L365	ENST00000381831.3	37	c.1095	CCDS13627.1	21																																																																																			GART	-	pfam_PRibGlycinamide_synth_C-dom,superfamily_Rudment_hybrid_motif,tigrfam_PRibGlycinamide_synth	ENSG00000159131		0.443	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	HGNC	protein_coding	OTTHUMT00000140626.3	36	0.00	0	C	NM_000819		34897279	34897279	-1	no_errors	ENST00000381815	ensembl	human	known	69_37n	silent	24	35.14	13	SNP	0.976	T
GBF1	8729	genome.wustl.edu	37	10	104140919	104140919	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr10:104140919C>G	ENST00000369983.3	+	39	5466	c.5206C>G	c.(5206-5208)Ctc>Gtc	p.L1736V		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1736					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.L1736V(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CCAAAAGCCTCTCGCCTCAGC	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	63.0	62.0					10																	104140919		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.5206C>G	10.37:g.104140919C>G	ENSP00000359000:p.Leu1736Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.L1736V	ENST00000369983.3	37	c.5206	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.952698	0.00470	.	.	ENSG00000107862	ENST00000369983	T	0.09538	2.97	5.41	2.43	0.29744	.	0.959697	0.08665	N	0.911838	T	0.08846	0.0219	L	0.36672	1.1	0.21499	N	0.999662	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.11329	0.006;0.006;0.006	T	0.42310	-0.9459	10	0.17369	T	0.5	-0.2917	7.1584	0.25651	0.4641:0.4564:0.0:0.0796	.	1732;1732;1736	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	V	1736	ENSP00000359000:L1736V	ENSP00000359000:L1736V	L	+	1	0	GBF1	104130909	0.528000	0.26314	0.960000	0.40013	0.022000	0.10575	-0.223000	0.09177	0.806000	0.34183	-0.274000	0.10170	CTC	GBF1	-	NULL	ENSG00000107862		0.602	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1	85	0.00	0	C			104140919	104140919	+1	no_errors	ENST00000369983	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.716	G
GMPR	2766	genome.wustl.edu	37	6	16279067	16279067	+	Silent	SNP	T	T	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr6:16279067T>C	ENST00000259727.4	+	6	714	c.600T>C	c.(598-600)agT>agC	p.S200S		NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	200					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)	p.S200S(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				CCCAGCTGAGTGCCGTCATTG	0.587																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											91.0	81.0	84.0					6																	16279067		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.600T>C	6.37:g.16279067T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96HQ6	Silent	SNP	pfam_IMP_DH_GMPRt,pirsf_GMP_reduct1,tigrfam_GMP_reduct1	p.S200	ENST00000259727.4	37	c.600	CCDS4537.1	6																																																																																			GMPR	-	pfam_IMP_DH_GMPRt,pirsf_GMP_reduct1,tigrfam_GMP_reduct1	ENSG00000137198		0.587	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPR	HGNC	protein_coding	OTTHUMT00000039942.2	114	0.00	0	T			16279067	16279067	+1	no_errors	ENST00000259727	ensembl	human	known	69_37n	silent	101	22.73	30	SNP	0.971	C
GRAMD4	23151	genome.wustl.edu	37	22	47064620	47064620	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr22:47064620A>T	ENST00000406902.1	+	12	1178	c.965A>T	c.(964-966)aAg>aTg	p.K322M	GRAMD4_ENST00000361034.3_Missense_Mutation_p.K322M			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	322					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.K322M(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		ATCCTGGAGAAGATCAAGAAG	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	108.0	103.0					22																	47064620		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.965A>T	22.37:g.47064620A>T	ENSP00000385689:p.Lys322Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.K322M	ENST00000406902.1	37	c.965	CCDS33672.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	21.1|21.1	4.095480|4.095480	0.76870|0.76870	.|.	.|.	ENSG00000075240|ENSG00000075240	ENST00000456069|ENST00000406902;ENST00000361034	T|T;T	0.50001|0.49720	0.76|0.77;0.77	4.57|4.57	4.57|4.57	0.56435|0.56435	.|.	.|0.056791	.|0.64402	.|D	.|0.000004	T|T	0.61198|0.61198	0.2328|0.2328	L|L	0.52573|0.52573	1.65|1.65	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D	.|0.89917	.|0.987;1.0	.|P;D	.|0.77557	.|0.838;0.99	T|T	0.64550|0.64550	-0.6381|-0.6381	7|10	0.72032|0.87932	D|D	0.01|0	-40.7515|-40.7515	12.2375|12.2375	0.54524|0.54524	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|144;322	.|B0QZ08;Q6IC98	.|.;GRAM4_HUMAN	D|M	144|322	ENSP00000397501:E144D|ENSP00000385689:K322M;ENSP00000354313:K322M	ENSP00000397501:E144D|ENSP00000354313:K322M	E|K	+|+	3|2	2|0	GRAMD4|GRAMD4	45443284|45443284	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.941000|0.941000	0.58515|0.58515	8.177000|8.177000	0.89688|0.89688	1.833000|1.833000	0.53350|0.53350	0.454000|0.454000	0.30748|0.30748	GAA|AAG	GRAMD4	-	NULL	ENSG00000075240		0.627	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	HGNC	protein_coding	OTTHUMT00000317969.1	12	0.00	0	A	NM_015124		47064620	47064620	+1	no_errors	ENST00000361034	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	T
GYS2	2998	genome.wustl.edu	37	12	21716262	21716262	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr12:21716262C>T	ENST00000261195.2	-	6	1095	c.841G>A	c.(841-843)Ggc>Agc	p.G281S		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	281					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)	p.G281S(1)		NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACATTCAAGCCGTTTGGAGTA	0.328																																					Colon(149;9 1820 3690 10544 50424)	dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	80.0	79.0					12																	21716262		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.841G>A	12.37:g.21716262C>T	ENSP00000261195:p.Gly281Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVD8	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1	p.G281S	ENST00000261195.2	37	c.841	CCDS8690.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.091972	0.94149	.	.	ENSG00000111713	ENST00000261195	T	0.75938	-0.98	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.89972	0.6870	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92350	0.5889	10	0.87932	D	0	-20.9612	18.7322	0.91739	0.0:1.0:0.0:0.0	.	281	P54840	GYS2_HUMAN	S	281	ENSP00000261195:G281S	ENSP00000261195:G281S	G	-	1	0	GYS2	21607529	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.626000	0.83164	2.650000	0.89964	0.655000	0.94253	GGC	GYS2	-	pfam_Glycogen_synth	ENSG00000111713		0.328	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS2	HGNC	protein_coding	OTTHUMT00000402396.1	121	0.00	0	C	NM_021957		21716262	21716262	-1	no_errors	ENST00000261195	ensembl	human	known	69_37n	missense	43	29.51	18	SNP	1.000	T
HNRNPH2	3188	genome.wustl.edu	37	X	100668305	100668305	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chrX:100668305C>A	ENST00000316594.5	+	2	1407	c.1329C>A	c.(1327-1329)gaC>gaA	p.D443E		NM_001032393.2|NM_001199973.1|NM_001199974.1|NM_019597.4	NP_001027565.1|NP_001186902.1|NP_001186903.1|NP_062543.1	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2 (H')	443					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D443E(1)		breast(3)|large_intestine(2)|lung(6)|skin(1)	12						ACTCCAGTGACTATCAGTCAA	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											160.0	154.0	156.0					X																	100668305		2192	4291	6483	-	-	-	SO:0001583	missense	0			U01923	CCDS14485.1	Xq22	2013-02-12		2008-04-18	ENSG00000126945	ENSG00000126945		"""RNA binding motif (RRM) containing"""	5042	protein-coding gene	gene with protein product		300610		HNRPH2		7499401	Standard	NM_019597		Approved	hnRNPH', FTP3, HNRPH'	uc004ehn.3	P55795	OTTHUMG00000022029	ENST00000316594.5:c.1329C>A	X.37:g.100668305C>A	ENSP00000361927:p.Asp443Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L400|Q9HHA7	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.D443E	ENST00000316594.5	37	c.1329	CCDS14485.1	X	.	.	.	.	.	.	.	.	.	.	C	3.420	-0.118275	0.06838	.	.	ENSG00000126945	ENST00000457902;ENST00000316594	T	0.09255	3.0	4.52	1.67	0.24075	.	0.190093	0.47093	D	0.000251	T	0.06234	0.0161	N	0.24115	0.695	0.25325	N	0.989081	B	0.32918	0.39	B	0.28638	0.092	T	0.29366	-1.0014	10	0.51188	T	0.08	-21.2966	7.3153	0.26498	0.0:0.6578:0.0:0.3422	.	443	P55795	HNRH2_HUMAN	E	398;443	ENSP00000361927:D443E	ENSP00000361927:D443E	D	+	3	2	HNRNPH2	100554961	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	0.830000	0.27462	0.412000	0.25729	0.513000	0.50165	GAC	HNRNPH2	-	NULL	ENSG00000126945		0.458	HNRNPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPH2	HGNC	protein_coding	OTTHUMT00000057556.1	148	0.00	0	C	NM_019597		100668305	100668305	+1	no_errors	ENST00000316594	ensembl	human	known	69_37n	missense	76	43.28	58	SNP	0.995	A
INPP5B	3633	genome.wustl.edu	37	1	38397539	38397539	+	Missense_Mutation	SNP	C	C	A	rs535046773		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:38397539C>A	ENST00000373026.1	-	6	578	c.578G>T	c.(577-579)cGg>cTg	p.R193L	INPP5B_ENST00000373027.1_5'Flank|INPP5B_ENST00000373024.3_Intron|INPP5B_ENST00000373023.2_Missense_Mutation_p.R193L|INPP5B_ENST00000373021.1_Missense_Mutation_p.R193L			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	193					in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)	p.R193L(1)|p.R230L(1)		breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CCCCTGTGGCCGGGCCTCCTC	0.652																																						dbGAP											2	Substitution - Missense(2)	breast(2)											40.0	43.0	42.0					1																	38397539		1901	4110	6011	-	-	-	SO:0001583	missense	0			M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.578G>T	1.37:g.38397539C>A	ENSP00000362117:p.Arg193Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R193L	ENST00000373026.1	37	c.578		1	.	.	.	.	.	.	.	.	.	.	C	6.230	0.410538	0.11812	.	.	ENSG00000204084	ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373021	D;D;T	0.92048	-2.96;-2.96;0.89	4.34	-8.68	0.00859	.	4.923680	0.00424	N	0.000068	T	0.77512	0.4141	.	.	.	0.09310	N	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.73030	-0.4111	9	0.12766	T	0.61	.	0.5332	0.00632	0.2947:0.1281:0.2809:0.2963	.	193	B1ARF3	.	L	193	ENSP00000362114:R193L;ENSP00000362117:R193L;ENSP00000362112:R193L	ENSP00000362112:R193L	R	-	2	0	INPP5B	38170126	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.421000	0.01031	-2.369000	0.00603	-0.471000	0.05019	CGG	INPP5B	-	NULL	ENSG00000204084		0.652	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	HGNC	protein_coding	OTTHUMT00000012968.1	12	0.00	0	C	NM_005540		38397539	38397539	-1	no_errors	ENST00000373023	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.000	A
IQSEC1	9922	genome.wustl.edu	37	3	12977153	12977153	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr3:12977153C>G	ENST00000273221.4	-	3	1621	c.1405G>C	c.(1405-1407)Gac>Cac	p.D469H	IQSEC1_ENST00000473088.1_5'Flank	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	469					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.D469H(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGTCATTGTCACCGTCTGAG	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											136.0	126.0	129.0					3																	12977153		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.1405G>C	3.37:g.12977153C>G	ENSP00000273221:p.Asp469His	Somatic		WXS	Illumina GAIIx	Phase_IV	O94863|Q96D85	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.D469H	ENST00000273221.4	37	c.1405	CCDS33703.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.154295|4.154295	0.78114|0.78114	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000273221;ENST00000435445;ENST00000429247|ENST00000450726	T;T|.	0.48836|.	0.8;0.8|.	4.58|4.58	4.58|4.58	0.56647|0.56647	.|.	0.237551|.	0.41938|.	D|.	0.000785|.	T|.	0.73473|.	0.3591|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.998;0.999|.	T|.	0.73496|.	-0.3964|.	9|.	0.56958|.	D|.	0.05|.	.|.	17.5734|17.5734	0.87941|0.87941	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	455;455;469|.	E9PG60;C9JMG9;Q6DN90|.	.;.;IQEC1_HUMAN|.	H|S	469;455;455|469	ENSP00000273221:D469H;ENSP00000402299:D455H|.	ENSP00000273221:D469H|.	D|X	-|-	1|2	0|2	IQSEC1|IQSEC1	12952153|12952153	1.000000|1.000000	0.71417|0.71417	0.936000|0.936000	0.37596|0.37596	0.861000|0.861000	0.49209|0.49209	7.569000|7.569000	0.82380|0.82380	2.374000|2.374000	0.81015|0.81015	0.655000|0.655000	0.94253|0.94253	GAC|TGA	IQSEC1	-	NULL	ENSG00000144711		0.607	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC1	HGNC	protein_coding	OTTHUMT00000339865.2	32	0.00	0	C	NM_014869		12977153	12977153	-1	no_errors	ENST00000273221	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	1.000	G
KIF4A	24137	genome.wustl.edu	37	X	69521793	69521793	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chrX:69521793C>G	ENST00000374403.3	+	6	642	c.560C>G	c.(559-561)aCt>aGt	p.T187S	KIF4A_ENST00000374388.3_Missense_Mutation_p.T187S	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	187	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.T187S(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GCCTTGGATACTGTTTCCTGT	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	123.0	131.0					X																	69521793		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.560C>G	X.37:g.69521793C>G	ENSP00000363524:p.Thr187Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T187S	ENST00000374403.3	37	c.560	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971399	0.53614	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.74947	-0.89;-0.89	5.1	4.23	0.50019	Kinesin, motor domain (4);	0.000000	0.53938	D	0.000046	T	0.70640	0.3247	L	0.46885	1.475	0.37247	D	0.906371	B;P	0.40875	0.16;0.731	B;B	0.43990	0.401;0.438	T	0.76953	-0.2768	10	0.56958	D	0.05	.	11.2426	0.48979	0.0:0.9094:0.0:0.0906	.	187;187	O95239;O95239-2	KIF4A_HUMAN;.	S	187	ENSP00000363509:T187S;ENSP00000363524:T187S	ENSP00000363509:T187S	T	+	2	0	KIF4A	69438518	0.998000	0.40836	0.997000	0.53966	0.966000	0.64601	3.399000	0.52586	2.115000	0.64714	0.538000	0.68166	ACT	KIF4A	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000090889		0.438	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	259	0.00	0	C	NM_012310		69521793	69521793	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	155	13.89	25	SNP	0.999	G
L3MBTL2	83746	genome.wustl.edu	37	22	41623175	41623175	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr22:41623175C>T	ENST00000216237.5	+	14	1828	c.1670C>T	c.(1669-1671)aCg>aTg	p.T557M		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	557					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.T557M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGTGTGGCCACGGTGAAACGA	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	40.0	47.0					22																	41623175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1670C>T	22.37:g.41623175C>T	ENSP00000216237:p.Thr557Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.T557M	ENST00000216237.5	37	c.1670	CCDS14011.1	22	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366154	0.82463	.	.	ENSG00000100395	ENST00000216237	T	0.56275	0.47	5.52	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.80874	0.4707	H	0.96916	3.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.919;0.991	D	0.87010	0.2122	10	0.87932	D	0	.	13.6617	0.62372	0.0:0.9257:0.0:0.0743	.	557;557	Q969R5-3;Q969R5	.;LMBL2_HUMAN	M	557	ENSP00000216237:T557M	ENSP00000216237:T557M	T	+	2	0	L3MBTL2	39953121	1.000000	0.71417	0.857000	0.33713	0.943000	0.58893	7.805000	0.86005	1.331000	0.45412	-0.244000	0.11960	ACG	L3MBTL2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000100395		0.607	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	HGNC	protein_coding	OTTHUMT00000320613.1	11	0.00	0	C	NM_031488		41623175	41623175	+1	no_errors	ENST00000216237	ensembl	human	known	69_37n	missense	13	48.00	12	SNP	0.999	T
LAYN	143903	genome.wustl.edu	37	11	111414758	111414758	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr11:111414758G>A	ENST00000375615.3	+	3	405	c.220G>A	c.(220-222)Gat>Aat	p.D74N	LAYN_ENST00000525126.1_Missense_Mutation_p.D74N|LAYN_ENST00000533265.1_Missense_Mutation_p.D66N|LAYN_ENST00000375614.2_Missense_Mutation_p.D66N|LAYN_ENST00000528924.1_3'UTR|LAYN_ENST00000436913.2_De_novo_Start_InFrame	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	74	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.D66N(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	CTGCAGGAGGGATGGAGGCCA	0.468																																					Ovarian(17;551 586 12136 22082 22900)	dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	81.0	83.0					11																	111414758		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.220G>A	11.37:g.111414758G>A	ENSP00000364765:p.Asp74Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.D74N	ENST00000375615.3	37	c.220	CCDS58178.1	11	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431593	0.62844	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000525126;ENST00000533265	T;T;T;T	0.27890	3.22;1.64;1.64;3.22	4.5	2.62	0.31277	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.105860	0.64402	N	0.000006	T	0.28566	0.0707	L	0.46670	1.46	0.80722	D	1	P;B;P;B	0.35944	0.529;0.235;0.529;0.082	B;B;B;B	0.40477	0.33;0.19;0.33;0.039	T	0.02758	-1.1114	10	0.31617	T	0.26	-11.5608	10.2058	0.43112	0.1645:0.0:0.8355:0.0	.	66;74;74;66	E9PMI0;Q6UX15;E9PQU7;Q6UX15-2	.;LAYN_HUMAN;.;.	N	66;74;74;66	ENSP00000364764:D66N;ENSP00000364765:D74N;ENSP00000434328:D74N;ENSP00000434972:D66N	ENSP00000364764:D66N	D	+	1	0	LAYN	110919968	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	6.244000	0.72391	0.517000	0.28361	0.462000	0.41574	GAT	LAYN	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000204381		0.468	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	HGNC	protein_coding	OTTHUMT00000391187.1	117	0.00	0	G	NM_178834		111414758	111414758	+1	no_errors	ENST00000375615	ensembl	human	known	69_37n	missense	41	41.43	29	SNP	0.990	A
LCN10	414332	genome.wustl.edu	37	9	139634413	139634413	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr9:139634413delA	ENST00000474369.1	-	4	523	c.524delT	c.(523-525)ctcfs	p.L175fs	LCN10_ENST00000527229.1_Frame_Shift_Del_p.L152fs|LCN6_ENST00000480584.1_5'Flank|LCN6_ENST00000435202.1_3'UTR|LCN10_ENST00000497771.1_Frame_Shift_Del_p.L188fs			Q6JVE6	LCN10_HUMAN	lipocalin 10	175					transport (GO:0006810)	extracellular region (GO:0005576)		p.L188fs*>13(2)		breast(2)|cervix(1)|large_intestine(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		GTCTTTCGGGAGGATGACGGC	0.557																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)											90.0	68.0	75.0					9																	139634413		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			AY301271	CCDS35182.2	9q34.3	2011-10-24			ENSG00000187922	ENSG00000187922		"""Lipocalins"""	20892	protein-coding gene	gene with protein product		612904				15363845	Standard	NM_001001712		Approved		uc004civ.3	Q6JVE6	OTTHUMG00000150428	ENST00000474369.1:c.524delT	9.37:g.139634413delA	ENSP00000420564:p.Leu175fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUU3|B0QZ79	Frame_Shift_Del	DEL	superfamily_Calycin-like	p.L188fs	ENST00000474369.1	37	c.563	CCDS35182.2	9																																																																																			LCN10	-	superfamily_Calycin-like	ENSG00000187922		0.557	LCN10-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LCN10	HGNC	protein_coding	OTTHUMT00000318062.2	85	0.00	0	A	NM_001001712		139634413	139634413	-1	no_errors	ENST00000497771	ensembl	human	known	69_37n	frame_shift_del	55	25.33	19	DEL	0.065	-
LEUTX	342900	genome.wustl.edu	37	19	40276356	40276356	+	Missense_Mutation	SNP	C	C	T	rs577142991		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr19:40276356C>T	ENST00000396841.4	+	3	252	c.88C>T	c.(88-90)Cgt>Tgt	p.R30C		NM_001143832.1	NP_001137304.1	A8MZ59	LEUTX_HUMAN	leucine twenty homeobox	30					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R30C(1)		autonomic_ganglia(1)|breast(1)|kidney(1)|skin(2)	5						CAAGAACCAGCGTGCCAAATG	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	58.0	59.0					19																	40276356		692	1591	2283	-	-	-	SO:0001583	missense	0					19q13.2	2011-06-20			ENSG00000213921	ENSG00000213921		"""Homeoboxes / PRD class"""	31953	protein-coding gene	gene with protein product							Standard	NM_001143832		Approved		uc010xvg.2	A8MZ59		ENST00000396841.4:c.88C>T	19.37:g.40276356C>T	ENSP00000380053:p.Arg30Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,pfscan_Homeodomain	p.R30C	ENST00000396841.4	37	c.88		19	.	.	.	.	.	.	.	.	.	.	.	12.15	1.851817	0.32699	.	.	ENSG00000213921	ENST00000396841	D	0.95980	-3.87	2.66	0.32	0.15878	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	.	.	.	.	D	0.97904	0.9311	H	0.97186	3.955	0.09310	N	1	D	0.89917	1.0	D	0.72075	0.976	D	0.91621	0.5311	9	0.87932	D	0	.	4.867	0.13613	0.2484:0.5095:0.2421:0.0	.	30	A8MZ59	LEUTX_HUMAN	C	30	ENSP00000380053:R30C	ENSP00000380053:R30C	R	+	1	0	LEUTX	44968196	0.321000	0.24625	0.002000	0.10522	0.003000	0.03518	1.987000	0.40687	0.163000	0.19507	-0.175000	0.13238	CGT	LEUTX	-	pfam_Homeodomain,superfamily_Homeodomain-like,pfscan_Homeodomain	ENSG00000213921		0.512	LEUTX-001	NOVEL	basic|appris_principal	protein_coding	LEUTX	HGNC	protein_coding	OTTHUMT00000410828.3	83	0.00	0	C	XM_001129035		40276356	40276356	+1	no_errors	ENST00000396841	ensembl	human	known	69_37n	missense	81	34.15	42	SNP	0.002	T
LIFR	3977	genome.wustl.edu	37	5	38496650	38496650	+	Silent	SNP	T	T	C	rs183990367		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr5:38496650T>C	ENST00000263409.4	-	13	1881	c.1719A>G	c.(1717-1719)gtA>gtG	p.V573V	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Silent_p.V573V	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	573	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.V573V(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					ATGAACACGATACATTGTAGG	0.383			T	PLAG1	salivary adenoma								T|||	1	0.000199681	0.0	0.0	5008	,	,		24092	0.0		0.001	False		,,,				2504	0.0				Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	2	Substitution - coding silent(2)	breast(2)											184.0	157.0	166.0					5																	38496650		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1719A>G	5.37:g.38496650T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.V573	ENST00000263409.4	37	c.1719	CCDS3927.1	5																																																																																			LIFR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113594		0.383	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	151	0.00	0	T	NM_002310		38496650	38496650	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	silent	106	44.79	86	SNP	0.194	C
LINC00471	151477	genome.wustl.edu	37	2	232373772	232373772	+	RNA	SNP	A	A	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:232373772A>G	ENST00000313064.2	-	0	646					NR_024079.1		Q8N535	CB052_HUMAN	long intergenic non-protein coding RNA 471									p.F107L(1)									TTTTAACAGAACCTCTCCCCA	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	96.0	96.0					2																	232373772		2203	4300	6503	-	-	-			0			BC033054		2q37.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000181798	ENSG00000181798		"""Long non-coding RNAs"""	28668	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 52"""	C2orf52		12477932	Standard	NR_024079		Approved	MGC43122	uc002vrx.1	Q8N535	OTTHUMG00000133227		2.37:g.232373772A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000313064.2	37	NULL		2																																																																																			LINC00471	-	-	ENSG00000181798		0.493	LINC00471-001	KNOWN	basic	processed_transcript	LINC00471	HGNC	processed_transcript	OTTHUMT00000256963.2	83	0.00	0	A	NM_173513		232373772	232373772	-1	no_errors	ENST00000313064	ensembl	human	known	69_37n	rna	55	32.93	27	SNP	0.001	G
LPHN3	23284	genome.wustl.edu	37	4	62778466	62778466	+	Silent	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr4:62778466C>T	ENST00000514591.1	+	12	2228	c.1899C>T	c.(1897-1899)gcC>gcT	p.A633A	LPHN3_ENST00000507625.1_Silent_p.A701A|LPHN3_ENST00000511324.1_Silent_p.A701A|LPHN3_ENST00000514157.1_Silent_p.A633A|LPHN3_ENST00000506720.1_Silent_p.A701A|LPHN3_ENST00000509896.1_Silent_p.A701A|LPHN3_ENST00000507164.1_Silent_p.A701A|LPHN3_ENST00000508693.1_Silent_p.A701A|LPHN3_ENST00000504896.1_Silent_p.A633A|LPHN3_ENST00000508946.1_Silent_p.A633A|LPHN3_ENST00000545650.1_Silent_p.A633A|LPHN3_ENST00000506746.1_Silent_p.A701A|LPHN3_ENST00000512091.2_Silent_p.A633A|LPHN3_ENST00000514996.1_Silent_p.A633A|LPHN3_ENST00000506700.1_Silent_p.A633A			Q9HAR2	LPHN3_HUMAN	latrophilin 3	623					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.A633A(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CTTGCAGAGCCTATGTCCAGG	0.358																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											175.0	159.0	164.0					4																	62778466		1839	4097	5936	-	-	-	SO:0001819	synonymous_variant	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1899C>T	4.37:g.62778466C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE04|O94867|Q9NWK5	Silent	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.A701	ENST00000514591.1	37	c.2103	CCDS54768.1	4																																																																																			LPHN3	-	pfam_DUF3497	ENSG00000150471		0.358	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	180	0.00	0	C			62778466	62778466	+1	no_errors	ENST00000507625	ensembl	human	known	69_37n	silent	216	11.84	29	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170063010	170063010	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:170063010T>C	ENST00000263816.3	-	39	7505	c.7220A>G	c.(7219-7221)aAc>aGc	p.N2407S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2407					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.N2407S(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGGGCTATGGTTTTCAGGGTC	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	93.0	93.0					2																	170063010		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7220A>G	2.37:g.170063010T>C	ENSP00000263816:p.Asn2407Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.N2407S	ENST00000263816.3	37	c.7220	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	T	6.599	0.478903	0.12581	.	.	ENSG00000081479	ENST00000263816	D	0.91068	-2.78	5.87	4.71	0.59529	Six-bladed beta-propeller, TolB-like (1);	0.322830	0.39909	N	0.001237	D	0.83285	0.5221	L	0.39467	1.215	0.80722	D	1	B	0.31581	0.329	B	0.27170	0.077	T	0.77308	-0.2636	10	0.06494	T	0.89	.	12.4784	0.55827	0.1254:0.0:0.0:0.8746	.	2407	P98164	LRP2_HUMAN	S	2407	ENSP00000263816:N2407S	ENSP00000263816:N2407S	N	-	2	0	LRP2	169771256	1.000000	0.71417	0.058000	0.19502	0.985000	0.73830	3.537000	0.53590	1.027000	0.39758	0.482000	0.46254	AAC	LRP2	-	NULL	ENSG00000081479		0.393	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	101	0.00	0	T	NM_004525		170063010	170063010	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	144	17.24	30	SNP	0.976	C
MCF2L2	23101	genome.wustl.edu	37	3	182994663	182994664	+	Frame_Shift_Ins	INS	-	-	G	rs200280939		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr3:182994663_182994664insG	ENST00000328913.3	-	15	2155_2156	c.1858_1859insC	c.(1858-1860)cgcfs	p.R620fs	MCF2L2_ENST00000414362.2_Frame_Shift_Ins_p.R620fs|MCF2L2_ENST00000447025.2_Frame_Shift_Ins_p.R620fs|MCF2L2_ENST00000473233.1_Frame_Shift_Ins_p.R620fs	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	620	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R620fs*16(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GTCTTACCTGCGGGGGGAAAGG	0.564																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1859dupC	3.37:g.182994669_182994669dupG	ENSP00000328118:p.Arg620fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Frame_Shift_Ins	INS	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R620fs	ENST00000328913.3	37	c.1859_1858	CCDS3243.1	3																																																																																			MCF2L2	-	superfamily_DH-domain,pfscan_DH-domain	ENSG00000053524		0.564	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	51	0.00	0	-	NM_015078		182994663	182994664	-1	no_errors	ENST00000328913	ensembl	human	known	69_37n	frame_shift_ins	26	10.34	3	INS	0.001:0.000	G
NRROS	375387	genome.wustl.edu	37	3	196387122	196387122	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr3:196387122G>T	ENST00000328557.4	+	3	811	c.608G>T	c.(607-609)gGc>gTc	p.G203V		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	203					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G203V(1)									GCTTTCGACGGCCTGGCTGAG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	50.0	50.0					3																	196387122		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.608G>T	3.37:g.196387122G>T	ENSP00000328625:p.Gly203Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.G203V	ENST00000328557.4	37	c.608	CCDS3319.1	3	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336131	0.24253	.	.	ENSG00000174004	ENST00000328557	T	0.62941	-0.01	6.17	3.05	0.35203	.	0.411690	0.29021	N	0.013400	T	0.78805	0.4341	M	0.89658	3.05	0.24399	N	0.994716	P	0.51537	0.946	P	0.61940	0.896	T	0.70985	-0.4723	10	0.30078	T	0.28	.	12.6966	0.57008	0.2055:0.0:0.7945:0.0	.	203	Q86YC3	LRC33_HUMAN	V	203	ENSP00000328625:G203V	ENSP00000328625:G203V	G	+	2	0	LRRC33	197871519	0.978000	0.34361	0.008000	0.14137	0.004000	0.04260	4.653000	0.61462	0.956000	0.37904	-0.136000	0.14681	GGC	LRRC33	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174004		0.632	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC33	HGNC	protein_coding	OTTHUMT00000340676.1	39	0.00	0	G	NM_198565		196387122	196387122	+1	no_errors	ENST00000328557	ensembl	human	known	69_37n	missense	11	56.00	14	SNP	0.005	T
MEGF11	84465	genome.wustl.edu	37	15	66420684	66420684	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr15:66420684G>C	ENST00000409699.2	-	2	230	c.58C>G	c.(58-60)Ctg>Gtg	p.L20V	MEGF11_ENST00000422354.1_Missense_Mutation_p.L20V|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000288745.3_Intron|MEGF11_ENST00000360698.4_Missense_Mutation_p.L20V|MEGF11_ENST00000395625.2_5'UTR			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	20					homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L20V(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						TCGGGGTTCAGGGCAAGGGTG	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	78.0	76.0					15																	66420684		690	1590	2280	-	-	-	SO:0001583	missense	0			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.58C>G	15.37:g.66420684G>C	ENSP00000386908:p.Leu20Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_EMI_domain	p.L20V	ENST00000409699.2	37	c.58	CCDS10213.2	15	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604409	0.66445	.	.	ENSG00000157890	ENST00000409699;ENST00000422354;ENST00000360698	D;D;D	0.88201	-2.32;-2.32;-2.35	5.05	5.05	0.67936	.	.	.	.	.	D	0.91794	0.7404	L	0.54323	1.7	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	D	0.91621	0.5311	9	0.56958	D	0.05	.	10.6303	0.45532	0.0886:0.0:0.9114:0.0	.	20	A6BM72	MEG11_HUMAN	V	20	ENSP00000386908:L20V;ENSP00000414475:L20V;ENSP00000353919:L20V	ENSP00000353919:L20V	L	-	1	2	MEGF11	64207738	1.000000	0.71417	0.976000	0.42696	0.570000	0.35934	4.326000	0.59241	2.343000	0.79666	0.655000	0.94253	CTG	MEGF11	-	NULL	ENSG00000157890		0.637	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF11	HGNC	protein_coding	OTTHUMT00000329307.2	124	0.00	0	G	NM_032445		66420684	66420684	-1	no_errors	ENST00000409699	ensembl	human	known	69_37n	missense	66	23.26	20	SNP	0.996	C
MEGF8	1954	genome.wustl.edu	37	19	42863306	42863307	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr19:42863306_42863307insG	ENST00000251268.6	+	31	5400_5401	c.5400_5401insG	c.(5401-5403)gggfs	p.G1801fs	MEGF8_ENST00000334370.4_Frame_Shift_Ins_p.G1734fs	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1801					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGTGGTTCTTGGGGGGCGCTC	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.5406dupG	19.37:g.42863312_42863312dupG	ENSP00000251268:p.Gly1801fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Frame_Shift_Ins	INS	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.R1802fs	ENST00000251268.6	37	c.5400_5401		19																																																																																			MEGF8	-	superfamily_Gal_Oxase/kelch_b-propeller	ENSG00000105429		0.644	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	15	0.00	0	-	NM_001410		42863306	42863307	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	frame_shift_ins	17	15.00	3	INS	0.034:1.000	G
MFN1	55669	genome.wustl.edu	37	3	179094864	179094864	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr3:179094864G>C	ENST00000471841.1	+	11	1258	c.1132G>C	c.(1132-1134)Gat>Cat	p.D378H	MFN1_ENST00000263969.5_Missense_Mutation_p.D378H|MFN1_ENST00000280653.7_Missense_Mutation_p.D378H	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	378					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D378H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			AGACCAAATTGATAGACTGGA	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	85.0	85.0					3																	179094864		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1132G>C	3.37:g.179094864G>C	ENSP00000420617:p.Asp378His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase	p.D378H	ENST00000471841.1	37	c.1132	CCDS3228.1	3	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821367	0.90873	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000474903	D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.98804	0.9597	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.99556	1.0967	10	0.62326	D	0.03	-23.1075	19.6435	0.95767	0.0:0.0:1.0:0.0	.	378;406;378	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	H	378;378;378;378;241	ENSP00000420617:D378H;ENSP00000280653:D378H;ENSP00000263969:D378H;ENSP00000419926:D241H	ENSP00000263969:D378H	D	+	1	0	MFN1	180577558	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.638000	0.89438	0.655000	0.94253	GAT	MFN1	-	NULL	ENSG00000171109		0.398	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN1	HGNC	protein_coding	OTTHUMT00000348654.2	68	0.00	0	G	NM_017927		179094864	179094864	+1	no_errors	ENST00000263969	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	1.000	C
MICAL2	9645	genome.wustl.edu	37	11	12225820	12225820	+	Silent	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr11:12225820C>G	ENST00000256194.4	+	4	576	c.288C>G	c.(286-288)ccC>ccG	p.P96P	MICAL2_ENST00000527195.1_3'UTR|MICAL2_ENST00000342902.5_Silent_p.P96P|MICAL2_ENST00000379612.3_Silent_p.P96P|MICAL2_ENST00000527546.1_Silent_p.P96P|MICAL2_ENST00000537344.1_Silent_p.P96P	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	96	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.P96P(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GGGGAGGACCCTGTGGCTTGC	0.557																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											78.0	70.0	73.0					11																	12225820		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.288C>G	11.37:g.12225820C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Silent	SNP	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,prints_Rng_hydrolase-like,pfscan_CH-domain,pfscan_Znf_LIM	p.P96	ENST00000256194.4	37	c.288	CCDS7809.1	11																																																																																			MICAL2	-	pfam_mOase_FAD-bd,pfam_FAD_bind_dom,prints_Rng_hydrolase-like	ENSG00000133816		0.557	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1	88	0.00	0	C	NM_014632		12225820	12225820	+1	no_errors	ENST00000256194	ensembl	human	known	69_37n	silent	59	28.92	24	SNP	0.649	G
KMT2E	55904	genome.wustl.edu	37	7	104753730	104753730	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr7:104753730C>A	ENST00000311117.3	+	27	6072	c.5527C>A	c.(5527-5529)Cag>Aag	p.Q1843K	SRPK2_ENST00000493638.1_Intron|KMT2E_ENST00000334877.4_Missense_Mutation_p.Q1801K|KMT2E_ENST00000257745.4_Missense_Mutation_p.Q1843K	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1843	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.Q1843K(1)									TCACAGAGCACAGGTGCCACC	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	63.0	64.0					7																	104753730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.5527C>A	7.37:g.104753730C>A	ENSP00000312379:p.Gln1843Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.Q1843K	ENST00000311117.3	37	c.5527	CCDS34723.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.37|13.37	2.217642|2.217642	0.39201|0.39201	.|.	.|.	ENSG00000005483|ENSG00000005483	ENST00000393656|ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745	.|T;T;T	.|0.40476	.|1.03;1.03;1.03	4.7|4.7	4.7|4.7	0.59300|0.59300	.|.	.|0.000000	.|0.51477	.|D	.|0.000086	T|T	0.45756|0.45756	0.1358|0.1358	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|D;P	.|0.61080	.|0.989;0.924	.|D;P	.|0.70487	.|0.969;0.857	T|T	0.60052|0.60052	-0.7338|-0.7338	6|10	0.87932|0.87932	D|D	0|0	.|.	17.6289|17.6289	0.88100|0.88100	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1763;1843	.|F8W6H1;Q8IZD2	.|.;MLL5_HUMAN	Q|K	1625|1843;1801;1763;1843	.|ENSP00000312379:Q1843K;ENSP00000335599:Q1801K;ENSP00000257745:Q1843K	ENSP00000377266:H1625Q|ENSP00000257745:Q1843K	H|Q	+|+	3|1	2|0	MLL5|MLL5	104540966|104540966	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.892000|3.892000	0.56235|0.56235	2.151000|2.151000	0.67156|0.67156	0.557000|0.557000	0.71058|0.71058	CAC|CAG	MLL5	-	NULL	ENSG00000005483		0.458	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL5	HGNC	protein_coding	OTTHUMT00000348697.1	33	0.00	0	C			104753730	104753730	+1	no_errors	ENST00000257745	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	1.000	A
MSH6	2956	genome.wustl.edu	37	2	48027198	48027198	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:48027198A>C	ENST00000234420.5	+	4	2228	c.2076A>C	c.(2074-2076)aaA>aaC	p.K692N	MSH6_ENST00000540021.1_Missense_Mutation_p.K562N|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000538136.1_Missense_Mutation_p.K390N	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	692					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.K692N(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCTACCTCAAAAAATGCCTTA	0.408			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	3	Whole gene deletion(2)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(2)|breast(1)											164.0	159.0	161.0					2																	48027198		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.2076A>C	2.37:g.48027198A>C	ENSP00000234420:p.Lys692Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_core,pfam_PWWP,pfam_DNA_mismatch_repair_MutS_clamp,pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mismatch_repair_MutS_connt,smart_PWWP,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_Msh6,pfscan_PWWP	p.K692N	ENST00000234420.5	37	c.2076	CCDS1836.1	2	.	.	.	.	.	.	.	.	.	.	A	14.43	2.534201	0.45073	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.89552	-2.53;-2.53;-2.53	5.01	3.86	0.44501	DNA mismatch repair protein MutS, connector (1);	0.045291	0.85682	D	0.000000	D	0.91981	0.7460	M	0.79805	2.47	0.80722	D	1	P;P;D	0.59357	0.943;0.943;0.985	P;P;P	0.57620	0.733;0.733;0.824	D	0.91353	0.5106	10	0.87932	D	0	-6.4032	8.0611	0.30633	0.8437:0.0:0.1563:0.0	.	562;692;692	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	N	692;690;562;390	ENSP00000234420:K692N;ENSP00000446475:K562N;ENSP00000438580:K390N	ENSP00000234420:K692N	K	+	3	2	MSH6	47880702	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.486000	0.53215	0.943000	0.37553	-0.467000	0.05162	AAA	MSH6	-	pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_connt,pirsf_DNA_mismatch_repair_Msh6	ENSG00000116062		0.408	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH6	HGNC	protein_coding	OTTHUMT00000251180.4	140	0.00	0	A	NM_000179		48027198	48027198	+1	no_errors	ENST00000234420	ensembl	human	known	69_37n	missense	163	13.76	26	SNP	1.000	C
NCAPD2	9918	genome.wustl.edu	37	12	6637440	6637440	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr12:6637440T>C	ENST00000315579.5	+	25	4044	c.3245T>C	c.(3244-3246)cTg>cCg	p.L1082P	NCAPD2_ENST00000545962.1_Missense_Mutation_p.L1037P	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1082					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)	p.L1082P(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						ACTGGGGATCTGGCCATCCGC	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											220.0	224.0	223.0					12																	6637440		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.3245T>C	12.37:g.6637440T>C	ENSP00000325017:p.Leu1082Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUR4|Q8N6U3	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	p.L1082P	ENST00000315579.5	37	c.3245	CCDS8548.1	12	.	.	.	.	.	.	.	.	.	.	T	25.3	4.628101	0.87560	.	.	ENSG00000010292	ENST00000315579;ENST00000545962	T;T	0.68765	-0.35;-0.35	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86522	0.5953	M	0.93462	3.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.90037	0.4139	10	0.87932	D	0	-15.3673	16.1761	0.81851	0.0:0.0:0.0:1.0	.	1037;1043;1082	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	P	1082;1037	ENSP00000325017:L1082P;ENSP00000444417:L1037P	ENSP00000325017:L1082P	L	+	2	0	NCAPD2	6507701	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.694000	0.84235	2.215000	0.71742	0.459000	0.35465	CTG	NCAPD2	-	superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	ENSG00000010292		0.572	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD2	HGNC	protein_coding	OTTHUMT00000399964.1	205	0.00	0	T	NM_014865		6637440	6637440	+1	no_errors	ENST00000315579	ensembl	human	known	69_37n	missense	167	23.74	52	SNP	1.000	C
NKX2-3	159296	genome.wustl.edu	37	10	101294773	101294773	+	Silent	SNP	G	G	A	rs367821133		TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr10:101294773G>A	ENST00000344586.7	+	2	589	c.390G>A	c.(388-390)acG>acA	p.T130T		NM_145285.2	NP_660328.2	Q8TAU0	NKX23_HUMAN	NK2 homeobox 3	130					CD4-positive, alpha-beta T cell differentiation (GO:0043367)|gland morphogenesis (GO:0022612)|leukocyte homeostasis (GO:0001776)|leukocyte migration (GO:0050900)|lymph node development (GO:0048535)|macrophage differentiation (GO:0030225)|odontogenesis of dentin-containing tooth (GO:0042475)|Peyer's patch development (GO:0048541)|plasma cell differentiation (GO:0002317)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic digestive tract morphogenesis (GO:0048621)|regulation of cell proliferation (GO:0042127)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)|triglyceride metabolic process (GO:0006641)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.45e-08)		CTCTAGAGACGGCCGGAGACT	0.652																																					Pancreas(173;2021 2035 19403 19989 27291)	dbGAP											0													7.0	9.0	8.0					10																	101294773		1981	4151	6132	-	-	-	SO:0001819	synonymous_variant	0				CCDS41558.1	10q24.2	2013-09-20	2011-06-01	2002-10-04	ENSG00000119919	ENSG00000119919		"""Homeoboxes / ANTP class : NKL subclass"""	7836	protein-coding gene	gene with protein product		606727	"""NK-2 (Drosophila) homolog C"", ""NK2 transcription factor related, locus 3 (Drosophila)"""	NKX2C		1346742, 9142493	Standard	NM_145285		Approved	NKX2.3, CSX3, NKX4-3	uc009xwj.3	Q8TAU0	OTTHUMG00000018887	ENST00000344586.7:c.390G>A	10.37:g.101294773G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUZ4|Q9NYS6	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.T130	ENST00000344586.7	37	c.390	CCDS41558.1	10																																																																																			NKX2-3	-	NULL	ENSG00000119919		0.652	NKX2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-3	HGNC	protein_coding	OTTHUMT00000049808.2	10	0.00	0	G			101294773	101294773	+1	no_errors	ENST00000344586	ensembl	human	known	69_37n	silent	2	66.67	4	SNP	0.661	A
NOL4	8715	genome.wustl.edu	37	18	31803107	31803107	+	Silent	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr18:31803107G>C	ENST00000261592.5	-	1	408	c.111C>G	c.(109-111)gtC>gtG	p.V37V	NOL4_ENST00000589544.1_Silent_p.V37V|NOL4_ENST00000590846.1_5'Flank|NOL4_ENST00000538587.1_5'Flank|NOL4_ENST00000269185.4_5'UTR|NOL4_ENST00000535475.1_5'Flank|RP11-379L18.1_ENST00000587528.1_RNA	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	37						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.V37V(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TGAGGAGCTGGACGATCCGTT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											110.0	116.0	114.0					18																	31803107		2070	4188	6258	-	-	-	SO:0001819	synonymous_variant	0			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.111C>G	18.37:g.31803107G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Silent	SNP	NULL	p.V37	ENST00000261592.5	37	c.111	CCDS11907.2	18																																																																																			NOL4	-	NULL	ENSG00000101746		0.572	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	HGNC	protein_coding	OTTHUMT00000255386.1	100	0.00	0	G	NM_003787		31803107	31803107	-1	no_errors	ENST00000261592	ensembl	human	known	69_37n	silent	39	27.78	15	SNP	1.000	C
NTRK3	4916	genome.wustl.edu	37	15	88678459	88678459	+	Silent	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr15:88678459G>A	ENST00000360948.2	-	9	1238	c.1077C>T	c.(1075-1077)tcC>tcT	p.S359S	NTRK3_ENST00000542733.2_Silent_p.S261S|NTRK3_ENST00000355254.2_Silent_p.S359S|NTRK3_ENST00000394480.2_Silent_p.S359S|NTRK3_ENST00000317501.3_Silent_p.S359S|NTRK3_ENST00000357724.2_Silent_p.S359S|NTRK3_ENST00000540489.2_Silent_p.S359S|NTRK3_ENST00000557856.1_Silent_p.S359S|NTRK3_ENST00000558676.1_Silent_p.S359S	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	359	Ig-like C2-type 2.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S359S(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGCAGCCCTCGGAAATCTCTC	0.552			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																												dbGAP		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	3	Substitution - coding silent(3)	breast(3)											215.0	200.0	205.0					15																	88678459		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1077C>T	15.37:g.88678459G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S359	ENST00000360948.2	37	c.1077	CCDS32322.1	15																																																																																			NTRK3	-	pfam_Ig_I-set,prints_Tyr_kin_neurotrophic_rcpt_3	ENSG00000140538		0.552	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		195	0.00	0	G			88678459	88678459	-1	no_errors	ENST00000360948	ensembl	human	known	69_37n	silent	109	43.23	83	SNP	0.201	A
OCSTAMP	128506	genome.wustl.edu	37	20	45174807	45174807	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr20:45174807C>T	ENST00000279028.2	-	2	219	c.206G>A	c.(205-207)tGg>tAg	p.W69*		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	69					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)		p.W69*(2)		breast(1)|endometrium(1)	2						GGATGCCAGCCAGTGATAAAC	0.622																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											61.0	76.0	72.0					20																	45174807		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.206G>A	20.37:g.45174807C>T	ENSP00000279028:p.Trp69*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_DC_STAMP-like	p.W69*	ENST00000279028.2	37	c.206	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	c	16.86	3.239751	0.58995	.	.	ENSG00000149635	ENST00000279028	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.3166	18.1067	0.89523	0.0:1.0:0.0:0.0	.	.	.	.	X	69	.	ENSP00000279028:W69X	W	-	2	0	C20orf123	44608214	1.000000	0.71417	0.998000	0.56505	0.274000	0.26718	5.837000	0.69381	2.507000	0.84556	0.651000	0.88453	TGG	OCSTAMP	-	NULL	ENSG00000149635		0.622	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	70	0.00	0	C	XM_496476		45174807	45174807	-1	no_errors	ENST00000279028	ensembl	human	known	69_37n	nonsense	44	24.14	14	SNP	1.000	T
OLFML3	56944	genome.wustl.edu	37	1	114523022	114523022	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:114523022G>C	ENST00000320334.4	+	2	257	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OLFML3_ENST00000369551.1_Missense_Mutation_p.K41N|OLFML3_ENST00000393300.2_Missense_Mutation_p.K41N|OLFML3_ENST00000491700.1_3'UTR	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	61					multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)		p.K61N(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAAGAACAAGATGCTGCCAC	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	70.0	68.0					1																	114523022		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.183G>C	1.37:g.114523022G>C	ENSP00000322273:p.Lys61Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Missense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.K61N	ENST00000320334.4	37	c.183	CCDS870.1	1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222054	0.39300	.	.	ENSG00000116774	ENST00000369551;ENST00000320334;ENST00000393300	D;D;D	0.89270	-2.49;-2.49;-2.49	5.37	3.14	0.36123	.	0.049874	0.85682	D	0.000000	T	0.62208	0.2409	N	0.14661	0.345	0.36565	D	0.872637	P;P	0.43352	0.804;0.675	B;B	0.40134	0.32;0.291	T	0.66736	-0.5848	10	0.07030	T	0.85	.	10.3824	0.44119	0.2398:0.0:0.7602:0.0	.	41;61	Q9NRN5-2;Q9NRN5	.;OLFL3_HUMAN	N	41;61;41	ENSP00000358564:K41N;ENSP00000322273:K61N;ENSP00000376977:K41N	ENSP00000322273:K61N	K	+	3	2	OLFML3	114324545	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.270000	0.58896	1.260000	0.44134	0.561000	0.74099	AAG	OLFML3	-	NULL	ENSG00000116774		0.627	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	118	0.00	0	G	NM_020190		114523022	114523022	+1	no_errors	ENST00000320334	ensembl	human	known	69_37n	missense	119	30.00	51	SNP	1.000	C
OR2T3	343173	genome.wustl.edu	37	1	248636865	248636865	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:248636865G>A	ENST00000359594.2	+	1	239	c.214G>A	c.(214-216)Gcg>Acg	p.A72T		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A72T(1)		breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGCCAGCTCGCGCTCATGGA	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											10.0	7.0	8.0					1																	248636865		2116	3985	6101	-	-	-	SO:0001583	missense	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.214G>A	1.37:g.248636865G>A	ENSP00000352604:p.Ala72Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A72T	ENST00000359594.2	37	c.214	CCDS31117.1	1	.	.	.	.	.	.	.	.	.	.	g	12.18	1.859216	0.32884	.	.	ENSG00000196539	ENST00000359594	T	0.03094	4.05	2.65	-3.61	0.04556	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.05731	0.0150	M	0.77103	2.36	0.09310	N	1	B	0.30033	0.266	B	0.23574	0.047	T	0.25502	-1.0130	9	0.87932	D	0	.	9.7553	0.40500	0.0:0.0:0.516:0.484	.	72	Q8NH03	OR2T3_HUMAN	T	72	ENSP00000352604:A72T	ENSP00000352604:A72T	A	+	1	0	OR2T3	246703488	0.000000	0.05858	0.005000	0.12908	0.039000	0.13416	-0.129000	0.10515	-0.392000	0.07751	0.186000	0.17326	GCG	OR2T3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196539		0.562	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	166	0.00	0	G	NM_001005495		248636865	248636865	+1	no_errors	ENST00000359594	ensembl	human	known	69_37n	missense	439	12.18	61	SNP	0.266	A
P2RY2	5029	genome.wustl.edu	37	11	72946208	72946208	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr11:72946208G>A	ENST00000311131.2	+	3	1471	c.1004G>A	c.(1003-1005)aGg>aAg	p.R335K	P2RY2_ENST00000393596.2_Missense_Mutation_p.R335K|P2RY2_ENST00000393597.2_Missense_Mutation_p.R335K	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	335					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	GCTCGCCGCAGGCTGGGCCTG	0.652																																						dbGAP											0													29.0	33.0	32.0					11																	72946208		2197	4292	6489	-	-	-	SO:0001583	missense	0			U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.1004G>A	11.37:g.72946208G>A	ENSP00000310305:p.Arg335Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9W3|Q96EM8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_P2U_purnocptor,prints_P2_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2Y4_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.R335K	ENST00000311131.2	37	c.1004	CCDS8219.1	11	.	.	.	.	.	.	.	.	.	.	G	6.996	0.553938	0.13374	.	.	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.20069	2.1;2.1;2.1	4.44	2.48	0.30137	.	1.353490	0.04791	N	0.431720	T	0.09818	0.0241	N	0.08118	0	0.21915	N	0.999475	B	0.02656	0.0	B	0.01281	0.0	T	0.24297	-1.0164	10	0.02654	T	1	.	6.8808	0.24173	0.2401:0.0:0.7599:0.0	.	335	P41231	P2RY2_HUMAN	K	335	ENSP00000377222:R335K;ENSP00000310305:R335K;ENSP00000377221:R335K	ENSP00000310305:R335K	R	+	2	0	P2RY2	72623856	0.001000	0.12720	0.998000	0.56505	0.518000	0.34316	-0.554000	0.06006	0.972000	0.38314	0.561000	0.74099	AGG	P2RY2	-	prints_P2U_purnocptor	ENSG00000175591		0.652	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY2	HGNC	protein_coding	OTTHUMT00000397336.1	11	0.00	0	G	NM_176072		72946208	72946208	+1	no_errors	ENST00000311131	ensembl	human	known	69_37n	missense	22	43.59	17	SNP	0.787	A
OR6X1	390260	genome.wustl.edu	37	11	123624318	123624318	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr11:123624318C>G	ENST00000327930.2	-	1	935	c.909G>C	c.(907-909)atG>atC	p.M303I		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M303I(1)		breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TTGGGCAAGTCATTGCCTTTC	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	143.0	140.0					11																	123624318		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.909G>C	11.37:g.123624318C>G	ENSP00000333724:p.Met303Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGW9|Q6IFA0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M303I	ENST00000327930.2	37	c.909	CCDS31695.1	11	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.025168	0.00041	.	.	ENSG00000221931	ENST00000327930	T	0.35236	1.32	3.82	-0.404	0.12396	.	.	.	.	.	T	0.11965	0.0291	N	0.04275	-0.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31280	-0.9949	9	0.05959	T	0.93	-0.2177	4.0588	0.09829	0.1699:0.5366:0.0:0.2935	.	303	Q8NH79	OR6X1_HUMAN	I	303	ENSP00000333724:M303I	ENSP00000333724:M303I	M	-	3	0	OR6X1	123129528	0.028000	0.19301	0.016000	0.15963	0.226000	0.24999	0.221000	0.17680	-0.281000	0.09141	-0.808000	0.03180	ATG	OR6X1	-	NULL	ENSG00000221931		0.398	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6X1	HGNC	protein_coding	OTTHUMT00000387436.1	59	0.00	0	C	NM_001005188		123624318	123624318	-1	no_errors	ENST00000327930	ensembl	human	known	69_37n	missense	32	42.86	24	SNP	0.025	G
PCNX	22990	genome.wustl.edu	37	14	71514550	71514550	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr14:71514550C>A	ENST00000304743.2	+	22	4633	c.4187C>A	c.(4186-4188)gCt>gAt	p.A1396D	PCNX_ENST00000439984.3_Missense_Mutation_p.A1285D|PCNX_ENST00000238570.5_Missense_Mutation_p.A1396D	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1396						integral component of membrane (GO:0016021)		p.A1396D(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		ATCACTGTTGCTGGTTTGAAG	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											220.0	187.0	198.0					14																	71514550		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4187C>A	14.37:g.71514550C>A	ENSP00000304192:p.Ala1396Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	pfam_Pecanex	p.A1396D	ENST00000304743.2	37	c.4187	CCDS9806.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.69|17.69	3.452141|3.452141	0.63290|0.63290	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.11604|.	3.16;3.13;2.76|.	5.32|5.32	4.43|4.43	0.53597|0.53597	.|.	0.101498|.	0.64402|.	D|.	0.000002|.	T|T	0.73567|0.73567	0.3603|0.3603	M|M	0.75777|0.75777	2.31|2.31	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.996;0.999;0.994|.	D;D;P|.	0.72982|.	0.919;0.979;0.832|.	T|T	0.74699|0.74699	-0.3577|-0.3577	10|5	0.66056|.	D|.	0.02|.	.|.	14.4254|14.4254	0.67212|0.67212	0.0:0.9285:0.0:0.0715|0.0:0.9285:0.0:0.0715	.|.	1396;1285;1396|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	D|M	1396;1396;1285|455	ENSP00000304192:A1396D;ENSP00000238570:A1396D;ENSP00000396617:A1285D|.	ENSP00000238570:A1396D|.	A|L	+|+	2|1	0|2	PCNX|PCNX	70584303|70584303	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.720000|0.720000	0.41350|0.41350	7.776000|7.776000	0.85560|0.85560	1.369000|1.369000	0.46134|0.46134	0.591000|0.591000	0.81541|0.81541	GCT|CTG	PCNX	-	NULL	ENSG00000100731		0.343	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	168	0.00	0	C	NM_014982		71514550	71514550	+1	no_errors	ENST00000304743	ensembl	human	known	69_37n	missense	83	23.85	26	SNP	1.000	A
PLEKHA4	57664	genome.wustl.edu	37	19	49355488	49355488	+	Silent	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr19:49355488G>C	ENST00000263265.6	-	13	1977	c.1422C>G	c.(1420-1422)ccC>ccG	p.P474P	PLEKHA4_ENST00000355496.5_Silent_p.P449P	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	474						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)	p.P474P(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GATTTACCTGGGGAGAACCAA	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											106.0	90.0	95.0					19																	49355488		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.1422C>G	19.37:g.49355488G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4M8|Q8N658	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P474	ENST00000263265.6	37	c.1422	CCDS12737.1	19																																																																																			PLEKHA4	-	NULL	ENSG00000105559		0.562	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA4	HGNC	protein_coding	OTTHUMT00000466216.1	118	0.00	0	G			49355488	49355488	-1	no_errors	ENST00000263265	ensembl	human	known	69_37n	silent	113	13.08	17	SNP	0.998	C
PODN	127435	genome.wustl.edu	37	1	53535536	53535536	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:53535536G>C	ENST00000312553.5	+	2	160	c.153G>C	c.(151-153)caG>caC	p.Q51H	PODN_ENST00000395871.2_Missense_Mutation_p.Q51H|PODN_ENST00000371500.3_Missense_Mutation_p.Q32H|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	3					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)	p.Q51H(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCATGGCCCAGAGCCGGGtgc	0.682																																						dbGAP											1	Substitution - Missense(1)	breast(1)											7.0	9.0	8.0					1																	53535536		2151	4243	6394	-	-	-	SO:0001583	missense	0			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.153G>C	1.37:g.53535536G>C	ENSP00000308315:p.Gln51His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.Q51H	ENST00000312553.5	37	c.153	CCDS573.1	1	.	.	.	.	.	.	.	.	.	.	G	8.631	0.893621	0.17613	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.59772	0.91;0.24;1.01	4.02	1.97	0.26223	.	2.358670	0.01978	N	0.044611	T	0.40815	0.1132	N	0.08118	0	0.19775	N	0.999951	P;B;B	0.35050	0.482;0.216;0.216	B;B;B	0.36666	0.23;0.089;0.089	T	0.44345	-0.9334	10	0.72032	D	0.01	.	5.4515	0.16568	0.1176:0.2057:0.6767:0.0	.	51;32;51	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	H	32;51;51	ENSP00000360555:Q32H;ENSP00000379212:Q51H;ENSP00000308315:Q51H	ENSP00000308315:Q51H	Q	+	3	2	PODN	53308124	0.114000	0.22134	0.787000	0.31911	0.202000	0.24057	0.212000	0.17497	0.841000	0.35020	0.313000	0.20887	CAG	PODN	-	NULL	ENSG00000174348		0.682	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	HGNC	protein_coding	OTTHUMT00000024735.1	9	0.00	0	G	NM_153703		53535536	53535536	+1	no_errors	ENST00000312553	ensembl	human	known	69_37n	missense	5	54.55	6	SNP	0.833	C
PPEF1	5475	genome.wustl.edu	37	X	18748318	18748318	+	Silent	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chrX:18748318C>T	ENST00000361511.4	+	5	560	c.66C>T	c.(64-66)atC>atT	p.I22I	PPEF1_ENST00000543630.1_Silent_p.I22I|PPEF1_ENST00000471570.1_3'UTR|PPEF1_ENST00000349874.5_Silent_p.I22I|PPEF1_ENST00000359763.6_Silent_p.I22I|PPEF1_ENST00000544635.1_Intron	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	22	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.I22I(1)		breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					CTGCGTTGATCATCCAGAACT	0.468																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											186.0	131.0	150.0					X																	18748318		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.66C>T	X.37:g.18748318C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Silent	SNP	pfam_Metallo_PEstase_dom,pfam_EF-hand,pfam_PPP_dom,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_HAND_2,pfscan_IQ_motif_EF-hand-BS,prints_Ser/Thr-sp_prot-phosphatase	p.I22	ENST00000361511.4	37	c.66	CCDS14188.1	X																																																																																			PPEF1	-	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_IQ_motif_EF-hand-BS	ENSG00000086717		0.468	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF1	HGNC	protein_coding	OTTHUMT00000055953.3	246	0.00	0	C	NM_006240		18748318	18748318	+1	no_errors	ENST00000361511	ensembl	human	known	69_37n	silent	148	32.42	71	SNP	1.000	T
PPP1R12A	4659	genome.wustl.edu	37	12	80214707	80214707	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr12:80214707C>G	ENST00000450142.2	-	8	1227	c.961G>C	c.(961-963)Gag>Cag	p.E321Q	PPP1R12A_ENST00000546369.1_Missense_Mutation_p.E234Q|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.E321Q|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.E321Q|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.E321Q|RP11-530C5.2_ENST00000548469.1_RNA	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	321					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.E321Q(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						ATCAACGTCTCTTTGCTGTTA	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	74.0	77.0					12																	80214707		1831	4073	5904	-	-	-	SO:0001583	missense	0			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.961G>C	12.37:g.80214707C>G	ENSP00000389168:p.Glu321Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E321Q	ENST00000450142.2	37	c.961	CCDS44947.1	12	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915808	0.92178	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000547131	T;T;T;T;T;T;T	0.54071	1.13;1.13;1.15;1.13;1.09;1.07;0.59	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.73923	0.3649	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.67145	0.996;0.991;0.996;0.993	D;D;D;D	0.78314	0.986;0.925;0.991;0.968	T	0.73375	-0.4002	10	0.48119	T	0.1	.	19.82	0.96590	0.0:1.0:0.0:0.0	.	321;321;321;321	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	Q	321;321;321;321;321;321;321;234;321;321;16	ENSP00000261207:E321Q;ENSP00000389168:E321Q;ENSP00000416769:E321Q;ENSP00000449514:E234Q;ENSP00000446855:E321Q;ENSP00000446816:E321Q;ENSP00000450061:E16Q	ENSP00000261207:E321Q	E	-	1	0	PPP1R12A	78738838	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.243000	0.78219	2.660000	0.90430	0.591000	0.81541	GAG	PPP1R12A	-	pirsf_Pase-1_reg_su_12A/B/C_euk	ENSG00000058272		0.358	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	182	0.00	0	C	NM_002480		80214707	80214707	-1	no_errors	ENST00000261207	ensembl	human	known	69_37n	missense	110	25.68	38	SNP	1.000	G
PPP4R2	151987	genome.wustl.edu	37	3	73114268	73114268	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr3:73114268G>C	ENST00000356692.5	+	8	1157	c.904G>C	c.(904-906)Gaa>Caa	p.E302Q	PPP4R2_ENST00000394284.3_Missense_Mutation_p.E245Q|PPP4R2_ENST00000295862.9_Missense_Mutation_p.E246Q			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	302	Glu-rich.				cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)	p.E302Q(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		agaggatgaagaagaggatga	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											29.0	31.0	31.0					3																	73114268		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.904G>C	3.37:g.73114268G>C	ENSP00000349124:p.Glu302Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Missense_Mutation	SNP	pfam_PPP4R2	p.E302Q	ENST00000356692.5	37	c.904	CCDS2917.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.99|12.99	2.102201|2.102201	0.37048|0.37048	.|.	.|.	ENSG00000163605|ENSG00000163605	ENST00000356692;ENST00000394284;ENST00000295862|ENST00000460360	T;T;T|.	0.37752|.	1.2;1.18;1.21|.	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	0.430029|.	0.26414|.	N|.	0.024506|.	T|T	0.68293|0.68293	0.2985|0.2985	L|L	0.50333|0.50333	1.59|1.59	0.48571|0.48571	D|D	0.999678|0.999678	B;B|.	0.30361|.	0.277;0.079|.	B;B|.	0.37989|.	0.262;0.029|.	T|T	0.66192|0.66192	-0.5985|-0.5985	10|5	0.19590|.	T|.	0.45|.	.|.	16.553|16.553	0.84477|0.84477	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	245;302|.	Q9NY27-2;Q9NY27|.	.;PP4R2_HUMAN|.	Q|N	302;245;246|133	ENSP00000349124:E302Q;ENSP00000377825:E245Q;ENSP00000295862:E246Q|.	ENSP00000295862:E246Q|.	E|K	+|+	1|3	0|2	PPP4R2|PPP4R2	73196958|73196958	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.989000|0.989000	0.77384|0.77384	7.204000|7.204000	0.77872|0.77872	2.391000|2.391000	0.81399|0.81399	0.585000|0.585000	0.79938|0.79938	GAA|AAG	PPP4R2	-	NULL	ENSG00000163605		0.403	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R2	HGNC	protein_coding	OTTHUMT00000352321.1	84	0.00	0	G	NM_174907		73114268	73114268	+1	no_errors	ENST00000356692	ensembl	human	known	69_37n	missense	83	13.40	13	SNP	1.000	C
PRPF4B	8899	genome.wustl.edu	37	6	4021684	4021684	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr6:4021684C>A	ENST00000337659.6	+	1	125	c.25C>A	c.(25-27)Cta>Ata	p.L9I	PRPF4B_ENST00000538861.1_5'Flank|RP3-406P24.4_ENST00000606564.1_lincRNA|RP3-406P24.3_ENST00000415144.1_RNA	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	9					mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L9I(1)		breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GACCCAGTCGCTACGGGAGCA	0.672																																						dbGAP											1	Substitution - Missense(1)	breast(1)											16.0	16.0	16.0					6																	4021684		2187	4281	6468	-	-	-	SO:0001583	missense	0			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.25C>A	6.37:g.4021684C>A	ENSP00000337194:p.Leu9Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L9I	ENST00000337659.6	37	c.25	CCDS4488.1	6	.	.	.	.	.	.	.	.	.	.	C	10.22	1.289803	0.23478	.	.	ENSG00000112739	ENST00000337659	T	0.67865	-0.29	5.06	3.29	0.37713	.	0.000000	0.52532	D	0.000079	T	0.28830	0.0715	N	0.14661	0.345	0.80722	D	1	B	0.10296	0.003	B	0.12837	0.008	T	0.11421	-1.0588	10	0.46703	T	0.11	.	8.5548	0.33474	0.0:0.8202:0.0:0.1798	.	9	Q13523	PRP4B_HUMAN	I	9	ENSP00000337194:L9I	ENSP00000337194:L9I	L	+	1	2	PRPF4B	3966683	0.991000	0.36638	0.670000	0.29842	0.198000	0.23893	1.346000	0.33964	0.531000	0.28639	-0.136000	0.14681	CTA	PRPF4B	-	NULL	ENSG00000112739		0.672	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	HGNC	protein_coding	OTTHUMT00000314018.2	47	0.00	0	C			4021684	4021684	+1	no_errors	ENST00000337659	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	0.906	A
PRR11	55771	genome.wustl.edu	37	17	57262479	57262479	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr17:57262479A>T	ENST00000262293.4	+	3	505	c.193A>T	c.(193-195)Aat>Tat	p.N65Y		NM_018304.3	NP_060774.2	Q96HE9	PRR11_HUMAN	proline rich 11	65						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.W62fs*1(1)|p.N65Y(1)		breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|pancreas(1)	16	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					CTGGAACTTCAATTTTCCTAA	0.368																																						dbGAP											2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|breast(1)											93.0	98.0	96.0					17																	57262479		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11614.1	17q23.2	2005-12-13				ENSG00000068489			25619	protein-coding gene	gene with protein product		615920				11799066	Standard	NM_018304		Approved	FLJ11029	uc002ixf.2	Q96HE9		ENST00000262293.4:c.193A>T	17.37:g.57262479A>T	ENSP00000262293:p.Asn65Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NUZ7|Q9NXE9	Missense_Mutation	SNP	NULL	p.N65Y	ENST00000262293.4	37	c.193	CCDS11614.1	17	.	.	.	.	.	.	.	.	.	.	A	2.301	-0.360177	0.05103	.	.	ENSG00000068489	ENST00000262293	.	.	.	5.67	3.39	0.38822	.	1.227560	0.05622	N	0.580122	T	0.21550	0.0519	N	0.08118	0	0.09310	N	1	B	0.24317	0.101	B	0.21917	0.037	T	0.26883	-1.0090	9	0.56958	D	0.05	-8.5077	5.8016	0.18417	0.7454:0.1683:0.0863:0.0	.	65	Q96HE9	PRR11_HUMAN	Y	65	.	ENSP00000262293:N65Y	N	+	1	0	PRR11	54617261	0.011000	0.17503	0.005000	0.12908	0.085000	0.17905	1.029000	0.30140	0.390000	0.25115	0.482000	0.46254	AAT	PRR11	-	NULL	ENSG00000068489		0.368	PRR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR11	HGNC	protein_coding	OTTHUMT00000445949.1	68	0.00	0	A	NM_018304		57262479	57262479	+1	no_errors	ENST00000262293	ensembl	human	known	69_37n	missense	56	27.27	21	SNP	0.001	T
PSIP1	11168	genome.wustl.edu	37	9	15486061	15486061	+	Silent	SNP	C	C	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr9:15486061C>G	ENST00000380733.4	-	6	742	c.399G>C	c.(397-399)gtG>gtC	p.V133V	PSIP1_ENST00000397519.2_Silent_p.V133V|PSIP1_ENST00000380715.1_Silent_p.V133V|PSIP1_ENST00000380738.4_Silent_p.V133V|PSIP1_ENST00000380716.4_Silent_p.V133V			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	133					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)	p.V133V(2)		breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CTGCTTTAGTCACATCCTAAA	0.343																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											116.0	119.0	118.0					9																	15486061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.399G>C	9.37:g.15486061C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Silent	SNP	pfam_LEDGF,pfam_PWWP,smart_PWWP,prints_Treacle-like_TCS,pfscan_PWWP	p.V133	ENST00000380733.4	37	c.399	CCDS6479.1	9																																																																																			PSIP1	-	NULL	ENSG00000164985		0.343	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	HGNC	protein_coding	OTTHUMT00000055445.1	223	0.00	0	C	NM_033222		15486061	15486061	-1	no_errors	ENST00000380733	ensembl	human	known	69_37n	silent	86	15.69	16	SNP	1.000	G
RGR	5995	genome.wustl.edu	37	10	86014115	86014115	+	Silent	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr10:86014115C>T	ENST00000359452.4	+	5	596	c.558C>T	c.(556-558)ttC>ttT	p.F186F	RGR_ENST00000358110.5_Silent_p.F182F	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	182					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.F186F(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						CCATGTCCTTCTTCAACTTCG	0.557																																					NSCLC(15;204 545 5889 6385 32445)	dbGAP											1	Substitution - coding silent(1)	breast(1)											212.0	182.0	192.0					10																	86014115		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.558C>T	10.37:g.86014115C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKK7|Q96FC5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_RPE_GPCR,prints_7TM_GPCR_Rhodpsn	p.F186	ENST00000359452.4	37	c.558	CCDS7374.1	10																																																																																			RGR	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000148604		0.557	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	HGNC	protein_coding	OTTHUMT00000049116.1	179	0.00	0	C	NM_002921		86014115	86014115	+1	no_errors	ENST00000359452	ensembl	human	known	69_37n	silent	85	35.61	47	SNP	0.993	T
RGS22	26166	genome.wustl.edu	37	8	101075866	101075866	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr8:101075866G>C	ENST00000360863.6	-	8	1324	c.1130C>G	c.(1129-1131)tCa>tGa	p.S377*	RGS22_ENST00000523437.1_Nonsense_Mutation_p.S365*|RGS22_ENST00000523287.1_Nonsense_Mutation_p.S196*	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	377					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.S377*(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TATCTCTTCTGACCTCTCCTT	0.368																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											126.0	111.0	116.0					8																	101075866		1857	4105	5962	-	-	-	SO:0001587	stop_gained	0			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1130C>G	8.37:g.101075866G>C	ENSP00000354109:p.Ser377*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.S377*	ENST00000360863.6	37	c.1130	CCDS43758.1	8	.	.	.	.	.	.	.	.	.	.	G	38	7.282725	0.98186	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	.	.	.	5.68	1.33	0.21861	.	0.651897	0.13884	N	0.356109	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	6.398	0.21622	0.3258:0.0:0.553:0.1212	.	.	.	.	X	377;365;196;365	.	ENSP00000354109:S377X	S	-	2	0	RGS22	101145042	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	0.116000	0.15561	0.428000	0.26173	0.650000	0.86243	TCA	RGS22	-	NULL	ENSG00000132554		0.368	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	HGNC	protein_coding	OTTHUMT00000380365.1	315	0.00	0	G	NM_015668		101075866	101075866	-1	no_errors	ENST00000360863	ensembl	human	known	69_37n	nonsense	334	22.33	96	SNP	0.000	C
RIN2	54453	genome.wustl.edu	37	20	19951534	19951534	+	Missense_Mutation	SNP	T	T	G	rs3803981	byFrequency	TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr20:19951534T>G	ENST00000255006.6	+	7	885	c.736T>G	c.(736-738)Tcg>Gcg	p.S246A	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	197					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AACAGCCAAGTCGGAGGCTCA	0.438																																						dbGAP											0													71.0	72.0	72.0					20																	19951534		1935	4127	6062	-	-	-	SO:0001583	missense	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.736T>G	20.37:g.19951534T>G	ENSP00000255006:p.Ser246Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.S246A	ENST00000255006.6	37	c.736	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	T	16.76	3.213313	0.58452	.	.	ENSG00000132669	ENST00000255006	T	0.48522	0.81	5.66	4.56	0.56223	.	0.049002	0.85682	D	0.000000	T	0.37293	0.0998	L	0.39898	1.24	0.09310	P	1.0	B	0.02656	0.0	B	0.04013	0.001	T	0.42413	-0.9453	8	.	.	.	-15.9515	11.5874	0.50927	0.8613:0.0:0.0:0.1387	.	197	Q8WYP3	RIN2_HUMAN	A	246	ENSP00000255006:S246A	.	S	+	1	0	RIN2	19899534	1.000000	0.71417	0.994000	0.49952	0.971000	0.66376	6.837000	0.75354	0.960000	0.38005	-0.624000	0.04008	TCG	RIN2	-	NULL	ENSG00000132669		0.438	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	127	0.00	0	T			19951534	19951534	+1	no_errors	ENST00000255006	ensembl	human	known	69_37n	missense	86	23.89	27	SNP	1.000	G
SLC11A1	6556	genome.wustl.edu	37	2	219255977	219255977	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:219255977C>A	ENST00000233202.6	+	10	1351	c.1011C>A	c.(1009-1011)aaC>aaA	p.N337K	SLC11A1_ENST00000539932.1_Missense_Mutation_p.N219K	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	337					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)	p.N337K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCCCATGAACAACGCCACCG	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	68.0	73.0					2																	219255977		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1011C>A	2.37:g.219255977C>A	ENSP00000233202:p.Asn337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C0H5Y3	Missense_Mutation	SNP	pfam_Nat-R-assoc-macro_Nramp,prints_Nat-R-assoc-macro_Nramp,tigrfam_Nat-R-assoc-macro_Nramp	p.N337K	ENST00000233202.6	37	c.1011	CCDS2415.1	2	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184593	0.57909	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.23348	2.22;1.91	4.46	3.58	0.41010	.	0.430030	0.25765	N	0.028460	T	0.39253	0.1071	M	0.85777	2.775	0.49582	D	0.999809	B;B;B	0.21905	0.041;0.062;0.029	B;B;B	0.35899	0.099;0.141;0.213	T	0.49466	-0.8937	10	0.87932	D	0	-10.5284	11.6225	0.51126	0.0:0.9121:0.0:0.0879	.	337;219;337	B4DQ73;C0H5Y3;P49279	.;.;NRAM1_HUMAN	K	337;219	ENSP00000233202:N337K;ENSP00000443435:N219K	ENSP00000233202:N337K	N	+	3	2	SLC11A1	218964221	1.000000	0.71417	0.989000	0.46669	0.689000	0.40095	2.123000	0.41996	2.487000	0.83934	0.555000	0.69702	AAC	SLC11A1	-	pfam_Nat-R-assoc-macro_Nramp,tigrfam_Nat-R-assoc-macro_Nramp	ENSG00000018280		0.637	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC11A1	HGNC	protein_coding	OTTHUMT00000195076.2	33	0.00	0	C	NM_000578		219255977	219255977	+1	no_errors	ENST00000233202	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	A
SLC4A3	6508	genome.wustl.edu	37	2	220494110	220494111	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:220494110_220494111insC	ENST00000358055.3	+	4	974_975	c.462_463insC	c.(463-465)cccfs	p.P155fs	SLC4A3_ENST00000317151.3_Frame_Shift_Ins_p.P155fs|SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000373762.3_Frame_Shift_Ins_p.P155fs|AC009955.8_ENST00000455896.1_RNA|SLC4A3_ENST00000273063.6_Frame_Shift_Ins_p.P155fs|SLC4A3_ENST00000373760.2_Frame_Shift_Ins_p.P155fs			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	155	Pro-rich.				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACCTGTGGAGCCCCCCCACTC	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.469dupC	2.37:g.220494117_220494117dupC	ENSP00000350756:p.Pro155fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Frame_Shift_Ins	INS	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.H156fs	ENST00000358055.3	37	c.462_463	CCDS2445.1	2																																																																																			SLC4A3	-	prints_Anion_exchange_3	ENSG00000114923		0.629	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	HGNC	protein_coding	OTTHUMT00000316472.1	61	0.00	0	-	NM_005070		220494110	220494111	+1	no_errors	ENST00000273063	ensembl	human	known	69_37n	frame_shift_ins	48	15.79	9	INS	0.015:0.049	C
SLIT2	9353	genome.wustl.edu	37	4	20525795	20525795	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr4:20525795delG	ENST00000504154.1	+	14	1685	c.1433delG	c.(1432-1434)tgtfs	p.C478fs	SLIT2_ENST00000503837.1_Frame_Shift_Del_p.C482fs|SLIT2_ENST00000503823.1_Frame_Shift_Del_p.C478fs|SLIT2_ENST00000273739.5_Frame_Shift_Del_p.C482fs	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	478	LRRCT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.C478fs*19(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AAATTCCGTTGTTCAGGTAAT	0.483																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											82.0	94.0	90.0					4																	20525795		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1433delG	4.37:g.20525795delG	ENSP00000422591:p.Cys478fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Frame_Shift_Del	DEL	pfam_EGF-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.C478fs	ENST00000504154.1	37	c.1433	CCDS3426.1	4																																																																																			SLIT2	-	pfam_Cys-rich_flank_reg_C,smart_Cys-rich_flank_reg_C	ENSG00000145147		0.483	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	193	0.00	0	G			20525795	20525795	+1	no_errors	ENST00000504154	ensembl	human	known	69_37n	frame_shift_del	89	29.10	39	DEL	1.000	-
SMTN	6525	genome.wustl.edu	37	22	31484057	31484057	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr22:31484057G>A	ENST00000347557.2	+	3	376	c.158G>A	c.(157-159)cGt>cAt	p.R53H	SMTN_ENST00000358743.1_Missense_Mutation_p.R53H|SMTN_ENST00000333137.7_Missense_Mutation_p.R53H|SMTN_ENST00000475548.1_3'UTR	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	53					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.R53H(3)|p.R45H(2)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						GCATCCAAGCGTTTCCGTGCC	0.657																																						dbGAP											5	Substitution - Missense(5)	breast(3)|ovary(2)											31.0	33.0	32.0					22																	31484057		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.158G>A	22.37:g.31484057G>A	ENSP00000328635:p.Arg53His	Somatic		WXS	Illumina GAIIx	Phase_IV	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	pfam_Smoothelin,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R53H	ENST00000347557.2	37	c.158	CCDS13886.1	22	.	.	.	.	.	.	.	.	.	.	G	33	5.279869	0.95489	.	.	ENSG00000183963	ENST00000426927;ENST00000440425;ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496;ENST00000431481	T;T;T;T;T	0.79141	0.43;0.4;-0.77;-1.24;-1.24	4.8	4.8	0.61643	.	0.000000	0.36932	N	0.002328	T	0.81269	0.4787	N	0.19112	0.55	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.997;0.997;0.984;0.997;0.997;0.999	D	0.84785	0.0775	10	0.87932	D	0	-13.6578	18.2748	0.90078	0.0:0.0:1.0:0.0	.	109;107;45;53;53;53	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	H	107;107;53;53;53;53;45;45	ENSP00000399432:R107H;ENSP00000401341:R107H;ENSP00000351593:R53H;ENSP00000328635:R53H;ENSP00000329532:R53H	ENSP00000329393:R53H	R	+	2	0	SMTN	29814057	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.421000	0.90259	2.401000	0.81631	0.655000	0.94253	CGT	SMTN	-	NULL	ENSG00000183963		0.657	SMTN-001	KNOWN	basic|CCDS	protein_coding	SMTN	HGNC	protein_coding	OTTHUMT00000321766.1	40	0.00	0	G	NM_134270		31484057	31484057	+1	no_errors	ENST00000347557	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	1.000	A
STX6	10228	genome.wustl.edu	37	1	180957443	180957443	+	Silent	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:180957443G>A	ENST00000258301.5	-	6	765	c.528C>T	c.(526-528)gtC>gtT	p.V176V	STX6_ENST00000469135.1_5'UTR|STX6_ENST00000542060.1_Silent_p.V75V	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	176	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)	p.V176V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						TGCTGCCAGAGACCAGCTCCA	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											129.0	114.0	119.0					1																	180957443		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.528C>T	1.37:g.180957443G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R652|B4DR17|Q5VY08|Q6FH83	Silent	SNP	pfam_Syntaxin-6_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.V176	ENST00000258301.5	37	c.528	CCDS1341.1	1																																																																																			STX6	-	pfam_T_SNARE_dom,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000135823		0.537	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX6	HGNC	protein_coding	OTTHUMT00000085143.1	132	0.00	0	G	NM_005819		180957443	180957443	-1	no_errors	ENST00000258301	ensembl	human	known	69_37n	silent	109	17.42	23	SNP	1.000	A
STXBP5	134957	genome.wustl.edu	37	6	147680336	147680336	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr6:147680336G>A	ENST00000321680.6	+	23	2422	c.2422G>A	c.(2422-2424)Gac>Aac	p.D808N	STXBP5_ENST00000179882.6_Missense_Mutation_p.D463N|STXBP5_ENST00000367480.3_Missense_Mutation_p.D755N|STXBP5_ENST00000367481.3_Missense_Mutation_p.D772N	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	808					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)	p.D808N(1)|p.D772N(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TCGAAAGACGGACTCGTCCCC	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											126.0	116.0	119.0					6																	147680336		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.2422G>A	6.37:g.147680336G>A	ENSP00000321826:p.Asp808Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.D808N	ENST00000321680.6	37	c.2422	CCDS47499.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.13|16.13	3.036542|3.036542	0.54896|0.54896	.|.	.|.	ENSG00000164506|ENSG00000164506	ENST00000367479;ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882;ENST00000392291|ENST00000367475	T;T;T;T;T|.	0.39406|.	1.08;1.08;1.08;1.08;1.08|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.051947|.	0.85682|.	D|.	0.000000|.	T|T	0.66790|0.66790	0.2825|0.2825	L|L	0.60067|0.60067	1.865|1.865	0.80722|0.80722	D|D	1|1	P;D;D|.	0.53745|.	0.925;0.962;0.962|.	P;P;P|.	0.52672|.	0.616;0.706;0.686|.	T|T	0.63677|0.63677	-0.6583|-0.6583	10|5	0.87932|.	D|.	0|.	.|.	19.3349|19.3349	0.94312|0.94312	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	772;808;463|.	Q5T5C0-2;Q5T5C0;B3KXX0|.	.;STXB5_HUMAN;.|.	N|E	147;772;808;755;463;132|133	ENSP00000356451:D772N;ENSP00000321826:D808N;ENSP00000356450:D755N;ENSP00000179882:D463N;ENSP00000376112:D132N|.	ENSP00000179882:D463N|.	D|G	+|+	1|2	0|0	STXBP5|STXBP5	147722029|147722029	1.000000|1.000000	0.71417|0.71417	0.114000|0.114000	0.21550|0.21550	0.023000|0.023000	0.10783|0.10783	7.581000|7.581000	0.82535|0.82535	2.570000|2.570000	0.86706|0.86706	0.655000|0.655000	0.94253|0.94253	GAC|GGA	STXBP5	-	NULL	ENSG00000164506		0.493	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP5	HGNC	protein_coding	OTTHUMT00000042606.1	116	0.00	0	G			147680336	147680336	+1	no_errors	ENST00000321680	ensembl	human	known	69_37n	missense	88	19.27	21	SNP	0.996	A
SYNE4	163183	genome.wustl.edu	37	19	36494306	36494306	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr19:36494306G>C	ENST00000324444.3	-	8	1259	c.1148C>G	c.(1147-1149)tCt>tGt	p.S383C	SYNE4_ENST00000340477.5_Missense_Mutation_p.S270C	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	383	KASH. {ECO:0000255|PROSITE- ProRule:PRU00385}.				establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)		p.S383C(1)									TCGGGCATGAGAGCAGCAGGG	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											45.0	47.0	46.0					19																	36494306		2049	4191	6240	-	-	-	SO:0001583	missense	0			BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.1148C>G	19.37:g.36494306G>C	ENSP00000316130:p.Ser383Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS0|A8MYE3|Q7Z7L3	Missense_Mutation	SNP	pfam_KASH,pfscan_KASH	p.S383C	ENST00000324444.3	37	c.1148	CCDS42553.1	19	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416443	0.42918	.	.	ENSG00000181392	ENST00000503121;ENST00000340477;ENST00000324444	T;T	0.23552	1.9;1.9	6.07	3.93	0.45458	Klarsicht/ANC-1/syne-1 homology (2);	2.008210	0.02540	N	0.094511	T	0.26048	0.0635	L	0.32530	0.975	0.29114	N	0.880671	B;B	0.19073	0.033;0.02	B;B	0.23018	0.043;0.043	T	0.27606	-1.0069	10	0.87932	D	0	-6.9387	8.7261	0.34469	0.0796:0.1504:0.77:0.0	.	270;383	Q8N205-2;Q8N205	.;SYNE4_HUMAN	C	120;270;383	ENSP00000343152:S270C;ENSP00000316130:S383C	ENSP00000316130:S383C	S	-	2	0	C19orf46	41186146	0.993000	0.37304	0.966000	0.40874	0.023000	0.10783	0.598000	0.24074	0.889000	0.36185	-0.137000	0.14449	TCT	SYNE4	-	pfam_KASH,pfscan_KASH	ENSG00000181392		0.557	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE4	HGNC	protein_coding	OTTHUMT00000109525.3	51	0.00	0	G	NM_001039876		36494306	36494306	-1	no_errors	ENST00000324444	ensembl	human	known	69_37n	missense	46	28.12	18	SNP	0.971	C
TBC1D2B	23102	genome.wustl.edu	37	15	78290617	78290617	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr15:78290617T>C	ENST00000300584.3	-	13	2776	c.2777A>G	c.(2776-2778)gAg>gGg	p.E926G	TBC1D2B_ENST00000492078.1_5'UTR|TBC1D2B_ENST00000409931.3_Missense_Mutation_p.R909G|RP11-114H24.6_ENST00000562716.1_RNA	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	926							Rab GTPase activator activity (GO:0005097)	p.R909G(1)|p.E926G(1)		breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						CCGGACTTTCTCCAAGTGGTA	0.622																																						dbGAP											2	Substitution - Missense(2)	breast(2)											38.0	32.0	34.0					15																	78290617		2196	4291	6487	-	-	-	SO:0001583	missense	0			AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2777A>G	15.37:g.78290617T>C	ENSP00000300584:p.Glu926Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Prefoldin,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.E926G	ENST00000300584.3	37	c.2777	CCDS45314.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	24.4|24.4	4.528746|4.528746	0.85706|0.85706	.|.	.|.	ENSG00000167202|ENSG00000167202	ENST00000300584|ENST00000418039;ENST00000409931	T|T	0.11169|0.10573	2.8|2.86	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	.|0.068054	.|0.50627	.|D	.|0.000114	T|T	0.14098|0.14098	0.0341|0.0341	.|.	.|.	.|.	0.41102|0.41102	D|D	0.98567|0.98567	D|P	0.89917|0.46784	1.0|0.884	D|P	0.67382|0.46076	0.951|0.503	T|T	0.03784|0.03784	-1.1004|-1.1004	8|8	0.51188|.	T|.	0.08|.	.|.	12.9679|12.9679	0.58494|0.58494	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	926|909	Q9UPU7|Q9UPU7-2	TBD2B_HUMAN|.	G|G	926|808;909	ENSP00000300584:E926G|ENSP00000387165:R909G	ENSP00000300584:E926G|.	E|R	-|-	2|1	0|2	TBC1D2B|TBC1D2B	76077672|76077672	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.753000|0.753000	0.42808|0.42808	7.945000|7.945000	0.87732|0.87732	1.653000|1.653000	0.50694|0.50694	0.392000|0.392000	0.25879|0.25879	GAG|AGA	TBC1D2B	-	NULL	ENSG00000167202		0.622	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D2B	HGNC	protein_coding	OTTHUMT00000328369.3	23	0.00	0	T	NM_015079		78290617	78290617	-1	no_errors	ENST00000300584	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	C
TBX15	6913	genome.wustl.edu	37	1	119428004	119428004	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:119428004C>T	ENST00000369429.3	-	8	1169	c.1160G>A	c.(1159-1161)cGa>cAa	p.R387Q	TBX15_ENST00000207157.3_Missense_Mutation_p.R281Q			Q96SF7	TBX15_HUMAN	T-box 15	387					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R281Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		CTGGCTTTCTCGGCAGCCCAC	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	43.0	43.0					1																	119428004		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1160G>A	1.37:g.119428004C>T	ENSP00000358437:p.Arg387Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.R387Q	ENST00000369429.3	37	c.1160		1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606966	0.66558	.	.	ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873;ENST00000393149	T;T;T	0.34072	1.38;1.38;1.38	5.14	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.33030	0.0849	L	0.40543	1.245	0.54753	D	0.999989	D;D	0.69078	0.983;0.997	B;D	0.67725	0.363;0.953	T	0.07908	-1.0748	10	0.13470	T	0.59	.	15.0774	0.72087	0.1429:0.8571:0.0:0.0	.	184;387	E9PCG3;Q96SF7	.;TBX15_HUMAN	Q	184;281;387;115;114	ENSP00000207157:R281Q;ENSP00000358437:R387Q;ENSP00000398625:R115Q	ENSP00000207157:R281Q	R	-	2	0	TBX15	119229527	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.003000	0.76310	1.384000	0.46424	0.561000	0.74099	CGA	TBX15	-	NULL	ENSG00000092607		0.522	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	78	0.00	0	C	NM_152380		119428004	119428004	-1	no_errors	ENST00000369429	ensembl	human	known	69_37n	missense	123	23.60	38	SNP	1.000	T
TNFAIP3	7128	genome.wustl.edu	37	6	138201278	138201278	+	Silent	SNP	G	G	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr6:138201278G>T	ENST00000237289.4	+	8	2043	c.1977G>T	c.(1975-1977)ggG>ggT	p.G659G		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	659	Interaction with TNIP1. {ECO:0000250}.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.G659G(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CGTGCCTGGGGAGGGAATGCG	0.498			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	dbGAP		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	26	Whole gene deletion(25)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(25)|breast(1)											96.0	86.0	90.0					6																	138201278		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1977G>T	6.37:g.138201278G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Silent	SNP	pfam_Znf_A20,pfam_OTU,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.G659	ENST00000237289.4	37	c.1977	CCDS5187.1	6	.	.	.	.	.	.	.	.	.	.	G	8.978	0.974518	0.18736	.	.	ENSG00000118503	ENST00000544646	.	.	.	6.08	-7.76	0.01232	.	.	.	.	.	.	.	.	.	.	.	0.50467	D	0.999879	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.4697	14.7782	0.69746	0.0543:0.6696:0.127:0.149	.	.	.	.	X	659	.	ENSP00000442207:E659X	E	+	1	0	TNFAIP3	138242971	0.006000	0.16342	0.153000	0.22517	0.960000	0.62799	-0.767000	0.04720	-1.598000	0.01607	-0.211000	0.12701	GAG	TNFAIP3	-	pfam_Znf_A20,smart_Znf_A20,pfscan_Znf_A20	ENSG00000118503		0.498	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP3	HGNC	protein_coding	OTTHUMT00000042414.1	110	0.00	0	G			138201278	138201278	+1	no_errors	ENST00000237289	ensembl	human	known	69_37n	silent	39	29.09	16	SNP	0.004	T
TTC24	164118	genome.wustl.edu	37	1	156555562	156555562	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:156555562C>T	ENST00000368237.3	+	8	1514	c.1514C>T	c.(1513-1515)aCg>aTg	p.T505M	TTC24_ENST00000368236.3_Missense_Mutation_p.T505M|AL365181.1_ENST00000581084.1_RNA|TTC24_ENST00000478081.1_3'UTR			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	505								p.T505M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGTTGCCCCACGTTTACCAAG	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	127.0	126.0					1																	156555562		2122	4231	6353	-	-	-	SO:0001583	missense	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1514C>T	1.37:g.156555562C>T	ENSP00000357220:p.Thr505Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H7	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T505M	ENST00000368237.3	37	c.1514	CCDS53379.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	7.065|7.065	0.567074|0.567074	0.13560|0.13560	.|.	.|.	ENSG00000187862|ENSG00000187862	ENST00000340086|ENST00000368236;ENST00000368237	.|T;T	.|0.31510	.|1.49;1.49	3.63|3.63	-2.97|-2.97	0.05530|0.05530	.|.	.|4.943640	.|0.00659	.|N	.|0.000599	T|T	0.05044|0.05044	0.0135|0.0135	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.22208|0.22208	-1.0223|-1.0223	5|10	.|0.45353	.|T	.|0.12	.|.	1.5341|1.5341	0.02542|0.02542	0.1388:0.3556:0.2322:0.2733|0.1388:0.3556:0.2322:0.2733	.|.	.|505	.|A2A3L6	.|TTC24_HUMAN	C|M	278|505	.|ENSP00000357219:T505M;ENSP00000357220:T505M	.|ENSP00000357219:T505M	R|T	+|+	1|2	0|0	TTC24|TTC24	154822186|154822186	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.056000|0.056000	0.15407|0.15407	-0.789000|-0.789000	0.04609|0.04609	-0.583000|-0.583000	0.05921|0.05921	-0.598000|-0.598000	0.04106|0.04106	CGT|ACG	TTC24	-	NULL	ENSG00000187862		0.522	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1	69	0.00	0	C	XM_089384		156555562	156555562	+1	no_errors	ENST00000368236	ensembl	human	known	69_37n	missense	126	19.75	31	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179621321	179621321	+	Intron	SNP	G	G	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:179621321G>C	ENST00000591111.1	-	44	10528				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q3628E|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Intron|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q3457E|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGTATCTTGAACAGATGCA	0.413																																						dbGAP											0													110.0	111.0	110.0					2																	179621321		1941	4135	6076	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10303+2389C>G	2.37:g.179621321G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Q3457E	ENST00000591111.1	37	c.10369		2	.	.	.	.	.	.	.	.	.	.	G	9.135	1.012299	0.19277	.	.	ENSG00000155657	ENST00000342175	T	0.56941	0.43	6.17	5.29	0.74685	.	.	.	.	.	T	0.44286	0.1286	.	.	.	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.41395	-0.9511	8	0.87932	D	0	.	10.7285	0.46083	0.0:0.2814:0.5876:0.1311	.	3457	E7ET18	.	E	3457	ENSP00000340554:Q3457E	ENSP00000340554:Q3457E	Q	-	1	0	TTN	179329566	0.011000	0.17503	0.008000	0.14137	0.019000	0.09904	0.995000	0.29706	1.612000	0.50221	0.655000	0.94253	CAA	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	125	0.00	0	G	NM_133378		179621321	179621321	-1	no_errors	ENST00000342175	ensembl	human	known	69_37n	missense	154	10.40	18	SNP	0.001	C
TYW1	55253	genome.wustl.edu	37	7	66474604	66474604	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr7:66474604C>A	ENST00000359626.5	+	4	472	c.308C>A	c.(307-309)tCc>tAc	p.S103Y		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	103	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.S103Y(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				GCAGTTACATCCCTGGATCTG	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											143.0	127.0	132.0					7																	66474604		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.308C>A	7.37:g.66474604C>A	ENSP00000352645:p.Ser103Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	pfam_rSAM,pfam_Flavodoxin/NO_synth,pfam_tRNA_wybutosine-synth,pfscan_Flavodoxin/NO_synth,prints_Flavdoxin	p.S103Y	ENST00000359626.5	37	c.308	CCDS5538.1	7	.	.	.	.	.	.	.	.	.	.	C	10.22	1.289684	0.23478	.	.	ENSG00000198874	ENST00000359626;ENST00000442959	T;T	0.74526	-0.85;-0.85	3.75	2.85	0.33270	Flavodoxin/nitric oxide synthase (2);	0.865201	0.09976	U	0.731594	T	0.73713	0.3622	L	0.49350	1.555	0.09310	N	0.999997	P	0.40107	0.703	P	0.48114	0.567	T	0.63413	-0.6643	10	0.66056	D	0.02	.	5.2989	0.15768	0.0:0.6725:0.2125:0.115	.	103	Q9NV66	TYW1_HUMAN	Y	103	ENSP00000352645:S103Y;ENSP00000398897:S103Y	ENSP00000352645:S103Y	S	+	2	0	TYW1	66112039	0.840000	0.29493	0.141000	0.22245	0.057000	0.15508	2.341000	0.43983	0.905000	0.36596	0.491000	0.48974	TCC	TYW1	-	pfam_Flavodoxin/NO_synth,pfscan_Flavodoxin/NO_synth	ENSG00000198874		0.373	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYW1	HGNC	protein_coding	OTTHUMT00000251932.2	132	0.00	0	C	NM_018264		66474604	66474604	+1	no_errors	ENST00000359626	ensembl	human	known	69_37n	missense	104	38.82	66	SNP	0.237	A
UGT1A3	54659	genome.wustl.edu	37	2	234638186	234638186	+	Silent	SNP	C	C	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:234638186C>T	ENST00000482026.1	+	1	433	c.414C>T	c.(412-414)atC>atT	p.I138I	UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000609767.1_Silent_p.I138I|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	138					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)	p.I138I(1)		breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	AGGCCCTGATCAGGCACCTGA	0.428																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											193.0	199.0	197.0					2																	234638186		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.414C>T	2.37:g.234638186C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B8K287	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.I138	ENST00000482026.1	37	c.414	CCDS2509.1	2																																																																																			UGT1A3	-	pfam_UDP_glucos_trans	ENSG00000243135		0.428	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A3	HGNC	protein_coding	OTTHUMT00000130983.1	304	0.00	0	C	NM_019093		234638186	234638186	+1	no_errors	ENST00000482026	ensembl	human	known	69_37n	silent	201	34.74	107	SNP	0.035	T
USH2A	7399	genome.wustl.edu	37	1	215848874	215848874	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:215848874G>T	ENST00000307340.3	-	63	12765	c.12379C>A	c.(12379-12381)Ctc>Atc	p.L4127I	USH2A_ENST00000366943.2_Missense_Mutation_p.L4127I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4127	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.L4127I(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTGTGTAGAGAGTGAAAGGA	0.552										HNSCC(13;0.011)																												dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	55.0	55.0					1																	215848874		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12379C>A	1.37:g.215848874G>T	ENSP00000305941:p.Leu4127Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L4127I	ENST00000307340.3	37	c.12379	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.742533	0.30865	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54479	0.57;0.57	5.25	-5.61	0.02489	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.823967	0.10115	N	0.714106	T	0.46132	0.1377	M	0.61703	1.905	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.38373	-0.9664	10	0.37606	T	0.19	.	13.3487	0.60589	0.0572:0.64:0.2091:0.0937	.	4127	O75445	USH2A_HUMAN	I	4127	ENSP00000305941:L4127I;ENSP00000355910:L4127I	ENSP00000305941:L4127I	L	-	1	0	USH2A	213915497	0.000000	0.05858	0.001000	0.08648	0.936000	0.57629	-0.038000	0.12144	-1.111000	0.02988	-0.172000	0.13284	CTC	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.552	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	215	0.46	1	G	NM_007123		215848874	215848874	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	369	12.77	54	SNP	0.000	T
VWF	7450	genome.wustl.edu	37	12	6125930	6125930	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr12:6125930T>A	ENST00000261405.5	-	29	5414	c.5160A>T	c.(5158-5160)aaA>aaT	p.K1720N		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1720	VWFA 3; main binding site for collagens type I and III. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.K1720N(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CTATATTGGCTTTTGAAATGA	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	81.0	78.0					12																	6125930		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5160A>T	12.37:g.6125930T>A	ENSP00000261405:p.Lys1720Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.K1720N	ENST00000261405.5	37	c.5160	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	.	16.10	3.026511	0.54683	.	.	ENSG00000110799	ENST00000261405	T	0.78924	-1.22	4.31	-0.714	0.11219	von Willebrand factor, type A (3);	0.143577	0.31976	N	0.006762	T	0.69006	0.3063	L	0.55017	1.72	0.80722	D	1	B	0.31413	0.322	B	0.36808	0.233	T	0.60525	-0.7246	10	0.59425	D	0.04	.	4.955	0.14035	0.1413:0.389:0.0:0.4696	.	1720	P04275	VWF_HUMAN	N	1720	ENSP00000261405:K1720N	ENSP00000261405:K1720N	K	-	3	2	VWF	5996191	0.162000	0.22906	0.909000	0.35828	0.954000	0.61252	-0.324000	0.07986	-0.020000	0.14032	0.454000	0.30748	AAA	VWF	-	pirsf_VWF,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000110799		0.478	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	149	0.00	0	T	NM_000552		6125930	6125930	-1	no_errors	ENST00000261405	ensembl	human	known	69_37n	missense	86	14.85	15	SNP	0.061	A
XIRP2	129446	genome.wustl.edu	37	2	168106882	168106882	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr2:168106882G>A	ENST00000409195.1	+	9	9069	c.8980G>A	c.(8980-8982)Gaa>Aaa	p.E2994K	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.E2772K|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.E2994K|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2819					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.E2994K(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGATAAGAGAGAATATGCAGT	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	84.0	84.0					2																	168106882		1832	4086	5918	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8980G>A	2.37:g.168106882G>A	ENSP00000386840:p.Glu2994Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.E2994K	ENST00000409195.1	37	c.8980	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	5.174	0.217717	0.09810	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02498	4.27;4.27;4.27	5.36	-1.1	0.09872	.	0.687236	0.14656	N	0.306250	T	0.02193	0.0068	L	0.42245	1.32	0.20638	N	0.999879	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.14578	0.005;0.011;0.011	T	0.46470	-0.9189	10	0.23891	T	0.37	0.0661	1.1243	0.01732	0.2879:0.2416:0.3344:0.136	.	2819;2819;2772	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	K	2994;2994;2772;408	ENSP00000386840:E2994K;ENSP00000295237:E2994K;ENSP00000387255:E2772K	ENSP00000295237:E2994K	E	+	1	0	XIRP2	167815128	0.001000	0.12720	0.032000	0.17829	0.471000	0.32888	-0.187000	0.09656	-0.418000	0.07450	0.563000	0.77884	GAA	XIRP2	-	NULL	ENSG00000163092		0.338	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	78	0.00	0	G	NM_152381		168106882	168106882	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	58	23.68	18	SNP	0.142	A
ZC3H12A	80149	genome.wustl.edu	37	1	37948444	37948445	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:37948444_37948445insC	ENST00000373087.6	+	6	1148_1149	c.1032_1033insC	c.(1033-1035)cccfs	p.P345fs		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTCTCCTCTCACCCCCCAGAGC	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1038dupC	1.37:g.37948450_37948450dupC	ENSP00000362179:p.Pro345fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_RNase_Zc3h12	p.R346fs	ENST00000373087.6	37	c.1032_1033	CCDS417.1	1																																																																																			ZC3H12A	-	NULL	ENSG00000163874		0.599	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12A	HGNC	protein_coding	OTTHUMT00000012154.2	26	0.00	0	-	NM_025079		37948444	37948445	+1	no_errors	ENST00000373082	ensembl	human	known	69_37n	frame_shift_ins	13	13.33	2	INS	0.255:0.982	C
ZMYM4	9202	genome.wustl.edu	37	1	35851767	35851767	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A0J4-01A-11W-A050-09	TCGA-AO-A0J4-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7667f49c-449d-44ce-bab8-02a491bb6775	211ddcb7-5fea-46cf-86f5-dc6d5f4cae36	g.chr1:35851767T>G	ENST00000314607.6	+	11	1893	c.1813T>G	c.(1813-1815)Tac>Gac	p.Y605D	ZMYM4_ENST00000373297.2_Intron	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	605					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Y605D(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTTCTGCAGCTACAGCTGTGT	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	145.0	150.0					1																	35851767		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1813T>G	1.37:g.35851767T>G	ENSP00000322915:p.Tyr605Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH	p.Y605D	ENST00000314607.6	37	c.1813	CCDS389.1	1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.058321	0.76074	.	.	ENSG00000146463	ENST00000314607	T	0.26957	1.7	5.92	5.92	0.95590	TRASH (1);	0.270150	0.37857	N	0.001907	T	0.43322	0.1242	L	0.57536	1.79	0.80722	D	1	D	0.63046	0.992	P	0.58520	0.84	T	0.14090	-1.0485	10	0.36615	T	0.2	-8.9698	16.347	0.83138	0.0:0.0:0.0:1.0	.	605	Q5VZL5	ZMYM4_HUMAN	D	605	ENSP00000322915:Y605D	ENSP00000322915:Y605D	Y	+	1	0	ZMYM4	35624354	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.825000	0.62708	2.261000	0.74972	0.443000	0.29094	TAC	ZMYM4	-	smart_TRASH	ENSG00000146463		0.448	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3	104	0.00	0	T	NM_005095		35851767	35851767	+1	no_errors	ENST00000314607	ensembl	human	known	69_37n	missense	62	30.34	27	SNP	1.000	G
