#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AEBP1	165	genome.wustl.edu	37	7	44150599	44150599	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr7:44150599C>A	ENST00000223357.3	+	13	1878	c.1573C>A	c.(1573-1575)Ctc>Atc	p.L525I	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.L68I	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	525	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for DNA-binding and interaction with NFKBIA. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CATCTACCCACTCACCTGGAA	0.637																																						dbGAP											0													80.0	78.0	78.0					7																	44150599		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1573C>A	7.37:g.44150599C>A	ENSP00000223357:p.Leu525Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.L525I	ENST00000223357.3	37	c.1573	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624794	0.87560	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	D;D	0.97430	-4.38;-4.38	5.64	4.76	0.60689	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.078632	0.53938	D	0.000046	D	0.96377	0.8818	N	0.26042	0.785	0.29466	N	0.857378	D;D	0.62365	0.991;0.982	P;P	0.62089	0.805;0.898	D	0.93502	0.6845	10	0.46703	T	0.11	-50.5781	14.1078	0.65101	0.0:0.9267:0.0:0.0733	.	68;525	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	I	525;68	ENSP00000223357:L525I;ENSP00000398878:L68I	ENSP00000223357:L525I	L	+	1	0	AEBP1	44117124	0.997000	0.39634	0.985000	0.45067	0.995000	0.86356	3.625000	0.54238	1.387000	0.46486	0.650000	0.86243	CTC	AEBP1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000106624		0.637	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	28	0.00	0	C	NM_001129		44150599	44150599	+1	no_errors	ENST00000223357	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	0.997	A
ANKRD20A2	441430	genome.wustl.edu	37	9	42410305	42410306	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr9:42410305_42410306delAA	ENST00000377601.2	+	15	2406_2407	c.2294_2295delAA	c.(2293-2295)caafs	p.Q765fs	RP11-146D12.2_ENST00000421686.2_5'Flank|RP11-146D12.2_ENST00000590154.1_3'UTR	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2	765										large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						ACTAATATCCAAAGAGGCTTTA	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.2294_2295delAA	9.37:g.42410305_42410306delAA	ENSP00000366826:p.Gln765fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G767fs	ENST00000377601.2	37	c.2294_2295	CCDS35028.1	9																																																																																			ANKRD20A2	-	NULL	ENSG00000183148		0.376	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A2	HGNC	protein_coding	OTTHUMT00000129794.1	18	0.00	0	AA	NM_001012421		42410305	42410306	+1	no_errors	ENST00000377601	ensembl	human	known	69_37n	frame_shift_del	6	64.71	11	DEL	0.440:0.416	-
AP1G2	8906	genome.wustl.edu	37	14	24035107	24035107	+	Intron	SNP	G	G	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr14:24035107G>T	ENST00000308724.5	-	5	1324				AP1G2_ENST00000397120.3_Intron|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_Intron	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		GATGCCTGGGGTCAGCGTCGG	0.627																																						dbGAP											0													32.0	27.0	29.0					14																	24035107		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.569-6C>A	14.37:g.24035107G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS51|O75504	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.T43N	ENST00000308724.5	37	c.128	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626788	0.46840	.	.	ENSG00000213983	ENST00000535852	.	.	.	5.72	3.73	0.42828	.	.	.	.	.	T	0.23133	0.0559	.	.	.	0.20873	N	0.999838	P	0.38250	0.624	B	0.37346	0.247	T	0.04708	-1.0932	6	.	.	.	.	5.8318	0.18584	0.0969:0.0:0.6989:0.2041	.	43	Q86V28	.	N	43	.	.	T	-	2	0	AP1G2	23104947	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.751000	0.47508	2.698000	0.92095	0.561000	0.74099	ACC	AP1G2	-	pfam_Clathrin/coatomer_adapt-like_N,pirsf_AP1_complex_gsu	ENSG00000213983		0.627	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	HGNC	protein_coding	OTTHUMT00000071812.4	60	0.00	0	G	NM_003917		24035107	24035107	-1	no_errors	ENST00000535852	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	T
ATAD2	29028	genome.wustl.edu	37	8	124351573	124351573	+	Silent	SNP	A	A	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr8:124351573A>C	ENST00000287394.5	-	20	2939	c.2832T>G	c.(2830-2832)ccT>ccG	p.P944P	ATAD2_ENST00000521903.1_Silent_p.P262P	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	944					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TTGATATAGGAGGCTTAGCAG	0.289																																						dbGAP											0													49.0	48.0	48.0					8																	124351573		2196	4295	6491	-	-	-	SO:0001819	synonymous_variant	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.2832T>G	8.37:g.124351573A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.P944	ENST00000287394.5	37	c.2832	CCDS6343.1	8																																																																																			ATAD2	-	NULL	ENSG00000156802		0.289	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	61	0.00	0	A	NM_014109		124351573	124351573	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	silent	70	20.45	18	SNP	1.000	C
C16orf70	80262	genome.wustl.edu	37	16	67183643	67183643	+	IGR	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr16:67183643G>A	ENST00000219139.3	+	0	2865				B3GNT9_ENST00000449549.3_Missense_Mutation_p.A249V	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70											cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		CAGGTCTTGCGCCGGGTCCCG	0.632																																						dbGAP											0													21.0	23.0	22.0					16																	67183643		1973	4135	6108	-	-	-	SO:0001628	intergenic_variant	0			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510		16.37:g.67183643G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HA86	Missense_Mutation	SNP	pfam_Glyco_trans_31,pfam_Fringe-like	p.A249V	ENST00000219139.3	37	c.746	CCDS10828.1	16	.	.	.	.	.	.	.	.	.	.	g	7.539	0.660335	0.14645	.	.	ENSG00000237172	ENST00000449549	T	0.43294	0.95	5.02	-0.846	0.10734	.	.	.	.	.	T	0.28499	0.0705	L	0.41632	1.29	0.09310	N	1	P	0.37398	0.593	B	0.32805	0.153	T	0.10706	-1.0618	9	0.25751	T	0.34	-20.0683	10.004	0.41946	0.0:0.3861:0.3717:0.2422	.	249	Q6UX72	B3GN9_HUMAN	V	249	ENSP00000400157:A249V	ENSP00000400157:A249V	A	-	2	0	B3GNT9	65741144	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.038000	0.12144	-0.409000	0.07553	-0.319000	0.08680	GCG	B3GNT9	-	pfam_Glyco_trans_31,pfam_Fringe-like	ENSG00000237172		0.632	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT9	HGNC	protein_coding	OTTHUMT00000268829.2	29	0.00	0	G	NM_025187		67183643	67183643	-1	no_errors	ENST00000449549	ensembl	human	known	69_37n	missense	4	66.67	8	SNP	0.000	A
BTN3A3	10384	genome.wustl.edu	37	6	26443819	26443819	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:26443819C>A	ENST00000244519.2	+	3	260	c.17C>A	c.(16-18)tCc>tAc	p.S6Y	BTN3A3_ENST00000339789.4_Intron|BTN3A3_ENST00000361232.3_Intron	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	6					T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						ATGGCAAGTTCCCTGGCTTTC	0.463																																						dbGAP											0													200.0	163.0	176.0					6																	26443819		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.17C>A	6.37:g.26443819C>A	ENSP00000244519:p.Ser6Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.S6Y	ENST00000244519.2	37	c.17	CCDS4611.1	6	.	.	.	.	.	.	.	.	.	.	C	6.942	0.543681	0.13250	.	.	ENSG00000111801	ENST00000494393;ENST00000482451;ENST00000244519;ENST00000496719	T;T;T;T	0.36699	3.27;2.94;1.24;3.88	1.88	-0.281	0.12882	.	.	.	.	.	T	0.12944	0.0314	M	0.68952	2.095	0.09310	N	1	P	0.41947	0.766	B	0.37198	0.243	T	0.12863	-1.0531	9	0.42905	T	0.14	.	2.5415	0.04727	0.0:0.4488:0.3288:0.2224	.	6	O00478	BT3A3_HUMAN	Y	6	ENSP00000417234:S6Y;ENSP00000419312:S6Y;ENSP00000244519:S6Y;ENSP00000420147:S6Y	ENSP00000244519:S6Y	S	+	2	0	BTN3A3	26551798	0.000000	0.05858	0.003000	0.11579	0.201000	0.24016	-0.300000	0.08243	0.061000	0.16311	0.305000	0.20034	TCC	BTN3A3	-	NULL	ENSG00000111801		0.463	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	HGNC	protein_coding	OTTHUMT00000040116.2	93	0.00	0	C	NM_006994		26443819	26443819	+1	no_errors	ENST00000244519	ensembl	human	known	69_37n	missense	67	33.66	34	SNP	0.002	A
SLX4IP	128710	genome.wustl.edu	37	20	10603752	10603753	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr20:10603752_10603753insC	ENST00000334534.5	+	8	1132_1133	c.952_953insC	c.(952-954)ttafs	p.L318fs		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	318																	AAGTGATCGATTAGTCCCGAGA	0.47																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	Exception_encountered	20.37:g.10603752_10603753insC	ENSP00000335557:p.Leu318fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05CG2|Q05CT9	Frame_Shift_Ins	INS	NULL	p.L318fs	ENST00000334534.5	37	c.952_953	CCDS33439.1	20																																																																																			C20orf94	-	NULL	ENSG00000149346		0.470	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf94	HGNC	protein_coding	OTTHUMT00000078000.3	177	0.00	0	-	NM_001009608		10603752	10603753	+1	no_errors	ENST00000334534	ensembl	human	known	69_37n	frame_shift_ins	168	34.88	90	INS	0.998:0.999	C
C2orf16	84226	genome.wustl.edu	37	2	27803116	27803116	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:27803116C>A	ENST00000408964.2	+	1	3728	c.3677C>A	c.(3676-3678)gCt>gAt	p.A1226D	AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000413371.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000556601.1_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1226						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					CAGTCCCCTGCTCCTGTACAA	0.458																																						dbGAP											0													115.0	113.0	114.0					2																	27803116		1883	4114	5997	-	-	-	SO:0001583	missense	0			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.3677C>A	2.37:g.27803116C>A	ENSP00000386190:p.Ala1226Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.A1226D	ENST00000408964.2	37	c.3677	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964280	0.34659	.	.	ENSG00000221843	ENST00000408964	T	0.13307	2.6	5.19	3.13	0.36017	.	.	.	.	.	T	0.11623	0.0283	L	0.27053	0.805	0.09310	N	1	D	0.54047	0.964	P	0.44359	0.447	T	0.13072	-1.0523	9	0.87932	D	0	.	8.8838	0.35392	0.1757:0.6733:0.151:0.0	.	1226	Q68DN1	CB016_HUMAN	D	1226	ENSP00000386190:A1226D	ENSP00000386190:A1226D	A	+	2	0	C2orf16	27656620	0.000000	0.05858	0.971000	0.41717	0.163000	0.22366	-0.172000	0.09868	1.151000	0.42436	0.467000	0.42956	GCT	C2orf16	-	NULL	ENSG00000221843		0.458	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	259	0.00	0	C	NM_032266		27803116	27803116	+1	no_errors	ENST00000408964	ensembl	human	known	69_37n	missense	168	35.63	93	SNP	0.156	A
C3orf30	152405	genome.wustl.edu	37	3	118865046	118865046	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr3:118865046delC	ENST00000295622.1	+	1	50	c.10delC	c.(10-12)cctfs	p.P5fs	IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	5										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		AATGGAAGAGCCTCCGCAAGA	0.607																																						dbGAP											0													26.0	24.0	25.0					3																	118865046		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.10delC	3.37:g.118865046delC	ENSP00000295622:p.Pro5fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B7	Frame_Shift_Del	DEL	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.P4fs	ENST00000295622.1	37	c.10	CCDS2984.1	3																																																																																			C3orf30	-	NULL	ENSG00000163424		0.607	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	29	0.00	0	C	NM_152539		118865046	118865046	+1	no_errors	ENST00000295622	ensembl	human	known	69_37n	frame_shift_del	21	25.00	7	DEL	0.001	-
ERMARD	55780	genome.wustl.edu	37	6	170155510	170155510	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:170155510T>G	ENST00000366773.3	+	3	340	c.307T>G	c.(307-309)Ttt>Gtt	p.F103V	ERMARD_ENST00000366772.2_Missense_Mutation_p.F103V|ERMARD_ENST00000588451.1_5'UTR|ERMARD_ENST00000392095.4_5'UTR|ERMARD_ENST00000418781.3_Missense_Mutation_p.F103V	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	103					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GTGGACAAGTTTTCCAGAGGT	0.443																																						dbGAP											0													114.0	104.0	107.0					6																	170155510		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.307T>G	6.37:g.170155510T>G	ENSP00000355735:p.Phe103Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	NULL	p.F103V	ENST00000366773.3	37	c.307	CCDS34576.1	6	.	.	.	.	.	.	.	.	.	.	T	6.164	0.398428	0.11696	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781	T	0.42513	0.97	5.86	3.37	0.38596	.	0.900346	0.09633	N	0.776057	T	0.09818	0.0241	N	0.22421	0.69	0.19300	N	0.999977	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.001	T	0.37430	-0.9706	10	0.17832	T	0.49	.	6.6296	0.22849	0.2695:0.0:0.1404:0.59	.	103;103	Q5T6L9-2;Q5T6L9	.;CF070_HUMAN	V	103	ENSP00000355735:F103V	ENSP00000355734:F103V	F	+	1	0	C6orf70	169897435	0.000000	0.05858	0.009000	0.14445	0.390000	0.30446	0.100000	0.15231	0.426000	0.26116	0.455000	0.32223	TTT	C6orf70	-	NULL	ENSG00000130023		0.443	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf70	HGNC	protein_coding	OTTHUMT00000043238.2	97	0.00	0	T	NM_018341		170155510	170155510	+1	no_errors	ENST00000366773	ensembl	human	known	69_37n	missense	74	35.09	40	SNP	0.003	G
CCDC132	55610	genome.wustl.edu	37	7	92952973	92952976	+	Frame_Shift_Del	DEL	ATTC	ATTC	-			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	ATTC	ATTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr7:92952973_92952976delATTC	ENST00000305866.5	+	21	2034_2037	c.1906_1909delATTC	c.(1906-1911)attcatfs	p.IH636fs	CCDC132_ENST00000544910.1_Frame_Shift_Del_p.IH606fs|CCDC132_ENST00000541136.1_Frame_Shift_Del_p.IH447fs|CCDC132_ENST00000535481.1_Frame_Shift_Del_p.IH356fs	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	636						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTTGATGTTATTCATTTCATGTC	0.279																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1906_1909delATTC	7.37:g.92952973_92952976delATTC	ENSP00000307666:p.Ile636fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Frame_Shift_Del	DEL	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.H637fs	ENST00000305866.5	37	c.1906_1909	CCDS43617.1	7																																																																																			CCDC132	-	NULL	ENSG00000004766		0.279	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1	51	0.00	0	ATTC	NM_017667		92952973	92952976	+1	no_errors	ENST00000305866	ensembl	human	known	69_37n	frame_shift_del	88	11.11	11	DEL	1.000:1.000:1.000:1.000	-
CDH19	28513	genome.wustl.edu	37	18	64239322	64239322	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr18:64239322T>G	ENST00000540086.1	-	2	366	c.120A>C	c.(118-120)agA>agC	p.R40S	CDH19_ENST00000262150.2_Missense_Mutation_p.R40S	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CACGCTTCACTCTCAAATGAG	0.418																																						dbGAP											0													105.0	98.0	100.0					18																	64239322		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.120A>C	18.37:g.64239322T>G	ENSP00000439593:p.Arg40Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O15098	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R40S	ENST00000540086.1	37	c.120	CCDS59325.1	18	.	.	.	.	.	.	.	.	.	.	T	11.26	1.586268	0.28268	.	.	ENSG00000071991	ENST00000262150;ENST00000540086	T;T	0.00584	6.4;6.4	5.7	3.36	0.38483	.	0.000000	0.85682	D	0.000000	T	0.02380	0.0073	M	0.83603	2.65	0.36399	D	0.862987	D;D	0.89917	0.981;1.0	P;D	0.85130	0.59;0.997	T	0.41342	-0.9514	10	0.87932	D	0	.	7.3442	0.26654	0.0:0.2352:0.0:0.7648	.	40;40	F5H1K0;Q9H159	.;CAD19_HUMAN	S	40	ENSP00000262150:R40S;ENSP00000439593:R40S	ENSP00000262150:R40S	R	-	3	2	CDH19	62390302	0.460000	0.25776	0.970000	0.41538	0.810000	0.45777	0.611000	0.24268	0.990000	0.38787	0.460000	0.39030	AGA	CDH19	-	NULL	ENSG00000071991		0.418	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000442285.1	77	0.00	0	T	NM_021153		64239322	64239322	-1	no_errors	ENST00000262150	ensembl	human	known	69_37n	missense	45	65.12	84	SNP	0.442	G
CEP68	23177	genome.wustl.edu	37	2	65299282	65299282	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:65299282C>T	ENST00000377990.2	+	3	1255	c.1052C>T	c.(1051-1053)aCt>aTt	p.T351I	CEP68_ENST00000537589.1_5'UTR|CEP68_ENST00000546106.1_Missense_Mutation_p.T351I|CEP68_ENST00000497039.1_3'UTR|RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000260569.4_Missense_Mutation_p.T351I	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	351					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						AAATCACCTACTAATGTCTCC	0.592																																						dbGAP											0													115.0	122.0	120.0					2																	65299282		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1052C>T	2.37:g.65299282C>T	ENSP00000367229:p.Thr351Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	NULL	p.T351I	ENST00000377990.2	37	c.1052	CCDS1880.2	2	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383616	0.42207	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000260569;ENST00000545501	T;T;T	0.14893	2.47;2.47;2.47	5.66	2.63	0.31362	.	0.431115	0.24152	N	0.041061	T	0.16854	0.0405	M	0.63428	1.95	0.51767	D	0.999936	P;P;B;B;P	0.40332	0.713;0.713;0.043;0.379;0.713	B;B;B;B;B	0.36845	0.234;0.234;0.026;0.155;0.234	T	0.04915	-1.0918	10	0.72032	D	0.01	-3.6001	8.9402	0.35725	0.0:0.675:0.2463:0.0786	.	339;351;351;351;351	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	I	351;351;351;339	ENSP00000367229:T351I;ENSP00000438306:T351I;ENSP00000260569:T351I	ENSP00000260569:T351I	T	+	2	0	CEP68	65152786	0.081000	0.21417	1.000000	0.80357	0.952000	0.60782	0.939000	0.28978	1.396000	0.46663	0.491000	0.48974	ACT	CEP68	-	NULL	ENSG00000011523		0.592	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP68	HGNC	protein_coding	OTTHUMT00000251727.2	134	0.00	0	C	NM_015147		65299282	65299282	+1	no_errors	ENST00000377990	ensembl	human	known	69_37n	missense	58	59.03	85	SNP	0.821	T
COL4A1	1282	genome.wustl.edu	37	13	110859238	110859238	+	Splice_Site	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr13:110859238C>T	ENST00000375820.4	-	14	902	c.781G>A	c.(781-783)Ggc>Agc	p.G261S	COL4A1_ENST00000543140.1_Splice_Site_p.G261S	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	261	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCTTTTTGGCCCTGAAAGAAT	0.353																																						dbGAP											0													59.0	60.0	60.0					13																	110859238		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.781-1G>A	13.37:g.110859238C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G261S	ENST00000375820.4	37	c.781	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	12.42	1.933957	0.34096	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.99607	-4.72;-6.27	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.99619	0.9861	H	0.95745	3.715	0.80722	D	1	P;P	0.46142	0.873;0.799	P;B	0.52710	0.707;0.295	D	0.97660	1.0160	10	0.87932	D	0	.	15.4999	0.75691	0.0:1.0:0.0:0.0	.	261;261	F5H5K0;P02462	.;CO4A1_HUMAN	S	250;261;261;261	ENSP00000364979:G261S;ENSP00000443348:G261S	ENSP00000364973:G250S	G	-	1	0	COL4A1	109657239	1.000000	0.71417	0.996000	0.52242	0.248000	0.25809	4.544000	0.60691	2.434000	0.82447	0.573000	0.79308	GGC	COL4A1	-	NULL	ENSG00000187498		0.353	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	181	0.00	0	C		Missense_Mutation	110859238	110859238	-1	no_errors	ENST00000375820	ensembl	human	known	69_37n	missense	240	13.31	37	SNP	1.000	T
COL6A3	1293	genome.wustl.edu	37	2	238283233	238283233	+	Silent	SNP	G	G	A	rs199998363		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:238283233G>A	ENST00000295550.4	-	8	3953	c.3501C>T	c.(3499-3501)atC>atT	p.I1167I	COL6A3_ENST00000346358.4_Silent_p.I967I|COL6A3_ENST00000353578.4_Silent_p.I961I|COL6A3_ENST00000472056.1_Silent_p.I560I|COL6A3_ENST00000392004.3_Silent_p.I961I|COL6A3_ENST00000392003.2_Silent_p.I760I|COL6A3_ENST00000409809.1_Silent_p.I961I|COL6A3_ENST00000347401.3_Silent_p.I966I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1167	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGCGTTCCCGATGCCAATGC	0.612																																						dbGAP											0													101.0	79.0	86.0					2																	238283233		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3501C>T	2.37:g.238283233G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.I1167	ENST00000295550.4	37	c.3501	CCDS33412.1	2																																																																																			COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.612	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	68	0.00	0	G	NM_004369		238283233	238283233	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	silent	8	74.19	23	SNP	0.001	A
CSMD3	114788	genome.wustl.edu	37	8	113702256	113702256	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr8:113702256C>A	ENST00000297405.5	-	14	2240	c.1996G>T	c.(1996-1998)Gat>Tat	p.D666Y	CSMD3_ENST00000343508.3_Missense_Mutation_p.D626Y|CSMD3_ENST00000352409.3_Missense_Mutation_p.D666Y|CSMD3_ENST00000455883.2_Missense_Mutation_p.D562Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	666	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D666N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTACCAGGATCACCACAACTT	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											1	Substitution - Missense(1)	large_intestine(1)											131.0	140.0	137.0					8																	113702256		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1996G>T	8.37:g.113702256C>A	ENSP00000297405:p.Asp666Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.D666Y	ENST00000297405.5	37	c.1996	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200279	0.79015	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.09	5.09	0.68999	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.78381	0.4274	M	0.65498	2.005	0.50313	D	0.999867	D;D;D	0.89917	0.997;1.0;0.999	D;D;D	0.79108	0.956;0.992;0.983	T	0.79550	-0.1757	10	0.56958	D	0.05	.	18.8569	0.92255	0.0:1.0:0.0:0.0	.	562;666;626	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Y	626;666;6;562;666	ENSP00000345799:D626Y;ENSP00000297405:D666Y;ENSP00000341558:D6Y;ENSP00000412263:D562Y;ENSP00000343124:D666Y	ENSP00000297405:D666Y	D	-	1	0	CSMD3	113771432	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.525000	0.85131	0.585000	0.79938	GAT	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	229	0.00	0	C	NM_052900		113702256	113702256	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	314	23.23	95	SNP	1.000	A
CUEDC1	404093	genome.wustl.edu	37	17	55962645	55962645	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr17:55962645C>A	ENST00000577830.1	-	2	694	c.281G>T	c.(280-282)aGc>aTc	p.S94I	CUEDC1_ENST00000407144.2_Missense_Mutation_p.S94I|CUEDC1_ENST00000577840.1_Intron|CUEDC1_ENST00000360238.2_Missense_Mutation_p.S94I	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	94										endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						GCCGCCGCTGCTGCCACCGCC	0.647																																						dbGAP											0													39.0	42.0	41.0					17																	55962645		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.281G>T	17.37:g.55962645C>A	ENSP00000462717:p.Ser94Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTZ2|Q9NWD0	Missense_Mutation	SNP	pfam_CUE,superfamily_UBA-like,smart_CUE,pfscan_CUE	p.S94I	ENST00000577830.1	37	c.281	CCDS11599.1	17	.	.	.	.	.	.	.	.	.	.	C	2.460	-0.324314	0.05350	.	.	ENSG00000180891	ENST00000407144;ENST00000360238	T;T	0.24908	1.83;1.83	2.47	-0.153	0.13403	.	0.429687	0.17313	N	0.178800	T	0.10809	0.0264	N	0.08118	0	0.19575	N	0.999963	B	0.02656	0.0	B	0.01281	0.0	T	0.23833	-1.0177	10	0.33940	T	0.23	.	7.0811	0.25231	0.5869:0.4131:0.0:0.0	.	94	Q9NWM3	CUED1_HUMAN	I	94	ENSP00000384712:S94I;ENSP00000353373:S94I	ENSP00000353373:S94I	S	-	2	0	CUEDC1	53317644	0.878000	0.30173	0.045000	0.18777	0.027000	0.11550	2.635000	0.46537	-0.010000	0.14271	0.462000	0.41574	AGC	CUEDC1	-	NULL	ENSG00000180891		0.647	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUEDC1	HGNC	protein_coding	OTTHUMT00000443305.1	16	0.00	0	C	NM_017949		55962645	55962645	-1	no_errors	ENST00000360238	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	0.312	A
DBR1	51163	genome.wustl.edu	37	3	137890542	137890542	+	Silent	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr3:137890542C>A	ENST00000260803.4	-	3	489	c.336G>T	c.(334-336)gtG>gtT	p.V112V	DBR1_ENST00000463982.2_5'UTR|DBR1_ENST00000505015.2_5'UTR	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	112					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						GGTATTTTACCACACCAGCCA	0.338																																						dbGAP											0													79.0	80.0	79.0					3																	137890542		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.336G>T	3.37:g.137890542C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GH0|Q9NXQ6	Silent	SNP	pfam_DBR1_C,pfam_Metallo_PEstase_dom	p.V112	ENST00000260803.4	37	c.336	CCDS33863.1	3																																																																																			DBR1	-	pfam_Metallo_PEstase_dom	ENSG00000138231		0.338	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBR1	HGNC	protein_coding	OTTHUMT00000357585.1	103	0.00	0	C			137890542	137890542	-1	no_errors	ENST00000260803	ensembl	human	known	69_37n	silent	77	34.19	40	SNP	0.795	A
DDX11L1	100287102	genome.wustl.edu	37	1	13494	13494	+	RNA	SNP	A	A	G	rs574697788	byFrequency	TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:13494A>G	ENST00000456328.2	+	0	742					NR_046018.2|NR_051986.1				DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11 like 1																		CAGCTGCACCACTGCCTGGCG	0.577													a|||	7	0.00139776	0.0	0.0029	5008	,	,		51763	0.0		0.003	False		,,,				2504	0.002					dbGAP											0																																										-	-	-			0			AM992871		1p36.33	2012-02-23	2012-02-23		ENSG00000223972	ENSG00000223972			37102	pseudogene	pseudogene			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 like 1"""			19476624	Standard	NR_046018		Approved		uc010nxq.1		OTTHUMG00000000961		1.37:g.13494A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000456328.2	37	NULL		1																																																																																			DDX11L1	-	-	ENSG00000223972		0.577	DDX11L1-002	KNOWN	basic	processed_transcript	DDX11L1	HGNC	pseudogene	OTTHUMT00000362751.1	26	0.00	0	A			13494	13494	+1	no_errors	ENST00000456328	ensembl	human	known	69_37n	rna	35	12.50	5	SNP	0.098	G
DENND1B	163486	genome.wustl.edu	37	1	197481050	197481050	+	IGR	SNP	T	T	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:197481050T>G								CRB1 (33465 upstream) : DENND1B (40334 downstream)																							AAGCAGAAGCTTCTTCACCAT	0.373																																						dbGAP											0													80.0	80.0	80.0					1																	197481050		2203	4299	6502	-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.197481050T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E181D		37	c.543		1	.	.	.	.	.	.	.	.	.	.	T	15.70	2.911759	0.52439	.	.	ENSG00000213047	ENST00000391979;ENST00000542760;ENST00000450419	T	0.36340	1.26	5.7	-0.744	0.11101	.	0.448691	0.19228	U	0.119497	T	0.34279	0.0892	M	0.66506	2.035	0.80722	D	1	B	0.23442	0.085	B	0.28305	0.088	T	0.11203	-1.0597	10	0.39692	T	0.17	.	10.1642	0.42871	0.0:0.3275:0.0:0.6725	.	541	Q6P3S1-5	.	D	181;541;521	ENSP00000375839:E181D	ENSP00000375839:E181D	E	-	3	2	DENND1B	195747673	0.525000	0.26290	0.301000	0.25044	0.865000	0.49528	0.153000	0.16323	-0.388000	0.07797	0.528000	0.53228	GAA	DENND1B	-	NULL	ENSG00000213047	0	0.373					DENND1B	HGNC			107	0.00	0	T			197481050	197481050	-1	no_start_codon	ENST00000391979	ensembl	human	putative	69_37n	missense	136	31.31	62	SNP	0.950	G
DNAJB8	165721	genome.wustl.edu	37	3	128181749	128181749	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr3:128181749A>C	ENST00000469083.1	-	2	2897	c.340T>G	c.(340-342)Ttc>Gtc	p.F114V	DNAJB8_ENST00000319153.3_Missense_Mutation_p.F114V|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	114					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		CTGTCCCAGAACTCAAAGGAG	0.602																																						dbGAP											0													58.0	60.0	59.0					3																	128181749		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.340T>G	3.37:g.128181749A>C	ENSP00000417418:p.Phe114Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWV7	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.F114V	ENST00000469083.1	37	c.340	CCDS3048.1	3	.	.	.	.	.	.	.	.	.	.	A	12.24	1.879441	0.33162	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.79247	-1.25;-1.25	4.59	4.59	0.56863	.	0.107907	0.64402	D	0.000005	T	0.75436	0.3849	M	0.89968	3.075	0.47476	D	0.999432	P	0.43477	0.808	B	0.30572	0.117	T	0.78989	-0.1986	10	0.54805	T	0.06	.	8.0844	0.30762	0.9041:0.0:0.0959:0.0	.	114	Q8NHS0	DNJB8_HUMAN	V	114	ENSP00000417418:F114V;ENSP00000316053:F114V	ENSP00000316053:F114V	F	-	1	0	DNAJB8	129664439	0.998000	0.40836	0.957000	0.39632	0.007000	0.05969	2.863000	0.48396	1.705000	0.51264	0.459000	0.35465	TTC	DNAJB8	-	NULL	ENSG00000179407		0.602	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJB8	HGNC	protein_coding	OTTHUMT00000356933.1	121	0.00	0	A	NM_153330		128181749	128181749	-1	no_errors	ENST00000319153	ensembl	human	known	69_37n	missense	13	71.11	32	SNP	0.899	C
DPH1	1801	genome.wustl.edu	37	17	1939888	1939888	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr17:1939888delA	ENST00000263083.6	+	5	526	c.481delA	c.(481-483)actfs	p.T162fs	DPH1_ENST00000570477.1_Frame_Shift_Del_p.T82fs|DPH1_ENST00000576891.2_3'UTR	NM_001383.3	NP_001374.3	Q9BZG8	DPH1_HUMAN	diphthamide biosynthesis 1	162				T -> I (in Ref. 6; AAH96088). {ECO:0000305}.	cell proliferation (GO:0008283)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	17						CCGGATAGACACTACACACCT	0.592																																						dbGAP											0													116.0	128.0	124.0					17																	1939888		2115	4230	6345	-	-	-	SO:0001589	frameshift_variant	0			S81752	CCDS42228.1	17p13.3	2013-05-02	2013-05-02	2005-06-03	ENSG00000108963	ENSG00000108963			3003	protein-coding gene	gene with protein product	"""ovarian tumor suppressor candidate 1"""	603527	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 1 (S. cerevisiae)"", ""DPH-like 1 (S. cerevisiae)"", ""DPH1 homolog (S. cerevisiae)"""	DPH2L, DPH2L1		8603384, 15485916, 22869748	Standard	NM_001383		Approved	OVCA1	uc002fts.3	Q9BZG8	OTTHUMG00000177724	ENST00000263083.6:c.481delA	17.37:g.1939888delA	ENSP00000263083:p.Thr162fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTI3|Q16439|Q4VBA2|Q9BTW7|Q9UCY0	Frame_Shift_Del	DEL	pfam_DPH1/DPH2,pirsf_eu_DPH1/arc_DPH2,tigrfam_DPH1/DPH2	p.T161fs	ENST00000263083.6	37	c.481	CCDS42228.1	17																																																																																			DPH1	-	pfam_DPH1/DPH2,pirsf_eu_DPH1/arc_DPH2,tigrfam_DPH1/DPH2	ENSG00000108963		0.592	DPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPH1	HGNC	protein_coding	OTTHUMT00000438660.1	38	0.00	0	A	NM_001383		1939888	1939888	+1	no_errors	ENST00000263083	ensembl	human	known	69_37n	frame_shift_del	12	53.57	15	DEL	1.000	-
DST	667	genome.wustl.edu	37	6	56399925	56399925	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:56399925G>A	ENST00000361203.3	-	59	16310	c.16303C>T	c.(16303-16305)Caa>Taa	p.Q5435*	DST_ENST00000446842.2_Nonsense_Mutation_p.Q5111*|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Nonsense_Mutation_p.Q3349*|DST_ENST00000340834.4_5'UTR|DST_ENST00000370769.4_Nonsense_Mutation_p.Q5437*|DST_ENST00000370754.5_Nonsense_Mutation_p.Q5615*|DST_ENST00000370788.2_Nonsense_Mutation_p.Q3349*|DST_ENST00000244364.6_Nonsense_Mutation_p.Q3023*			Q03001	DYST_HUMAN	dystonin	5435					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTACCTTTTGTTCTTGTATC	0.413																																						dbGAP											0													165.0	166.0	166.0					6																	56399925		1861	4113	5974	-	-	-	SO:0001587	stop_gained	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16303C>T	6.37:g.56399925G>A	ENSP00000354508:p.Gln5435*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.Q5615*	ENST00000361203.3	37	c.16843		6	.	.	.	.	.	.	.	.	.	.	G	56	26.378274	0.99968	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	5.91	5.91	0.95273	.	0.000000	0.52532	D	0.000075	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	.	.	.	X	3023;5615;5437;3349;5111;3349;5435	.	ENSP00000244364:Q3023X	Q	-	1	0	DST	56507884	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.823000	0.99369	2.814000	0.96858	0.650000	0.86243	CAA	DST	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000151914		0.413	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	159	0.00	0	G	NM_001723		56399925	56399925	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	nonsense	263	24.21	84	SNP	1.000	A
EPB41L4B	54566	genome.wustl.edu	37	9	111938882	111938882	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr9:111938882G>A	ENST00000374566.3	-	25	3099	c.2582C>T	c.(2581-2583)tCc>tTc	p.S861F		NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	861					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTGCACTGTGGAGACGGTCTC	0.562																																						dbGAP											0													70.0	72.0	71.0					9																	111938882		1965	4155	6120	-	-	-	SO:0001583	missense	0			AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.2582C>T	9.37:g.111938882G>A	ENSP00000363694:p.Ser861Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.S861F	ENST00000374566.3	37	c.2582	CCDS43859.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.52|17.52	3.410787|3.410787	0.62399|0.62399	.|.	.|.	ENSG00000095203|ENSG00000095203	ENST00000262536|ENST00000374566	.|D	.|0.87491	.|-2.26	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	.|0.621363	.|0.13498	.|N	.|0.383456	.|D	.|0.83640	.|0.5298	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|B	.|0.27068	.|0.167	.|B	.|0.24394	.|0.053	.|T	.|0.80462	.|-0.1372	.|10	.|0.72032	.|D	.|0.01	.|.	17.3312|17.3312	0.87264|0.87264	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|861	.|Q9H329	.|E41LB_HUMAN	.|F	-1|861	.|ENSP00000363694:S861F	.|ENSP00000363694:S861F	.|S	-|-	.|2	.|0	EPB41L4B|EPB41L4B	110978703|110978703	0.999000|0.999000	0.42202|0.42202	0.987000|0.987000	0.45799|0.45799	0.988000|0.988000	0.76386|0.76386	6.030000|6.030000	0.70903|0.70903	2.507000|2.507000	0.84556|0.84556	0.655000|0.655000	0.94253|0.94253	.|TCC	EPB41L4B	-	NULL	ENSG00000095203		0.562	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L4B	HGNC	protein_coding	OTTHUMT00000053592.1	53	0.00	0	G	NM_018424		111938882	111938882	-1	no_errors	ENST00000374566	ensembl	human	known	69_37n	missense	73	12.05	10	SNP	0.981	A
FAM135A	57579	genome.wustl.edu	37	6	71186934	71186934	+	Silent	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:71186934C>A	ENST00000418814.2	+	8	1055	c.441C>A	c.(439-441)ggC>ggA	p.G147G	FAM135A_ENST00000370479.3_Silent_p.G104G|FAM135A_ENST00000505769.1_Silent_p.G147G|FAM135A_ENST00000361499.3_Silent_p.G147G|FAM135A_ENST00000457062.2_Silent_p.G104G|FAM135A_ENST00000505868.1_Silent_p.G147G	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	147										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						CCCATAGAGGCCTTCATCATC	0.408																																						dbGAP											0													182.0	160.0	168.0					6																	71186934		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.441C>A	6.37:g.71186934C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Silent	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like,pfam_LACT/PDAT_acylTrfase	p.G147	ENST00000418814.2	37	c.441	CCDS55028.1	6																																																																																			FAM135A	-	pfam_DUF3657	ENSG00000082269		0.408	FAM135A-001	KNOWN	basic|CCDS	protein_coding	FAM135A	HGNC	protein_coding	OTTHUMT00000041137.2	63	0.00	0	C	NM_020819		71186934	71186934	+1	no_errors	ENST00000418814	ensembl	human	known	69_37n	silent	74	35.09	40	SNP	1.000	A
FNDC4	64838	genome.wustl.edu	37	2	27717516	27717517	+	Frame_Shift_Ins	INS	-	-	G	rs375116041		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:27717516_27717517insG	ENST00000264703.3	-	2	421_422	c.30_31insC	c.(28-33)cccagcfs	p.S11fs	GCKR_ENST00000424318.2_5'Flank|GCKR_ENST00000264717.2_5'Flank	NM_022823.2	NP_073734.1	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4	11						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S11fs*28(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|prostate(1)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					CGGAGTCCGCTGGGGGGGGAAC	0.649																																						dbGAP											1	Insertion - Frameshift(1)	liver(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK026015	CCDS1756.1	2p23.3	2013-02-11			ENSG00000115226	ENSG00000115226		"""Fibronectin type III domain containing"""	20239	protein-coding gene	gene with protein product		611905				12384288	Standard	NM_022823		Approved	FLJ22362, FRCP1	uc002rkx.3	Q9H6D8	OTTHUMG00000097787	ENST00000264703.3:c.31dupC	2.37:g.27717524_27717524dupG	ENSP00000264703:p.Ser11fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W560	Frame_Shift_Ins	INS	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S10fs	ENST00000264703.3	37	c.31_30	CCDS1756.1	2																																																																																			FNDC4	-	NULL	ENSG00000115226		0.649	FNDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC4	HGNC	protein_coding	OTTHUMT00000215031.1	8	0.00	0	-	NM_022823		27717516	27717517	-1	no_errors	ENST00000264703	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.989:0.915	G
GCM2	9247	genome.wustl.edu	37	6	10877583	10877583	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:10877583A>C	ENST00000379491.4	-	2	280	c.133T>G	c.(133-135)Tat>Gat	p.Y45D	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	45					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				AAGCGCACATAGCCGTCAGGC	0.552																																						dbGAP											0													86.0	71.0	76.0					6																	10877583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.133T>G	6.37:g.10877583A>C	ENSP00000368805:p.Tyr45Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3GDV6|Q5THN5	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.Y45D	ENST00000379491.4	37	c.133	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824695	0.50739	.	.	ENSG00000124827	ENST00000379491	T	0.73258	-0.73	5.69	4.54	0.55810	.	0.107206	0.64402	D	0.000003	T	0.68568	0.3015	L	0.48877	1.53	0.80722	D	1	D	0.76494	0.999	D	0.69142	0.962	T	0.68614	-0.5362	10	0.34782	T	0.22	-13.6512	11.2873	0.49228	0.9295:0.0:0.0705:0.0	.	45	O75603	GCM2_HUMAN	D	45	ENSP00000368805:Y45D	ENSP00000368805:Y45D	Y	-	1	0	GCM2	10985569	1.000000	0.71417	0.997000	0.53966	0.153000	0.21895	5.748000	0.68697	1.001000	0.39076	0.528000	0.53228	TAT	GCM2	-	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	ENSG00000124827		0.552	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	63	0.00	0	A			10877583	10877583	-1	no_errors	ENST00000379491	ensembl	human	known	69_37n	missense	35	45.31	29	SNP	1.000	C
GCSAML	148823	genome.wustl.edu	37	1	247712349	247712349	+	5'Flank	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:247712349C>A	ENST00000366488.4	+	0	0				GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000536561.1_5'Flank|GCSAML_ENST00000531662.1_3'UTR|GCSAML_ENST00000366491.2_5'UTR|GCSAML_ENST00000366490.3_Missense_Mutation_p.P73H|GCSAML_ENST00000366489.1_5'UTR|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000527541.1_Intron	NM_001281836.1|NM_001281837.1|NM_001281853.1|NM_145278.3	NP_001268765.1|NP_001268766.1|NP_001268782.1|NP_660321.1	Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like																		ATGCGCAGGCCCCTGGCAGCT	0.557																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648		1.37:g.247712349C>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4Y5|B3KX46|Q5JQT3	Missense_Mutation	SNP	NULL	p.P73H	ENST00000366488.4	37	c.218	CCDS1635.1	1	.	.	.	.	.	.	.	.	.	.	C	9.069	0.996398	0.19043	.	.	ENSG00000169224	ENST00000366490	.	.	.	3.32	0.294	0.15747	.	.	.	.	.	T	0.35711	0.0941	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36817	-0.9732	5	0.87932	D	0	.	3.5018	0.07676	0.0:0.5371:0.2144:0.2485	.	.	.	.	H	73	.	ENSP00000355446:P73H	P	+	2	0	C1orf150	245778972	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-0.499000	0.06413	0.069000	0.16605	0.591000	0.81541	CCC	GCSAML	-	NULL	ENSG00000169224		0.557	GCSAML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCSAML	HGNC	protein_coding	OTTHUMT00000097745.4	30	0.00	0	C	NM_145278		247712349	247712349	+1	no_errors	ENST00000366490	ensembl	human	known	69_37n	missense	8	46.67	7	SNP	0.001	A
GLB1L3	112937	genome.wustl.edu	37	11	134151330	134151330	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr11:134151330T>G	ENST00000431683.2	+	4	422	c.422T>G	c.(421-423)cTg>cGg	p.L141R	GLB1L3_ENST00000389887.5_Missense_Mutation_p.L141R	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	141					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		TCTGGGAACCTGGACCTGGAG	0.517																																						dbGAP											0													225.0	220.0	222.0					11																	134151330		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.422T>G	11.37:g.134151330T>G	ENSP00000396615:p.Leu141Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.L141R	ENST00000431683.2	37	c.422	CCDS44780.1	11	.	.	.	.	.	.	.	.	.	.	T	18.77	3.695135	0.68386	.	.	ENSG00000166105	ENST00000389887;ENST00000431683	D;D	0.97791	-4.54;-4.54	4.16	4.16	0.48862	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.97269	0.9107	L	0.48877	1.53	0.54753	D	0.999987	D;P	0.64830	0.994;0.774	P;P	0.61592	0.891;0.53	D	0.96314	0.9231	9	0.39692	T	0.17	.	11.0976	0.48155	0.0:0.0:0.0:1.0	.	141;141	Q8NCI6-4;Q8NCI6	.;GLBL3_HUMAN	R	141	ENSP00000374537:L141R;ENSP00000396615:L141R	ENSP00000374537:L141R	L	+	2	0	GLB1L3	133656540	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.541000	0.73865	1.885000	0.54596	0.459000	0.35465	CTG	GLB1L3	-	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF	ENSG00000166105		0.517	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L3	HGNC	protein_coding	OTTHUMT00000393625.1	136	0.00	0	T	NM_138416		134151330	134151330	+1	no_errors	ENST00000431683	ensembl	human	known	69_37n	missense	72	33.94	37	SNP	1.000	G
GPAT2	150763	genome.wustl.edu	37	2	96689096	96689096	+	Silent	SNP	G	G	A	rs201923200		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:96689096G>A	ENST00000434632.1	-	19	2448	c.1989C>T	c.(1987-1989)gaC>gaT	p.D663D	GPAT2_ENST00000377137.3_Intron|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Silent_p.D592D|GPAT2_ENST00000359548.4_Silent_p.D663D			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	663					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						AGTCATCACTGTCACTATCAG	0.607																																						dbGAP											0													42.0	40.0	41.0					2																	96689096		2053	4188	6241	-	-	-	SO:0001819	synonymous_variant	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1989C>T	2.37:g.96689096G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Silent	SNP	smart_Acyltransferase	p.D663	ENST00000434632.1	37	c.1989	CCDS42714.1	2																																																																																			GPAT2	-	NULL	ENSG00000186281		0.607	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	33	0.00	0	G	NM_207328		96689096	96689096	-1	no_errors	ENST00000359548	ensembl	human	known	69_37n	silent	9	40.00	6	SNP	1.000	A
GPR64	10149	genome.wustl.edu	37	X	19031863	19031863	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chrX:19031863G>A	ENST00000379869.3	-	16	1203	c.1040C>T	c.(1039-1041)tCt>tTt	p.S347F	GPR64_ENST00000354791.3_Missense_Mutation_p.S331F|GPR64_ENST00000379878.3_Missense_Mutation_p.S331F|GPR64_ENST00000379873.2_Missense_Mutation_p.S347F|GPR64_ENST00000357991.3_Missense_Mutation_p.S344F|GPR64_ENST00000360279.4_Missense_Mutation_p.S325F|GPR64_ENST00000340581.3_Missense_Mutation_p.S317F|GPR64_ENST00000357544.3_Missense_Mutation_p.S317F|GPR64_ENST00000379876.1_Missense_Mutation_p.S323F|GPR64_ENST00000356606.4_Missense_Mutation_p.S333F	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	347					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					CACGGTGGGAGAGGAAAATGA	0.557																																						dbGAP											0													143.0	119.0	127.0					X																	19031863		2203	4300	6503	-	-	-	SO:0001583	missense	0			X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1040C>T	X.37:g.19031863G>A	ENSP00000369198:p.Ser347Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S347F	ENST00000379869.3	37	c.1040	CCDS43923.1	X	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313091	0.40895	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581	T;T;T;T;T;T;T;T;T;T	0.36520	1.32;1.43;1.43;1.44;1.44;1.48;1.44;1.48;1.47;1.25	5.23	4.36	0.52297	.	0.345102	0.25344	N	0.031347	T	0.42899	0.1223	L	0.34521	1.04	0.09310	N	1	B;P;P;P;P;P;P;P;D;P;P	0.56746	0.002;0.907;0.952;0.812;0.812;0.952;0.952;0.952;0.977;0.715;0.92	B;P;P;P;P;P;P;P;P;B;P	0.61397	0.005;0.73;0.789;0.642;0.568;0.789;0.789;0.789;0.888;0.439;0.62	T	0.21655	-1.0239	10	0.72032	D	0.01	.	9.2534	0.37568	0.1037:0.0:0.8963:0.0	.	317;309;317;323;331;347;325;333;344;347;331	Q14CE0;Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;.;GPR64_HUMAN;.	F	347;331;331;323;317;347;325;344;333;317	ENSP00000369202:S347F;ENSP00000369207:S331F;ENSP00000346845:S331F;ENSP00000369205:S323F;ENSP00000350152:S317F;ENSP00000369198:S347F;ENSP00000353421:S325F;ENSP00000350680:S344F;ENSP00000349015:S333F;ENSP00000344972:S317F	ENSP00000344972:S317F	S	-	2	0	GPR64	18941784	0.356000	0.24930	0.013000	0.15412	0.339000	0.28857	2.050000	0.41297	1.103000	0.41568	0.529000	0.55759	TCT	GPR64	-	NULL	ENSG00000173698		0.557	GPR64-003	KNOWN	basic|CCDS	protein_coding	GPR64	HGNC	protein_coding	OTTHUMT00000055970.2	119	0.00	0	G			19031863	19031863	-1	no_errors	ENST00000379869	ensembl	human	known	69_37n	missense	51	29.17	21	SNP	0.011	A
HERC4	26091	genome.wustl.edu	37	10	69684843	69684843	+	Splice_Site	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr10:69684843C>A	ENST00000395198.3	-	25	3211	c.2964G>T	c.(2962-2964)ctG>ctT	p.L988L	HERC4_ENST00000412272.2_Splice_Site_p.L910L|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000373700.4_Splice_Site_p.L980L|HERC4_ENST00000277817.6_Splice_Site_p.L878L	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	988	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						AATACTTACACAGAAACTGTT	0.299																																						dbGAP											0													63.0	62.0	63.0					10																	69684843		2203	4296	6499	-	-	-	SO:0001630	splice_region_variant	0			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2965+1G>T	10.37:g.69684843C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.L988	ENST00000395198.3	37	c.2964	CCDS41533.1	10																																																																																			HERC4	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000148634		0.299	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	HGNC	protein_coding	OTTHUMT00000359262.1	78	0.00	0	C	NM_015601	Silent	69684843	69684843	-1	no_errors	ENST00000395198	ensembl	human	known	69_37n	silent	46	36.11	26	SNP	0.981	A
HOXD3	3232	genome.wustl.edu	37	2	177034213	177034213	+	Missense_Mutation	SNP	C	C	G	rs140883088	byFrequency	TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:177034213C>G	ENST00000468418.3	+	3	2461	c.371C>G	c.(370-372)cCg>cGg	p.P124R	HOXD3_ENST00000410016.1_Missense_Mutation_p.P124R|HOXD3_ENST00000249440.3_Missense_Mutation_p.P124R			P31249	HXD3_HUMAN	homeobox D3	124	Poly-Pro.				anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|embryonic skeletal system morphogenesis (GO:0048704)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		cctccaccaccgaccctgccc	0.647																																						dbGAP											0													42.0	44.0	44.0					2																	177034213		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2270.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128652	ENSG00000128652		"""Homeoboxes / ANTP class : HOXL subclass"""	5137	protein-coding gene	gene with protein product		142980	"""homeo box D3"""	HOX4A, HOX4, HOX1D		1973146, 1358459	Standard	NM_006898		Approved		uc002ukt.1	P31249	OTTHUMG00000132517	ENST00000468418.3:c.371C>G	2.37:g.177034213C>G	ENSP00000424734:p.Pro124Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99955|Q9BSC5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.P124R	ENST00000468418.3	37	c.371	CCDS2270.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005048	0.74932	.	.	ENSG00000128652	ENST00000468418;ENST00000410016;ENST00000249440	D;D;D	0.91180	-2.8;-2.8;-2.8	5.33	5.33	0.75918	.	0.305258	0.35320	N	0.003287	D	0.92691	0.7677	M	0.81614	2.55	0.41348	D	0.987345	P	0.50272	0.933	P	0.46510	0.519	D	0.92941	0.6372	9	.	.	.	.	19.3826	0.94543	0.0:1.0:0.0:0.0	.	124	P31249	HXD3_HUMAN	R	124	ENSP00000424734:P124R;ENSP00000386498:P124R;ENSP00000249440:P124R	.	P	+	2	0	HOXD3	176742459	0.882000	0.30256	0.926000	0.36857	0.963000	0.63663	2.933000	0.48948	2.651000	0.90000	0.555000	0.69702	CCG	HOXD3	-	NULL	ENSG00000128652		0.647	HOXD3-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	HOXD3	HGNC	protein_coding	OTTHUMT00000334246.4	84	0.00	0	C			177034213	177034213	+1	no_errors	ENST00000249440	ensembl	human	known	69_37n	missense	52	23.53	16	SNP	1.000	G
HRNR	388697	genome.wustl.edu	37	1	152186443	152186443	+	Silent	SNP	A	A	G	rs140336724		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:152186443A>G	ENST00000368801.2	-	3	7737	c.7662T>C	c.(7660-7662)caT>caC	p.H2554H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2554					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCAGACCCATGTCGGCCGT	0.627																																						dbGAP											0													1.0	1.0	1.0					1																	152186443		25	122	147	-	-	-	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7662T>C	1.37:g.152186443A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.H2554	ENST00000368801.2	37	c.7662	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.627	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	10	0.00	0	A	XM_373868		152186443	152186443	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	silent	3	40.00	2	SNP	0.000	G
HTR1B	3351	genome.wustl.edu	37	6	78172741	78172741	+	Frame_Shift_Del	DEL	G	G	-	rs200726002		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:78172741delG	ENST00000369947.2	-	1	749	c.380delC	c.(379-381)tcgfs	p.S128fs		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	128	Agonist binding.				adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.S127L(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GATGTCCGACGACAGCCAGAA	0.597																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											97.0	74.0	82.0					6																	78172741		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.380delC	6.37:g.78172741delG	ENSP00000358963:p.Ser128fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAY7	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT1B_rcpt,prints_5HT_rcpt,prints_Adrnrgc_rcpt	p.S127fs	ENST00000369947.2	37	c.380	CCDS4986.1	6																																																																																			HTR1B	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000135312		0.597	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1B	HGNC	protein_coding	OTTHUMT00000041292.1	37	0.00	0	G	NM_000863		78172741	78172741	-1	no_errors	ENST00000369947	ensembl	human	known	69_37n	frame_shift_del	27	18.18	6	DEL	1.000	-
KCNIP4	80333	genome.wustl.edu	37	4	20734354	20734354	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr4:20734354G>T	ENST00000382152.2	-	7	759	c.592C>A	c.(592-594)Cct>Act	p.P198T	KCNIP4_ENST00000382150.4_Missense_Mutation_p.P177T|PACRGL_ENST00000507634.1_Intron|KCNIP4_ENST00000509207.1_Missense_Mutation_p.P136T|KCNIP4_ENST00000359001.5_Missense_Mutation_p.P136T|KCNIP4_ENST00000382148.3_Missense_Mutation_p.P173T|KCNIP4_ENST00000382149.4_5'UTR|KCNIP4_ENST00000447367.2_Missense_Mutation_p.P164T	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4	198						dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				TTGAGGACAGGATATGTACAT	0.373																																						dbGAP											0													149.0	136.0	140.0					4																	20734354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.592C>A	4.37:g.20734354G>T	ENSP00000371587:p.Pro198Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	Missense_Mutation	SNP	pfam_EF-hand,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.P177T	ENST00000382152.2	37	c.529	CCDS43216.1	4	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755129	0.89843	.	.	ENSG00000185774	ENST00000382148;ENST00000447367;ENST00000382150;ENST00000413487;ENST00000382152;ENST00000509207;ENST00000359001	T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.32	5.32	0.75619	EF-hand-like domain (1);	0.098298	0.64402	D	0.000001	T	0.81470	0.4829	M	0.67625	2.065	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.994;0.999	D;D;D;D	0.97110	1.0;1.0;0.992;1.0	T	0.82057	-0.0646	10	0.59425	D	0.04	.	19.4268	0.94743	0.0:0.0:1.0:0.0	.	173;177;181;198	Q3YAB9;Q3YAC0;Q3YAB7;Q6PIL6	.;.;.;KCIP4_HUMAN	T	173;164;177;136;198;136;136	ENSP00000371583:P173T;ENSP00000399080:P164T;ENSP00000371585:P177T;ENSP00000371587:P198T;ENSP00000423257:P136T;ENSP00000351892:P136T	ENSP00000351892:P136T	P	-	1	0	KCNIP4	20343452	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.809000	0.99208	2.659000	0.90383	0.558000	0.71614	CCT	KCNIP4	-	pfam_SPARC/Testican_Ca-bd-dom	ENSG00000185774		0.373	KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	KCNIP4	HGNC	protein_coding	OTTHUMT00000360407.3	58	0.00	0	G	NM_025221		20734354	20734354	-1	no_errors	ENST00000382150	ensembl	human	known	69_37n	missense	27	49.06	26	SNP	1.000	T
KCNK5	8645	genome.wustl.edu	37	6	39162506	39162506	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:39162506G>C	ENST00000359534.3	-	3	667	c.329C>G	c.(328-330)gCc>gGc	p.A110G		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	110					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						GAGGCGACCGGCGGGGGTCTT	0.592																																						dbGAP											0													56.0	67.0	63.0					6																	39162506		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.329C>G	6.37:g.39162506G>C	ENSP00000352527:p.Ala110Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAQ6|B5TJL2|Q5VV76	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.A110G	ENST00000359534.3	37	c.329	CCDS4841.1	6	.	.	.	.	.	.	.	.	.	.	G	6.458	0.452660	0.12283	.	.	ENSG00000164626	ENST00000359534	T	0.31510	1.49	5.57	5.57	0.84162	Ion transport 2 (1);	0.358393	0.31167	N	0.008128	T	0.05227	0.0139	N	0.02708	-0.52	0.27607	N	0.948795	B	0.02656	0.0	B	0.11329	0.006	T	0.23976	-1.0173	10	0.05959	T	0.93	.	19.5469	0.95302	0.0:0.0:1.0:0.0	.	110	O95279	KCNK5_HUMAN	G	110	ENSP00000352527:A110G	ENSP00000352527:A110G	A	-	2	0	KCNK5	39270484	0.951000	0.32395	0.016000	0.15963	0.036000	0.12997	4.561000	0.60809	2.619000	0.88677	0.561000	0.74099	GCC	KCNK5	-	pfam_Ion_trans_2,prints_2pore_dom_K_chnl	ENSG00000164626		0.592	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK5	HGNC	protein_coding	OTTHUMT00000040449.1	114	0.00	0	G	NM_003740		39162506	39162506	-1	no_errors	ENST00000359534	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.093	C
KDELR1	10945	genome.wustl.edu	37	19	48892898	48892899	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr19:48892898_48892899insT	ENST00000330720.2	-	3	456_457	c.262_263insA	c.(262-264)gggfs	p.G88fs	KDELR1_ENST00000597017.1_Frame_Shift_Ins_p.G26fs	NM_006801.2	NP_006792.1	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1	88					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	KDEL sequence binding (GO:0005046)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|pancreas(1)|urinary_tract(1)	11		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		GTCATGGTTCCCATCGTAAGTA	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X55885	CCDS12718.1	19q13.3	2008-05-02				ENSG00000105438			6304	protein-coding gene	gene with protein product		131235				2172835	Standard	NM_006801		Approved	ERD2.1, ERD2, HDEL	uc002pjb.1	P24390		ENST00000330720.2:c.262_263insA	19.37:g.48892898_48892899insT	ENSP00000329471:p.Gly88fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6N4|Q54A39|Q8NBW7	Frame_Shift_Ins	INS	pfam_ER_ret_rcpt,prints_ER_ret_rcpt	p.G88fs	ENST00000330720.2	37	c.263_262	CCDS12718.1	19																																																																																			KDELR1	-	pfam_ER_ret_rcpt	ENSG00000105438		0.535	KDELR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR1	HGNC	protein_coding	OTTHUMT00000465708.1	90	0.00	0	-			48892898	48892899	-1	no_errors	ENST00000330720	ensembl	human	known	69_37n	frame_shift_ins	305	91.33	3214	INS	1.000:1.000	T
KDELR1	10945	genome.wustl.edu	37	19	48892902	48892903	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr19:48892902_48892903insT	ENST00000330720.2	-	3	452_453	c.258_259insA	c.(256-261)tacgatfs	p.D87fs	KDELR1_ENST00000597017.1_Frame_Shift_Ins_p.D25fs	NM_006801.2	NP_006792.1	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1	87					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	KDEL sequence binding (GO:0005046)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|pancreas(1)|urinary_tract(1)	11		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		TGGTTCCCATCGTAAGTAGCTT	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X55885	CCDS12718.1	19q13.3	2008-05-02				ENSG00000105438			6304	protein-coding gene	gene with protein product		131235				2172835	Standard	NM_006801		Approved	ERD2.1, ERD2, HDEL	uc002pjb.1	P24390		ENST00000330720.2:c.258_259insA	19.37:g.48892902_48892903insT	ENSP00000329471:p.Asp87fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6N4|Q54A39|Q8NBW7	Frame_Shift_Ins	INS	pfam_ER_ret_rcpt,prints_ER_ret_rcpt	p.D86fs	ENST00000330720.2	37	c.259_258	CCDS12718.1	19																																																																																			KDELR1	-	pfam_ER_ret_rcpt	ENSG00000105438		0.535	KDELR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR1	HGNC	protein_coding	OTTHUMT00000465708.1	90	0.00	0	-			48892902	48892903	-1	no_errors	ENST00000330720	ensembl	human	known	69_37n	frame_shift_ins	322	90.21	2967	INS	1.000:0.833	T
CLUH	23277	genome.wustl.edu	37	17	2601712	2601713	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr17:2601712_2601713insC	ENST00000570628.2	-	10	1429_1430	c.1324_1325insG	c.(1324-1326)gacfs	p.D442fs	CLUH_ENST00000538975.1_Frame_Shift_Ins_p.D442fs|CLUH_ENST00000435359.1_Frame_Shift_Ins_p.D442fs			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	442					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											GGCCGCCACGTCCCCCCCGAAG	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.1325dupG	17.37:g.2601719_2601719dupC	ENSP00000458986:p.Asp442fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Frame_Shift_Ins	INS	superfamily_GSKIP/TIF31_domain	p.D442fs	ENST00000570628.2	37	c.1325_1324	CCDS45572.1	17																																																																																			KIAA0664	-	NULL	ENSG00000132361		0.624	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0664	HGNC	protein_coding	OTTHUMT00000437807.2	18	0.00	0	-	NM_015229		2601712	2601713	-1	no_errors	ENST00000435359	ensembl	human	known	69_37n	frame_shift_ins	1	66.67	2	INS	1.000:1.000	C
LCE1F	353137	genome.wustl.edu	37	1	152749130	152749130	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:152749130T>C	ENST00000334371.2	+	1	283	c.283T>C	c.(283-285)Tgc>Cgc	p.C95R		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	95					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGCTCTGACTGCTGCAGCCA	0.677																																						dbGAP											0													28.0	32.0	30.0					1																	152749130		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.283T>C	1.37:g.152749130T>C	ENSP00000334187:p.Cys95Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C95R	ENST00000334371.2	37	c.283	CCDS1023.1	1	.	.	.	.	.	.	.	.	.	.	T	8.396	0.840942	0.16891	.	.	ENSG00000240386	ENST00000334371	T	0.04809	3.55	4.45	4.45	0.53987	.	0.000000	0.38381	N	0.001719	T	0.12220	0.0297	M	0.78801	2.425	0.49483	D	0.999792	D	0.69078	0.997	D	0.78314	0.991	T	0.00286	-1.1847	10	0.87932	D	0	.	10.2783	0.43523	0.0:0.0:0.0:1.0	.	95	Q5T754	LCE1F_HUMAN	R	95	ENSP00000334187:C95R	ENSP00000334187:C95R	C	+	1	0	LCE1F	151015754	0.548000	0.26473	0.971000	0.41717	0.539000	0.34962	0.479000	0.22228	1.979000	0.57680	0.455000	0.32223	TGC	LCE1F	-	NULL	ENSG00000240386		0.677	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1F	HGNC	protein_coding	OTTHUMT00000034523.2	67	0.00	0	T	NM_178354		152749130	152749130	+1	no_errors	ENST00000334371	ensembl	human	known	69_37n	missense	55	26.67	20	SNP	0.991	C
LIPN	643418	genome.wustl.edu	37	10	90537956	90537956	+	Missense_Mutation	SNP	G	G	A	rs567792606		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr10:90537956G>A	ENST00000404459.1	+	9	1154	c.1154G>A	c.(1153-1155)cGg>cAg	p.R385Q		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	385					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		GCCCCTCAACGGATGTACAGT	0.408													G|||	1	0.000199681	0.0	0.0	5008	,	,		23098	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													70.0	65.0	66.0					10																	90537956		1874	4095	5969	-	-	-	SO:0001583	missense	0				CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.1154G>A	10.37:g.90537956G>A	ENSP00000383923:p.Arg385Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7KIH9	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.R385Q	ENST00000404459.1	37	c.1154	CCDS44456.1	10	.	.	.	.	.	.	.	.	.	.	G	13.18	2.158967	0.38119	.	.	ENSG00000204020	ENST00000404459	T	0.70749	-0.51	5.21	4.28	0.50868	.	.	.	.	.	T	0.58949	0.2158	N	0.17800	0.525	0.09310	N	1	D	0.56521	0.976	P	0.47376	0.545	T	0.46938	-0.9155	8	.	.	.	-12.6596	8.4773	0.33021	0.0807:0.0:0.7627:0.1566	.	385	Q5VXI9	LIPN_HUMAN	Q	385	ENSP00000383923:R385Q	.	R	+	2	0	LIPN	90527936	0.001000	0.12720	0.002000	0.10522	0.992000	0.81027	1.084000	0.30828	1.515000	0.48885	0.643000	0.83706	CGG	LIPN	-	NULL	ENSG00000204020		0.408	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPN	HGNC	protein_coding	OTTHUMT00000049254.2	37	0.00	0	G	XM_926751		90537956	90537956	+1	no_errors	ENST00000404459	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	0.002	A
LOXL3	84695	genome.wustl.edu	37	2	74762843	74762843	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:74762843C>T	ENST00000264094.3	-	8	1359	c.1288G>A	c.(1288-1290)Gtc>Atc	p.V430I	LOXL3_ENST00000409986.1_Missense_Mutation_p.V285I|LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409549.1_Intron|LOXL3_ENST00000393937.2_Missense_Mutation_p.V285I	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	430	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						TGCACCTCGACTCGCCCCTCA	0.622																																						dbGAP											0													42.0	49.0	47.0					2																	74762843		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1288G>A	2.37:g.74762843C>T	ENSP00000264094:p.Val430Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Lysyl_oxidase,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.V430I	ENST00000264094.3	37	c.1288	CCDS1953.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.303425|4.303425	0.81136|0.81136	.|.	.|.	ENSG00000115318|ENSG00000115318	ENST00000420535|ENST00000264094;ENST00000393937;ENST00000409986	.|T;T;T	.|0.53206	.|0.63;0.63;0.63	5.11|5.11	5.11|5.11	0.69529|0.69529	.|Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74527|0.74527	0.3728|0.3728	M|M	0.90650|0.90650	3.135|3.135	0.50467|0.50467	D|D	0.999877|0.999877	.|D;D;P	.|0.71674	.|0.998;0.998;0.907	.|D;D;P	.|0.83275	.|0.996;0.98;0.527	T|T	0.79725|0.79725	-0.1683|-0.1683	5|10	.|0.87932	.|D	.|0	.|.	16.4212|16.4212	0.83759|0.83759	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|285;285;430	.|B9A025;Q6IPL7;P58215	.|.;.;LOXL3_HUMAN	N|I	156|430;285;285	.|ENSP00000264094:V430I;ENSP00000377512:V285I;ENSP00000386545:V285I	.|ENSP00000264094:V430I	S|V	-|-	2|1	0|0	LOXL3|LOXL3	74616351|74616351	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.993000|0.993000	0.82548|0.82548	4.705000|4.705000	0.61838|0.61838	2.816000|2.816000	0.96949|0.96949	0.563000|0.563000	0.77884|0.77884	AGT|GTC	LOXL3	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000115318		0.622	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	HGNC	protein_coding	OTTHUMT00000252215.1	187	0.00	0	C	NM_032603		74762843	74762843	-1	no_errors	ENST00000264094	ensembl	human	known	69_37n	missense	40	40.30	27	SNP	1.000	T
LPO	4025	genome.wustl.edu	37	17	56342263	56342263	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr17:56342263C>G	ENST00000262290.4	+	10	1763	c.1447C>G	c.(1447-1449)Cag>Gag	p.Q483E	LPO_ENST00000582328.1_Missense_Mutation_p.Q400E|LPO_ENST00000421678.2_Missense_Mutation_p.Q400E|LPO_ENST00000543544.1_Missense_Mutation_p.Q424E	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	483					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TGAGAATTATCAGCCATGGGG	0.522																																						dbGAP											0													99.0	80.0	86.0					17																	56342263		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1447C>G	17.37:g.56342263C>G	ENSP00000262290:p.Gln483Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.Q483E	ENST00000262290.4	37	c.1447	CCDS32689.1	17	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327377	0.41197	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.72835	-0.69;-0.69;-0.69	6.17	4.02	0.46733	.	0.304519	0.34750	N	0.003712	T	0.61602	0.2360	L	0.43701	1.375	0.32439	N	0.546956	B;B	0.09022	0.0;0.002	B;B	0.11329	0.001;0.006	T	0.65817	-0.6076	10	0.39692	T	0.17	-13.7066	11.7379	0.51775	0.2258:0.6511:0.1231:0.0	.	400;483	E7EMJ3;P22079	.;PERL_HUMAN	E	483;400;424;228	ENSP00000262290:Q483E;ENSP00000400245:Q400E;ENSP00000445344:Q424E	ENSP00000262290:Q483E	Q	+	1	0	LPO	53697262	0.000000	0.05858	0.988000	0.46212	0.977000	0.68977	-0.324000	0.07986	1.584000	0.49913	0.655000	0.94253	CAG	LPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000167419		0.522	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	103	0.00	0	C			56342263	56342263	+1	no_errors	ENST00000262290	ensembl	human	known	69_37n	missense	113	31.52	52	SNP	0.993	G
MGA	23269	genome.wustl.edu	37	15	42034982	42034982	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr15:42034982T>A	ENST00000570161.1	+	14	4824	c.4824T>A	c.(4822-4824)aaT>aaA	p.N1608K	MGA_ENST00000566586.1_Intron|MGA_ENST00000545763.1_Intron|MGA_ENST00000389936.4_Missense_Mutation_p.N1608K|MGA_ENST00000219905.7_Missense_Mutation_p.N1608K			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTTTAGAAAATACTACTGCTG	0.468																																						dbGAP											0													90.0	88.0	89.0					15																	42034982		1909	4129	6038	-	-	-	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.4824T>A	15.37:g.42034982T>A	ENSP00000457035:p.Asn1608Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.N1608K	ENST00000570161.1	37	c.4824	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	T	17.39	3.376512	0.61735	.	.	ENSG00000174197	ENST00000219905;ENST00000389936	D;D	0.84873	-1.91;-1.85	4.96	3.7	0.42460	.	1.308000	0.05253	N	0.514391	T	0.72581	0.3478	N	0.14661	0.345	0.80722	D	1	P;P	0.40970	0.734;0.608	B;B	0.34722	0.188;0.115	T	0.56768	-0.7924	10	0.17832	T	0.49	.	9.6314	0.39782	0.0:0.0895:0.0:0.9105	.	224;1608	B4DVS1;E7ENI0	.;.	K	1608	ENSP00000219905:N1608K;ENSP00000374586:N1608K	ENSP00000219905:N1608K	N	+	3	2	MGA	39822274	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.020000	0.30027	0.797000	0.33971	0.460000	0.39030	AAT	MGA	-	NULL	ENSG00000174197		0.468	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	138	0.00	0	T	NM_001164273.1		42034982	42034982	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	missense	118	27.16	44	SNP	1.000	A
MTHFS	10588	genome.wustl.edu	37	15	80181580	80181580	+	Silent	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr15:80181580G>A	ENST00000258874.3	-	2	294	c.234C>T	c.(232-234)tgC>tgT	p.C78C	ST20-MTHFS_ENST00000494999.1_5'UTR|ST20-MTHFS_ENST00000479961.1_Silent_p.C54C|MTHFS_ENST00000559722.1_5'UTR	NM_006441.3	NP_006432.1	P49914	MTHFS_HUMAN	5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)	78					formate metabolic process (GO:0015942)|tetrahydrofolate metabolic process (GO:0046653)	cytoplasm (GO:0005737)	5-formyltetrahydrofolate cyclo-ligase activity (GO:0030272)|ATP binding (GO:0005524)|folic acid binding (GO:0005542)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|liver(1)	5				all cancers(203;0.00467)		GAGGGATGAAGCAGATTTTGC	0.403																																						dbGAP											0													219.0	191.0	200.0					15																	80181580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L38928	CCDS10311.1	15q24.3	2014-05-15			ENSG00000136371	ENSG00000136371	6.3.3.2		7437	protein-coding gene	gene with protein product		604197				8522195	Standard	NM_006441		Approved	HsT19268	uc002bex.4	P49914	OTTHUMG00000144174	ENST00000258874.3:c.234C>T	15.37:g.80181580G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	H3BQ75	Silent	SNP	pfam_FTHF_cligase,pirsf_FTHF_cligase,tigrfam_FTHF_cligase	p.C78	ENST00000258874.3	37	c.234	CCDS10311.1	15																																																																																			MTHFS	-	pfam_FTHF_cligase,pirsf_FTHF_cligase,tigrfam_FTHF_cligase	ENSG00000136371		0.403	MTHFS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFS	HGNC	protein_coding	OTTHUMT00000291374.2	250	0.40	1	G	NM_006441		80181580	80181580	-1	no_errors	ENST00000258874	ensembl	human	known	69_37n	silent	90	81.24	394	SNP	0.998	A
NUP93	9688	genome.wustl.edu	37	16	56782315	56782315	+	Silent	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr16:56782315C>T	ENST00000308159.5	+	2	277	c.156C>T	c.(154-156)tcC>tcT	p.S52S	NUP93_ENST00000569842.1_Silent_p.S52S	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	52					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CACGCACGTCCCAGGAGACGG	0.567																																					Colon(33;610 796 1305 1705 38917)	dbGAP											0													40.0	37.0	38.0					16																	56782315		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.156C>T	16.37:g.56782315C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPQ8|Q14705	Missense_Mutation	SNP	NULL	p.P19S	ENST00000308159.5	37	c.55	CCDS10769.1	16																																																																																			NUP93	-	NULL	ENSG00000102900		0.567	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP93	HGNC	protein_coding	OTTHUMT00000257058.4	36	0.00	0	C	NM_014669		56782315	56782315	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000566678	ensembl	human	putative	69_37n	missense	20	39.39	13	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228492905	228492905	+	Intron	SNP	G	G	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:228492905G>C	ENST00000422127.1	+	44	11703				OBSCN_ENST00000570156.2_Missense_Mutation_p.S4783T|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000366707.4_Missense_Mutation_p.S1460T|OBSCN_ENST00000284548.11_Intron|RP5-1139B12.4_ENST00000602778.1_RNA	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGTGAGCTGAGCAAGGTGGCC	0.567																																						dbGAP											0													136.0	118.0	123.0					1																	228492905		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11660-1168G>C	1.37:g.228492905G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S1460T	ENST00000422127.1	37	c.4379	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.601154	0.66332	.	.	ENSG00000154358	ENST00000366707	T	0.66995	-0.24	4.56	3.56	0.40772	.	.	.	.	.	T	0.57431	0.2053	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49899	-0.8890	6	0.20519	T	0.43	.	6.5012	0.22170	0.1117:0.373:0.5153:0.0	.	.	.	.	T	1460	ENSP00000355668:S1460T	ENSP00000355668:S1460T	S	+	2	0	OBSCN	226559528	0.630000	0.27155	1.000000	0.80357	0.400000	0.30750	0.980000	0.29513	2.362000	0.80069	0.491000	0.48974	AGC	OBSCN	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000154358		0.567	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		147	0.00	0	G	NM_052843		228492905	228492905	+1	no_errors	ENST00000366707	ensembl	human	known	69_37n	missense	75	32.43	36	SNP	1.000	C
PPIL2	23759	genome.wustl.edu	37	22	22042019	22042020	+	In_Frame_Ins	INS	-	-	GCA			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr22:22042019_22042020insGCA	ENST00000335025.8	+	13	1076_1077	c.985_986insGCA	c.(985-987)gtg>gGCAtg	p.329_329V>GM	PPIL2_ENST00000446951.1_3'UTR|PPIL2_ENST00000406385.1_In_Frame_Ins_p.329_329V>GM|PPIL2_ENST00000492445.2_In_Frame_Ins_p.329_329V>GM|PPIL2_ENST00000398831.3_In_Frame_Ins_p.329_329V>GM|PPIL2_ENST00000412327.1_In_Frame_Ins_p.329_329V>GM|PPIL2_ENST00000456792.2_In_Frame_Ins_p.308_308V>GM					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					CCGGAACTTTGTGGTGAGTGAC	0.559																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0				CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	Exception_encountered	22.37:g.22042019_22042020insGCA	ENSP00000334553:p.Val329delinsGlyMet	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Ins	INS	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_Ubox_domain,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.V329in_frame_insGM	ENST00000335025.8	37	c.985_986	CCDS13793.1	22																																																																																			PPIL2	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	ENSG00000100023		0.559	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL2	HGNC	protein_coding	OTTHUMT00000075028.4	81	0.00	0	-			22042019	22042020	+1	no_errors	ENST00000412327	ensembl	human	known	69_37n	in_frame_ins	16	55.56	20	INS	1.000:1.000	GCA
PRRC2B	84726	genome.wustl.edu	37	9	134343003	134343003	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr9:134343003C>T	ENST00000357304.4	+	12	1829	c.1774C>T	c.(1774-1776)Ccc>Tcc	p.P592S	PRRC2B_ENST00000405995.1_Missense_Mutation_p.P592S|PRRC2B_ENST00000458550.1_Missense_Mutation_p.P592S|PRRC2B_ENST00000372249.1_5'UTR	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	592							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						AGAAGAGGCACCCACAGTGTC	0.562																																						dbGAP											0													42.0	46.0	44.0					9																	134343003		1955	4160	6115	-	-	-	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.1774C>T	9.37:g.134343003C>T	ENSP00000349856:p.Pro592Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.P592S	ENST00000357304.4	37	c.1774	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	C	12.37	1.916313	0.33815	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550;ENST00000422467	T;T;T;T	0.09630	2.96;2.96;2.96;2.96	5.76	4.81	0.61882	.	0.174050	0.26855	U	0.022142	T	0.12178	0.0296	L	0.51422	1.61	0.80722	D	1	B	0.21071	0.051	B	0.12156	0.007	T	0.03818	-1.1001	10	0.32370	T	0.25	-1.2546	14.9096	0.70746	0.1917:0.8082:0.0:0.0	.	592	Q5JSZ5	PRC2B_HUMAN	S	592;592;592;132	ENSP00000384606:P592S;ENSP00000349856:P592S;ENSP00000398853:P592S;ENSP00000391063:P132S	ENSP00000349856:P592S	P	+	1	0	PRRC2B	133332824	0.433000	0.25562	0.921000	0.36526	0.299000	0.27559	0.732000	0.26072	2.882000	0.98803	0.655000	0.94253	CCC	PRRC2B	-	NULL	ENSG00000130723		0.562	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		33	0.00	0	C			134343003	134343003	+1	no_errors	ENST00000357304	ensembl	human	known	69_37n	missense	12	63.64	21	SNP	0.932	T
PSG9	5678	genome.wustl.edu	37	19	43762251	43762251	+	Intron	SNP	A	A	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr19:43762251A>C	ENST00000270077.3	-	5	1340				PSG9_ENST00000443718.3_Intron|PSG9_ENST00000418820.2_Intron|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000244293.7_Missense_Mutation_p.M356R|PSG9_ENST00000593948.1_Intron|PSG9_ENST00000596730.1_Missense_Mutation_p.M263R	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GCTTGTGCCCATGGGACACAG	0.453																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.1243+102T>G	19.37:g.43762251A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.M356R	ENST00000270077.3	37	c.1067	CCDS12618.1	19	.	.	.	.	.	.	.	.	.	.	N	1.417	-0.573882	0.03882	.	.	ENSG00000183668	ENST00000244293	T	0.28255	1.62	1.04	-2.08	0.07254	.	.	.	.	.	T	0.19327	0.0464	.	.	.	0.09310	N	1	B;B	0.18013	0.025;0.025	B;B	0.09377	0.004;0.004	T	0.16188	-1.0411	8	0.56958	D	0.05	.	5.2585	0.15559	0.6412:0.0:0.3588:0.0	.	305;356	Q15225;Q15227	.;.	R	356	ENSP00000244293:M356R	ENSP00000244293:M356R	M	-	2	0	PSG9	48454091	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.777000	0.04669	-1.119000	0.02958	-1.140000	0.01884	ATG	PSG9	-	NULL	ENSG00000183668		0.453	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG9	HGNC	protein_coding	OTTHUMT00000323065.1	175	0.00	0	A	NM_002784		43762251	43762251	-1	no_errors	ENST00000244293	ensembl	human	putative	69_37n	missense	89	45.06	73	SNP	0.000	C
PZP	5858	genome.wustl.edu	37	12	9307212	9307212	+	Splice_Site	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr12:9307212C>A	ENST00000261336.2	-	29	3802	c.3774G>T	c.(3772-3774)caG>caT	p.Q1258H	PZP_ENST00000381997.2_Splice_Site_p.Q1044H	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1258					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						AACCACTGACCTGGGTGGAGG	0.498																																					Melanoma(125;1402 1695 4685 34487 38571)	dbGAP											0													63.0	53.0	56.0					12																	9307212		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3774+1G>T	12.37:g.9307212C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.Q1258H	ENST00000261336.2	37	c.3774	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	C	14.82	2.649120	0.47362	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.55052	0.54;0.54	3.66	2.76	0.32466	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.000000	0.43579	U	0.000556	T	0.81230	0.4779	H	0.98333	4.205	0.38719	D	0.953405	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	D	0.86760	0.1966	9	.	.	.	.	11.3316	0.49479	0.0:0.9061:0.0:0.0939	.	1044;1258	P20742-2;P20742	.;PZP_HUMAN	H	1258;1044	ENSP00000261336:Q1258H;ENSP00000371427:Q1044H	.	Q	-	3	2	PZP	9198479	1.000000	0.71417	0.909000	0.35828	0.295000	0.27426	4.541000	0.60670	0.835000	0.34877	0.563000	0.77884	CAG	PZP	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000126838		0.498	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	45	0.00	0	C	NM_002864	Missense_Mutation	9307212	9307212	-1	no_errors	ENST00000261336	ensembl	human	known	69_37n	missense	37	38.33	23	SNP	1.000	A
RAB9B	51209	genome.wustl.edu	37	X	103080633	103080633	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chrX:103080633C>T	ENST00000243298.2	-	3	366	c.82G>A	c.(82-84)Gta>Ata	p.V28I		NM_016370.2	NP_057454.1	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	28					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|lung(11)	14						TTGTTGGTTACGTAACGGTTC	0.463																																						dbGAP											0													129.0	119.0	122.0					X																	103080633		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB036693	CCDS14515.1	Xq22.1-q22.3	2010-04-19			ENSG00000123570	ENSG00000123570		"""RAB, member RAS oncogene"""	14090	protein-coding gene	gene with protein product		300285				11043518	Standard	NM_016370		Approved	RAB9L	uc004ell.2	Q9NP90	OTTHUMG00000022112	ENST00000243298.2:c.82G>A	X.37:g.103080633C>T	ENSP00000243298:p.Val28Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8M0|Q52LX2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V28I	ENST00000243298.2	37	c.82	CCDS14515.1	X	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059334	0.55325	.	.	ENSG00000123570	ENST00000243298	T	0.77229	-1.08	5.95	5.95	0.96441	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.71350	0.3329	N	0.25789	0.76	0.80722	D	1	P	0.35456	0.502	B	0.39152	0.292	T	0.72643	-0.4231	10	0.51188	T	0.08	-13.1421	16.5572	0.84488	0.0:1.0:0.0:0.0	.	28	Q9NP90	RAB9B_HUMAN	I	28	ENSP00000243298:V28I	ENSP00000243298:V28I	V	-	1	0	RAB9B	102967289	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.518000	0.84900	0.600000	0.82982	GTA	RAB9B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000123570		0.463	RAB9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB9B	HGNC	protein_coding	OTTHUMT00000057746.1	236	0.00	0	C			103080633	103080633	-1	no_errors	ENST00000243298	ensembl	human	known	69_37n	missense	270	14.29	45	SNP	1.000	T
RGAG1	57529	genome.wustl.edu	37	X	109694149	109694149	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chrX:109694149C>A	ENST00000465301.2	+	3	550	c.304C>A	c.(304-306)Cca>Aca	p.P102T	RGAG1_ENST00000540313.1_Missense_Mutation_p.P102T	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	102										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GGCACTTTCCCCATTGCTAAT	0.527																																						dbGAP											0													157.0	145.0	149.0					X																	109694149		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.304C>A	X.37:g.109694149C>A	ENSP00000419786:p.Pro102Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.P102T	ENST00000465301.2	37	c.304	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539456	0.45176	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.64438	-0.1;-0.1	4.19	3.3	0.37823	.	0.000000	0.34386	N	0.004007	T	0.64238	0.2580	L	0.29908	0.895	0.32965	D	0.521615	D	0.89917	1.0	D	0.87578	0.998	T	0.68296	-0.5446	9	.	.	.	-14.0016	8.1794	0.31302	0.238:0.762:0.0:0.0	.	102	Q8NET4	RGAG1_HUMAN	T	102	ENSP00000419786:P102T;ENSP00000441452:P102T	.	P	+	1	0	RGAG1	109580805	1.000000	0.71417	0.496000	0.27539	0.798000	0.45092	2.494000	0.45329	1.076000	0.40961	0.600000	0.82982	CCA	RGAG1	-	NULL	ENSG00000243978		0.527	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	741	0.00	0	C	NM_020769		109694149	109694149	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	311	36.92	182	SNP	0.813	A
RIN2	54453	genome.wustl.edu	37	20	19970723	19970723	+	Silent	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr20:19970723G>A	ENST00000255006.6	+	9	2132	c.1983G>A	c.(1981-1983)aaG>aaA	p.K661K	RIN2_ENST00000440354.2_Silent_p.K179K|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	612	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						CCATGCTGAAGGACTTTCACA	0.562																																						dbGAP											0													26.0	28.0	28.0					20																	19970723		1929	4138	6067	-	-	-	SO:0001819	synonymous_variant	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1983G>A	20.37:g.19970723G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.K661	ENST00000255006.6	37	c.1983	CCDS56182.1	20																																																																																			RIN2	-	NULL	ENSG00000132669		0.562	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	11	0.00	0	G			19970723	19970723	+1	no_errors	ENST00000255006	ensembl	human	known	69_37n	silent	12	33.33	6	SNP	0.997	A
SCN3A	6328	genome.wustl.edu	37	2	165948952	165948952	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr2:165948952A>C	ENST00000360093.3	-	27	5110	c.4619T>G	c.(4618-4620)aTg>aGg	p.M1540R	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000283254.7_Missense_Mutation_p.M1540R|SCN3A_ENST00000465043.1_5'UTR|SCN3A_ENST00000540861.1_Missense_Mutation_p.M23R|SCN3A_ENST00000409101.3_Missense_Mutation_p.M1491R	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1540					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATGGTGACCATGTTGAGGCA	0.418																																						dbGAP											0													158.0	122.0	134.0					2																	165948952		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4619T>G	2.37:g.165948952A>C	ENSP00000353206:p.Met1540Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.M1540R	ENST00000360093.3	37	c.4619		2	.	.	.	.	.	.	.	.	.	.	A	23.3	4.400343	0.83120	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.99026	0.9667	H	0.96748	3.875	0.80722	D	1	D;D;D	0.76494	0.984;0.994;0.999	D;D;D	0.76575	0.974;0.988;0.935	D	0.99414	1.0931	10	0.87932	D	0	.	16.4053	0.83662	1.0:0.0:0.0:0.0	.	1491;1491;1540	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	R	1540;1540;1491;23	ENSP00000353206:M1540R;ENSP00000283254:M1540R;ENSP00000386726:M1491R;ENSP00000439920:M23R	ENSP00000283254:M1540R	M	-	2	0	SCN3A	165657198	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.333000	0.79357	0.482000	0.46254	ATG	SCN3A	-	NULL	ENSG00000153253		0.418	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		84	0.00	0	A	NM_006922		165948952	165948952	-1	no_errors	ENST00000283254	ensembl	human	known	69_37n	missense	154	20.21	39	SNP	1.000	C
SEMG1	6406	genome.wustl.edu	37	20	43836891	43836891	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr20:43836891C>A	ENST00000372781.3	+	2	1010	c.953C>A	c.(952-954)aCt>aAt	p.T318N	SEMG1_ENST00000244069.6_Intron	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	318	2 X 60 AA tandem repeats, type 1.|Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TATAGCCAAACTGAAGAGAAA	0.373																																						dbGAP											0													72.0	68.0	70.0					20																	43836891		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.953C>A	20.37:g.43836891C>A	ENSP00000361867:p.Thr318Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	pfam_Semenogelin	p.T318N	ENST00000372781.3	37	c.953	CCDS13345.1	20	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357031	0.24598	.	.	ENSG00000124233	ENST00000372781	T	0.10960	2.82	1.69	-0.514	0.11958	.	.	.	.	.	T	0.25005	0.0607	M	0.78456	2.415	0.09310	N	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.911;0.998	T	0.11891	-1.0569	9	0.44086	T	0.13	.	2.2344	0.04004	0.3003:0.5021:0.0:0.1977	.	318;318	P04279;E7EPD3	SEMG1_HUMAN;.	N	318	ENSP00000361867:T318N	ENSP00000361867:T318N	T	+	2	0	SEMG1	43270305	0.005000	0.15991	0.001000	0.08648	0.000000	0.00434	-0.075000	0.11431	-0.112000	0.11979	-1.141000	0.01876	ACT	SEMG1	-	pfam_Semenogelin	ENSG00000124233		0.373	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEMG1	HGNC	protein_coding	OTTHUMT00000079416.3	86	0.00	0	C	NM_003007		43836891	43836891	+1	no_errors	ENST00000372781	ensembl	human	known	69_37n	missense	40	73.15	109	SNP	0.001	A
SERPINA4	5267	genome.wustl.edu	37	14	95030369	95030369	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr14:95030369G>A	ENST00000557004.1	+	2	971	c.550G>A	c.(550-552)Gac>Aac	p.D184N	SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000298841.5_Missense_Mutation_p.D184N|SERPINA4_ENST00000555095.1_Missense_Mutation_p.D184N			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	184					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GCTTATCAACGACCACGTCAA	0.463																																						dbGAP											0													171.0	160.0	164.0					14																	95030369		2203	4300	6503	-	-	-	SO:0001583	missense	0			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.550G>A	14.37:g.95030369G>A	ENSP00000450838:p.Asp184Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.D184N	ENST00000557004.1	37	c.550	CCDS9927.1	14	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486893	0.26686	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.82711	-1.64;-1.64;-1.64	4.41	-5.08	0.02929	Serpin domain (3);	0.902165	0.09304	N	0.820578	T	0.66587	0.2804	N	0.21508	0.67	0.09310	N	0.999999	B;B	0.21381	0.021;0.055	B;B	0.26416	0.013;0.069	T	0.53222	-0.8469	10	0.42905	T	0.14	.	4.0813	0.09927	0.574:0.1083:0.2091:0.1086	.	184;184	B2R815;P29622	.;KAIN_HUMAN	N	184	ENSP00000450838:D184N;ENSP00000451172:D184N;ENSP00000298841:D184N	ENSP00000298841:D184N	D	+	1	0	SERPINA4	94100122	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.147000	0.10234	-1.087000	0.03081	-1.251000	0.01509	GAC	SERPINA4	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000100665		0.463	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA4	HGNC	protein_coding	OTTHUMT00000410718.1	294	0.00	0	G	NM_006215		95030369	95030369	+1	no_errors	ENST00000298841	ensembl	human	known	69_37n	missense	137	33.17	68	SNP	0.006	A
SERPINF1	5176	genome.wustl.edu	37	17	1675177	1675177	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr17:1675177A>C	ENST00000254722.4	+	5	614	c.451A>C	c.(451-453)Aaa>Caa	p.K151Q	SERPINF1_ENST00000571870.1_3'UTR	NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	151					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						GCTGCGCATAAAATCCAGCTT	0.552																																						dbGAP											0													41.0	41.0	41.0					17																	1675177		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.451A>C	17.37:g.1675177A>C	ENSP00000254722:p.Lys151Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.K151Q	ENST00000254722.4	37	c.451	CCDS11012.1	17	.	.	.	.	.	.	.	.	.	.	A	17.05	3.290325	0.59976	.	.	ENSG00000132386	ENST00000254722	D	0.85013	-1.93	5.79	5.79	0.91817	Serpin domain (3);	0.087721	0.85682	D	0.000000	D	0.83700	0.5311	M	0.73217	2.22	0.80722	D	1	P	0.44690	0.841	B	0.42798	0.398	T	0.81767	-0.0782	10	0.25751	T	0.34	.	10.4583	0.44563	0.9277:0.0:0.0723:0.0	.	151	P36955	PEDF_HUMAN	Q	151	ENSP00000254722:K151Q	ENSP00000254722:K151Q	K	+	1	0	SERPINF1	1621927	1.000000	0.71417	0.998000	0.56505	0.358000	0.29455	4.773000	0.62331	2.208000	0.71279	0.459000	0.35465	AAA	SERPINF1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000132386		0.552	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF1	HGNC	protein_coding	OTTHUMT00000207109.4	77	0.00	0	A	NM_002615		1675177	1675177	+1	no_errors	ENST00000254722	ensembl	human	known	69_37n	missense	9	59.09	13	SNP	1.000	C
SHISA4	149345	genome.wustl.edu	37	1	201858660	201858660	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:201858660delG	ENST00000362011.6	+	2	448	c.161delG	c.(160-162)tgcfs	p.C54fs	SHISA4_ENST00000464117.1_3'UTR	NM_198149.2	NP_937792.2	Q96DD7	SHSA4_HUMAN	shisa family member 4	54						integral component of membrane (GO:0016021)				kidney(1)|lung(4)	5						ACCTTCTGCTGCGGGACCTGC	0.627																																						dbGAP											0													96.0	92.0	93.0					1																	201858660		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY358589	CCDS1416.1	1q32.1	2013-07-31	2013-07-31	2008-04-01	ENSG00000198892	ENSG00000198892		"""Shisa homologs"""	27139	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 40"", ""transmembrane protein 58"", ""shisa homolog 4 (Xenopus laevis)"""	C1orf40, TMEM58		12975309	Standard	NR_030775		Approved	hShisa4	uc001gxa.3	Q96DD7	OTTHUMG00000035807	ENST00000362011.6:c.161delG	1.37:g.201858660delG	ENSP00000355064:p.Cys54fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFI0|B7ZAJ7|Q5VUU1|Q6P711|Q6UWY7	Frame_Shift_Del	DEL	NULL	p.C54fs	ENST00000362011.6	37	c.161	CCDS1416.1	1																																																																																			SHISA4	-	NULL	ENSG00000198892		0.627	SHISA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA4	HGNC	protein_coding	OTTHUMT00000087096.1	84	0.00	0	G	NM_198149		201858660	201858660	+1	no_errors	ENST00000362011	ensembl	human	known	69_37n	frame_shift_del	80	41.01	57	DEL	1.000	-
SIGLEC7	27036	genome.wustl.edu	37	19	51645679	51645680	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr19:51645679_51645680insCT	ENST00000317643.6	+	1	122_123	c.53_54insCT	c.(52-57)ggacagfs	p.Q19fs	SIGLEC7_ENST00000600577.1_Frame_Shift_Ins_p.Q19fs|SIGLEC7_ENST00000305628.7_Frame_Shift_Ins_p.Q19fs	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	19					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		AGGGTGGAAGGACAGAAGAGTA	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	Exception_encountered	19.37:g.51645679_51645680insCT	ENSP00000323328:p.Gln19fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Frame_Shift_Ins	INS	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q19fs	ENST00000317643.6	37	c.53_54	CCDS12826.1	19																																																																																			SIGLEC7	-	NULL	ENSG00000168995		0.609	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	72	0.00	0	-	NM_016543		51645679	51645680	+1	no_errors	ENST00000317643	ensembl	human	known	69_37n	frame_shift_ins	33	38.89	21	INS	0.004:0.000	CT
SIK2	23235	genome.wustl.edu	37	11	111575768	111575768	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr11:111575768C>T	ENST00000304987.3	+	8	1179	c.1006C>T	c.(1006-1008)Cgc>Tgc	p.R336C		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	336					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						GTTGGTGGAGCGCCTGAAATC	0.463																																						dbGAP											0													161.0	151.0	154.0					11																	111575768		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1006C>T	11.37:g.111575768C>T	ENSP00000305976:p.Arg336Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R336C	ENST00000304987.3	37	c.1006	CCDS8347.1	11	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401495	0.83120	.	.	ENSG00000170145	ENST00000304987	T	0.78364	-1.17	5.7	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.87442	0.6178	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88332	0.2969	10	0.87932	D	0	.	11.1753	0.48595	0.3844:0.6156:0.0:0.0	.	336	Q9H0K1	SIK2_HUMAN	C	336	ENSP00000305976:R336C	ENSP00000305976:R336C	R	+	1	0	SIK2	111080978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.810000	0.62598	2.700000	0.92200	0.563000	0.77884	CGC	SIK2	-	pirsf_Ser/Thr_kinase_SIK1/2	ENSG00000170145		0.463	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK2	HGNC	protein_coding	OTTHUMT00000319352.3	114	0.00	0	C	NM_015191		111575768	111575768	+1	no_errors	ENST00000304987	ensembl	human	known	69_37n	missense	97	30.22	42	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158653171	158653171	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:158653171T>C	ENST00000368147.4	-	3	560	c.380A>G	c.(379-381)gAa>gGa	p.E127G		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	127				Missing (in Ref. 3; AAA60575). {ECO:0000305}.	actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTTCGTTTCTTCGTGGGCAGA	0.388																																						dbGAP											0													206.0	182.0	189.0					1																	158653171		1835	4090	5925	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.380A>G	1.37:g.158653171T>C	ENSP00000357129:p.Glu127Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E127G	ENST00000368147.4	37	c.380	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.496809	0.64186	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.55052	0.54;0.54	6.17	6.17	0.99709	.	0.254426	0.20534	N	0.090457	T	0.60196	0.2250	L	0.60455	1.87	0.58432	D	0.999998	P	0.36616	0.561	P	0.55161	0.77	T	0.61322	-0.7086	10	0.54805	T	0.06	.	15.6572	0.77150	0.0:0.0:0.0:1.0	.	127	P02549	SPTA1_HUMAN	G	127	ENSP00000357130:E127G;ENSP00000357129:E127G	ENSP00000357129:E127G	E	-	2	0	SPTA1	156919795	1.000000	0.71417	0.973000	0.42090	0.010000	0.07245	6.644000	0.74338	2.371000	0.80710	0.533000	0.62120	GAA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.388	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	140	0.00	0	T	NM_003126		158653171	158653171	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	149	36.44	86	SNP	1.000	C
SUGP2	10147	genome.wustl.edu	37	19	19115425	19115425	+	Silent	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr19:19115425G>A	ENST00000601879.1	-	7	2778	c.2481C>T	c.(2479-2481)ttC>ttT	p.F827F	SUGP2_ENST00000452918.2_Silent_p.F827F|SUGP2_ENST00000337018.6_Silent_p.F827F|SUGP2_ENST00000600377.1_Silent_p.F841F|SUGP2_ENST00000456085.2_Silent_p.F596F			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	827					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GATAGAATTTGAAAGCAGAAC	0.418																																						dbGAP											0													59.0	59.0	59.0					19																	19115425		2196	4296	6492	-	-	-	SO:0001819	synonymous_variant	0			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.2481C>T	19.37:g.19115425G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Silent	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.F827	ENST00000601879.1	37	c.2481	CCDS12392.1	19																																																																																			SUGP2	-	pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	ENSG00000064607		0.418	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SUGP2	HGNC	protein_coding	OTTHUMT00000464627.1	141	0.00	0	G	NM_001017392		19115425	19115425	-1	no_errors	ENST00000337018	ensembl	human	known	69_37n	silent	93	23.77	29	SNP	1.000	A
SYNDIG1L	646658	genome.wustl.edu	37	14	74874370	74874370	+	Silent	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr14:74874370G>A	ENST00000554823.1	-	3	646	c.585C>T	c.(583-585)gaC>gaT	p.D195D	SYNDIG1L_ENST00000331628.3_Silent_p.D195D			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	195					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						CCAGGCGGAAGTCCCCTTTGG	0.662																																						dbGAP											0													70.0	93.0	86.0					14																	74874370		2144	4252	6396	-	-	-	SO:0001819	synonymous_variant	0				CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.585C>T	14.37:g.74874370G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Interferon-induced_TM_protein	p.D195	ENST00000554823.1	37	c.585	CCDS41970.1	14																																																																																			SYNDIG1L	-	pfam_Interferon-induced_TM_protein	ENSG00000183379		0.662	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYNDIG1L	HGNC	protein_coding	OTTHUMT00000412341.1	32	0.00	0	G	XM_938515		74874370	74874370	-1	no_errors	ENST00000331628	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	1.000	A
TBX22	50945	genome.wustl.edu	37	X	79282218	79282218	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chrX:79282218A>G	ENST00000373294.5	+	5	677	c.649A>G	c.(649-651)Atg>Gtg	p.M217V	TBX22_ENST00000373296.3_Missense_Mutation_p.M217V|TBX22_ENST00000442340.1_Missense_Mutation_p.M97V|TBX22_ENST00000373291.1_Missense_Mutation_p.M97V	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	217					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TCTGCAATCCATGCATAAGTA	0.483																																						dbGAP											0													148.0	121.0	130.0					X																	79282218		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.649A>G	X.37:g.79282218A>G	ENSP00000362390:p.Met217Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.M217V	ENST00000373294.5	37	c.649	CCDS14445.1	X	.	.	.	.	.	.	.	.	.	.	A	18.67	3.674156	0.67928	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44	3.88	3.88	0.44766	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94135	0.8119	H	0.96175	3.78	0.80722	D	1	D	0.59767	0.986	P	0.53518	0.728	D	0.94718	0.7898	10	0.87932	D	0	.	9.9835	0.41828	1.0:0.0:0.0:0.0	.	217	Q9Y458	TBX22_HUMAN	V	217;97;217;97	ENSP00000362393:M217V;ENSP00000396394:M97V;ENSP00000362390:M217V;ENSP00000362388:M97V	ENSP00000362388:M97V	M	+	1	0	TBX22	79168874	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.151000	0.89636	1.547000	0.49401	0.486000	0.48141	ATG	TBX22	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	ENSG00000122145		0.483	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	170	0.00	0	A	NM_016954		79282218	79282218	+1	no_errors	ENST00000373294	ensembl	human	known	69_37n	missense	123	44.09	97	SNP	1.000	G
TLR4	7099	genome.wustl.edu	37	9	120475992	120475992	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr9:120475992A>G	ENST00000355622.6	+	3	1687	c.1586A>G	c.(1585-1587)cAc>cGc	p.H529R	TLR4_ENST00000394487.4_Missense_Mutation_p.H489R|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	529					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	AATATGAGCCACAACAACTTC	0.413																																						dbGAP											0													94.0	86.0	89.0					9																	120475992		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1586A>G	9.37:g.120475992A>G	ENSP00000363089:p.His529Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.H529R	ENST00000355622.6	37	c.1586	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	A	10.27	1.305227	0.23736	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.00932	5.53;5.53	5.82	4.67	0.58626	.	0.338620	0.29178	N	0.012904	T	0.00906	0.0030	N	0.21194	0.64	0.30148	N	0.803311	B	0.29766	0.256	B	0.25291	0.059	T	0.41342	-0.9514	10	0.21540	T	0.41	.	13.2664	0.60135	0.8677:0.1322:0.0:0.0	.	529	O00206	TLR4_HUMAN	R	489;529	ENSP00000377997:H489R;ENSP00000363089:H529R	ENSP00000363089:H529R	H	+	2	0	TLR4	119515813	1.000000	0.71417	0.995000	0.50966	0.322000	0.28314	4.872000	0.63050	1.013000	0.39391	0.528000	0.53228	CAC	TLR4	-	pirsf_Toll-like_receptor,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136869		0.413	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	98	0.00	0	A	NM_138554		120475992	120475992	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	84	34.38	44	SNP	1.000	G
TNXB	7148	genome.wustl.edu	37	6	32029331	32029331	+	Silent	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr6:32029331G>A	ENST00000375244.3	-	21	7536	c.7335C>T	c.(7333-7335)taC>taT	p.Y2445Y	TNXB_ENST00000375247.2_Silent_p.Y2445Y			P22105	TENX_HUMAN	tenascin XB	2505	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCCTGTCCTTGTACTGCACGG	0.672																																						dbGAP											0													51.0	58.0	56.0					6																	32029331		1182	2489	3671	-	-	-	SO:0001819	synonymous_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.7335C>T	6.37:g.32029331G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.Y2445	ENST00000375244.3	37	c.7335		6																																																																																			TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.672	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	50	0.00	0	G	NM_019105		32029331	32029331	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	silent	42	23.64	13	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	121	0.00	0	G	NM_000546		7578212	7578212	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	23	57.41	31	SNP	0.893	A
TRAM1L1	133022	genome.wustl.edu	37	4	118005694	118005695	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C|A	C|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr4:118005694_118005695CA>AG	ENST00000310754.4	-	1	1041_1042	c.855_856TG>CT	c.(853-858)gaTGcc>gaCTcc	p.A286S		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	286	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						CCAGTAAGGGCATCAGGATTCC	0.446																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.855_856delinsAG	4.37:g.118005694_118005695delinsAG	ENSP00000309402:p.Ala286Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2L7	Missense_Mutation|Silent	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.A286S|p.D285	ENST00000310754.4	37	c.856|c.855	CCDS3707.1	4																																																																																			TRAM1L1	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	ENSG00000174599		0.446	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM1L1	HGNC	protein_coding	OTTHUMT00000256513.1	122|121	0.00	0	C|A	NM_152402		118005694|118005695	118005694|118005695	-1	no_errors	ENST00000310754	ensembl	human	known	69_37n	missense|silent	96|98	27.82|27.94	37|38	SNP	0.000	A|G
TRBV6-8	28599	genome.wustl.edu	37	7	142124359	142124359	+	RNA	SNP	A	A	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr7:142124359A>G	ENST00000390376.2	-	0	118									T cell receptor beta variable 6-8																		GGCACACTGCAGTGTCATGCT	0.507																																						dbGAP											0													121.0	115.0	117.0					7																	142124359		1944	4148	6092	-	-	-			0			L36092		7q34	2012-02-07			ENSG00000253534	ENSG00000253534		"""T cell receptors / TRB locus"""	12233	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV68, TCRBV13S7P, TCRBV6S8			OTTHUMG00000158916		7.37:g.142124359A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L40P	ENST00000390376.2	37	c.119		7																																																																																			TRBV6-8	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000253534		0.507	TRBV6-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV6-8	HGNC	TR_V_gene	OTTHUMT00000352531.2	293	0.00	0	A	NG_001333		142124359	142124359	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390376	ensembl	human	known	69_37n	missense	304	28.57	122	SNP	0.001	G
TRIOBP	11078	genome.wustl.edu	37	22	38155444	38155444	+	Intron	DEL	G	G	-			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr22:38155444delG	ENST00000406386.3	+	17	6579				TRIOBP_ENST00000407319.2_Frame_Shift_Del_p.V402fs|TRIOBP_ENST00000403663.2_Intron	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein						actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					tgatcactgtgcccgttttac	0.557																																						dbGAP											0													139.0	140.0	140.0					22																	38155444		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6324+173G>-	22.37:g.38155444delG		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Del	DEL	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V404fs	ENST00000406386.3	37	c.1206	CCDS43015.1	22																																																																																			TRIOBP	-	NULL	ENSG00000100106		0.557	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	90	0.00	0	G			38155444	38155444	+1	no_errors	ENST00000407319	ensembl	human	known	69_37n	frame_shift_del	32	35.29	18	DEL	1.000	-
TRIOBP	11078	genome.wustl.edu	37	22	38155468	38155469	+	Intron	INS	-	-	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr22:38155468_38155469insA	ENST00000406386.3	+	17	6579				TRIOBP_ENST00000407319.2_Frame_Shift_Ins_p.S411fs|TRIOBP_ENST00000403663.2_Intron	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein						actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					caaggccactgagctctgagag	0.564																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6324+197->A	22.37:g.38155469_38155469dupA		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Ins	INS	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S410fs	ENST00000406386.3	37	c.1230_1231	CCDS43015.1	22																																																																																			TRIOBP	-	NULL	ENSG00000100106		0.564	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	73	0.00	0	-			38155468	38155469	+1	no_errors	ENST00000407319	ensembl	human	known	69_37n	frame_shift_ins	26	38.10	16	INS	1.000:1.000	A
TUBB4B	10383	genome.wustl.edu	37	9	140137915	140137915	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr9:140137915G>A	ENST00000340384.4	+	4	1393	c.1245G>A	c.(1243-1245)atG>atA	p.M415I		NM_006088.5	NP_006079.1	P68371	TBB4B_HUMAN	tubulin, beta 4B class IVb	415					'de novo' posttranslational protein folding (GO:0051084)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|unfolded protein binding (GO:0051082)									Albendazole(DB00518)|Mebendazole(DB00643)	AGAGCAACATGAATGACCTGG	0.627																																						dbGAP											0													105.0	100.0	101.0					9																	140137915		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019359	CCDS7039.1	9q34.3	2011-10-10	2011-10-10	2011-10-10	ENSG00000188229	ENSG00000188229		"""Tubulins"""	20771	protein-coding gene	gene with protein product	"""class IVb beta-tubulin"""	602660	"""tubulin, beta 2C"""	TUBB2C		3999141	Standard	NM_006088		Approved	Beta2	uc004cmh.1	P68371	OTTHUMG00000131783	ENST00000340384.4:c.1245G>A	9.37:g.140137915G>A	ENSP00000341289:p.Met415Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BFA2|P05217	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.M415I	ENST00000340384.4	37	c.1245	CCDS7039.1	9	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089281	0.36855	.	.	ENSG00000188229	ENST00000340384	D	0.82984	-1.67	5.57	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.86711	0.5998	M	0.88377	2.95	0.58432	D	0.999994	B	0.14012	0.009	B	0.30316	0.114	D	0.85493	0.1186	10	0.87932	D	0	.	13.3812	0.60768	0.0765:0.0:0.9235:0.0	.	415	P68371	TBB4B_HUMAN	I	415	ENSP00000341289:M415I	ENSP00000341289:M415I	M	+	3	0	TUBB2C	139257736	1.000000	0.71417	0.996000	0.52242	0.940000	0.58332	7.798000	0.85924	1.357000	0.45904	0.655000	0.94253	ATG	TUBB4B	-	superfamily_Tub_FtsZ_C,prints_Beta_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	ENSG00000188229		0.627	TUBB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB4B	HGNC	protein_coding	OTTHUMT00000254715.1	54	0.00	0	G	NM_006088		140137915	140137915	+1	no_errors	ENST00000340384	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	A
TUBGCP6	85378	genome.wustl.edu	37	22	50682186	50682187	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr22:50682186_50682187insG	ENST00000248846.5	-	1	806_807	c.702_703insC	c.(700-705)cccgtgfs	p.V235fs	TUBGCP6_ENST00000439308.2_Frame_Shift_Ins_p.V235fs|HDAC10_ENST00000498366.1_5'Flank|MAPK12_ENST00000497036.1_5'Flank			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	235					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TTGTCTGGCACGGGGGGCAGGC	0.559																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.703dupC	22.37:g.50682192_50682192dupG	ENSP00000248846:p.Val235fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Frame_Shift_Ins	INS	pfam_Spc97_Spc98	p.V234fs	ENST00000248846.5	37	c.703_702	CCDS14087.1	22																																																																																			TUBGCP6	-	NULL	ENSG00000128159		0.559	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	HGNC	protein_coding	OTTHUMT00000075004.3	24	0.00	0	-	NM_020461		50682186	50682187	-1	no_errors	ENST00000248846	ensembl	human	known	69_37n	frame_shift_ins	10	16.67	2	INS	0.995:0.063	G
UBR1	197131	genome.wustl.edu	37	15	43347026	43347026	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr15:43347026C>A	ENST00000290650.4	-	12	1431	c.1353G>T	c.(1351-1353)gaG>gaT	p.E451D	UBR1_ENST00000382177.2_Missense_Mutation_p.E451D	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	451					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TGTCCAAGTACTCAGGTAAAA	0.363																																						dbGAP											0													142.0	136.0	138.0					15																	43347026		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.1353G>T	15.37:g.43347026C>A	ENSP00000290650:p.Glu451Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E451D	ENST00000290650.4	37	c.1353	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772362	0.49680	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.50813	0.73;0.73	5.59	1.52	0.23074	.	0.000000	0.85682	D	0.000000	T	0.31702	0.0805	L	0.33485	1.01	0.50813	D	0.999892	B;B	0.21606	0.016;0.058	B;B	0.20184	0.006;0.028	T	0.06570	-1.0819	10	0.18710	T	0.47	-0.5138	9.6372	0.39817	0.0:0.5954:0.0:0.4046	.	451;451	B4DYL2;Q8IWV7	.;UBR1_HUMAN	D	451	ENSP00000290650:E451D;ENSP00000371612:E451D	ENSP00000290650:E451D	E	-	3	2	UBR1	41134318	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	0.446000	0.21694	0.291000	0.22468	0.655000	0.94253	GAG	UBR1	-	NULL	ENSG00000159459		0.363	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	296	0.00	0	C	NM_174916		43347026	43347026	-1	no_errors	ENST00000290650	ensembl	human	known	69_37n	missense	170	40.35	115	SNP	0.998	A
UCP2	7351	genome.wustl.edu	37	11	73689330	73689330	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr11:73689330A>T	ENST00000310473.3	-	3	936	c.94T>A	c.(94-96)Ttt>Att	p.F32I	UCP2_ENST00000536983.1_Missense_Mutation_p.F32I|UCP2_ENST00000542615.1_5'Flank	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	32					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					TCCAGAGGAAAGGTGATGAGA	0.547																																					Colon(191;388 2040 43557 45622 48925)	dbGAP											0													97.0	96.0	96.0					11																	73689330		2200	4293	6493	-	-	-	SO:0001583	missense	0			U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.94T>A	11.37:g.73689330A>T	ENSP00000312029:p.Phe32Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4PJH8|Q53HM3	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.F32I	ENST00000310473.3	37	c.94	CCDS8228.1	11	.	.	.	.	.	.	.	.	.	.	A	18.51	3.640744	0.67244	.	.	ENSG00000175567	ENST00000310473;ENST00000536983;ENST00000539764	T;T;T	0.80566	-1.2;-1.2;-1.39	5.77	4.64	0.57946	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.81819	0.4903	L	0.55017	1.72	0.58432	D	0.999998	P;P	0.52463	0.953;0.812	P;P	0.53035	0.716;0.701	T	0.79495	-0.1780	10	0.34782	T	0.22	-10.4229	11.0327	0.47783	0.9264:0.0:0.0736:0.0	.	32;32	F5GX45;P55851	.;UCP2_HUMAN	I	32	ENSP00000312029:F32I;ENSP00000441147:F32I;ENSP00000438230:F32I	ENSP00000312029:F32I	F	-	1	0	UCP2	73366978	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.401000	0.79962	1.114000	0.41781	0.533000	0.62120	TTT	UCP2	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000175567		0.547	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP2	HGNC	protein_coding	OTTHUMT00000398108.1	95	0.00	0	A	NM_003355		73689330	73689330	-1	no_errors	ENST00000310473	ensembl	human	known	69_37n	missense	54	50.89	57	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	215848573	215848573	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:215848573T>C	ENST00000307340.3	-	63	13066	c.12680A>G	c.(12679-12681)gAc>gGc	p.D4227G	USH2A_ENST00000366943.2_Missense_Mutation_p.D4227G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4227	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAAACCTGTGTCATTATACAT	0.413										HNSCC(13;0.011)																												dbGAP											0													114.0	111.0	112.0					1																	215848573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12680A>G	1.37:g.215848573T>C	ENSP00000305941:p.Asp4227Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.D4227G	ENST00000307340.3	37	c.12680	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.029721	0.54790	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.57273	0.41;0.41	5.14	5.14	0.70334	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.47093	D	0.000244	T	0.71290	0.3322	M	0.83223	2.63	0.41965	D	0.990725	D	0.65815	0.995	D	0.64595	0.927	T	0.76402	-0.2972	10	0.72032	D	0.01	.	11.6279	0.51156	0.0:0.0:0.1485:0.8515	.	4227	O75445	USH2A_HUMAN	G	4227	ENSP00000305941:D4227G;ENSP00000355910:D4227G	ENSP00000305941:D4227G	D	-	2	0	USH2A	213915196	1.000000	0.71417	0.986000	0.45419	0.480000	0.33159	1.507000	0.35758	1.934000	0.56057	0.533000	0.62120	GAC	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	230	0.00	0	T	NM_007123		215848573	215848573	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	302	27.23	113	SNP	1.000	C
WDR4	10785	genome.wustl.edu	37	21	44270341	44270342	+	Frame_Shift_Ins	INS	-	-	A	rs200755631|rs149022976		TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr21:44270341_44270342insA	ENST00000398208.2	-	11	1115_1116	c.1056_1057insT	c.(1054-1059)ggcgcafs	p.A353fs	WDR4_ENST00000330317.2_Frame_Shift_Ins_p.A353fs|WDR4_ENST00000492742.1_5'UTR	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4											haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		CTGGCGTCTGCGCCGGCAGAGC	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.1056_1057insT	21.37:g.44270341_44270342insA	ENSP00000381266:p.Ala353fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A352fs	ENST00000398208.2	37	c.1057_1056	CCDS13691.1	21																																																																																			WDR4	-	NULL	ENSG00000160193		0.604	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR4	HGNC	protein_coding	OTTHUMT00000195479.1	78	0.00	0	-			44270341	44270342	-1	no_errors	ENST00000330317	ensembl	human	known	69_37n	frame_shift_ins	40	62.26	66	INS	0.000:0.000	A
WDR4	10785	genome.wustl.edu	37	21	44270347	44270348	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr21:44270347_44270348insA	ENST00000398208.2	-	11	1109_1110	c.1050_1051insT	c.(1048-1053)tctgccfs	p.A351fs	WDR4_ENST00000330317.2_Frame_Shift_Ins_p.A351fs|WDR4_ENST00000492742.1_5'UTR	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4											haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		TCTGCGCCGGCAGAGCCTGTGA	0.614																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.1051dupT	21.37:g.44270348_44270348dupA	ENSP00000381266:p.Ala351fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A350fs	ENST00000398208.2	37	c.1051_1050	CCDS13691.1	21																																																																																			WDR4	-	NULL	ENSG00000160193		0.614	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR4	HGNC	protein_coding	OTTHUMT00000195479.1	76	0.00	0	-			44270347	44270348	-1	no_errors	ENST00000330317	ensembl	human	known	69_37n	frame_shift_ins	38	64.15	68	INS	0.000:0.000	A
WIF1	11197	genome.wustl.edu	37	12	65514265	65514265	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr12:65514265delG	ENST00000286574.4	-	2	594	c.220delC	c.(220-222)caafs	p.Q75fs		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	75	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		ATTCTCTGTTGTGCTTTTCTG	0.358			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)	dbGAP		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	0													142.0	145.0	144.0					12																	65514265		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.220delC	12.37:g.65514265delG	ENSP00000286574:p.Gln75fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXI1|Q8WVG4	Frame_Shift_Del	DEL	pfam_WIF,pfam_EGF_extracell,smart_WIF,smart_EGF-like,pfscan_EG-like_dom,pfscan_WIF,prints_Wnt-inh	p.Q74fs	ENST00000286574.4	37	c.220	CCDS8971.1	12																																																																																			WIF1	-	pfam_WIF,smart_WIF,pfscan_WIF,prints_Wnt-inh	ENSG00000156076		0.358	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIF1	HGNC	protein_coding	OTTHUMT00000401258.2	58	0.00	0	G			65514265	65514265	-1	no_errors	ENST00000286574	ensembl	human	known	69_37n	frame_shift_del	63	38.68	41	DEL	1.000	-
ZNF319	57567	genome.wustl.edu	37	16	58031098	58031098	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr16:58031098G>C	ENST00000299237.2	-	2	1694	c.1072C>G	c.(1072-1074)Ctg>Gtg	p.L358V	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						TGGCGCATCAGTGCGTACTGC	0.647																																						dbGAP											0													75.0	69.0	71.0					16																	58031098		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.1072C>G	16.37:g.58031098G>C	ENSP00000299237:p.Leu358Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LH8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L358V	ENST00000299237.2	37	c.1072	CCDS32462.1	16	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049502	0.36181	.	.	ENSG00000166188	ENST00000299237	T	0.52983	0.64	5.21	4.24	0.50183	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.69788	0.3150	M	0.90870	3.155	0.52501	D	0.999956	P	0.49447	0.924	P	0.57468	0.821	T	0.77281	-0.2646	10	0.72032	D	0.01	-21.3568	13.2622	0.60111	0.0783:0.0:0.9217:0.0	.	358	Q9P2F9	ZN319_HUMAN	V	358	ENSP00000299237:L358V	ENSP00000299237:L358V	L	-	1	2	ZNF319	56588599	1.000000	0.71417	0.931000	0.37212	0.005000	0.04900	5.750000	0.68712	2.423000	0.82170	0.655000	0.94253	CTG	ZNF319	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000166188		0.647	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF319	HGNC	protein_coding	OTTHUMT00000430317.1	19	0.00	0	G			58031098	58031098	-1	no_errors	ENST00000299237	ensembl	human	known	69_37n	missense	1	87.50	7	SNP	1.000	C
ZNF407	55628	genome.wustl.edu	37	18	72343892	72343892	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr18:72343892G>C	ENST00000299687.5	+	1	917	c.917G>C	c.(916-918)aGa>aCa	p.R306T	ZNF407_ENST00000577538.1_Missense_Mutation_p.R306T|ZNF407_ENST00000309902.6_Missense_Mutation_p.R306T|ZNF407_ENST00000582337.1_Missense_Mutation_p.R306T	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TCAAAACCAAGAACTTCTAAA	0.343																																						dbGAP											0													103.0	105.0	105.0					18																	72343892		1835	4090	5925	-	-	-	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.917G>C	18.37:g.72343892G>C	ENSP00000299687:p.Arg306Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.R306T	ENST00000299687.5	37	c.917	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646232	0.67358	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.10763	2.84;3.32	5.18	4.31	0.51392	.	0.362432	0.15963	U	0.236167	T	0.19248	0.0462	L	0.53249	1.67	0.09310	N	1	B;D;B	0.56035	0.102;0.974;0.062	B;P;B	0.56343	0.055;0.796;0.025	T	0.15809	-1.0424	10	0.18276	T	0.48	.	9.1638	0.37038	0.075:0.2663:0.6587:0.0	.	306;306;306	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	T	306	ENSP00000299687:R306T;ENSP00000310359:R306T	ENSP00000299687:R306T	R	+	2	0	ZNF407	70472880	0.183000	0.23186	0.377000	0.26055	0.758000	0.43043	1.312000	0.33574	-0.223000	0.09943	0.533000	0.62120	AGA	ZNF407	-	NULL	ENSG00000215421		0.343	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	184	0.00	0	G	NM_017757		72343892	72343892	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	missense	98	18.18	22	SNP	0.001	C
ZNF671	79891	genome.wustl.edu	37	19	58232832	58232832	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr19:58232832C>T	ENST00000317398.6	-	4	717	c.622G>A	c.(622-624)Gac>Aac	p.D208N	ZNF671_ENST00000335820.3_Missense_Mutation_p.D110N|ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGGTGCTGGTCAAAGTCTGTA	0.502																																						dbGAP											0													139.0	132.0	135.0					19																	58232832		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.622G>A	19.37:g.58232832C>T	ENSP00000321848:p.Asp208Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF07|Q9H5E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D208N	ENST00000317398.6	37	c.622	CCDS12961.1	19	.	.	.	.	.	.	.	.	.	.	C	13.37	2.218275	0.39201	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.27402	1.67;1.67	2.45	-2.07	0.07276	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10895	0.0266	N	0.04297	-0.235	0.09310	N	1	B	0.17038	0.02	B	0.19391	0.025	T	0.37314	-0.9711	9	0.13108	T	0.6	.	4.9308	0.13916	0.0:0.5176:0.2982:0.1842	.	208	Q8TAW3	ZN671_HUMAN	N	208;110	ENSP00000321848:D208N;ENSP00000338670:D110N	ENSP00000321848:D208N	D	-	1	0	ZNF671	62924644	0.000000	0.05858	0.006000	0.13384	0.365000	0.29674	-2.416000	0.01035	-0.084000	0.12595	0.467000	0.42956	GAC	ZNF671	-	pfscan_Znf_C2H2	ENSG00000083814		0.502	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	HGNC	protein_coding	OTTHUMT00000466817.1	139	0.00	0	C	NM_024833		58232832	58232832	-1	no_errors	ENST00000317398	ensembl	human	known	69_37n	missense	117	13.33	18	SNP	0.325	T
PI4KB	5298	genome.wustl.edu	37	1	151263360	151263361	+	IGR	INS	-	-	G			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr1:151263360_151263361insG	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_3'UTR			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGGTTGAGGGTGGAGGATGGTG	0.639																																					Colon(154;765 1838 9854 28443 37492)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151263362_151263362dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1131fs	ENST00000368873.1	37	c.3389_3390		1																																																																																			ZNF687	-	NULL	ENSG00000143373		0.639	PI4KB-002	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding	OTTHUMT00000034400.3	31	0.00	0	-	NM_002651		151263360	151263361	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	frame_shift_ins	14	36.36	8	INS	1.000:1.000	G
ZNF737	100129842	genome.wustl.edu	37	19	20728192	20728192	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0JB-01A-11W-A071-09	TCGA-AO-A0JB-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4f06be-2a16-4ae2-9dd4-5d87f480810b	f51b5a75-a541-4589-b883-7f651a2612c9	g.chr19:20728192T>C	ENST00000427401.4	-	4	911	c.817A>G	c.(817-819)Act>Gct	p.T273A		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	273					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TTATGTGTAGTAAGGTTAGAG	0.408																																						dbGAP											0													40.0	39.0	39.0					19																	20728192		692	1591	2283	-	-	-	SO:0001583	missense	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.817A>G	19.37:g.20728192T>C	ENSP00000395733:p.Thr273Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JHM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T273A	ENST00000427401.4	37	c.817	CCDS54238.1	19	.	.	.	.	.	.	.	.	.	.	-	5.027	0.190608	0.09547	.	.	ENSG00000237440	ENST00000427401	T	0.07216	3.21	0.801	0.801	0.18679	.	.	.	.	.	T	0.04182	0.0116	N	0.11064	0.09	0.09310	N	1	B	0.23806	0.091	B	0.26416	0.069	T	0.43261	-0.9402	9	0.38643	T	0.18	.	3.5302	0.07774	0.0:0.0:0.417:0.583	.	273	C9JHM3	.	A	273	ENSP00000395733:T273A	ENSP00000395733:T273A	T	-	1	0	ZNF737	20520032	0.000000	0.05858	0.031000	0.17742	0.031000	0.12232	0.303000	0.19210	0.147000	0.19030	0.145000	0.16022	ACT	ZNF737	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000237440		0.408	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF737	HGNC	protein_coding	OTTHUMT00000447844.2	263	0.38	1	T	NM_145289		20728192	20728192	-1	no_errors	ENST00000427401	ensembl	human	known	69_37n	missense	241	35.39	132	SNP	0.005	C
