#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AKAP13	11214	genome.wustl.edu	37	15	86122377	86122377	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr15:86122377G>A	ENST00000394518.2	+	7	1173	c.1078G>A	c.(1078-1080)Gtt>Att	p.V360I	AKAP13_ENST00000361243.2_Missense_Mutation_p.V360I|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	360					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GTCAAGCATAGTTGAGGAGGA	0.502																																					Melanoma(94;603 1453 3280 32295 32951)	dbGAP											0													69.0	71.0	70.0					15																	86122377		2202	4299	6501	-	-	-	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1078G>A	15.37:g.86122377G>A	ENSP00000378026:p.Val360Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.V360I	ENST00000394518.2	37	c.1078	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	9.186	1.024729	0.19433	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.11495	2.79;2.77	5.52	-0.805	0.10879	.	.	.	.	.	T	0.06735	0.0172	N	0.24115	0.695	0.09310	N	0.999999	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.35425	-0.9789	9	0.56958	D	0.05	.	5.5773	0.17231	0.4049:0.1368:0.4583:0.0	.	360;360	Q12802;Q12802-2	AKP13_HUMAN;.	I	360;360;359;359	ENSP00000354718:V360I;ENSP00000378026:V360I	ENSP00000354718:V360I	V	+	1	0	AKAP13	83923381	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.260000	0.18424	-0.083000	0.12618	-1.261000	0.01458	GTT	AKAP13	-	NULL	ENSG00000170776		0.502	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	142	0.00	0	G	NM_007200		86122377	86122377	+1	no_errors	ENST00000361243	ensembl	human	known	69_37n	missense	144	24.21	46	SNP	0.000	A
AQP10	89872	genome.wustl.edu	37	1	154295794	154295794	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:154295794C>A	ENST00000324978.3	+	4	488	c.448C>A	c.(448-450)Cct>Act	p.P150T	ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000484864.1_Missense_Mutation_p.P150T|AQP10_ENST00000355197.4_3'UTR	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	150					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGCCACCTATCCTGCCCCCTA	0.567																																						dbGAP											0													115.0	115.0	115.0					1																	154295794		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.448C>A	1.37:g.154295794C>A	ENSP00000318355:p.Pro150Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_3,tigrfam_Aquaporin	p.P150T	ENST00000324978.3	37	c.448	CCDS1065.1	1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631067	0.87660	.	.	ENSG00000143595	ENST00000324978;ENST00000484864	T;T	0.14144	2.53;2.53	5.04	5.04	0.67666	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	T	0.46288	0.1385	H	0.96048	3.76	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63839	-0.6546	10	0.87932	D	0	.	17.1739	0.86836	0.0:1.0:0.0:0.0	.	150;150	Q96PS8-2;Q96PS8	.;AQP10_HUMAN	T	150	ENSP00000318355:P150T;ENSP00000420341:P150T	ENSP00000318355:P150T	P	+	1	0	AQP10	152562418	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.810000	0.69179	2.644000	0.89710	0.555000	0.69702	CCT	AQP10	-	pfam_MIP,superfamily_Aquaporin-like,tigrfam_Aquaporin	ENSG00000143595		0.567	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP10	HGNC	protein_coding	OTTHUMT00000087661.1	79	0.00	0	C	NM_080429		154295794	154295794	+1	no_errors	ENST00000324978	ensembl	human	known	69_37n	missense	66	21.43	18	SNP	1.000	A
ARHGEF40	55701	genome.wustl.edu	37	14	21549827	21549828	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr14:21549827_21549828insA	ENST00000298694.4	+	14	2927_2928	c.2800_2801insA	c.(2800-2802)gccfs	p.A934fs	ARHGEF40_ENST00000298693.3_Frame_Shift_Ins_p.A934fs			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	934						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						CAGCCCAGCAGCCCTGCGAGAA	0.718																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		Exception_encountered	14.37:g.21549827_21549828insA	ENSP00000298694:p.Ala934fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Frame_Shift_Ins	INS	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.A934fs	ENST00000298694.4	37	c.2800_2801	CCDS32041.1	14																																																																																			ARHGEF40	-	NULL	ENSG00000165801		0.718	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	HGNC	protein_coding	OTTHUMT00000413122.1	13	0.00	0	-			21549827	21549828	+1	no_errors	ENST00000298694	ensembl	human	known	69_37n	frame_shift_ins	15	61.54	24	INS	0.989:0.985	A
ATG13	9776	genome.wustl.edu	37	11	46686403	46686403	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr11:46686403C>A	ENST00000434074.1	+	11	1483	c.794C>A	c.(793-795)tCa>tAa	p.S265*	ATG13_ENST00000451945.1_Intron|ATG13_ENST00000526508.1_Nonsense_Mutation_p.S265*|ATG13_ENST00000530500.1_Intron|ATG13_ENST00000524625.1_Intron|ATG13_ENST00000528494.1_Nonsense_Mutation_p.S298*|ATG13_ENST00000359513.4_Nonsense_Mutation_p.S265*|ATG13_ENST00000529655.1_Intron|ATG13_ENST00000312040.4_Nonsense_Mutation_p.S265*	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	265					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						GCTTAGCTCTCAAGCTCTCGC	0.478																																						dbGAP											0													141.0	126.0	131.0					11																	46686403		1566	3581	5147	-	-	-	SO:0001587	stop_gained	0			AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.794C>A	11.37:g.46686403C>A	ENSP00000400642:p.Ser265*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Nonsense_Mutation	SNP	pfam_Autophagy-rel_p13	p.S265*	ENST00000434074.1	37	c.794	CCDS44582.1	11	.	.	.	.	.	.	.	.	.	.	C	38	7.126536	0.98081	.	.	ENSG00000175224	ENST00000434074;ENST00000312040;ENST00000526508;ENST00000359513;ENST00000528494	.	.	.	5.57	5.57	0.84162	.	0.379952	0.28016	N	0.016931	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-35.3081	14.7451	0.69485	0.0:0.8555:0.1444:0.0	.	.	.	.	X	265;265;265;265;298	.	ENSP00000310321:S265X	S	+	2	0	ATG13	46642979	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.294000	0.51787	2.614000	0.88457	0.563000	0.77884	TCA	ATG13	-	NULL	ENSG00000175224		0.478	ATG13-202	KNOWN	basic|CCDS	protein_coding	ATG13	HGNC	protein_coding	OTTHUMT00000390300.2	119	0.00	0	C	NM_014741		46686403	46686403	+1	no_errors	ENST00000312040	ensembl	human	known	69_37n	nonsense	80	35.48	44	SNP	1.000	A
ATP1A3	478	genome.wustl.edu	37	19	42482824	42482824	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:42482824C>T	ENST00000302102.5	-	12	1714	c.1564G>A	c.(1564-1566)Gag>Aag	p.E522K	ATP1A3_ENST00000602133.1_Missense_Mutation_p.E492K|ATP1A3_ENST00000543770.1_Missense_Mutation_p.E533K|ATP1A3_ENST00000545399.1_Missense_Mutation_p.E535K	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	522					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						TTCATTTCCTCGTCCAGAGGC	0.652																																						dbGAP											0													77.0	72.0	74.0					19																	42482824		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.1564G>A	19.37:g.42482824C>T	ENSP00000302397:p.Glu522Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.E535K	ENST00000302102.5	37	c.1603	CCDS12594.1	19	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815205	0.50527	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	4.02	4.02	0.46733	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.182541	0.44688	D	0.000433	T	0.72277	0.3440	L	0.41079	1.255	0.54753	D	0.999987	B;B;B;B	0.18741	0.001;0.0;0.03;0.0	B;B;B;B	0.15052	0.004;0.001;0.012;0.002	T	0.68217	-0.5467	10	0.29301	T	0.29	.	14.0577	0.64779	0.0:1.0:0.0:0.0	.	535;533;522;522	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	K	522;522;535;492;266;533	ENSP00000302397:E522K;ENSP00000411503:E522K;ENSP00000444688:E535K;ENSP00000437577:E533K	ENSP00000302397:E522K	E	-	1	0	ATP1A3	47174664	0.992000	0.36948	0.995000	0.50966	0.811000	0.45836	3.160000	0.50739	2.258000	0.74832	0.561000	0.74099	GAG	ATP1A3	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000105409		0.652	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	HGNC	protein_coding	OTTHUMT00000268107.1	56	0.00	0	C	NM_152296		42482824	42482824	-1	no_errors	ENST00000545399	ensembl	human	known	69_37n	missense	33	20.93	9	SNP	0.997	T
ATP7A	538	genome.wustl.edu	37	X	77268498	77268499	+	In_Frame_Ins	INS	-	-	CTA			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chrX:77268498_77268499insCTA	ENST00000341514.6	+	10	2450_2451	c.2295_2296insCTA	c.(2296-2298)cta>CTActa	p.766_766L>LL	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	766					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGATTATTCTTCTAGTTGCAAT	0.421																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.2296_2298dupCTA	X.37:g.77268499_77268501dupCTA	ENSP00000345728:p.Leu766dup	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AT72|O00227|O00745|Q9BYY8	In_Frame_Ins	INS	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_HG_scavenger,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.766in_frame_insL	ENST00000341514.6	37	c.2295_2296	CCDS35339.1	X																																																																																			ATP7A	-	tigrfam_ATPase_P-typ_heavy-metal	ENSG00000165240		0.421	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7A	HGNC	protein_coding	OTTHUMT00000057306.1	237	0.00	0	-	NM_000052		77268498	77268499	+1	no_errors	ENST00000341514	ensembl	human	known	69_37n	in_frame_ins	200	22.48	58	INS	0.998:1.000	CTA
BAI1	575	genome.wustl.edu	37	8	143558834	143558835	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr8:143558834_143558835insC	ENST00000517894.1	+	6	2205_2206	c.1311_1312insC	c.(1312-1314)cccfs	p.P438fs	BAI1_ENST00000323289.5_Frame_Shift_Ins_p.P438fs			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	438	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GCACCTGCAGGCCCCCCCAGTT	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1318dupC	8.37:g.143558841_143558841dupC	ENSP00000430945:p.Pro438fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.Q439fs	ENST00000517894.1	37	c.1311_1312		8																																																																																			BAI1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000181790		0.653	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	10	0.00	0	-	NM_001702		143558834	143558835	+1	no_errors	ENST00000323289	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.955:1.000	C
BCL3	602	genome.wustl.edu	37	19	45259541	45259541	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:45259541G>T	ENST00000164227.5	+	3	707	c.463G>T	c.(463-465)Gtc>Ttc	p.V155F		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	155					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				GCACCGGCTGGTCAACCTCTT	0.627			T	IGH@	CLL																																	dbGAP		Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	0													38.0	35.0	36.0					19																	45259541		2203	4300	6503	-	-	-	SO:0001583	missense	0			M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.463G>T	19.37:g.45259541G>T	ENSP00000164227:p.Val155Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V155F	ENST00000164227.5	37	c.463	CCDS12642.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.30|16.30	3.084099|3.084099	0.55861|0.55861	.|.	.|.	ENSG00000069399|ENSG00000069399	ENST00000444487|ENST00000403534;ENST00000164227	.|T	.|0.67698	.|-0.28	4.69|4.69	-0.243|-0.243	0.13035|0.13035	.|Ankyrin repeat-containing domain (3);	.|1.199950	.|0.06488	.|N	.|0.734061	T|T	0.62196|0.62196	0.2408|0.2408	M|M	0.69358|0.69358	2.11|2.11	0.09310|0.09310	N|N	1|1	.|D	.|0.52996	.|0.957	.|P	.|0.44921	.|0.464	T|T	0.53774|0.53774	-0.8391|-0.8391	5|10	.|0.87932	.|D	.|0	-6.2027|-6.2027	0.9329|0.9329	0.01339|0.01339	0.2836:0.1656:0.3925:0.1583|0.2836:0.1656:0.3925:0.1583	.|.	.|155	.|P20749	.|BCL3_HUMAN	V|F	38|115;155	.|ENSP00000164227:V155F	.|ENSP00000164227:V155F	G|V	+|+	2|1	0|0	BCL3|BCL3	49951381|49951381	0.960000|0.960000	0.32886|0.32886	0.119000|0.119000	0.21687|0.21687	0.815000|0.815000	0.46073|0.46073	1.787000|1.787000	0.38704|0.38704	-0.210000|-0.210000	0.10140|0.10140	0.462000|0.462000	0.41574|0.41574	GGT|GTC	BCL3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000069399		0.627	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL3	HGNC	protein_coding	OTTHUMT00000322976.1	21	0.00	0	G	NM_005178		45259541	45259541	+1	no_errors	ENST00000164227	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.031	T
BCOR	54880	genome.wustl.edu	37	X	39933528	39933528	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chrX:39933528G>T	ENST00000378444.4	-	4	1299	c.1071C>A	c.(1069-1071)ttC>ttA	p.F357L	BCOR_ENST00000378455.4_Missense_Mutation_p.F357L|BCOR_ENST00000397354.3_Missense_Mutation_p.F357L|BCOR_ENST00000342274.4_Missense_Mutation_p.F357L	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	357					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						AGTGCTTGTGGAACTCCGAGT	0.627			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															dbGAP		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													47.0	35.0	39.0					X																	39933528		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.1071C>A	X.37:g.39933528G>T	ENSP00000367705:p.Phe357Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.F357L	ENST00000378444.4	37	c.1071	CCDS48093.1	X	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369039	0.42003	.	.	ENSG00000183337	ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000406200	T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08	5.56	3.75	0.43078	.	.	.	.	.	T	0.30792	0.0776	L	0.32530	0.975	0.48901	D	0.999725	D;D;D;D	0.67145	0.996;0.996;0.994;0.996	D;D;D;D	0.77557	0.99;0.99;0.977;0.99	T	0.01600	-1.1315	9	0.46703	T	0.11	-19.8023	8.4763	0.33016	0.2522:0.0:0.7478:0.0	.	357;357;357;357	Q6W2J9-3;Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;.;BCOR_HUMAN;.	L	357	ENSP00000367716:F357L;ENSP00000380512:F357L;ENSP00000367705:F357L;ENSP00000345923:F357L;ENSP00000384485:F357L	ENSP00000345923:F357L	F	-	3	2	BCOR	39818472	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	0.912000	0.28597	0.485000	0.27652	0.600000	0.82982	TTC	BCOR	-	NULL	ENSG00000183337		0.627	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	21	0.00	0	G	NM_017745		39933528	39933528	-1	no_errors	ENST00000378444	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	T
BEST2	54831	genome.wustl.edu	37	19	12868799	12868800	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:12868799_12868800insT	ENST00000549706.1	+	10	1762_1763	c.1438_1439insT	c.(1438-1440)cccfs	p.P480fs	BEST2_ENST00000042931.1_Frame_Shift_Ins_p.P480fs|BEST2_ENST00000553030.1_Frame_Shift_Ins_p.P480fs			Q8NFU1	BEST2_HUMAN	bestrophin 2	480					chloride transmembrane transport (GO:1902476)|membrane depolarization (GO:0051899)|sensory perception of smell (GO:0007608)	chloride channel complex (GO:0034707)|cilium (GO:0005929)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	12						GCCTGTCGAGCCCTTCAGCATC	0.718																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF440756	CCDS42506.1	19p13.13	2014-08-12	2006-10-18	2006-10-18	ENSG00000039987	ENSG00000039987		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17107	protein-coding gene	gene with protein product		607335	"""vitelliform macular dystrophy 2-like 1"""	VMD2L1		12032738, 16912113	Standard	NM_017682		Approved	FLJ20132	uc002mux.3	Q8NFU1	OTTHUMG00000169293	Exception_encountered	19.37:g.12868799_12868800insT	ENSP00000448310:p.Pro480fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YQ8|Q9NXP0	Frame_Shift_Ins	INS	pfam_Bestrophin/UPF0187	p.P480fs	ENST00000549706.1	37	c.1438_1439	CCDS42506.1	19																																																																																			BEST2	-	NULL	ENSG00000039987		0.718	BEST2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	BEST2	HGNC	protein_coding	OTTHUMT00000403343.1	13	0.00	0	-	NM_017682		12868799	12868800	+1	no_errors	ENST00000042931	ensembl	human	known	69_37n	frame_shift_ins	1	85.71	6	INS	0.157:0.129	T
C11orf24	53838	genome.wustl.edu	37	11	68029197	68029197	+	Silent	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr11:68029197C>G	ENST00000304271.6	-	4	1668	c.1266G>C	c.(1264-1266)ctG>ctC	p.L422L	C11orf24_ENST00000533310.1_Intron|C11orf24_ENST00000530166.1_5'Flank	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	422						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						CATAGGCCTGCAGGGCAAACA	0.547																																					NSCLC(21;855 905 4198 36694)	dbGAP											0													101.0	98.0	99.0					11																	68029197		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.1266G>C	11.37:g.68029197C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H2K4	Silent	SNP	NULL	p.L422	ENST00000304271.6	37	c.1266	CCDS8180.1	11																																																																																			C11orf24	-	NULL	ENSG00000171067		0.547	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf24	HGNC	protein_coding	OTTHUMT00000394750.1	35	0.00	0	C	NM_022338		68029197	68029197	-1	no_errors	ENST00000304271	ensembl	human	known	69_37n	silent	28	73.83	79	SNP	0.935	G
C19orf10	56005	genome.wustl.edu	37	19	4668614	4668614	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:4668614G>T	ENST00000262947.3	-	2	253	c.218C>A	c.(217-219)aCc>aAc	p.T73N	C19orf10_ENST00000599630.1_Missense_Mutation_p.T73N	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	73					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		CACCTCATTGGTCCCTCCTTG	0.408																																						dbGAP											0													126.0	105.0	112.0					19																	4668614		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.218C>A	19.37:g.4668614G>T	ENSP00000262947:p.Thr73Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	pfam_UPF0556	p.T73N	ENST00000262947.3	37	c.218	CCDS12133.1	19	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376848	0.61735	.	.	ENSG00000074842	ENST00000262947	T	0.60171	0.21	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.74298	0.3698	M	0.70275	2.135	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.77752	-0.2470	10	0.87932	D	0	-20.4127	14.7912	0.69844	0.0:0.0:1.0:0.0	.	73	Q969H8	CS010_HUMAN	N	73	ENSP00000262947:T73N	ENSP00000262947:T73N	T	-	2	0	C19orf10	4619614	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	7.267000	0.78462	2.398000	0.81561	0.561000	0.74099	ACC	C19orf10	-	pfam_UPF0556	ENSG00000074842		0.408	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf10	HGNC	protein_coding	OTTHUMT00000458937.1	10	0.00	0	G	NM_019107		4668614	4668614	-1	no_errors	ENST00000262947	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	1.000	T
CERCAM	51148	genome.wustl.edu	37	9	131198073	131198074	+	Frame_Shift_Ins	INS	-	-	G	rs148076888|rs376945364		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr9:131198073_131198074insG	ENST00000372838.4	+	12	2075_2076	c.1677_1678insG	c.(1678-1680)ggcfs	p.G560fs	CERCAM_ENST00000372842.1_Frame_Shift_Ins_p.G482fs	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	560					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						ATGATGACAGCGGCCGCCTCAT	0.683																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.1679dupG	9.37:g.131198075_131198075dupG	ENSP00000361929:p.Gly560fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Frame_Shift_Ins	INS	pfam_Glyco_trans_25	p.R560fs	ENST00000372838.4	37	c.1677_1678	CCDS6901.2	9																																																																																			CERCAM	-	NULL	ENSG00000167123		0.683	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CERCAM	HGNC	protein_coding	OTTHUMT00000054435.2	8	0.00	0	-	NM_016174		131198073	131198074	+1	no_errors	ENST00000372838	ensembl	human	known	69_37n	frame_shift_ins	11	63.33	19	INS	0.254:0.996	G
CHD9	80205	genome.wustl.edu	37	16	53191289	53191289	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr16:53191289C>G	ENST00000398510.3	+	1	1375	c.1288C>G	c.(1288-1290)Cac>Gac	p.H430D	CHD9_ENST00000566029.1_Missense_Mutation_p.H430D|CHD9_ENST00000564845.1_Missense_Mutation_p.H430D|CHD9_ENST00000447540.1_Missense_Mutation_p.H430D			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	430					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TAATTCAAGTCACATTTTAGA	0.473																																						dbGAP											0													89.0	81.0	84.0					16																	53191289		1916	4143	6059	-	-	-	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.1288C>G	16.37:g.53191289C>G	ENSP00000381522:p.His430Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.H430D	ENST00000398510.3	37	c.1288		16	.	.	.	.	.	.	.	.	.	.	C	11.65	1.703052	0.30232	.	.	ENSG00000177200	ENST00000447540;ENST00000398510	D;D	0.85702	-1.94;-2.02	5.87	4.93	0.64822	.	0.000000	0.64402	D	0.000005	T	0.77955	0.4208	L	0.51422	1.61	0.38223	D	0.940816	B;B;P;B	0.38078	0.058;0.035;0.617;0.058	B;B;B;B	0.33960	0.059;0.027;0.173;0.059	T	0.78863	-0.2036	10	0.51188	T	0.08	-8.6025	6.8338	0.23925	0.1434:0.7141:0.0:0.1425	.	430;430;430;430	Q3L8U1-3;Q3L8U1;Q8NAR9;Q3L8U1-2	.;CHD9_HUMAN;.;.	D	430	ENSP00000396345:H430D;ENSP00000381522:H430D	ENSP00000381522:H430D	H	+	1	0	CHD9	51748790	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.721000	0.47260	1.499000	0.48617	0.655000	0.94253	CAC	CHD9	-	NULL	ENSG00000177200		0.473	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	65	0.00	0	C	NM_025134		53191289	53191289	+1	no_errors	ENST00000398510	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	G
CHRNA6	8973	genome.wustl.edu	37	8	42611543	42611543	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr8:42611543C>A	ENST00000276410.2	-	5	1154	c.799G>T	c.(799-801)Gac>Tac	p.D267Y	CHRNA6_ENST00000530869.1_5'Flank|CHRNA6_ENST00000534622.1_Missense_Mutation_p.D252Y	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	267					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	TCACCACAGTCCGAAGGAAGG	0.408																																						dbGAP											0													101.0	92.0	95.0					8																	42611543		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.799G>T	8.37:g.42611543C>A	ENSP00000276410:p.Asp267Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V4|B4DQH1	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D267Y	ENST00000276410.2	37	c.799	CCDS6135.1	8	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383824	0.82792	.	.	ENSG00000147434	ENST00000276410;ENST00000534622	T;T	0.75260	-0.92;-0.92	5.97	5.97	0.96955	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.082700	0.85682	D	0.000000	D	0.91161	0.7216	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92762	0.6225	10	0.87932	D	0	.	20.4239	0.99064	0.0:1.0:0.0:0.0	.	252;267	B4DQH1;Q15825	.;ACHA6_HUMAN	Y	267;252	ENSP00000276410:D267Y;ENSP00000433871:D252Y	ENSP00000276410:D267Y	D	-	1	0	CHRNA6	42730700	1.000000	0.71417	0.990000	0.47175	0.871000	0.50021	6.018000	0.70811	2.828000	0.97474	0.655000	0.94253	GAC	CHRNA6	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000147434		0.408	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA6	HGNC	protein_coding	OTTHUMT00000383156.1	166	0.00	0	C			42611543	42611543	-1	no_errors	ENST00000276410	ensembl	human	known	69_37n	missense	76	34.19	40	SNP	1.000	A
CHST12	55501	genome.wustl.edu	37	7	2473033	2473033	+	Silent	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr7:2473033C>T	ENST00000258711.6	+	2	894	c.759C>T	c.(757-759)tcC>tcT	p.S253S		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	253					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		GCCTGATCTCCGCCTTCCGCA	0.627																																						dbGAP											0													77.0	64.0	68.0					7																	2473033		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.759C>T	7.37:g.2473033C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Z9|Q502W3|Q9NXY7	Silent	SNP	pfam_Sulfotransferase	p.S253	ENST00000258711.6	37	c.759	CCDS5333.1	7																																																																																			CHST12	-	pfam_Sulfotransferase	ENSG00000136213		0.627	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST12	HGNC	protein_coding	OTTHUMT00000060170.3	49	0.00	0	C	NM_018641		2473033	2473033	+1	no_errors	ENST00000258711	ensembl	human	known	69_37n	silent	36	14.29	6	SNP	0.076	T
CNTN5	53942	genome.wustl.edu	37	11	100211931	100211931	+	Silent	SNP	T	T	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr11:100211931T>A	ENST00000524871.1	+	23	3314	c.3024T>A	c.(3022-3024)ggT>ggA	p.G1008G	CNTN5_ENST00000279463.3_Silent_p.G1008G|CNTN5_ENST00000528682.1_Silent_p.G1008G|CNTN5_ENST00000418526.2_Silent_p.G934G|CNTN5_ENST00000524560.1_3'UTR	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	1008	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AAGTTGTGGGTTACAAGGTCA	0.428																																						dbGAP											0													131.0	129.0	130.0					11																	100211931		1864	4108	5972	-	-	-	SO:0001819	synonymous_variant	0			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.3024T>A	11.37:g.100211931T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G1008	ENST00000524871.1	37	c.3024	CCDS53696.1	11																																																																																			CNTN5	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000149972		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	240	0.00	0	T	NM_014361		100211931	100211931	+1	no_errors	ENST00000279463	ensembl	human	known	69_37n	silent	208	48.39	195	SNP	0.523	A
COL4A4	1286	genome.wustl.edu	37	2	227872836	227872836	+	Silent	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:227872836G>A	ENST00000396625.3	-	47	4914	c.4707C>T	c.(4705-4707)tgC>tgT	p.C1569C	COL4A4_ENST00000329662.7_Silent_p.C1566C	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1569	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCGGGGCCTCGCATACCGCAC	0.652																																						dbGAP											0													26.0	32.0	30.0					2																	227872836		2005	4167	6172	-	-	-	SO:0001819	synonymous_variant	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4707C>T	2.37:g.227872836G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.C1569	ENST00000396625.3	37	c.4707	CCDS42828.1	2																																																																																			COL4A4	-	pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	ENSG00000081052		0.652	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	24	0.00	0	G	NM_000092		227872836	227872836	-1	no_errors	ENST00000396625	ensembl	human	known	69_37n	silent	3	72.73	8	SNP	0.111	A
CYP2A13	1553	genome.wustl.edu	37	19	41600885	41600885	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:41600885C>A	ENST00000330436.3	+	8	1183	c.1183C>A	c.(1183-1185)Ctg>Atg	p.L395M		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	395					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GTTCCCTATGCTGGGCTCCGT	0.572																																						dbGAP											0													120.0	107.0	111.0					19																	41600885		2203	4300	6503	-	-	-	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1183C>A	19.37:g.41600885C>A	ENSP00000332679:p.Leu395Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.L395M	ENST00000330436.3	37	c.1183	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	17.10	3.302711	0.60195	.	.	ENSG00000197838	ENST00000330436	T	0.72167	-0.63	4.25	4.25	0.50352	.	0.000000	0.64402	U	0.000012	T	0.81597	0.4856	M	0.75264	2.295	0.31877	N	0.618959	D	0.55605	0.972	P	0.60541	0.876	D	0.85384	0.1121	10	0.72032	D	0.01	.	15.6095	0.76704	0.0:1.0:0.0:0.0	.	395	Q16696	CP2AD_HUMAN	M	395	ENSP00000332679:L395M	ENSP00000332679:L395M	L	+	1	2	CYP2A13	46292725	0.921000	0.31238	1.000000	0.80357	0.817000	0.46193	1.738000	0.38207	2.213000	0.71641	0.485000	0.47835	CTG	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like	ENSG00000197838		0.572	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	126	0.00	0	C	NM_000766		41600885	41600885	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	missense	98	37.18	58	SNP	1.000	A
DCTN4	51164	genome.wustl.edu	37	5	150110686	150110686	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr5:150110686T>G	ENST00000447998.2	-	7	759	c.644A>C	c.(643-645)aAg>aCg	p.K215T	DCTN4_ENST00000521093.1_5'Flank|DCTN4_ENST00000424236.1_Missense_Mutation_p.K158T|DCTN4_ENST00000446090.2_Missense_Mutation_p.K222T	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	215					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGCTCAATCTTTATCTCTTT	0.353																																						dbGAP											0													74.0	77.0	76.0					5																	150110686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.644A>C	5.37:g.150110686T>G	ENSP00000416968:p.Lys215Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Missense_Mutation	SNP	pfam_Dynactin_p62	p.K222T	ENST00000447998.2	37	c.665	CCDS4310.1	5	.	.	.	.	.	.	.	.	.	.	T	11.57	1.678602	0.29783	.	.	ENSG00000132912	ENST00000447998;ENST00000424236;ENST00000446090;ENST00000521728	T;T;T	0.19250	2.18;2.16;2.18	5.94	4.77	0.60923	.	0.231906	0.49305	D	0.000158	T	0.15046	0.0363	N	0.22421	0.69	0.45690	D	0.9986	B;B	0.02656	0.0;0.0	B;B	0.10450	0.003;0.005	T	0.04522	-1.0945	10	0.30078	T	0.28	-11.5178	12.6144	0.56567	0.1242:0.0:0.0:0.8758	.	222;215	Q9UJW0-3;Q9UJW0	.;DCTN4_HUMAN	T	215;158;222;72	ENSP00000416968:K215T;ENSP00000411251:K158T;ENSP00000414906:K222T	ENSP00000411251:K158T	K	-	2	0	DCTN4	150090879	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.513000	0.45494	1.054000	0.40438	0.528000	0.53228	AAG	DCTN4	-	pfam_Dynactin_p62	ENSG00000132912		0.353	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCTN4	HGNC	protein_coding	OTTHUMT00000252372.1	145	0.00	0	T			150110686	150110686	-1	no_errors	ENST00000446090	ensembl	human	known	69_37n	missense	148	27.09	55	SNP	1.000	G
DOCK11	139818	genome.wustl.edu	37	X	117758501	117758501	+	Splice_Site	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chrX:117758501G>A	ENST00000276202.7	+	32	3534		c.e32-1		DOCK11_ENST00000276204.6_Splice_Site	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.?(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTATTTTTCAGAACCAACAAG	0.313																																						dbGAP											1	Unknown(1)	lung(1)											135.0	128.0	130.0					X																	117758501		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3472-1G>A	X.37:g.117758501G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Splice_Site	SNP	-	e32-1	ENST00000276202.7	37	c.3472-1	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396147	0.83011	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3534	0.90345	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK11	117642529	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.866000	0.92307	2.361000	0.80049	0.594000	0.82650	.	DOCK11	-	-	ENSG00000147251		0.313	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	342	0.00	0	G	NM_144658	Intron	117758501	117758501	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	splice_site	363	21.09	97	SNP	1.000	A
DSP	1832	genome.wustl.edu	37	6	7576652	7576652	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr6:7576652A>T	ENST00000379802.3	+	19	3097	c.2756A>T	c.(2755-2757)gAt>gTt	p.D919V	DSP_ENST00000418664.2_Missense_Mutation_p.D919V	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	919	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAATTTGGAGATTCCAACACA	0.393																																						dbGAP											0													94.0	96.0	95.0					6																	7576652		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.2756A>T	6.37:g.7576652A>T	ENSP00000369129:p.Asp919Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.D919V	ENST00000379802.3	37	c.2756	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337832	0.81911	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	T;T	0.50277	0.75;0.75	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	T	0.44074	0.1276	L	0.61218	1.895	0.58432	D	0.999999	P;D	0.53619	0.931;0.961	B;P	0.47206	0.36;0.541	T	0.49916	-0.8888	10	0.59425	D	0.04	.	16.2988	0.82793	1.0:0.0:0.0:0.0	.	966;919	Q4LE79;P15924	.;DESP_HUMAN	V	919;919;724	ENSP00000369129:D919V;ENSP00000396591:D919V	ENSP00000369129:D919V	D	+	2	0	DSP	7521651	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	6.261000	0.72509	2.311000	0.77944	0.533000	0.62120	GAT	DSP	-	smart_Spectrin/alpha-actinin	ENSG00000096696		0.393	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	72	0.00	0	A	NM_004415		7576652	7576652	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	missense	47	41.98	34	SNP	1.000	T
EPHB1	2047	genome.wustl.edu	37	3	134885809	134885809	+	Missense_Mutation	SNP	G	G	A	rs548362226		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr3:134885809G>A	ENST00000398015.3	+	9	2090	c.1720G>A	c.(1720-1722)Gtg>Atg	p.V574M	EPHB1_ENST00000493838.1_Missense_Mutation_p.V135M	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	574					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CAAAGAGGCTGTGTACAGCGA	0.557																																						dbGAP											0													139.0	145.0	143.0					3																	134885809		1917	4140	6057	-	-	-	SO:0001583	missense	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1720G>A	3.37:g.134885809G>A	ENSP00000381097:p.Val574Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.V574M	ENST00000398015.3	37	c.1720	CCDS46921.1	3	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263931	0.80358	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.10288	2.89;2.89	6.08	6.08	0.98989	.	0.134415	0.48767	D	0.000162	T	0.08088	0.0202	N	0.08118	0	0.80722	D	1	B	0.21821	0.061	B	0.15052	0.012	T	0.40001	-0.9586	10	0.37606	T	0.19	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	574	P54762	EPHB1_HUMAN	M	574;135	ENSP00000381097:V574M;ENSP00000419574:V135M	ENSP00000381097:V574M	V	+	1	0	EPHB1	136368499	1.000000	0.71417	0.974000	0.42286	0.995000	0.86356	9.199000	0.95003	2.894000	0.99253	0.655000	0.94253	GTG	EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000154928		0.557	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	246	0.00	0	G	NM_004441		134885809	134885809	+1	no_errors	ENST00000398015	ensembl	human	known	69_37n	missense	129	29.12	53	SNP	1.000	A
ESD	2098	genome.wustl.edu	37	13	47354159	47354159	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr13:47354159C>G	ENST00000378720.3	-	8	693	c.511G>C	c.(511-513)Gca>Cca	p.A171P	ESD_ENST00000378697.1_Missense_Mutation_p.A142P|ESD_ENST00000495654.1_5'UTR	NM_001984.1	NP_001975.1	P10768	ESTD_HUMAN	esterase D	171					formaldehyde catabolic process (GO:0046294)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carboxylic ester hydrolase activity (GO:0052689)|hydrolase activity, acting on ester bonds (GO:0016788)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)|S-formylglutathione hydrolase activity (GO:0018738)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	9		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	GGAGCAAATGCTGACACAGAC	0.323																																						dbGAP											0													86.0	86.0	86.0					13																	47354159		2203	4299	6502	-	-	-	SO:0001583	missense	0			M13450	CCDS9404.1	13q14.1-q14.2	2014-05-13	2010-05-07		ENSG00000139684	ENSG00000139684	3.1.2.12		3465	protein-coding gene	gene with protein product	"""S-formylglutathione hydrolase"""	133280	"""esterase D/formylglutathione hydrolase"""				Standard	NM_001984		Approved		uc001vbn.3	P10768	OTTHUMG00000016878	ENST00000378720.3:c.511G>C	13.37:g.47354159C>G	ENSP00000367992:p.Ala171Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBU8|Q5TBV0|Q5TBV2|Q9BVJ2	Missense_Mutation	SNP	pfam_Esterase_put,pfam_Peptidase_S9,pfam_AXE1,tigrfam_S-formylglutathione_hydrol	p.A171P	ENST00000378720.3	37	c.511	CCDS9404.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.200614|5.200614	0.94997|0.94997	.|.	.|.	ENSG00000139684|ENSG00000139684	ENST00000378720;ENST00000378697|ENST00000412582	T;T|.	0.35048|.	1.33;1.33|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.102248|.	0.64402|.	D|.	0.000003|.	D|D	0.88127|0.88127	0.6353|0.6353	H|H	0.95712|0.95712	3.71|3.71	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	D|D	0.90385|0.90385	0.4391|0.4391	10|5	0.87932|.	D|.	0|.	-15.5913|-15.5913	19.4379|19.4379	0.94804|0.94804	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	171|.	P10768|.	ESTD_HUMAN|.	P|H	171;142|118	ENSP00000367992:A171P;ENSP00000367969:A142P|.	ENSP00000367969:A142P|.	A|Q	-|-	1|3	0|2	ESD|ESD	46252160|46252160	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.681000|7.681000	0.84073|0.84073	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCA|CAG	ESD	-	pfam_Esterase_put,pfam_Peptidase_S9,tigrfam_S-formylglutathione_hydrol	ENSG00000139684		0.323	ESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESD	HGNC	protein_coding	OTTHUMT00000044826.1	113	0.00	0	C			47354159	47354159	-1	no_errors	ENST00000378720	ensembl	human	known	69_37n	missense	173	30.52	76	SNP	1.000	G
ETFB	2109	genome.wustl.edu	37	19	51857488	51857488	+	Silent	SNP	G	G	A	rs374935848		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:51857488G>A	ENST00000309244.4	-	2	223	c.132C>T	c.(130-132)atC>atT	p.I44I	ETFB_ENST00000354232.4_Silent_p.I135I|CTD-2616J11.11_ENST00000600067.1_3'UTR|CTD-2616J11.9_ENST00000600974.1_RNA	NM_001985.2	NP_001976.1	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide	44					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)			kidney(2)|large_intestine(1)|lung(3)	6		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)		CCTCCACCGCGATCTCACAGA	0.612																																						dbGAP											0													97.0	73.0	81.0					19																	51857488		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X71129	CCDS12828.1, CCDS33085.1	19q13.3-q13.4	2008-02-05				ENSG00000105379			3482	protein-coding gene	gene with protein product		130410					Standard	NM_001014763		Approved		uc002pwg.3	P38117		ENST00000309244.4:c.132C>T	19.37:g.51857488G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K766|B3KNY2|Q6IBH7|Q71RF6|Q9Y3S7	Silent	SNP	pfam_ETF_a/b_N,smart_ETF_a/b_N	p.I135	ENST00000309244.4	37	c.405	CCDS12828.1	19																																																																																			ETFB	-	pfam_ETF_a/b_N,smart_ETF_a/b_N	ENSG00000105379		0.612	ETFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFB	HGNC	protein_coding	OTTHUMT00000464273.1	40	0.00	0	G			51857488	51857488	-1	no_errors	ENST00000354232	ensembl	human	known	69_37n	silent	25	58.73	37	SNP	0.961	A
EYS	346007	genome.wustl.edu	37	6	66205226	66205226	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr6:66205226delC	ENST00000370621.3	-	4	604	c.78delG	c.(76-78)cggfs	p.R26fs	EYS_ENST00000370618.3_Frame_Shift_Del_p.R26fs|EYS_ENST00000503581.1_Frame_Shift_Del_p.R26fs|EYS_ENST00000342421.5_Frame_Shift_Del_p.R26fs|EYS_ENST00000393380.2_Frame_Shift_Del_p.R26fs|EYS_ENST00000370616.2_Frame_Shift_Del_p.R26fs			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	26					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCACCAATTGCCGTCTACATG	0.398																																						dbGAP											0													89.0	88.0	88.0					6																	66205226		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.78delG	6.37:g.66205226delC	ENSP00000359655:p.Arg26fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Frame_Shift_Del	DEL	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.Q27fs	ENST00000370621.3	37	c.78		6																																																																																			EYS	-	NULL	ENSG00000188107		0.398	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	89	0.00	0	C	XM_294050		66205226	66205226	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	frame_shift_del	87	27.64	34	DEL	0.000	-
FAM92A1	137392	genome.wustl.edu	37	8	94738722	94738722	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr8:94738722G>T	ENST00000518322.1	+	8	899	c.758G>T	c.(757-759)tGt>tTt	p.C253F	FAM92A1_ENST00000517718.1_Missense_Mutation_p.C98F|FAM92A1_ENST00000519679.1_Missense_Mutation_p.C98F|FAM92A1_ENST00000520363.1_3'UTR|FAM92A1_ENST00000423990.2_Missense_Mutation_p.C215F	NM_145269.3	NP_660312.2	A1XBS5	F92A1_HUMAN	family with sequence similarity 92, member A1	253										NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)	7	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TCAGCTAAGTGTGTATCTGGA	0.403																																						dbGAP											0													75.0	71.0	72.0					8																	94738722		1897	4127	6024	-	-	-	SO:0001583	missense	0				CCDS47892.1, CCDS64933.1	8q22.1	2005-09-22			ENSG00000188343	ENSG00000188343			30452	protein-coding gene	gene with protein product						12477932	Standard	XM_005250783		Approved	FLJ38979	uc022ayd.1	A1XBS5	OTTHUMG00000164238	ENST00000518322.1:c.758G>T	8.37:g.94738722G>T	ENSP00000429367:p.Cys253Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1XBS4|Q32ND3|Q6AHW7|Q8N8R1|Q96L09	Missense_Mutation	SNP	pfam_FAM92	p.C253F	ENST00000518322.1	37	c.758	CCDS47892.1	8	.	.	.	.	.	.	.	.	.	.	G	14.55	2.570274	0.45798	.	.	ENSG00000188343	ENST00000518322;ENST00000423990;ENST00000436526;ENST00000341186;ENST00000517718;ENST00000521641;ENST00000519679	T;T;T;T;T	0.43294	1.54;1.45;0.95;0.95;0.95	5.5	5.5	0.81552	.	0.384747	0.31834	N	0.006987	T	0.32734	0.0839	L	0.46157	1.445	0.29428	N	0.860055	P;B	0.50710	0.938;0.203	B;B	0.43889	0.435;0.169	T	0.19063	-1.0317	10	0.08179	T	0.78	-0.6795	8.5878	0.33668	0.0819:0.1665:0.7515:0.0	.	215;253	A1XBS5-2;A1XBS5	.;F92A1_HUMAN	F	253;215;215;253;98;98;98	ENSP00000429367:C253F;ENSP00000401774:C215F;ENSP00000428874:C98F;ENSP00000428751:C98F;ENSP00000429955:C98F	ENSP00000341363:C253F	C	+	2	0	FAM92A1	94807898	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.574000	0.36482	2.732000	0.93576	0.650000	0.86243	TGT	FAM92A1	-	NULL	ENSG00000188343		0.403	FAM92A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92A1	HGNC	protein_coding	OTTHUMT00000377890.4	57	0.00	0	G	NM_145269		94738722	94738722	+1	no_errors	ENST00000518322	ensembl	human	known	69_37n	missense	61	34.41	32	SNP	0.993	T
FAT3	120114	genome.wustl.edu	37	11	92087136	92087136	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr11:92087136G>T	ENST00000298047.6	+	1	1875	c.1858G>T	c.(1858-1860)Gaa>Taa	p.E620*	FAT3_ENST00000409404.2_Nonsense_Mutation_p.E620*|FAT3_ENST00000541502.1_Nonsense_Mutation_p.E620*|FAT3_ENST00000525166.1_Nonsense_Mutation_p.E470*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	620	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTCTGGAAATGAACTTGGCTT	0.353										TCGA Ovarian(4;0.039)																												dbGAP											0													38.0	38.0	38.0					11																	92087136		1842	4082	5924	-	-	-	SO:0001587	stop_gained	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1858G>T	11.37:g.92087136G>T	ENSP00000298047:p.Glu620*	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.E620*	ENST00000298047.6	37	c.1858		11	.	.	.	.	.	.	.	.	.	.	G	39	7.558712	0.98358	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.8971	0.92427	0.0:0.0:1.0:0.0	.	.	.	.	X	620;620;620;470	.	ENSP00000298047:E620X	E	+	1	0	FAT3	91726784	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.893000	0.87330	2.709000	0.92574	0.591000	0.81541	GAA	FAT3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.353	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		91	0.00	0	G	NM_001008781		92087136	92087136	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	nonsense	53	18.46	12	SNP	1.000	T
FERMT1	55612	genome.wustl.edu	37	20	6088271	6088271	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr20:6088271A>G	ENST00000217289.4	-	6	1545	c.757T>C	c.(757-759)Tcc>Ccc	p.S253P	FERMT1_ENST00000536936.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	253	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						GAGCGTGAGGAGTCTAGCCAA	0.333																																						dbGAP											0													54.0	53.0	53.0					20																	6088271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.757T>C	20.37:g.6088271A>G	ENSP00000217289:p.Ser253Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S253P	ENST00000217289.4	37	c.757	CCDS13098.1	20	.	.	.	.	.	.	.	.	.	.	A	19.68	3.872148	0.72180	.	.	ENSG00000101311	ENST00000217289;ENST00000339538	T	0.75821	-0.97	5.5	5.5	0.81552	FERM, N-terminal (1);Band 4.1 domain (1);	0.000000	0.85682	D	0.000000	D	0.87775	0.6262	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.986;1.0	D	0.89126	0.3506	10	0.52906	T	0.07	-25.1305	15.9	0.79365	1.0:0.0:0.0:0.0	.	253;253	Q9BQL6-4;Q9BQL6	.;FERM1_HUMAN	P	253	ENSP00000217289:S253P	ENSP00000217289:S253P	S	-	1	0	FERMT1	6036271	1.000000	0.71417	0.976000	0.42696	0.382000	0.30200	9.049000	0.93837	2.221000	0.72209	0.528000	0.53228	TCC	FERMT1	-	pfam_FERM_N,smart_Band_41_domain	ENSG00000101311		0.333	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERMT1	HGNC	protein_coding	OTTHUMT00000077908.2	41	0.00	0	A	NM_017671		6088271	6088271	-1	no_errors	ENST00000217289	ensembl	human	known	69_37n	missense	41	34.92	22	SNP	1.000	G
FGF6	2251	genome.wustl.edu	37	12	4554431	4554431	+	Silent	SNP	G	G	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr12:4554431G>C	ENST00000228837.2	-	1	349	c.306C>G	c.(304-306)ccC>ccG	p.P102P		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	102					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			TCCGGCCGTCGGGGAGCACCT	0.627																																						dbGAP											0													44.0	41.0	42.0					12																	4554431		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.306C>G	12.37:g.4554431G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAE1	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.P102	ENST00000228837.2	37	c.306	CCDS8527.1	12																																																																																			FGF6	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF	ENSG00000111241		0.627	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF6	HGNC	protein_coding	OTTHUMT00000398939.1	38	0.00	0	G	NM_020996		4554431	4554431	-1	no_errors	ENST00000228837	ensembl	human	known	69_37n	silent	17	34.62	9	SNP	0.995	C
FLG	2312	genome.wustl.edu	37	1	152279089	152279089	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:152279089C>A	ENST00000368799.1	-	3	8308	c.8273G>T	c.(8272-8274)aGc>aTc	p.S2758I	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2758	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTCTAGTGCTGGGCCCCGT	0.592									Ichthyosis																													dbGAP											0													80.0	110.0	100.0					1																	152279089		2197	4293	6490	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8273G>T	1.37:g.152279089C>A	ENSP00000357789:p.Ser2758Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S2758I	ENST00000368799.1	37	c.8273	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443589	0.25987	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.01745	4.66	4.02	-6.41	0.01938	.	.	.	.	.	T	0.00695	0.0023	M	0.78637	2.42	0.09310	N	1	B	0.26744	0.158	B	0.20184	0.028	T	0.39941	-0.9589	9	0.45353	T	0.12	.	2.3088	0.04181	0.1201:0.2522:0.3878:0.24	.	2758	P20930	FILA_HUMAN	I	2758;20	ENSP00000357789:S2758I	ENSP00000357786:S20I	S	-	2	0	FLG	150545713	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.603000	0.02077	-1.323000	0.02275	0.306000	0.20318	AGC	FLG	-	NULL	ENSG00000143631		0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	196	0.00	0	C	NM_002016		152279089	152279089	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	172	11.79	23	SNP	0.000	A
FLG	2312	genome.wustl.edu	37	1	152281708	152281708	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:152281708T>C	ENST00000368799.1	-	3	5689	c.5654A>G	c.(5653-5655)cAc>cGc	p.H1885R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1885	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTTCATGGTGACGCGACCC	0.572									Ichthyosis																													dbGAP											0													286.0	287.0	286.0					1																	152281708		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5654A>G	1.37:g.152281708T>C	ENSP00000357789:p.His1885Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.H1885R	ENST00000368799.1	37	c.5654	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	5.155	0.214097	0.09810	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01584	4.75	2.54	-2.35	0.06684	.	.	.	.	.	T	0.02047	0.0064	M	0.71581	2.175	0.09310	N	1	D	0.54772	0.968	D	0.70487	0.969	T	0.34004	-0.9846	9	0.40728	T	0.16	-0.0911	2.4944	0.04618	0.2089:0.2786:0.0:0.5125	.	1885	P20930	FILA_HUMAN	R	1885;120	ENSP00000357789:H1885R	ENSP00000271820:H120R	H	-	2	0	FLG	150548332	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.368000	0.07543	-0.674000	0.05253	-0.406000	0.06334	CAC	FLG	-	pfam_Filaggrin	ENSG00000143631		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	239	0.41	1	T	NM_002016		152281708	152281708	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	101	27.34	38	SNP	0.001	C
GCKR	2646	genome.wustl.edu	37	2	27721130	27721131	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:27721130_27721131insG	ENST00000264717.2	+	4	357_358	c.294_295insG	c.(295-297)gggfs	p.G99fs	GCKR_ENST00000424318.2_5'UTR	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	99	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					AGGAGCCAGATGGGGGGCTGGT	0.53																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.300dupG	2.37:g.27721136_27721136dupG	ENSP00000264717:p.Gly99fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4C2|B4DPQ2|Q53RY6|Q99522	Frame_Shift_Ins	INS	NULL	p.L100fs	ENST00000264717.2	37	c.294_295	CCDS1757.1	2																																																																																			GCKR	-	NULL	ENSG00000084734		0.530	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCKR	HGNC	protein_coding	OTTHUMT00000250214.1	36	0.00	0	-	NM_001486		27721130	27721131	+1	no_errors	ENST00000264717	ensembl	human	known	69_37n	frame_shift_ins	30	11.76	4	INS	0.653:0.982	G
COLGALT2	23127	genome.wustl.edu	37	1	183944313	183944313	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:183944313G>T	ENST00000361927.4	-	3	781	c.410C>A	c.(409-411)cCa>cAa	p.P137Q	COLGALT2_ENST00000546159.1_Missense_Mutation_p.P137Q	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	137					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)	p.P137Q(1)									CCGGGAGGTTGGCCAGTGCTT	0.433																																						dbGAP											1	Substitution - Missense(1)	lung(1)											87.0	83.0	84.0					1																	183944313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.410C>A	1.37:g.183944313G>T	ENSP00000354960:p.Pro137Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O60327|Q9BZR0	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.P137Q	ENST00000361927.4	37	c.410	CCDS1360.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.296971	0.95574	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.22743	1.94;1.94	5.2	5.2	0.72013	.	0.056444	0.64402	D	0.000001	T	0.33760	0.0874	L	0.43923	1.385	0.80722	D	1	P;P	0.47034	0.839;0.889	P;P	0.52793	0.5;0.709	T	0.02184	-1.1199	10	0.56958	D	0.05	-13.5482	19.1269	0.93388	0.0:0.0:1.0:0.0	.	137;137	F5H3T5;Q8IYK4	.;GT252_HUMAN	Q	137	ENSP00000439112:P137Q;ENSP00000354960:P137Q	ENSP00000354960:P137Q	P	-	2	0	GLT25D2	182210936	1.000000	0.71417	0.971000	0.41717	0.993000	0.82548	9.497000	0.97970	2.583000	0.87209	0.650000	0.86243	CCA	GLT25D2	-	NULL	ENSG00000198756		0.433	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT25D2	HGNC	protein_coding	OTTHUMT00000086128.1	60	0.00	0	G	NM_015101		183944313	183944313	-1	no_errors	ENST00000361927	ensembl	human	known	69_37n	missense	85	15.00	15	SNP	1.000	T
GRAMD1C	54762	genome.wustl.edu	37	3	113595081	113595081	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr3:113595081A>T	ENST00000358160.4	+	5	925	c.433A>T	c.(433-435)Atc>Ttc	p.I145F	GRAMD1C_ENST00000452134.2_5'UTR|GRAMD1C_ENST00000479212.1_3'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	145						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						CCCAAACGCTATCCAGATAGT	0.313																																						dbGAP											0													109.0	116.0	113.0					3																	113595081		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.433A>T	3.37:g.113595081A>T	ENSP00000350881:p.Ile145Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.I145F	ENST00000358160.4	37	c.433	CCDS33826.1	3	.	.	.	.	.	.	.	.	.	.	A	26.9	4.780243	0.90195	.	.	ENSG00000178075	ENST00000358160	T	0.54479	0.57	5.2	5.2	0.72013	.	0.362678	0.28914	N	0.013725	T	0.75236	0.3822	M	0.87381	2.88	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.80108	-0.1520	10	0.87932	D	0	.	13.3066	0.60355	1.0:0.0:0.0:0.0	.	145	Q8IYS0	GRM1C_HUMAN	F	145	ENSP00000350881:I145F	ENSP00000350881:I145F	I	+	1	0	GRAMD1C	115077771	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.667000	0.91153	2.098000	0.63641	0.533000	0.62120	ATC	GRAMD1C	-	NULL	ENSG00000178075		0.313	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD1C	HGNC	protein_coding	OTTHUMT00000354733.1	185	0.00	0	A	NM_017577		113595081	113595081	+1	no_errors	ENST00000358160	ensembl	human	known	69_37n	missense	171	29.92	73	SNP	1.000	T
ITGA10	8515	genome.wustl.edu	37	1	145527997	145527998	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:145527997_145527998insG	ENST00000369304.3	+	3	409_410	c.234_235insG	c.(235-237)gggfs	p.G79fs	ITGA10_ENST00000539363.1_Intron|ITGA10_ENST00000538811.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	79					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCTGCCCTGTAGGGGGGGCCCA	0.584																																						dbGAP											0										14,4128		0,14,2057						-0.8	0.2			9	21,8137		1,19,4059	no	frameshift	ITGA10	NM_003637.3		1,33,6116	A1A1,A1R,RR		0.2574,0.338,0.2846				35,12265				-	-	-	SO:0001589	frameshift_variant	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.241dupG	1.37:g.145528004_145528004dupG	ENSP00000358310:p.Gly79fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Frame_Shift_Ins	INS	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A80fs	ENST00000369304.3	37	c.234_235	CCDS918.1	1																																																																																			ITGA10	-	smart_Int_alpha_beta-p	ENSG00000143127		0.584	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	23	0.00	0	-	NM_003637		145527997	145527998	+1	no_errors	ENST00000369304	ensembl	human	known	69_37n	frame_shift_ins	29	12.12	4	INS	0.998:1.000	G
HRNR	388697	genome.wustl.edu	37	1	152186699	152186699	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:152186699T>A	ENST00000368801.2	-	3	7481	c.7406A>T	c.(7405-7407)cAg>cTg	p.Q2469L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2469					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGAGGACTGTCCTGAGCG	0.557																																						dbGAP											0													1.0	1.0	1.0					1																	152186699		226	649	875	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7406A>T	1.37:g.152186699T>A	ENSP00000357791:p.Gln2469Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.Q2469L	ENST00000368801.2	37	c.7406	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	-	7.119	0.577571	0.13686	.	.	ENSG00000197915	ENST00000368801	T	0.01629	4.72	3.61	1.18	0.20946	.	.	.	.	.	T	0.00608	0.0020	L	0.43152	1.355	0.09310	N	1	P	0.47409	0.895	B	0.43838	0.433	T	0.36089	-0.9762	9	0.08599	T	0.76	.	6.706	0.23250	0.0:0.2023:0.0:0.7977	.	2469	Q86YZ3	HORN_HUMAN	L	2469	ENSP00000357791:Q2469L	ENSP00000357791:Q2469L	Q	-	2	0	HRNR	150453323	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	1.092000	0.30927	0.123000	0.18342	0.529000	0.55759	CAG	HRNR	-	NULL	ENSG00000197915		0.557	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	30	0.00	0	T	XM_373868		152186699	152186699	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	0.000	A
ITGB4	3691	genome.wustl.edu	37	17	73736913	73736913	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr17:73736913C>G	ENST00000200181.3	+	22	2777	c.2590C>G	c.(2590-2592)Ctc>Gtc	p.L864V	ITGB4_ENST00000450894.3_Missense_Mutation_p.L864V|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000579662.1_Missense_Mutation_p.L864V|ITGB4_ENST00000449880.2_Missense_Mutation_p.L864V|ITGB4_ENST00000339591.3_Missense_Mutation_p.L864V	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	864					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGTACACAAGCTCCAGCAGAC	0.687																																						dbGAP											0													61.0	61.0	61.0					17																	73736913		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.2590C>G	17.37:g.73736913C>G	ENSP00000200181:p.Leu864Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,pfscan_Fibronectin_type3,prints_Integrin_bsu	p.L864V	ENST00000200181.3	37	c.2590	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	C	9.885	1.202601	0.22121	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.74209	-0.82;-0.77;-0.77	5.07	0.606	0.17559	.	0.330417	0.28706	N	0.014413	T	0.42494	0.1205	N	0.04203	-0.255	0.27383	N	0.95537	B;B;B	0.12013	0.0;0.0;0.005	B;B;B	0.08055	0.002;0.001;0.003	T	0.24297	-1.0164	10	0.10377	T	0.69	.	5.0748	0.14625	0.1161:0.3114:0.4489:0.1235	.	864;864;864	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	V	864	ENSP00000200181:L864V;ENSP00000344079:L864V;ENSP00000400217:L864V	ENSP00000200181:L864V	L	+	1	0	ITGB4	71248508	1.000000	0.71417	0.997000	0.53966	0.788000	0.44548	0.789000	0.26886	0.134000	0.18681	0.561000	0.74099	CTC	ITGB4	-	pirsf_Integrin_bsu-4	ENSG00000132470		0.687	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	25	0.00	0	C			73736913	73736913	+1	no_errors	ENST00000200181	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.994	G
KCNG4	93107	genome.wustl.edu	37	16	84271027	84271027	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr16:84271027G>A	ENST00000308251.4	-	2	133	c.65C>T	c.(64-66)cCt>cTt	p.P22L	KCNG4_ENST00000568181.1_Missense_Mutation_p.P22L	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	22					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						CTGACTCCAAGGGCTGTGGGA	0.627																																						dbGAP											0													47.0	51.0	50.0					16																	84271027		2200	4299	6499	-	-	-	SO:0001583	missense	0			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.65C>T	16.37:g.84271027G>A	ENSP00000312129:p.Pro22Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H24	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.P22L	ENST00000308251.4	37	c.65	CCDS10945.1	16	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311601	0.40895	.	.	ENSG00000168418	ENST00000308251	D	0.96427	-4.01	4.95	4.95	0.65309	.	3.394180	0.00531	N	0.000211	D	0.94994	0.8380	L	0.27053	0.805	0.53688	D	0.999977	B;P	0.40731	0.267;0.728	B;B	0.40901	0.039;0.343	T	0.82279	-0.0536	10	0.52906	T	0.07	.	17.1807	0.86854	0.0:0.0:1.0:0.0	.	22;22	Q8TDN1;Q8TDN1-2	KCNG4_HUMAN;.	L	22	ENSP00000312129:P22L	ENSP00000312129:P22L	P	-	2	0	KCNG4	82828528	1.000000	0.71417	0.894000	0.35097	0.019000	0.09904	4.602000	0.61098	2.291000	0.77112	0.549000	0.68633	CCT	KCNG4	-	NULL	ENSG00000168418		0.627	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	HGNC	protein_coding	OTTHUMT00000269079.2	45	0.00	0	G	NM_172347		84271027	84271027	-1	no_errors	ENST00000308251	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.991	A
KCNK2	3776	genome.wustl.edu	37	1	215259971	215259971	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:215259971A>G	ENST00000444842.2	+	2	457	c.307A>G	c.(307-309)Ata>Gta	p.I103V	KCNK2_ENST00000391895.2_Missense_Mutation_p.I99V|KCNK2_ENST00000391894.2_Missense_Mutation_p.I88V	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	103					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	GCAAACATTCATATCCCAACA	0.463																																						dbGAP											0													170.0	156.0	160.0					1																	215259971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.307A>G	1.37:g.215259971A>G	ENSP00000394033:p.Ile103Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.I103V	ENST00000444842.2	37	c.307	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.878964	0.33162	.	.	ENSG00000082482	ENST00000366948;ENST00000391895;ENST00000478774;ENST00000391894;ENST00000444842;ENST00000457122	T;T;T;T;T	0.20332	2.09;2.35;2.08;2.08;2.57	5.55	4.43	0.53597	.	0.101398	0.64402	D	0.000004	T	0.14313	0.0346	N	0.25647	0.755	0.33954	D	0.644823	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.08229	-1.0732	10	0.59425	D	0.04	.	7.6805	0.28511	0.7913:0.0:0.2087:0.0	.	88;103;99	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	V	99;99;47;88;103;47	ENSP00000375765:I99V;ENSP00000420569:I47V;ENSP00000375764:I88V;ENSP00000394033:I103V;ENSP00000413460:I47V	ENSP00000355915:I99V	I	+	1	0	KCNK2	213326594	0.994000	0.37717	0.987000	0.45799	0.996000	0.88848	0.704000	0.25661	0.946000	0.37632	0.455000	0.32223	ATA	KCNK2	-	NULL	ENSG00000082482		0.463	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	160	0.00	0	A	NM_014217		215259971	215259971	+1	no_errors	ENST00000444842	ensembl	human	known	69_37n	missense	164	42.25	120	SNP	1.000	G
KIAA0408	9729	genome.wustl.edu	37	6	127765377	127765377	+	Silent	SNP	A	A	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr6:127765377A>G	ENST00000483725.3	-	6	2298	c.1962T>C	c.(1960-1962)gcT>gcC	p.A654A	SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	654										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		TTGCTGGTCTAGCAGGTCGGG	0.502																																						dbGAP											0													127.0	101.0	110.0					6																	127765377		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.1962T>C	6.37:g.127765377A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Nonstop_Mutation	SNP	NULL	p.*89Q	ENST00000483725.3	37	c.265	CCDS34531.1	6	.	.	.	.	.	.	.	.	.	.	A	13.81	2.348890	0.41599	.	.	ENSG00000189367	ENST00000465254	.	.	.	6.07	-0.828	0.10799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.2311	1.5572	0.02587	0.3334:0.1113:0.3378:0.2175	.	.	.	.	Q	89	.	.	X	-	1	0	KIAA0408	127807070	0.931000	0.31567	0.996000	0.52242	0.985000	0.73830	-0.034000	0.12225	-0.080000	0.12685	0.477000	0.44152	TAG	KIAA0408	-	NULL	ENSG00000189367		0.502	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA0408	HGNC	protein_coding	OTTHUMT00000042145.3	77	0.00	0	A	NM_014702		127765377	127765377	-1	no_start_codon	ENST00000465254	ensembl	human	putative	69_37n	nonstop	71	22.83	21	SNP	0.908	G
KIAA1614	57710	genome.wustl.edu	37	1	180905471	180905471	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:180905471C>A	ENST00000367588.4	+	5	2481	c.2426C>A	c.(2425-2427)aCc>aAc	p.T809N	KIAA1614_ENST00000367587.1_Missense_Mutation_p.T430N	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	809										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						TGGGCGCCAACCCCTCCCCCT	0.622																																						dbGAP											0													56.0	60.0	59.0					1																	180905471		1986	4152	6138	-	-	-	SO:0001583	missense	0			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.2426C>A	1.37:g.180905471C>A	ENSP00000356560:p.Thr809Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	NULL	p.T809N	ENST00000367588.4	37	c.2426	CCDS41442.1	1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.685546	0.47991	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.31510	2.01;1.49	4.51	4.51	0.55191	.	0.369517	0.25919	N	0.027446	T	0.41328	0.1154	L	0.34521	1.04	0.37412	D	0.913292	D	0.61080	0.989	P	0.61722	0.893	T	0.52335	-0.8589	9	0.54805	T	0.06	-10.4353	15.004	0.71498	0.0:1.0:0.0:0.0	.	809	Q5VZ46	K1614_HUMAN	N	809;430	ENSP00000356560:T809N;ENSP00000356559:T430N	ENSP00000356559:T430N	T	+	2	0	KIAA1614	179172094	0.002000	0.14202	1.000000	0.80357	0.082000	0.17680	1.371000	0.34250	2.051000	0.60960	0.561000	0.74099	ACC	KIAA1614	-	NULL	ENSG00000135835		0.622	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	HGNC	protein_coding	OTTHUMT00000085151.1	72	0.00	0	C	XM_046531		180905471	180905471	+1	no_errors	ENST00000367588	ensembl	human	known	69_37n	missense	53	25.35	18	SNP	0.989	A
KIR3DL1	3811	genome.wustl.edu	37	19	55351148	55351148	+	Intron	SNP	G	G	A	rs543819286		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:55351148G>A	ENST00000402254.2	+	6	1033				KIR2DS4_ENST00000339924.8_RNA			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GCTTGTTTCCGTCACAGGTGA	0.552																																						dbGAP											0													219.0	196.0	204.0					19																	55351148		2170	4167	6337	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000402254.2:c.1000+14615G>A	19.37:g.55351148G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43473|Q14946|Q16541	Silent	SNP	NULL	p.P212	ENST00000402254.2	37	c.636		19																																																																																			KIR2DS4	-	NULL	ENSG00000221957		0.552	KIR3DL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	KIR2DS4	HGNC	protein_coding		262	0.00	0	G	NM_013289		55351148	55351148	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000339924	ensembl	human	known	69_37n	silent	133	59.64	198	SNP	0.078	A
KLC4	89953	genome.wustl.edu	37	6	43039931	43039931	+	Missense_Mutation	SNP	C	C	T	rs557603845		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr6:43039931C>T	ENST00000394056.2	+	13	1921	c.1426C>T	c.(1426-1428)Cgc>Tgc	p.R476C	RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000347162.5_Missense_Mutation_p.R476C|KLC4_ENST00000394058.1_Missense_Mutation_p.R476C|KLC4_ENST00000453940.2_Missense_Mutation_p.R399C|KLC4_ENST00000479388.1_Missense_Mutation_p.R476C|KLC4_ENST00000259708.3_Missense_Mutation_p.R494C			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	476						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			TCTGTATAGGCGCCAGGGAAA	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		17504	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													68.0	76.0	73.0					6																	43039931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1426C>T	6.37:g.43039931C>T	ENSP00000377620:p.Arg476Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.R494C	ENST00000394056.2	37	c.1480	CCDS4883.1	6	.	.	.	.	.	.	.	.	.	.	C	29.7	5.031925	0.93575	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T	0.64803	-0.12;1.09;-0.12;-0.12;-0.12;-0.12	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000006	T	0.78610	0.4310	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;P;D	0.69824	0.966;0.897;0.938	T	0.78370	-0.2230	10	0.59425	D	0.04	-7.5943	20.5792	0.99380	0.0:1.0:0.0:0.0	.	399;494;476	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	C	476;399;494;476;476;476	ENSP00000340221:R476C;ENSP00000395806:R399C;ENSP00000259708:R494C;ENSP00000418031:R476C;ENSP00000377620:R476C;ENSP00000377622:R476C	ENSP00000259708:R494C	R	+	1	0	KLC4	43147909	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.851000	0.62896	2.873000	0.98535	0.561000	0.74099	CGC	KLC4	-	smart_TPR_repeat	ENSG00000137171		0.552	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLC4	HGNC	protein_coding	OTTHUMT00000040579.2	68	0.00	0	C	NM_138343		43039931	43039931	+1	no_errors	ENST00000259708	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	T
KRTAP1-5	83895	genome.wustl.edu	37	17	39182972	39182972	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr17:39182972G>C	ENST00000361883.5	-	1	482	c.436C>G	c.(436-438)Ctg>Gtg	p.L146V		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	146	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			GCATGGTGCAGTTGGCAGCAG	0.652																																						dbGAP											0													40.0	49.0	46.0					17																	39182972		2137	4240	6377	-	-	-	SO:0001583	missense	0			AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.436C>G	17.37:g.39182972G>C	ENSP00000355302:p.Leu146Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Missense_Mutation	SNP	pfam_Keratin-assoc	p.L146V	ENST00000361883.5	37	c.436	CCDS42321.1	17	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249835	0.39797	.	.	ENSG00000221852	ENST00000361883;ENST00000543389	T	0.33654	1.4	5.49	3.48	0.39840	.	.	.	.	.	T	0.43188	0.1236	M	0.86651	2.83	0.29768	N	0.834996	B	0.32409	0.37	B	0.34242	0.178	T	0.44590	-0.9318	9	0.39692	T	0.17	.	8.1111	0.30916	0.0852:0.1578:0.757:0.0	.	146	Q9BYS1	KRA15_HUMAN	V	146;136	ENSP00000355302:L146V	ENSP00000355302:L146V	L	-	1	2	KRTAP1-5	36436498	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	2.387000	0.44389	0.793000	0.33875	-0.224000	0.12420	CTG	KRTAP1-5	-	pfam_Keratin-assoc	ENSG00000221852		0.652	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP1-5	HGNC	protein_coding	OTTHUMT00000257691.1	43	0.00	0	G			39182972	39182972	-1	no_errors	ENST00000361883	ensembl	human	known	69_37n	missense	10	56.52	13	SNP	1.000	C
KRTAP10-9	386676	genome.wustl.edu	37	21	46047456	46047456	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr21:46047456A>C	ENST00000397911.3	+	1	417	c.368A>C	c.(367-369)cAg>cCg	p.Q123P	KRTAP10-9_ENST00000484861.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	123	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						tgctgccaacagtctagctac	0.657																																						dbGAP											0													131.0	142.0	138.0					21																	46047456		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.368A>C	21.37:g.46047456A>C	ENSP00000381009:p.Gln123Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	NULL	p.Q123P	ENST00000397911.3	37	c.368	CCDS42961.1	21	.	.	.	.	.	.	.	.	.	.	a	0.341	-0.950281	0.02285	.	.	ENSG00000221837	ENST00000397911	T	0.01068	5.38	1.88	0.594	0.17485	.	.	.	.	.	T	0.01254	0.0041	L	0.43598	1.365	0.26344	N	0.977311	B	0.30634	0.288	B	0.32022	0.139	T	0.46484	-0.9188	8	.	.	.	.	5.2841	0.15692	0.7446:0.0:0.0:0.2554	.	123	P60411	KR109_HUMAN	P	123	ENSP00000381009:Q123P	.	Q	+	2	0	KRTAP10-9	44871884	0.022000	0.18835	0.942000	0.38095	0.183000	0.23260	0.167000	0.16602	0.156000	0.19299	0.529000	0.55759	CAG	KRTAP10-9	-	NULL	ENSG00000221837		0.657	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	164	0.00	0	A			46047456	46047456	+1	no_errors	ENST00000397911	ensembl	human	known	69_37n	missense	105	13.22	16	SNP	0.998	C
MAGEA10	4109	genome.wustl.edu	37	X	151303066	151303066	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chrX:151303066C>T	ENST00000370323.4	-	4	1343	c.1027G>A	c.(1027-1029)Gac>Aac	p.D343N	MAGEA10_ENST00000244096.3_Missense_Mutation_p.D343N|RP11-1007I13.4_ENST00000509345.2_RNA	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	343						nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GCAATTCTGTCCTGGGCTCTC	0.473																																						dbGAP											0													188.0	157.0	168.0					X																	151303066		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.1027G>A	X.37:g.151303066C>T	ENSP00000359347:p.Asp343Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.D343N	ENST00000370323.4	37	c.1027	CCDS14705.1	X	.	.	.	.	.	.	.	.	.	.	C	9.386	1.074314	0.20227	.	.	ENSG00000124260	ENST00000370323;ENST00000244096	T;T	0.01538	4.79;4.79	2.5	1.59	0.23543	.	5.477980	0.02991	U	0.146780	T	0.01489	0.0048	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.14023	0.01	T	0.43442	-0.9391	10	0.59425	D	0.04	.	5.7478	0.18130	0.3169:0.6831:0.0:0.0	.	343	P43363	MAGAA_HUMAN	N	343	ENSP00000359347:D343N;ENSP00000244096:D343N	ENSP00000244096:D343N	D	-	1	0	MAGEA10	151053722	0.000000	0.05858	0.001000	0.08648	0.026000	0.11368	0.087000	0.14958	0.441000	0.26529	0.292000	0.19580	GAC	MAGEA10	-	NULL	ENSG00000124260		0.473	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGEA10	HGNC	protein_coding	OTTHUMT00000060916.3	195	0.00	0	C	NM_021048		151303066	151303066	-1	no_errors	ENST00000244096	ensembl	human	known	69_37n	missense	128	14.57	22	SNP	0.001	T
MCCC2	64087	genome.wustl.edu	37	5	70898474	70898474	+	Intron	SNP	G	G	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr5:70898474G>C	ENST00000340941.6	+	5	640				MCCC2_ENST00000323375.8_Intron|MCCC2_ENST00000509358.2_Intron|MCCC2_ENST00000510895.2_Intron	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)						biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	AGTCACCAGAGTGGTAAAATA	0.403																																						dbGAP											0													58.0	58.0	58.0					5																	70898474		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.511+14G>C	5.37:g.70898474G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIY9|Q96C27|Q9Y4L7	RNA	SNP	-	NULL	ENST00000340941.6	37	NULL	CCDS34184.1	5																																																																																			MCCC2	-	-	ENSG00000131844		0.403	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC2	HGNC	protein_coding	OTTHUMT00000369243.4	212	0.00	0	G			70898474	70898474	+1	no_errors	ENST00000507169	ensembl	human	known	69_37n	rna	141	29.15	58	SNP	0.000	C
MERTK	10461	genome.wustl.edu	37	2	112779075	112779075	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:112779075C>T	ENST00000295408.4	+	17	2523	c.2266C>T	c.(2266-2268)Caa>Taa	p.Q756*	MERTK_ENST00000421804.2_Nonsense_Mutation_p.Q756*|MERTK_ENST00000409780.1_Nonsense_Mutation_p.Q580*			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	756	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TTATTACCGCCAAGGCCGCAT	0.468																																						dbGAP											0													141.0	136.0	138.0					2																	112779075		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2266C>T	2.37:g.112779075C>T	ENSP00000295408:p.Gln756*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HBB4	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q756*	ENST00000295408.4	37	c.2266	CCDS2094.1	2	.	.	.	.	.	.	.	.	.	.	C	43	9.924888	0.99297	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780;ENST00000449344	.	.	.	5.24	5.24	0.73138	.	0.000000	0.32416	U	0.006121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-19.1817	19.012	0.92877	0.0:1.0:0.0:0.0	.	.	.	.	X	756;756;392;580;80	.	ENSP00000295408:Q756X	Q	+	1	0	MERTK	112495546	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.651000	0.83577	2.724000	0.93272	0.563000	0.77884	CAA	MERTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000153208		0.468	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2	78	0.00	0	C			112779075	112779075	+1	no_errors	ENST00000295408	ensembl	human	known	69_37n	nonsense	74	26.73	27	SNP	1.000	T
CHRM2	1129	genome.wustl.edu	37	7	136588002	136588002	+	Intron	SNP	T	T	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr7:136588002T>A	ENST00000445907.2	+	2	482				CHRM2_ENST00000453373.1_Intron|CHRM2_ENST00000397608.3_Intron|CHRM2_ENST00000320658.5_Intron|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000402486.3_Intron|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000608269.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000401861.1_Intron|MIR490_ENST00000384865.1_RNA|hsa-mir-490_ENST00000439694.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CCTGGAGGACTCCATGCTGTT	0.473																																						dbGAP											0													141.0	130.0	134.0					7																	136588002		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.-47+33837T>A	7.37:g.136588002T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VBK6|Q9P1X9	RNA	SNP	-	NULL	ENST00000445907.2	37	NULL	CCDS5843.1	7																																																																																			MIR490	-	-	ENSG00000207597		0.473	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR490	HGNC	protein_coding	OTTHUMT00000341010.1	121	0.00	0	T			136588002	136588002	+1	no_errors	ENST00000384865	ensembl	human	known	69_37n	rna	103	32.68	50	SNP	1.000	A
MLC1	23209	genome.wustl.edu	37	22	50518384	50518384	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr22:50518384A>G	ENST00000311597.5	-	5	992	c.386T>C	c.(385-387)tTt>tCt	p.F129S	MLC1_ENST00000450140.2_Intron|MLC1_ENST00000431262.2_Missense_Mutation_p.F99S|MLC1_ENST00000395876.2_Missense_Mutation_p.F129S|MLC1_ENST00000538737.1_Intron|MLC1_ENST00000535444.1_Missense_Mutation_p.F50S	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	129					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		TTTGCATCCAAACCAAATTAA	0.473																																						dbGAP											0													185.0	161.0	169.0					22																	50518384		2203	4300	6503	-	-	-	SO:0001583	missense	0			D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.386T>C	22.37:g.50518384A>G	ENSP00000310375:p.Phe129Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	NULL	p.F129S	ENST00000311597.5	37	c.386	CCDS14083.1	22	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279310	0.80692	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000431262;ENST00000535444;ENST00000442311	D;D;D;D;D	0.96136	-3.89;-3.89;-3.51;-3.73;-3.92	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.97188	0.9081	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.97812	1.0251	10	0.87932	D	0	-25.1109	13.9052	0.63831	1.0:0.0:0.0:0.0	.	99;129	B7Z659;Q15049	.;MLC1_HUMAN	S	129;129;99;50;99	ENSP00000379216:F129S;ENSP00000310375:F129S;ENSP00000415877:F99S;ENSP00000438910:F50S;ENSP00000401385:F99S	ENSP00000310375:F129S	F	-	2	0	MLC1	48860511	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	8.051000	0.89446	1.918000	0.55548	0.459000	0.35465	TTT	MLC1	-	NULL	ENSG00000100427		0.473	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	HGNC	protein_coding	OTTHUMT00000316979.2	46	0.00	0	A	NM_015166		50518384	50518384	-1	no_errors	ENST00000311597	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	G
MPP4	58538	genome.wustl.edu	37	2	202512439	202512439	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:202512439T>A	ENST00000409474.3	-	21	1901	c.1694A>T	c.(1693-1695)gAc>gTc	p.D565V	MPP4_ENST00000409143.1_Missense_Mutation_p.D507V|MPP4_ENST00000396886.3_Missense_Mutation_p.D490V|RNU6-651P_ENST00000411040.1_RNA|MPP4_ENST00000359962.5_Missense_Mutation_p.D565V|MPP4_ENST00000428900.2_Missense_Mutation_p.D541V|MPP4_ENST00000315506.7_Missense_Mutation_p.D521V|MPP4_ENST00000447335.2_Missense_Mutation_p.D558V	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	565	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						CACATAGTAGTCAGTAATAAC	0.438																																						dbGAP											0													159.0	158.0	158.0					2																	202512439		1878	4116	5994	-	-	-	SO:0001583	missense	0			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1694A>T	2.37:g.202512439T>A	ENSP00000387278:p.Asp565Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_L27_C,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.D565V	ENST00000409474.3	37	c.1694	CCDS46491.1	2	.	.	.	.	.	.	.	.	.	.	T	16.86	3.239770	0.58995	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	T;T;T;T;T;T	0.06608	3.28;3.3;3.28;3.3;3.31;3.28	5.74	5.74	0.90152	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.427392	0.26176	N	0.025881	T	0.13157	0.0319	M	0.66378	2.025	0.58432	D	0.999998	P;B;P;P;P;P;P;P	0.39044	0.604;0.293;0.656;0.656;0.604;0.51;0.656;0.552	B;B;B;B;B;B;B;B	0.41666	0.206;0.222;0.309;0.309;0.206;0.309;0.309;0.363	T	0.00500	-1.1703	10	0.72032	D	0.01	.	16.0351	0.80621	0.0:0.0:0.0:1.0	.	507;490;541;534;521;558;565;530	F6Q0Y6;B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;MPP4_HUMAN;.	V	565;521;490;565;530;494;541;507;558	ENSP00000387278:D565V;ENSP00000319363:D521V;ENSP00000353047:D565V;ENSP00000416781:D541V;ENSP00000387293:D507V;ENSP00000406160:D558V	ENSP00000319363:D521V	D	-	2	0	MPP4	202220684	1.000000	0.71417	0.983000	0.44433	0.992000	0.81027	4.469000	0.60169	2.189000	0.69895	0.460000	0.39030	GAC	MPP4	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin	ENSG00000082126		0.438	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPP4	HGNC	protein_coding	OTTHUMT00000335748.2	80	0.00	0	T			202512439	202512439	-1	no_errors	ENST00000359962	ensembl	human	known	69_37n	missense	45	35.71	25	SNP	0.999	A
TMEFF1	8577	genome.wustl.edu	37	9	103334854	103334854	+	Silent	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr9:103334854C>G	ENST00000374879.4	+	9	1386	c.954C>G	c.(952-954)ctC>ctG	p.L318L	TMEFF1_ENST00000334943.6_Silent_p.L279L|MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.L282V	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	318					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				TTAGTATTCTCTATGTAGTGC	0.348																																						dbGAP											0													132.0	125.0	128.0					9																	103334854		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.954C>G	9.37:g.103334854C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13086|Q8N3T8	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,pfscan_EG-like_dom	p.L282V	ENST00000374879.4	37	c.844	CCDS6750.1	9	.	.	.	.	.	.	.	.	.	.	C	7.946	0.743738	0.15642	.	.	ENSG00000251349	ENST00000502978	T	0.57595	0.39	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.61813	0.2377	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65348	-0.6190	7	0.72032	D	0.01	-5.0636	9.5024	0.39026	0.0:0.904:0.0:0.096	.	.	.	.	V	282	ENSP00000424768:L282V	ENSP00000424768:L282V	L	+	1	2	C9orf30-TMEFF1	102374675	0.702000	0.27816	1.000000	0.80357	0.998000	0.95712	-0.158000	0.10070	2.305000	0.77605	0.650000	0.86243	CTA	MSANTD3-TMEFF1	-	NULL	ENSG00000251349		0.348	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSANTD3-TMEFF1	HGNC	protein_coding	OTTHUMT00000053418.1	108	0.00	0	C	NM_003692		103334854	103334854	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000502978	ensembl	human	putative	69_37n	missense	57	50.86	59	SNP	1.000	G
MYO16	23026	genome.wustl.edu	37	13	109672250	109672250	+	Silent	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr13:109672250C>T	ENST00000357550.2	+	22	2762	c.2721C>T	c.(2719-2721)taC>taT	p.Y907Y	MYO16_ENST00000251041.5_Silent_p.Y907Y|MYO16_ENST00000457511.2_Silent_p.Y419Y|MYO16_ENST00000356711.2_Silent_p.Y907Y	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCATGCACTACGCAGGAAGGG	0.453																																						dbGAP											0													89.0	79.0	82.0					13																	109672250		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.2721C>T	13.37:g.109672250C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Y907	ENST00000357550.2	37	c.2721	CCDS32008.1	13																																																																																			MYO16	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000041515		0.453	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	77	0.00	0	C	NM_015011		109672250	109672250	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	silent	70	15.66	13	SNP	0.686	T
NDOR1	27158	genome.wustl.edu	37	9	140109063	140109063	+	Missense_Mutation	SNP	C	C	T	rs200133206		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr9:140109063C>T	ENST00000344894.5	+	7	847	c.764C>T	c.(763-765)tCg>tTg	p.S255L	NDOR1_ENST00000427047.2_Missense_Mutation_p.S221L|NDOR1_ENST00000458322.2_Missense_Mutation_p.S255L|NDOR1_ENST00000371521.4_Missense_Mutation_p.S255L	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CCCTCCAACTCGGCTGCCCAT	0.672																																						dbGAP											0													40.0	36.0	37.0					9																	140109063		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.764C>T	9.37:g.140109063C>T	ENSP00000343344:p.Ser255Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.S255L	ENST00000344894.5	37	c.764	CCDS7036.1	9	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959530	0.34565	.	.	ENSG00000188566	ENST00000458322;ENST00000427047;ENST00000371521;ENST00000344894	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	4.75	1.82	0.25136	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.689074	0.13915	N	0.353969	T	0.69975	0.3171	L	0.35288	1.05	0.09310	N	1	B;B;B;B	0.15930	0.014;0.015;0.011;0.007	B;B;B;B	0.20955	0.032;0.014;0.019;0.021	T	0.53301	-0.8458	10	0.22706	T	0.39	1.6762	4.6683	0.12676	0.1437:0.4939:0.2797:0.0828	.	255;221;255;255	D3YTG6;D3YTH9;Q9UHB4-2;Q9UHB4	.;.;.;NDOR1_HUMAN	L	255;221;255;255	ENSP00000389905:S255L;ENSP00000394309:S221L;ENSP00000360576:S255L;ENSP00000343344:S255L	ENSP00000343344:S255L	S	+	2	0	NDOR1	139228884	0.000000	0.05858	0.001000	0.08648	0.894000	0.52154	0.877000	0.28106	0.532000	0.28657	0.555000	0.69702	TCG	NDOR1	-	pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000188566		0.672	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDOR1	HGNC	protein_coding	OTTHUMT00000254704.1	26	0.00	0	C	NM_014434		140109063	140109063	+1	no_errors	ENST00000371521	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.001	T
NOL11	25926	genome.wustl.edu	37	17	65734083	65734083	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr17:65734083C>G	ENST00000253247.4	+	13	1639	c.1524C>G	c.(1522-1524)ttC>ttG	p.F508L	SNORA38B_ENST00000363524.1_RNA|NOL11_ENST00000535137.1_Missense_Mutation_p.F326L	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	508					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TAAAAATTTTCTTGAGGTAAG	0.328																																						dbGAP											0													88.0	92.0	91.0					17																	65734083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1524C>G	17.37:g.65734083C>G	ENSP00000253247:p.Phe508Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	pfam_NUC205	p.F508L	ENST00000253247.4	37	c.1524	CCDS11671.1	17	.	.	.	.	.	.	.	.	.	.	C	10.41	1.343401	0.24339	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.45668	0.89	5.11	4.14	0.48551	.	0.051600	0.85682	D	0.000000	T	0.43897	0.1268	M	0.76328	2.33	0.47862	D	0.999539	B	0.22541	0.071	B	0.19666	0.026	T	0.41538	-0.9503	10	0.45353	T	0.12	-9.339	12.5611	0.56281	0.0:0.9173:0.0:0.0827	.	508	Q9H8H0	NOL11_HUMAN	L	508;326	ENSP00000253247:F508L	ENSP00000253247:F508L	F	+	3	2	NOL11	63164545	0.992000	0.36948	0.998000	0.56505	0.046000	0.14306	0.478000	0.22212	1.264000	0.44198	0.650000	0.86243	TTC	NOL11	-	NULL	ENSG00000130935		0.328	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL11	HGNC	protein_coding	OTTHUMT00000448074.1	134	0.00	0	C	NM_015462		65734083	65734083	+1	no_errors	ENST00000253247	ensembl	human	known	69_37n	missense	192	13.12	29	SNP	1.000	G
NUP153	9972	genome.wustl.edu	37	6	17629106	17629106	+	Silent	SNP	T	T	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr6:17629106T>C	ENST00000262077.2	-	18	3323	c.3324A>G	c.(3322-3324)caA>caG	p.Q1108Q	NUP153_ENST00000537253.1_Silent_p.Q1139Q	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	1108					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TGACAGGCTCTTGCTGTTTCT	0.478																																						dbGAP											0													88.0	88.0	88.0					6																	17629106		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.3324A>G	6.37:g.17629106T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Silent	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.Q1139	ENST00000262077.2	37	c.3417	CCDS4541.1	6																																																																																			NUP153	-	NULL	ENSG00000124789		0.478	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	107	0.00	0	T			17629106	17629106	-1	no_errors	ENST00000537253	ensembl	human	known	69_37n	silent	73	37.07	43	SNP	0.998	C
OR14A16	284532	genome.wustl.edu	37	1	247978926	247978926	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:247978926C>A	ENST00000357627.1	-	1	105	c.106G>T	c.(106-108)Gcc>Tcc	p.A36S		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						CCCATCAGGGCACACAAATAA	0.373																																					Ovarian(112;180 1586 15073 21914 33526)	dbGAP											0													75.0	75.0	75.0					1																	247978926		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.106G>T	1.37:g.247978926C>A	ENSP00000350248:p.Ala36Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF96	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A36S	ENST00000357627.1	37	c.106	CCDS31097.1	1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208486	0.39003	.	.	ENSG00000196772	ENST00000357627	T	0.00605	6.27	3.36	2.44	0.29823	.	0.150426	0.29964	N	0.010746	T	0.00695	0.0023	L	0.37850	1.14	0.09310	N	1	P	0.42961	0.795	P	0.45577	0.486	T	0.53528	-0.8426	10	0.48119	T	0.1	.	6.5255	0.22299	0.0:0.6845:0.0:0.3155	.	36	Q8NHC5	O14AG_HUMAN	S	36	ENSP00000350248:A36S	ENSP00000350248:A36S	A	-	1	0	OR14A16	246045549	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-0.045000	0.12003	0.793000	0.33875	0.590000	0.80494	GCC	OR14A16	-	prints_7TM_GPCR_Rhodpsn	ENSG00000196772		0.373	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14A16	HGNC	protein_coding	OTTHUMT00000096856.1	119	0.00	0	C	NM_001001966		247978926	247978926	-1	no_errors	ENST00000357627	ensembl	human	known	69_37n	missense	223	21.75	62	SNP	0.021	A
OR2L2	26246	genome.wustl.edu	37	1	248201996	248201996	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:248201996A>G	ENST00000366479.2	+	1	523	c.427A>G	c.(427-429)Atg>Gtg	p.M143V	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GTGTGTGATGATGATAACAGG	0.433																																						dbGAP											0													192.0	171.0	178.0					1																	248201996		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.427A>G	1.37:g.248201996A>G	ENSP00000355435:p.Met143Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3T5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.M143V	ENST00000366479.2	37	c.427	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	9.449	1.090174	0.20390	.	.	ENSG00000203663	ENST00000366479	T	0.00448	7.38	1.9	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38272	U	0.001749	T	0.00695	0.0023	M	0.75884	2.315	0.21878	N	0.999493	P	0.45634	0.863	P	0.53360	0.724	T	0.37709	-0.9694	10	0.72032	D	0.01	.	9.0367	0.36291	1.0:0.0:0.0:0.0	.	143	Q8NH16	OR2L2_HUMAN	V	143	ENSP00000355435:M143V	ENSP00000355435:M143V	M	+	1	0	OR2L2	246268619	0.000000	0.05858	0.074000	0.20217	0.127000	0.20565	-2.448000	0.01009	0.746000	0.32786	0.163000	0.16589	ATG	OR2L2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000203663		0.433	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	403	0.00	0	A	NM_001004686		248201996	248201996	+1	no_errors	ENST00000366479	ensembl	human	known	69_37n	missense	460	44.11	363	SNP	0.524	G
OR2L2	26246	genome.wustl.edu	37	1	248202362	248202362	+	Nonsense_Mutation	SNP	C	C	T	rs546778867		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr1:248202362C>T	ENST00000366479.2	+	1	889	c.793C>T	c.(793-795)Cga>Tga	p.R265*	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			AAGATCCCTGCGATCTCCAAC	0.498													c|||	1	0.000199681	0.0	0.0014	5008	,	,		19946	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													138.0	125.0	130.0					1																	248202362		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.793C>T	1.37:g.248202362C>T	ENSP00000355435:p.Arg265*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3T5	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R265*	ENST00000366479.2	37	c.793	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	16.24	3.067941	0.55539	.	.	ENSG00000203663	ENST00000366479	.	.	.	1.9	0.911	0.19343	.	0.000000	0.27636	U	0.018492	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	3.04	0.06135	0.243:0.5305:0.0:0.2264	.	.	.	.	X	265	.	ENSP00000355435:R265X	R	+	1	2	OR2L2	246268985	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-2.234000	0.01203	0.005000	0.14708	0.194000	0.17425	CGA	OR2L2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000203663		0.498	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	276	0.00	0	C	NM_001004686		248202362	248202362	+1	no_errors	ENST00000366479	ensembl	human	known	69_37n	nonsense	422	24.19	135	SNP	0.000	T
PAN2	9924	genome.wustl.edu	37	12	56720592	56720592	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr12:56720592C>A	ENST00000425394.2	-	7	1447	c.1071G>T	c.(1069-1071)tgG>tgT	p.W357C	PAN2_ENST00000440411.3_Missense_Mutation_p.W357C|PAN2_ENST00000548043.1_Missense_Mutation_p.W357C|PAN2_ENST00000257931.5_Missense_Mutation_p.W357C	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GGGAATCAGTCCAGAGGTGCA	0.567																																						dbGAP											0													104.0	100.0	101.0					12																	56720592		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1071G>T	12.37:g.56720592C>A	ENSP00000401721:p.Trp357Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19	p.W357C	ENST00000425394.2	37	c.1071	CCDS44922.1	12	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332542	0.81801	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.122835	0.64402	D	0.000014	T	0.36468	0.0968	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.70487	0.969;0.969;0.864	T	0.10222	-1.0639	10	0.87932	D	0	-6.8967	17.9818	0.89144	0.0:1.0:0.0:0.0	.	357;357;357	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	C	357	ENSP00000401721:W357C;ENSP00000388231:W357C;ENSP00000257931:W357C;ENSP00000449861:W357C	ENSP00000257931:W357C	W	-	3	0	PAN2	55006859	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.525000	0.81892	2.850000	0.98022	0.650000	0.86243	TGG	PAN2	-	superfamily_WD40_repeat_dom	ENSG00000135473		0.567	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	HGNC	protein_coding	OTTHUMT00000409024.1	94	0.00	0	C	NM_014871		56720592	56720592	-1	no_errors	ENST00000425394	ensembl	human	known	69_37n	missense	110	29.94	47	SNP	1.000	A
PCDHB5	26167	genome.wustl.edu	37	5	140516843	140516843	+	Silent	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr5:140516843G>A	ENST00000231134.5	+	1	2044	c.1827G>A	c.(1825-1827)acG>acA	p.T609T		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	609	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAAGGCCACGGAGCCCGGGC	0.716																																						dbGAP											0													46.0	49.0	48.0					5																	140516843		2151	4221	6372	-	-	-	SO:0001819	synonymous_variant	0			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1827G>A	5.37:g.140516843G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q549F4|Q9UFU9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T609	ENST00000231134.5	37	c.1827	CCDS4247.1	5																																																																																			PCDHB5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113209		0.716	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB5	HGNC	protein_coding	OTTHUMT00000251811.1	78	0.00	0	G	NM_015669		140516843	140516843	+1	no_errors	ENST00000231134	ensembl	human	known	69_37n	silent	77	38.10	48	SNP	0.902	A
PCK1	5105	genome.wustl.edu	37	20	56138123	56138123	+	Missense_Mutation	SNP	C	C	A	rs377150721		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr20:56138123C>A	ENST00000319441.4	+	5	814	c.650C>A	c.(649-651)aCg>aAg	p.T217K	PCK1_ENST00000543666.1_Intron|PCK1_ENST00000535860.1_Missense_Mutation_p.T85K	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	217					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)	p.T217K(1)		endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CCGGAGCTGACGCTCATCGCC	0.627																																						dbGAP											1	Substitution - Missense(1)	lung(1)											61.0	61.0	61.0					20																	56138123		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.650C>A	20.37:g.56138123C>A	ENSP00000319814:p.Thr217Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	p.T217K	ENST00000319441.4	37	c.650	CCDS13460.1	20	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755761	0.69648	.	.	ENSG00000124253	ENST00000319441;ENST00000535860	T;T	0.03831	3.79;3.79	5.06	5.06	0.68205	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.045838	0.85682	D	0.000000	T	0.07188	0.0182	L	0.37697	1.125	0.80722	D	1	B	0.22146	0.065	B	0.37888	0.26	T	0.10753	-1.0616	10	0.02654	T	1	-34.3053	18.803	0.92025	0.0:1.0:0.0:0.0	.	217	P35558	PCKGC_HUMAN	K	217;85	ENSP00000319814:T217K;ENSP00000444342:T85K	ENSP00000319814:T217K	T	+	2	0	PCK1	55571529	1.000000	0.71417	0.978000	0.43139	0.859000	0.49053	5.639000	0.67868	2.520000	0.84964	0.655000	0.94253	ACG	PCK1	-	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	ENSG00000124253		0.627	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK1	HGNC	protein_coding	OTTHUMT00000079851.2	16	0.00	0	C			56138123	56138123	+1	no_errors	ENST00000319441	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	1.000	A
PCM1	5108	genome.wustl.edu	37	8	17872349	17872349	+	Splice_Site	SNP	T	T	G	rs369449114		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr8:17872349T>G	ENST00000519253.1	+	36	6068	c.5817T>G	c.(5815-5817)taT>taG	p.Y1939*	PCM1_ENST00000327578.8_Splice_Site_p.Y646*|PCM1_ENST00000325083.8_Splice_Site_p.Y1947*|PCM1_ENST00000524226.1_Intron			Q15154	PCM1_HUMAN	pericentriolar material 1	1947	Interaction with BBS4.				centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TGAATGACTATGTATGTATCA	0.348			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																	dbGAP		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	0													24.0	22.0	23.0					8																	17872349		1834	4086	5920	-	-	-	SO:0001630	splice_region_variant	0				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.5817+1T>G	8.37:g.17872349T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Nonsense_Mutation	SNP	NULL	p.Y1947*	ENST00000519253.1	37	c.5841		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	48|48	14.003378|14.003378	0.99774|0.99774	.|.	.|.	ENSG00000078674|ENSG00000078674	ENST00000522275|ENST00000325083;ENST00000519253;ENST00000327578	.|.	.|.	.|.	5.18|5.18	-0.478|-0.478	0.12093|0.12093	.|.	.|0.162995	.|0.56097	.|D	.|0.000036	T|.	0.20659|.	0.0497|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42766|.	-0.9432|.	3|.	.|0.02654	.|T	.|1	-16.2664|-16.2664	9.7003|9.7003	0.40182|0.40182	0.0:0.2887:0.0:0.7113|0.0:0.2887:0.0:0.7113	.|.	.|.	.|.	.|.	R|X	687|1947;1939;646	.|.	.|ENSP00000327077:Y1947X	M|Y	+|+	2|3	0|2	PCM1|PCM1	17916629|17916629	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.683000|0.683000	0.39861|0.39861	0.947000|0.947000	0.29082|0.29082	-0.120000|-0.120000	0.11809|0.11809	0.459000|0.459000	0.35465|0.35465	ATG|TAT	PCM1	-	NULL	ENSG00000078674		0.348	PCM1-003	NOVEL	basic|exp_conf	protein_coding	PCM1	HGNC	protein_coding	OTTHUMT00000374800.1	44	0.00	0	T	NM_006197	Nonsense_Mutation	17872349	17872349	+1	no_errors	ENST00000325083	ensembl	human	known	69_37n	nonsense	34	19.05	8	SNP	1.000	G
PCSK7	9159	genome.wustl.edu	37	11	117076792	117076792	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr11:117076792delA	ENST00000320934.3	-	17	2909	c.2279delT	c.(2278-2280)ctgfs	p.L760fs	PCSK7_ENST00000540028.1_3'UTR|PCSK7_ENST00000529458.1_5'UTR	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	760					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		GTTCTGGGACAGGCTCCAGTC	0.622			T	IGH@	MLCLS																																	dbGAP		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													13.0	13.0	13.0					11																	117076792		2186	4260	6446	-	-	-	SO:0001589	frameshift_variant	0			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.2279delT	11.37:g.117076792delA	ENSP00000325917:p.Leu760fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Frame_Shift_Del	DEL	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.L760fs	ENST00000320934.3	37	c.2279	CCDS8382.1	11																																																																																			PCSK7	-	NULL	ENSG00000160613		0.622	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	36	0.00	0	A	NM_004716		117076792	117076792	-1	no_errors	ENST00000320934	ensembl	human	known	69_37n	frame_shift_del	29	38.30	18	DEL	0.061	-
PNMA5	114824	genome.wustl.edu	37	X	152159875	152159875	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chrX:152159875C>T	ENST00000439251.1	-	2	706	c.268G>A	c.(268-270)Gaa>Aaa	p.E90K	PNMA5_ENST00000535214.1_Missense_Mutation_p.E90K|PNMA5_ENST00000452693.1_Missense_Mutation_p.E90K|PNMA5_ENST00000361887.5_Missense_Mutation_p.E90K	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	90					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					accaccacttcccaggagcca	0.502																																						dbGAP											0													120.0	111.0	114.0					X																	152159875		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.268G>A	X.37:g.152159875C>T	ENSP00000388850:p.Glu90Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	NULL	p.E90K	ENST00000439251.1	37	c.268	CCDS14718.1	X	.	.	.	.	.	.	.	.	.	.	C	0.664	-0.804655	0.02819	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693;ENST00000437210	T;T;T;T;T	0.09445	2.98;2.98;2.98;2.98;2.98	2.76	1.88	0.25563	.	.	.	.	.	T	0.06462	0.0166	L	0.29908	0.895	0.27914	N	0.938513	B	0.22983	0.078	B	0.24394	0.053	T	0.41627	-0.9498	9	0.05833	T	0.94	-9.8487	6.8868	0.24206	0.0:0.7169:0.2831:0.0	.	90	Q96PV4	PNMA5_HUMAN	K	90	ENSP00000354834:E90K;ENSP00000445775:E90K;ENSP00000388850:E90K;ENSP00000392342:E90K;ENSP00000391130:E90K	ENSP00000354834:E90K	E	-	1	0	PNMA5	151910531	0.997000	0.39634	0.926000	0.36857	0.722000	0.41435	0.569000	0.23638	0.576000	0.29452	0.529000	0.55759	GAA	PNMA5	-	NULL	ENSG00000198883		0.502	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA5	HGNC	protein_coding	OTTHUMT00000060925.1	155	0.00	0	C	NM_052926		152159875	152159875	-1	no_errors	ENST00000361887	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	0.967	T
PRAME	23532	genome.wustl.edu	37	22	22890679	22890679	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr22:22890679C>T	ENST00000398741.1	-	6	1646	c.1340G>A	c.(1339-1341)aGt>aAt	p.S447N	PRAME_ENST00000539862.1_Missense_Mutation_p.S431N|PRAME_ENST00000405655.3_Missense_Mutation_p.S447N|PRAME_ENST00000398743.2_Missense_Mutation_p.S447N|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000543184.1_Missense_Mutation_p.S447N|PRAME_ENST00000424204.2_Missense_Mutation_p.S431N|PRAME_ENST00000402697.1_Missense_Mutation_p.S447N	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	447	Mediates interaction with RARA.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		GTCCTCATAACTCTCCAGGGG	0.577																																					Melanoma(73;1707 1838 15168 27201)	dbGAP											0													105.0	89.0	94.0					22																	22890679		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.1340G>A	22.37:g.22890679C>T	ENSP00000381726:p.Ser447Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Y7|O43481|Q8IXN8	Missense_Mutation	SNP	NULL	p.S447N	ENST00000398741.1	37	c.1340	CCDS13801.1	22	.	.	.	.	.	.	.	.	.	.	C	10.77	1.445343	0.25987	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204	T;T;T;T;T;T;T	0.09445	2.98;2.98;2.98;2.98;2.98;2.98;2.98	3.52	1.33	0.21861	.	0.405883	0.27031	N	0.021263	T	0.17323	0.0416	M	0.75777	2.31	0.19945	N	0.999943	B	0.30104	0.268	B	0.37888	0.26	T	0.16217	-1.0410	10	0.62326	D	0.03	.	11.4001	0.49864	0.0:0.6477:0.3523:0.0	.	447	P78395	PRAME_HUMAN	N	447;447;447;447;431;447;431	ENSP00000381728:S447N;ENSP00000445675:S447N;ENSP00000381726:S447N;ENSP00000384343:S447N;ENSP00000445097:S431N;ENSP00000385198:S447N;ENSP00000407342:S431N	ENSP00000381726:S447N	S	-	2	0	PRAME	21220679	0.981000	0.34729	0.393000	0.26258	0.003000	0.03518	0.689000	0.25437	0.457000	0.26962	-0.189000	0.12847	AGT	PRAME	-	NULL	ENSG00000185686		0.577	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAME	HGNC	protein_coding	OTTHUMT00000321644.1	81	0.00	0	C	NM_206953		22890679	22890679	-1	no_errors	ENST00000398741	ensembl	human	known	69_37n	missense	47	42.68	35	SNP	0.537	T
PROKR2	128674	genome.wustl.edu	37	20	5294674	5294674	+	Silent	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr20:5294674G>A	ENST00000217270.3	-	1	341	c.342C>T	c.(340-342)taC>taT	p.Y114Y	PROKR2_ENST00000546004.1_Silent_p.Y114Y	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	114					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						GCCGTACCACGTAGTAGTCCA	0.582										HNSCC(71;0.22)																												dbGAP											0													139.0	106.0	117.0					20																	5294674		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.342C>T	20.37:g.5294674G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.Y114	ENST00000217270.3	37	c.342	CCDS13089.1	20																																																																																			PROKR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000101292		0.582	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR2	HGNC	protein_coding	OTTHUMT00000077854.1	77	0.00	0	G	NM_144773		5294674	5294674	-1	no_errors	ENST00000217270	ensembl	human	known	69_37n	silent	26	46.94	23	SNP	0.886	A
RCCD1	91433	genome.wustl.edu	37	15	91504977	91504977	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr15:91504977C>T	ENST00000394258.2	+	8	1311	c.1109C>T	c.(1108-1110)gCt>gTt	p.A370V	RCCD1_ENST00000555155.1_Missense_Mutation_p.A368V|RCCD1_ENST00000556618.1_Missense_Mutation_p.A370V	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	370						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			TACGTGTATGCTGTGGAGAAA	0.512																																						dbGAP											0													156.0	151.0	152.0					15																	91504977		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.1109C>T	15.37:g.91504977C>T	ENSP00000377801:p.Ala370Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTP9|Q29RX6	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,prints_Reg_chr_condens,pfscan_Reg_chr_condens	p.A370V	ENST00000394258.2	37	c.1109	CCDS32333.1	15	.	.	.	.	.	.	.	.	.	.	C	10.12	1.263802	0.23136	.	.	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618;ENST00000556333	T;T;T	0.39997	1.05;1.11;1.05	5.43	5.43	0.79202	.	0.070231	0.56097	D	0.000022	T	0.26666	0.0652	L	0.31207	0.915	0.30614	N	0.759217	P;P	0.40970	0.734;0.615	B;B	0.39503	0.301;0.158	T	0.17319	-1.0373	10	0.02654	T	1	.	10.8026	0.46497	0.0:0.8786:0.0:0.1214	.	368;370	G3V2I3;A6NED2	.;RCCD1_HUMAN	V	370;368;370;159	ENSP00000377801:A370V;ENSP00000450678:A368V;ENSP00000451963:A370V	ENSP00000377801:A370V	A	+	2	0	RCCD1	89305981	0.880000	0.30214	0.841000	0.33234	0.989000	0.77384	1.615000	0.36922	2.567000	0.86603	0.549000	0.68633	GCT	RCCD1	-	pfscan_Reg_chr_condens	ENSG00000166965		0.512	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RCCD1	HGNC	protein_coding	OTTHUMT00000414748.1	57	0.00	0	C	NM_033544		91504977	91504977	+1	no_errors	ENST00000394258	ensembl	human	known	69_37n	missense	108	12.20	15	SNP	0.863	T
REV1	51455	genome.wustl.edu	37	2	100019354	100019354	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:100019354G>C	ENST00000258428.3	-	20	3610	c.3382C>G	c.(3382-3384)Ctg>Gtg	p.L1128V	RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000393445.3_Missense_Mutation_p.L1127V|REV1_ENST00000465835.1_5'Flank	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1128					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGAATTACCAGGGGTTTCTCT	0.403								Direct reversal of damage																														dbGAP											0													93.0	101.0	98.0					2																	100019354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3382C>G	2.37:g.100019354G>C	ENSP00000258428:p.Leu1128Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.L1128V	ENST00000258428.3	37	c.3382	CCDS2045.1	2	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628119	0.28978	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.28069	1.63;1.63	5.95	4.12	0.48240	.	0.238666	0.33272	N	0.005085	T	0.27697	0.0681	L	0.51422	1.61	0.29047	N	0.884762	B;B	0.27068	0.104;0.167	B;B	0.28011	0.039;0.085	T	0.14448	-1.0472	10	0.27785	T	0.31	.	11.0525	0.47898	0.0665:0.0:0.8036:0.1299	.	1128;1127	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	V	1127;1128	ENSP00000377091:L1127V;ENSP00000258428:L1128V	ENSP00000258428:L1128V	L	-	1	2	REV1	99385786	1.000000	0.71417	0.975000	0.42487	0.375000	0.29983	4.157000	0.58144	0.816000	0.34421	0.655000	0.94253	CTG	REV1	-	pirsf_REV1	ENSG00000135945		0.403	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	150	0.00	0	G	NM_016316		100019354	100019354	-1	no_errors	ENST00000258428	ensembl	human	known	69_37n	missense	104	32.47	50	SNP	0.966	C
RNF123	63891	genome.wustl.edu	37	3	49757963	49757963	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr3:49757963G>A	ENST00000327697.6	+	36	3664	c.3520G>A	c.(3520-3522)Gtg>Atg	p.V1174M	AMIGO3_ENST00000320431.7_5'Flank|RNF123_ENST00000497099.1_3'UTR|RNF123_ENST00000433785.1_Missense_Mutation_p.V286M|AMIGO3_ENST00000535833.1_5'UTR|GMPPB_ENST00000480687.1_3'UTR|GMPPB_ENST00000308375.6_3'UTR	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	1174					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		AGCCACATCAGTGCTCCTGGC	0.597																																						dbGAP											0													49.0	40.0	43.0					3																	49757963		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.3520G>A	3.37:g.49757963G>A	ENSP00000328287:p.Val1174Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,smart_Znf_RING,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.V1174M	ENST00000327697.6	37	c.3520	CCDS33758.1	3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153767	0.78114	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000433785	T	0.74526	-0.85	4.97	4.97	0.65823	.	0.157579	0.43260	D	0.000593	T	0.80869	0.4706	L	0.36672	1.1	0.58432	D	0.99999	D	0.71674	0.998	D	0.78314	0.991	T	0.81250	-0.1018	10	0.49607	T	0.09	-26.2634	17.421	0.87515	0.0:0.0:1.0:0.0	.	1174	Q5XPI4	RN123_HUMAN	M	1174;1174;286	ENSP00000328287:V1174M	ENSP00000328287:V1174M	V	+	1	0	RNF123	49732967	1.000000	0.71417	0.964000	0.40570	0.952000	0.60782	7.747000	0.85070	2.583000	0.87209	0.561000	0.74099	GTG	RNF123	-	NULL	ENSG00000164068		0.597	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF123	HGNC	protein_coding	OTTHUMT00000346475.2	39	0.00	0	G	NM_022064		49757963	49757963	+1	no_errors	ENST00000327697	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.997	A
RNF19A	25897	genome.wustl.edu	37	8	101273937	101273937	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr8:101273937C>G	ENST00000519449.1	-	9	1831	c.1515G>C	c.(1513-1515)gaG>gaC	p.E505D	RNF19A_ENST00000341084.2_Missense_Mutation_p.E505D|RNF19A_ENST00000523255.1_5'UTR	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	505					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			CAACACTTCCCTCCCCTATGC	0.458																																						dbGAP											0													209.0	167.0	181.0					8																	101273937		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1515G>C	8.37:g.101273937C>G	ENSP00000428968:p.Glu505Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.E505D	ENST00000519449.1	37	c.1515	CCDS6286.1	8	.	.	.	.	.	.	.	.	.	.	C	14.48	2.546529	0.45383	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.85013	-1.93;-1.93	5.34	-0.301	0.12800	.	0.000000	0.85682	D	0.000000	T	0.78786	0.4338	L	0.49778	1.585	0.48571	D	0.999678	B	0.18166	0.026	B	0.10450	0.005	T	0.70357	-0.4894	10	0.54805	T	0.06	.	11.0887	0.48102	0.0:0.5621:0.0:0.4379	.	505	Q9NV58	RN19A_HUMAN	D	505	ENSP00000428968:E505D;ENSP00000342667:E505D	ENSP00000342667:E505D	E	-	3	2	RNF19A	101343113	0.996000	0.38824	0.998000	0.56505	0.928000	0.56348	0.456000	0.21859	0.002000	0.14630	-0.229000	0.12294	GAG	RNF19A	-	NULL	ENSG00000034677		0.458	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF19A	HGNC	protein_coding	OTTHUMT00000380004.1	116	0.00	0	C	NM_015435		101273937	101273937	-1	no_errors	ENST00000341084	ensembl	human	known	69_37n	missense	111	28.85	45	SNP	0.996	G
RNF219	79596	genome.wustl.edu	37	13	79209283	79209283	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr13:79209283T>G	ENST00000282003.6	-	5	658	c.600A>C	c.(598-600)ttA>ttC	p.L200F		NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	200							zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		CCTTCAGTCGTAAATTCTCCC	0.343																																						dbGAP											0													135.0	134.0	134.0					13																	79209283		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.600A>C	13.37:g.79209283T>G	ENSP00000282003:p.Leu200Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	pfscan_Znf_RING	p.L200F	ENST00000282003.6	37	c.600	CCDS31997.1	13	.	.	.	.	.	.	.	.	.	.	T	18.18	3.567365	0.65651	.	.	ENSG00000152193	ENST00000282003	.	.	.	5.96	-0.489	0.12052	.	0.122770	0.56097	D	0.000027	T	0.29093	0.0723	L	0.33485	1.01	0.33931	D	0.642018	D	0.53312	0.959	P	0.46659	0.523	T	0.38542	-0.9656	9	0.31617	T	0.26	2.2887	5.6072	0.17387	0.1413:0.4433:0.0:0.4155	.	200	Q5W0B1	RN219_HUMAN	F	200	.	ENSP00000282003:L200F	L	-	3	2	RNF219	78107284	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.366000	0.34193	0.136000	0.18733	0.533000	0.62120	TTA	RNF219	-	NULL	ENSG00000152193		0.343	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF219	HGNC	protein_coding	OTTHUMT00000045363.1	97	0.00	0	T	NM_024546		79209283	79209283	-1	no_errors	ENST00000282003	ensembl	human	known	69_37n	missense	54	29.87	23	SNP	1.000	G
SEMA5A	9037	genome.wustl.edu	37	5	9066543	9066543	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr5:9066543G>T	ENST00000382496.5	-	17	2954	c.2289C>A	c.(2287-2289)tgC>tgA	p.C763*		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	763	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CATCTGTGGAGCAGCCACTGG	0.517																																						dbGAP											0													145.0	142.0	143.0					5																	9066543		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2289C>A	5.37:g.9066543G>T	ENSP00000371936:p.Cys763*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTC6|O60408|Q1RLL9	Nonsense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.C763*	ENST00000382496.5	37	c.2289	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	G	45	11.989971	0.99625	.	.	ENSG00000112902	ENST00000382496	.	.	.	5.82	4.02	0.46733	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.771	0.46323	0.1361:0.0:0.8639:0.0	.	.	.	.	X	763	.	ENSP00000371936:C763X	C	-	3	2	SEMA5A	9119543	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	3.743000	0.55104	2.761000	0.94854	0.591000	0.81541	TGC	SEMA5A	-	NULL	ENSG00000112902		0.517	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	148	0.00	0	G			9066543	9066543	-1	no_errors	ENST00000382496	ensembl	human	known	69_37n	nonsense	167	30.89	76	SNP	1.000	T
SIDT1	54847	genome.wustl.edu	37	3	113345058	113345058	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr3:113345058T>G	ENST00000264852.4	+	24	3143	c.2417T>G	c.(2416-2418)tTc>tGc	p.F806C	SIDT1_ENST00000463226.1_3'UTR|SIDT1_ENST00000393830.3_Missense_Mutation_p.F811C	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	806					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TTTTTCTCATTCTTGGTGAGT	0.413																																						dbGAP											0													182.0	169.0	174.0					3																	113345058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.2417T>G	3.37:g.113345058T>G	ENSP00000264852:p.Phe806Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RR4	Missense_Mutation	SNP	NULL	p.F811C	ENST00000264852.4	37	c.2432	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	T	21.8	4.204573	0.79127	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.50277	0.75;0.75	5.26	5.26	0.73747	.	0.091449	0.48286	D	0.000193	T	0.72285	0.3441	M	0.87758	2.905	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78204	-0.2295	10	0.87932	D	0	-22.8365	14.1662	0.65477	0.0:0.0:0.0:1.0	.	811;806	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	C	806;811	ENSP00000264852:F806C;ENSP00000377416:F811C	ENSP00000264852:F806C	F	+	2	0	SIDT1	114827748	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.606000	0.82863	1.987000	0.57996	0.533000	0.62120	TTC	SIDT1	-	NULL	ENSG00000072858		0.413	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	179	0.00	0	T	NM_017699		113345058	113345058	+1	no_errors	ENST00000393830	ensembl	human	known	69_37n	missense	164	31.09	74	SNP	1.000	G
SLITRK5	26050	genome.wustl.edu	37	13	88328771	88328771	+	Silent	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr13:88328771C>T	ENST00000325089.6	+	2	1347	c.1128C>T	c.(1126-1128)acC>acT	p.T376T	SLITRK5_ENST00000400028.3_Silent_p.T135T	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	376	LRRNT.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					AGTGTCCCACCGCGTGCTCTT	0.587																																						dbGAP											0													69.0	62.0	64.0					13																	88328771		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1128C>T	13.37:g.88328771C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNB8|B4DSH5|Q5VT81	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T376	ENST00000325089.6	37	c.1128	CCDS9465.1	13																																																																																			SLITRK5	-	NULL	ENSG00000165300		0.587	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3	99	0.00	0	C			88328771	88328771	+1	no_errors	ENST00000325089	ensembl	human	known	69_37n	silent	93	28.46	37	SNP	0.913	T
EIF4A1	1973	genome.wustl.edu	37	17	7481290	7481290	+	Intron	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr17:7481290C>G	ENST00000293831.8	+	9	1012				CD68_ENST00000250092.6_5'Flank|SNORA67_ENST00000384423.1_RNA|SNORD10_ENST00000459579.1_RNA|EIF4A1_ENST00000577269.1_Intron|EIF4A1_ENST00000581808.1_Intron|EIF4A1_ENST00000582746.1_Intron|CD68_ENST00000380498.6_5'Flank|SENP3-EIF4A1_ENST00000579777.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GTGATTCCCTCTCCAAGGGGA	0.502																																					Melanoma(120;278 1668 15796 27423 46368)	dbGAP											0													46.0	42.0	43.0					17																	7481290		1568	3581	5149	-	-	-	SO:0001627	intron_variant	0			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.996+56C>G	17.37:g.7481290C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	RNA	SNP	-	NULL	ENST00000293831.8	37	NULL	CCDS11113.1	17																																																																																			SNORA67	-	-	ENSG00000207152		0.502	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA67	HGNC	protein_coding	OTTHUMT00000226952.6	144	0.00	0	C	NM_001416		7481290	7481290	+1	no_errors	ENST00000384423	ensembl	human	known	69_37n	rna	45	39.47	30	SNP	1.000	G
SSB	6741	genome.wustl.edu	37	2	170663549	170663549	+	Silent	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:170663549G>A	ENST00000409333.1	+	6	769	c.522G>A	c.(520-522)aaG>aaA	p.K174K	SSB_ENST00000260956.4_Silent_p.K174K			P05455	LA_HUMAN	Sjogren syndrome antigen B (autoantigen La)	174	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				histone mRNA metabolic process (GO:0008334)|tRNA modification (GO:0006400)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(3)|large_intestine(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CTGGCCAGAAGTACAAAGAAA	0.358																																						dbGAP											0													103.0	101.0	102.0					2																	170663549		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2237.1	2q31.1	2014-02-14		2005-06-16	ENSG00000138385	ENSG00000138385		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	11316	protein-coding gene	gene with protein product	"""La ribonucleoprotein domain family, member 3"""	109090					Standard	NM_003142		Approved	LARP3, La, La/SSB	uc002ufk.3	P05455	OTTHUMG00000132212	ENST00000409333.1:c.522G>A	2.37:g.170663549G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15367|Q53XJ4	Silent	SNP	pfam_RRM_3,pfam_Lupus_La_RNA-bd,pfam_RRM_dom,smart_Lupus_La_RNA-bd,smart_RRM_dom,pfscan_Lupus_La_RNA-bd,pfscan_RRM_dom,prints_Lupus_La	p.K174	ENST00000409333.1	37	c.522	CCDS2237.1	2																																																																																			SSB	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000138385		0.358	SSB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SSB	HGNC	protein_coding	OTTHUMT00000333316.1	98	0.00	0	G	NM_003142		170663549	170663549	+1	no_errors	ENST00000260956	ensembl	human	known	69_37n	silent	76	32.14	36	SNP	0.960	A
SPHKAP	80309	genome.wustl.edu	37	2	228884271	228884271	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:228884271A>T	ENST00000392056.3	-	7	1345	c.1299T>A	c.(1297-1299)taT>taA	p.Y433*	SPHKAP_ENST00000344657.5_Nonsense_Mutation_p.Y433*	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	433						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTTTTGTGGAATAGCAACTGG	0.473																																						dbGAP											0													111.0	108.0	109.0					2																	228884271		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1299T>A	2.37:g.228884271A>T	ENSP00000375909:p.Tyr433*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Nonsense_Mutation	SNP	pfam_AKAP_110_C	p.Y433*	ENST00000392056.3	37	c.1299	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	A	36	5.731606	0.96856	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	.	.	.	5.96	3.61	0.41365	.	0.245934	0.49305	D	0.000154	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2223	0.15375	0.6786:0.0:0.3214:0.0	.	.	.	.	X	433	.	ENSP00000339886:Y433X	Y	-	3	2	SPHKAP	228592515	0.433000	0.25562	1.000000	0.80357	0.873000	0.50193	0.070000	0.14573	1.071000	0.40834	0.496000	0.49642	TAT	SPHKAP	-	NULL	ENSG00000153820		0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	89	0.00	0	A	NM_030623		228884271	228884271	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	nonsense	48	18.64	11	SNP	0.989	T
SSH1	54434	genome.wustl.edu	37	12	109181920	109181920	+	Silent	SNP	C	C	A	rs140750900		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr12:109181920C>A	ENST00000326495.5	-	15	3087	c.2994G>T	c.(2992-2994)ccG>ccT	p.P998P	SSH1_ENST00000360239.3_Silent_p.P686P	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	998	Interaction with YWHAG.				actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CGACGGTGGACGGGTCAGCCT	0.597																																						dbGAP											0													148.0	150.0	149.0					12																	109181920		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.2994G>T	12.37:g.109181920C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.P998	ENST00000326495.5	37	c.2994	CCDS9121.1	12																																																																																			SSH1	-	NULL	ENSG00000084112		0.597	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	HGNC	protein_coding	OTTHUMT00000403724.1	101	0.00	0	C	NM_018984		109181920	109181920	-1	no_errors	ENST00000326495	ensembl	human	known	69_37n	silent	65	24.14	21	SNP	0.000	A
TACR2	6865	genome.wustl.edu	37	10	71174803	71174803	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr10:71174803A>T	ENST00000373306.4	-	2	1028	c.485T>A	c.(484-486)cTg>cAg	p.L162Q		NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	162					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						AGGGGAGGCCAGGGCGAGAGC	0.647																																						dbGAP											0													100.0	85.0	90.0					10																	71174803		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.485T>A	10.37:g.71174803A>T	ENSP00000362403:p.Leu162Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NK2_rcpt,prints_Neurokn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.L162Q	ENST00000373306.4	37	c.485	CCDS7293.1	10	.	.	.	.	.	.	.	.	.	.	A	23.9	4.465927	0.84425	.	.	ENSG00000075073	ENST00000373306	T	0.74737	-0.87	5.51	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	0.094392	0.47455	D	0.000232	D	0.89918	0.6854	H	0.97103	3.94	0.50039	D	0.999849	D	0.89917	1.0	D	0.87578	0.998	D	0.91588	0.5284	10	0.87932	D	0	.	11.4547	0.50173	0.929:0.0:0.071:0.0	.	162	P21452	NK2R_HUMAN	Q	162	ENSP00000362403:L162Q	ENSP00000362403:L162Q	L	-	2	0	TACR2	70844809	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	9.056000	0.93881	1.030000	0.39839	0.533000	0.62120	CTG	TACR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000075073		0.647	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR2	HGNC	protein_coding	OTTHUMT00000048411.1	22	0.00	0	A			71174803	71174803	-1	no_errors	ENST00000373306	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	0.994	T
THNSL2	55258	genome.wustl.edu	37	2	88474185	88474185	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr2:88474185T>C	ENST00000324166.5	+	2	1942	c.251T>C	c.(250-252)tTc>tCc	p.F84S	THNSL2_ENST00000449349.1_Missense_Mutation_p.F52S|THNSL2_ENST00000377254.3_Missense_Mutation_p.F84S|THNSL2_ENST00000343544.4_Missense_Mutation_p.F84S|THNSL2_ENST00000358591.2_Missense_Mutation_p.F84S|THNSL2_ENST00000402102.1_Missense_Mutation_p.F84S	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	84					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						TTCAGCAGATTCCGTCACAGA	0.532																																						dbGAP											0													174.0	140.0	152.0					2																	88474185		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.251T>C	2.37:g.88474185T>C	ENSP00000327323:p.Phe84Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	p.F84S	ENST00000324166.5	37	c.251	CCDS2002.2	2	.	.	.	.	.	.	.	.	.	.	T	31	5.080940	0.94050	.	.	ENSG00000144115	ENST00000358591;ENST00000377254;ENST00000402102;ENST00000419759;ENST00000449349;ENST00000343544;ENST00000324166	T;T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67;2.67	5.79	5.79	0.91817	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (1);	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	M	0.92880	3.355	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.994;0.997	T	0.60535	-0.7244	10	0.87932	D	0	.	15.3	0.73940	0.0:0.0:0.0:1.0	.	84;52;84	Q86YJ6;C9JU10;Q86YJ6-2	THNS2_HUMAN;.;.	S	84;84;84;84;52;84;84	ENSP00000351402:F84S;ENSP00000366464:F84S;ENSP00000384475:F84S;ENSP00000391300:F84S;ENSP00000407553:F52S;ENSP00000339563:F84S;ENSP00000327323:F84S	ENSP00000327323:F84S	F	+	2	0	THNSL2	88255300	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.315000	0.78998	2.208000	0.71279	0.459000	0.35465	TTC	THNSL2	-	superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	ENSG00000144115		0.532	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1	78	0.00	0	T	NM_018271		88474185	88474185	+1	no_errors	ENST00000324166	ensembl	human	known	69_37n	missense	42	28.81	17	SNP	1.000	C
TMC2	117532	genome.wustl.edu	37	20	2593995	2593995	+	Intron	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr20:2593995G>A	ENST00000358864.1	+	14	1887				TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2						detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGGACATTCCGCACAAAGGAA	0.458																																						dbGAP											0													138.0	113.0	121.0					20																	2593995		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1872+27G>A	20.37:g.2593995G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	RNA	SNP	-	NULL	ENST00000358864.1	37	NULL	CCDS13029.2	20																																																																																			TMC2	-	-	ENSG00000149488		0.458	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	34	0.00	0	G			2593995	2593995	+1	no_errors	ENST00000496948	ensembl	human	known	69_37n	rna	67	23.86	21	SNP	0.000	A
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr17:7578271T>A	ENST00000269305.4	-	6	767	c.578A>T	c.(577-579)cAt>cTt	p.H193L	TP53_ENST00000445888.2_Missense_Mutation_p.H193L|TP53_ENST00000413465.2_Missense_Mutation_p.H193L|TP53_ENST00000420246.2_Missense_Mutation_p.H193L|TP53_ENST00000359597.4_Missense_Mutation_p.H193L|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.H193L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>T	17.37:g.7578271T>A	ENSP00000269305:p.His193Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H193L	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	15.17	2.752987	0.49362	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99851	-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99864	0.9936	M	0.92738	3.34	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97204	0.9866	10	0.87932	D	0	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193L;ENSP00000352610:H193L;ENSP00000269305:H193L;ENSP00000398846:H193L;ENSP00000391127:H193L;ENSP00000391478:H193L;ENSP00000425104:H61L;ENSP00000423862:H100L	ENSP00000269305:H193L	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	104	0.00	0	T	NM_000546		7578271	7578271	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	40	50.60	42	SNP	0.998	A
TRRAP	8295	genome.wustl.edu	37	7	98579427	98579427	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr7:98579427G>C	ENST00000359863.4	+	58	8858	c.8649G>C	c.(8647-8649)aaG>aaC	p.K2883N	TRRAP_ENST00000446306.3_Missense_Mutation_p.K2865N|TRRAP_ENST00000355540.3_Missense_Mutation_p.K2865N	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2883	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGGCCTGGAAGGTGAACATGT	0.587																																						dbGAP											0													47.0	32.0	37.0					7																	98579427		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.8649G>C	7.37:g.98579427G>C	ENSP00000352925:p.Lys2883Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.K2883N	ENST00000359863.4	37	c.8649	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.035883|4.035883	0.75617|0.75617	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.69435|.	-0.4;-0.4|.	5.7|5.7	-1.34|-1.34	0.09143|0.09143	PIK-related kinase (1);PIK-related kinase, FAT (1);|.	0.052159|.	0.64402|.	D|.	0.000001|.	T|T	0.74786|0.74786	0.3762|0.3762	M|M	0.86343|0.86343	2.81|2.81	0.80722|0.80722	D|D	1|1	D;D;D|.	0.63880|.	0.991;0.993;0.993|.	P;D;D|.	0.67725|.	0.876;0.953;0.931|.	T|T	0.76769|0.76769	-0.2837|-0.2837	10|5	0.87932|.	D|.	0|.	.|.	12.3268|12.3268	0.55015|0.55015	0.5908:0.0:0.4092:0.0|0.5908:0.0:0.4092:0.0	.|.	2865;2604;2883|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	N|T	2883;2865;2864|2605	ENSP00000352925:K2883N;ENSP00000347733:K2865N|.	ENSP00000347733:K2865N|.	K|R	+|+	3|2	2|0	TRRAP|TRRAP	98417363|98417363	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.988000|0.988000	0.76386|0.76386	0.841000|0.841000	0.27613|0.27613	-0.135000|-0.135000	0.11495|0.11495	0.655000|0.655000	0.94253|0.94253	AAG|AGG	TRRAP	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT	ENSG00000196367		0.587	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	9	0.00	0	G	NM_003496		98579427	98579427	+1	no_errors	ENST00000359863	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	0.994	C
TUBA1C	84790	genome.wustl.edu	37	12	49663336	49663336	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr12:49663336A>T	ENST00000301072.6	+	2	367	c.92A>T	c.(91-93)cAg>cTg	p.Q31L	TUBA1C_ENST00000549183.1_Missense_Mutation_p.Q31L|TUBA1C_ENST00000541364.1_Missense_Mutation_p.Q101L|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	31					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						CACGGCATCCAGCCCGATGGC	0.582																																						dbGAP											0													85.0	78.0	80.0					12																	49663336		2203	4297	6500	-	-	-	SO:0001583	missense	0			BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.92A>T	12.37:g.49663336A>T	ENSP00000301072:p.Gln31Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.Q31L	ENST00000301072.6	37	c.92	CCDS8782.1	12	.	.	.	.	.	.	.	.	.	.	A	17.70	3.454252	0.63290	.	.	ENSG00000167553	ENST00000541364;ENST00000301072;ENST00000549183;ENST00000321665	T;T;T	0.68765	-0.35;-0.35;-0.35	3.66	3.66	0.41972	Tubulin/FtsZ, GTPase domain (3);	0.069511	0.64402	D	0.000019	T	0.71082	0.3298	L	0.60012	1.86	0.54753	D	0.999986	B;B	0.30824	0.002;0.296	B;P	0.45071	0.015;0.468	T	0.75283	-0.3372	10	0.87932	D	0	.	12.2987	0.54862	1.0:0.0:0.0:0.0	.	101;31	F5H5D3;Q9BQE3	.;TBA1C_HUMAN	L	101;31;31;31	ENSP00000443475:Q101L;ENSP00000301072:Q31L;ENSP00000448211:Q31L	ENSP00000301072:Q31L	Q	+	2	0	TUBA1C	47949603	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.959000	0.93110	1.899000	0.54978	0.454000	0.30748	CAG	TUBA1C	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin	ENSG00000167553		0.582	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1C	HGNC	protein_coding	OTTHUMT00000404424.1	121	0.00	0	A	NM_032704		49663336	49663336	+1	no_errors	ENST00000301072	ensembl	human	known	69_37n	missense	67	32.32	32	SNP	1.000	T
UPF3B	65109	genome.wustl.edu	37	X	118971887	118971887	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chrX:118971887G>A	ENST00000276201.2	-	10	1204	c.1135C>T	c.(1135-1137)Cgc>Tgc	p.R379C	UPF3B_ENST00000478840.1_5'Flank|UPF3B_ENST00000345865.2_Missense_Mutation_p.R366C	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	379	Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						TTCTCATAGCGCTCCTTCTGC	0.448																																						dbGAP											0													143.0	120.0	128.0					X																	118971887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.1135C>T	X.37:g.118971887G>A	ENSP00000276201:p.Arg379Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	pfam_Nonsense_mediated_decay_UPF3	p.R379C	ENST00000276201.2	37	c.1135	CCDS14588.1	X	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127641	0.77549	.	.	ENSG00000125351	ENST00000276201;ENST00000345865	T;T	0.79749	-1.24;-1.3	5.83	5.83	0.93111	.	0.096926	0.64402	D	0.000001	D	0.88727	0.6515	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68765	0.96;0.913	D	0.89528	0.3783	10	0.87932	D	0	.	18.0001	0.89196	0.0:0.0:1.0:0.0	.	366;379	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	C	379;366	ENSP00000276201:R379C;ENSP00000245418:R366C	ENSP00000276201:R379C	R	-	1	0	UPF3B	118855915	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	6.930000	0.75858	2.473000	0.83533	0.526000	0.51066	CGC	UPF3B	-	NULL	ENSG00000125351		0.448	UPF3B-001	KNOWN	basic|CCDS	protein_coding	UPF3B	HGNC	protein_coding	OTTHUMT00000058068.1	253	0.00	0	G			118971887	118971887	-1	no_errors	ENST00000276201	ensembl	human	known	69_37n	missense	245	31.56	113	SNP	1.000	A
USP53	54532	genome.wustl.edu	37	4	120192520	120192520	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr4:120192520A>G	ENST00000274030.6	+	16	2684	c.1505A>G	c.(1504-1506)cAt>cGt	p.H502R	USP53_ENST00000450251.1_Missense_Mutation_p.H502R	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						TTTAAACAACATGGGAATCCA	0.353																																						dbGAP											0													71.0	68.0	69.0					4																	120192520		1851	4099	5950	-	-	-	SO:0001583	missense	0			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1505A>G	4.37:g.120192520A>G	ENSP00000274030:p.His502Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.H502R	ENST00000274030.6	37	c.1505	CCDS43265.1	4	.	.	.	.	.	.	.	.	.	.	A	8.844	0.943015	0.18281	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.21734	1.99;1.99	5.84	0.677	0.17964	.	1.437660	0.03850	N	0.272172	T	0.13543	0.0328	N	0.24115	0.695	0.09310	N	1	B	0.24823	0.112	B	0.19148	0.024	T	0.23655	-1.0182	10	0.27785	T	0.31	-0.5636	4.4255	0.11501	0.5575:0.0:0.301:0.1415	.	502	Q70EK8	UBP53_HUMAN	R	502	ENSP00000274030:H502R;ENSP00000409906:H502R	ENSP00000274030:H502R	H	+	2	0	USP53	120411968	0.082000	0.21442	0.000000	0.03702	0.495000	0.33615	3.634000	0.54302	0.112000	0.17975	0.528000	0.53228	CAT	USP53	-	NULL	ENSG00000145390		0.353	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP53	HGNC	protein_coding	OTTHUMT00000364564.2	103	0.00	0	A	XM_052597		120192520	120192520	+1	no_errors	ENST00000274030	ensembl	human	known	69_37n	missense	70	32.69	34	SNP	0.000	G
VPS8	23355	genome.wustl.edu	37	3	184566859	184566859	+	Splice_Site	SNP	A	A	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr3:184566859A>T	ENST00000437079.3	+	9	713	c.542A>T	c.(541-543)gAt>gTt	p.D181V	VPS8_ENST00000446204.2_Splice_Site_p.D179V|VPS8_ENST00000287546.4_Splice_Site_p.Y181F|VPS8_ENST00000436792.2_Splice_Site_p.D179V	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	181							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CTTTCTTTAGATCAGAATCAA	0.423																																						dbGAP											0													95.0	91.0	92.0					3																	184566859		1937	4143	6080	-	-	-	SO:0001630	splice_region_variant	0			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.542-1A>T	3.37:g.184566859A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y181F	ENST00000437079.3	37	c.542	CCDS46971.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.2|25.2	4.617510|4.617510	0.87359|0.87359	.|.	.|.	ENSG00000156931|ENSG00000156931	ENST00000437079;ENST00000436792;ENST00000446204;ENST00000422105|ENST00000287546	D;T;T;T|T	0.95069|0.62941	-3.6;-0.85;-0.85;2.15|-0.01	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	.|0.552747	.|0.19690	.|N	.|0.108285	T|T	0.70518|0.70518	0.3233|0.3233	M|M	0.70842|0.70842	2.15|2.15	0.80722|0.80722	D|D	1|1	D;P|.	0.76494|.	0.999;0.836|.	D;P|.	0.85130|.	0.997;0.499|.	T|T	0.65911|0.65911	-0.6053|-0.6053	9|8	0.87932|0.14252	D|T	0|0.57	.|.	15.7686|15.7686	0.78146|0.78146	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	179;179|.	Q8N3P4-2;Q8N3P4-3|.	.;.|.	V|F	181;179;179;179|181	ENSP00000397879:D181V;ENSP00000404704:D179V;ENSP00000405483:D179V;ENSP00000415161:D179V|ENSP00000287546:Y181F	ENSP00000415161:D179V|ENSP00000287546:Y181F	D|Y	+|+	2|2	0|0	VPS8|VPS8	186049553|186049553	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.833000|0.833000	0.47200|0.47200	9.000000|9.000000	0.93564|0.93564	2.122000|2.122000	0.65172|0.65172	0.460000|0.460000	0.39030|0.39030	GAT|TAT	VPS8	-	superfamily_Quinonprotein_ADH-like	ENSG00000156931		0.423	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	HGNC	protein_coding		66	0.00	0	A	NM_015303	Missense_Mutation	184566859	184566859	+1	no_errors	ENST00000287546	ensembl	human	known	69_37n	missense	50	35.90	28	SNP	1.000	T
VRK3	51231	genome.wustl.edu	37	19	50510825	50510825	+	Splice_Site	SNP	C	C	A	rs113786199		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:50510825C>A	ENST00000599538.1	-	5	1212		c.e5+1		VRK3_ENST00000594092.1_Splice_Site|VRK3_ENST00000601912.1_Splice_Site|VRK3_ENST00000594948.1_Splice_Site|VRK3_ENST00000424804.2_Splice_Site|VRK3_ENST00000377011.2_Splice_Site|VRK3_ENST00000443401.2_Splice_Site|VRK3_ENST00000593919.1_Splice_Site|VRK3_ENST00000601341.1_Splice_Site|VRK3_ENST00000316763.3_Splice_Site			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3						negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		ACAGAGTGTACCTTCATAGAG	0.582																																					Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)	dbGAP											0													149.0	117.0	128.0					19																	50510825		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.547+1G>T	19.37:g.50510825C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEG5|A8KA53|Q502Y2|Q9P2V8	Splice_Site	SNP	-	e3+1	ENST00000599538.1	37	c.547+1	CCDS12791.1	19	.	.	.	.	.	.	.	.	.	.	C	8.306	0.821041	0.16678	.	.	ENSG00000105053	ENST00000316763;ENST00000377011;ENST00000443401;ENST00000424804	.	.	.	4.32	3.27	0.37495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3463	0.43907	0.0:0.8009:0.1991:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VRK3	55202637	1.000000	0.71417	0.991000	0.47740	0.140000	0.21249	2.860000	0.48372	1.399000	0.46721	-0.302000	0.09304	.	VRK3	-	-	ENSG00000105053		0.582	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	VRK3	HGNC	protein_coding	OTTHUMT00000464815.1	51	0.00	0	C	NM_016440	Intron	50510825	50510825	-1	no_errors	ENST00000316763	ensembl	human	known	69_37n	splice_site	71	34.26	37	SNP	0.992	A
VRTN	55237	genome.wustl.edu	37	14	74824475	74824476	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr14:74824475_74824476insC	ENST00000256362.4	+	2	1230_1231	c.989_990insC	c.(988-993)gtgccafs	p.P331fs		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	331					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						GGGGGCGTCGTGCCACTTCAGC	0.663																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	Exception_encountered	14.37:g.74824475_74824476insC	ENSP00000256362:p.Pro331fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVC7	Frame_Shift_Ins	INS	pfam_Transposase_8	p.P331fs	ENST00000256362.4	37	c.989_990	CCDS9830.1	14																																																																																			VRTN	-	NULL	ENSG00000133980		0.663	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VRTN	HGNC	protein_coding	OTTHUMT00000412339.1	35	0.00	0	-	NM_018228		74824475	74824476	+1	no_errors	ENST00000256362	ensembl	human	known	69_37n	frame_shift_ins	20	39.39	13	INS	0.994:0.997	C
WFDC8	90199	genome.wustl.edu	37	20	44180679	44180679	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr20:44180679C>G	ENST00000357199.4	-	6	790	c.712G>C	c.(712-714)Gac>Cac	p.D238H	WFDC8_ENST00000289953.2_Missense_Mutation_p.D238H	NM_181510.2	NP_852611.2	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8	238	WAP 3. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|stomach(1)|upper_aerodigestive_tract(1)	15		Myeloproliferative disorder(115;0.0122)				CGTCTGGGGTCCATACATTTC	0.403																																						dbGAP											0													139.0	127.0	131.0					20																	44180679		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031663	CCDS13361.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000158901	ENSG00000158901		"""WAP four-disulfide core domain containing"""	16163	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 170"""	C20orf170		12206714	Standard	NM_130896		Approved	dJ461P17.1, WAP8	uc002xow.3	Q8IUA0	OTTHUMG00000046342	ENST00000357199.4:c.712G>C	20.37:g.44180679C>G	ENSP00000361735:p.Asp238His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P623|Q5TDV2|Q96A34	Missense_Mutation	SNP	pfam_Whey_acidic_protein_4-diS_core,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,prints_4-disulphide_core,pfscan_Prot_inh_Kunz-m	p.D238H	ENST00000357199.4	37	c.712	CCDS13361.1	20	.	.	.	.	.	.	.	.	.	.	C	7.583	0.669096	0.14776	.	.	ENSG00000158901	ENST00000357199;ENST00000289953	T;T	0.73363	-0.74;-0.74	4.11	-3.39	0.04868	Whey acidic protein, 4-disulphide core (4);4-disulphide core (1);	2.064970	0.02048	N	0.049854	T	0.70124	0.3188	M	0.72479	2.2	0.09310	N	1	P	0.41265	0.744	B	0.42282	0.382	T	0.56438	-0.7979	10	0.35671	T	0.21	.	0.9813	0.01437	0.1451:0.2937:0.2845:0.2766	.	238	Q8IUA0	WFDC8_HUMAN	H	238	ENSP00000361735:D238H;ENSP00000289953:D238H	ENSP00000289953:D238H	D	-	1	0	WFDC8	43614093	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.307000	0.08167	-0.589000	0.05874	0.551000	0.68910	GAC	WFDC8	-	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,prints_4-disulphide_core	ENSG00000158901		0.403	WFDC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC8	HGNC	protein_coding	OTTHUMT00000106958.1	232	0.00	0	C			44180679	44180679	-1	no_errors	ENST00000289953	ensembl	human	known	69_37n	missense	283	24.53	92	SNP	0.000	G
WIPI1	55062	genome.wustl.edu	37	17	66426165	66426165	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr17:66426165C>T	ENST00000262139.5	-	9	936	c.937G>A	c.(937-939)Gga>Aga	p.G313R	WIPI1_ENST00000589459.1_5'UTR|RP11-120M18.2_ENST00000592030.1_RNA|WIPI1_ENST00000546360.1_Missense_Mutation_p.G231R	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	313					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)	p.G313R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						TTCCTCTGTCCGGAGAAGTTC	0.478																																						dbGAP											1	Substitution - Missense(1)	lung(1)											209.0	177.0	188.0					17																	66426165		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.937G>A	17.37:g.66426165C>T	ENSP00000262139:p.Gly313Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXM5|Q9NWF8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.G313R	ENST00000262139.5	37	c.937	CCDS11677.1	17	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965801	0.92855	.	.	ENSG00000070540	ENST00000262139;ENST00000546360	T;T	0.53423	0.62;2.28	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74650	0.3744	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	T	0.78666	-0.2115	10	0.59425	D	0.04	-22.6708	19.4835	0.95020	0.0:1.0:0.0:0.0	.	313	Q5MNZ9	WIPI1_HUMAN	R	313;231	ENSP00000262139:G313R;ENSP00000437345:G231R	ENSP00000262139:G313R	G	-	1	0	WIPI1	63937760	1.000000	0.71417	0.915000	0.36163	0.852000	0.48524	7.380000	0.79704	2.618000	0.88619	0.561000	0.74099	GGA	WIPI1	-	superfamily_WD40_repeat_dom	ENSG00000070540		0.478	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPI1	HGNC	protein_coding	OTTHUMT00000448739.1	111	0.00	0	C	NM_017983		66426165	66426165	-1	no_errors	ENST00000262139	ensembl	human	known	69_37n	missense	67	33.00	33	SNP	1.000	T
WSCD2	9671	genome.wustl.edu	37	12	108589649	108589649	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr12:108589649C>T	ENST00000332082.4	+	3	858	c.40C>T	c.(40-42)Cgg>Tgg	p.R14W	WSCD2_ENST00000547525.1_Missense_Mutation_p.R14W|WSCD2_ENST00000261400.3_Missense_Mutation_p.R14W|WSCD2_ENST00000549903.1_Missense_Mutation_p.R14W			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	14						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GTACTTCCGCCGGAAACCTGT	0.587																																						dbGAP											0													66.0	70.0	69.0					12																	108589649		1980	4154	6134	-	-	-	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.40C>T	12.37:g.108589649C>T	ENSP00000331933:p.Arg14Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.R14W	ENST00000332082.4	37	c.40	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215067	0.79352	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.43688	0.98;0.94;0.98;0.94	5.74	-3.28	0.05033	.	0.000000	0.85682	D	0.000000	T	0.60881	0.2303	M	0.70275	2.135	0.58432	D	0.99999	D	0.89917	1.0	D	0.77557	0.99	T	0.68066	-0.5507	10	0.87932	D	0	-35.8954	19.1331	0.93415	0.7476:0.2524:0.0:0.0	.	14	Q2TBF2	WSCD2_HUMAN	W	14	ENSP00000448047:R14W;ENSP00000261400:R14W;ENSP00000331933:R14W;ENSP00000447272:R14W	ENSP00000261400:R14W	R	+	1	2	WSCD2	107113779	1.000000	0.71417	0.973000	0.42090	0.995000	0.86356	1.378000	0.34328	-0.552000	0.06167	-0.181000	0.13052	CGG	WSCD2	-	NULL	ENSG00000075035		0.587	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	191	0.00	0	C	NM_014653		108589649	108589649	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	missense	141	25.40	48	SNP	0.977	T
WSCD2	9671	genome.wustl.edu	37	12	108589656	108589656	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr12:108589656C>A	ENST00000332082.4	+	3	865	c.47C>A	c.(46-48)cCt>cAt	p.P16H	WSCD2_ENST00000547525.1_Missense_Mutation_p.P16H|WSCD2_ENST00000261400.3_Missense_Mutation_p.P16H|WSCD2_ENST00000549903.1_Missense_Mutation_p.P16H			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	16						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CGCCGGAAACCTGTGCGCTTC	0.592																																						dbGAP											0													74.0	79.0	77.0					12																	108589656		1988	4166	6154	-	-	-	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.47C>A	12.37:g.108589656C>A	ENSP00000331933:p.Pro16His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.P16H	ENST00000332082.4	37	c.47	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455583	0.84209	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.31769	1.49;1.48;1.49;1.48	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.55609	0.1931	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.47032	-0.9148	10	0.35671	T	0.21	-20.7752	18.8897	0.92395	0.0:1.0:0.0:0.0	.	16	Q2TBF2	WSCD2_HUMAN	H	16	ENSP00000448047:P16H;ENSP00000261400:P16H;ENSP00000331933:P16H;ENSP00000447272:P16H	ENSP00000261400:P16H	P	+	2	0	WSCD2	107113786	1.000000	0.71417	0.914000	0.36105	0.984000	0.73092	7.367000	0.79558	2.704000	0.92352	0.655000	0.94253	CCT	WSCD2	-	NULL	ENSG00000075035		0.592	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	192	0.00	0	C	NM_014653		108589656	108589656	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	missense	120	37.50	72	SNP	1.000	A
XIST	7503	genome.wustl.edu	37	X	73063621	73063621	+	lincRNA	SNP	T	T	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chrX:73063621T>G	ENST00000429829.1	-	0	8967					NR_001564.2				X inactive specific transcript (non-protein coding)																		CCTTATCTAGTGCACAGATCA	0.408																																						dbGAP											0													80.0	71.0	74.0					X																	73063621		876	1991	2867	-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73063621T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.408	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	40	0.00	0	T	NR_001564		73063621	73063621	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	61	26.51	22	SNP	0.009	G
XKR6	286046	genome.wustl.edu	37	8	10755617	10755617	+	Silent	SNP	T	T	G			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr8:10755617T>G	ENST00000416569.2	-	3	1797	c.1771A>C	c.(1771-1773)Aga>Cga	p.R591R	XKR6_ENST00000304437.2_Silent_p.R312R	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	591						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		TATCGCTTTCTTGGCATGTCA	0.527																																						dbGAP											0													74.0	72.0	72.0					8																	10755617		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1771A>C	8.37:g.10755617T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBA0	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.Q367H	ENST00000416569.2	37	c.1101	CCDS5978.2	8	.	.	.	.	.	.	.	.	.	.	T	4.601	0.111648	0.08831	.	.	ENSG00000171044	ENST00000382461	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	T	0.68742	0.3034	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68096	-0.5499	4	.	.	.	-8.4626	13.5511	0.61732	0.0:0.0:0.0:1.0	.	.	.	.	H	367	.	.	Q	-	3	2	XKR6	10793027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.855000	0.62925	1.984000	0.57885	0.454000	0.30748	CAA	XKR6	-	NULL	ENSG00000171044		0.527	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR6	HGNC	protein_coding	OTTHUMT00000383958.1	164	0.00	0	T	NM_173683		10755617	10755617	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000382461	ensembl	human	putative	69_37n	missense	124	15.65	23	SNP	1.000	G
ZFR	51663	genome.wustl.edu	37	5	32390509	32390509	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr5:32390509C>A	ENST00000265069.8	-	12	2116	c.2014G>T	c.(2014-2016)Gag>Tag	p.E672*		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	672					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TGTTCTTCCTCCATTCTCCTC	0.463																																						dbGAP											0													144.0	139.0	141.0					5																	32390509		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2014G>T	5.37:g.32390509C>A	ENSP00000265069:p.Glu672*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Nonsense_Mutation	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.E672*	ENST00000265069.8	37	c.2014	CCDS34139.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.546030	0.99201	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.907	0.92466	0.0:1.0:0.0:0.0	.	.	.	.	X	672;650	.	ENSP00000265069:E672X	E	-	1	0	ZFR	32426266	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.248000	0.78268	2.463000	0.83235	0.561000	0.74099	GAG	ZFR	-	NULL	ENSG00000056097		0.463	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	55	0.00	0	C			32390509	32390509	-1	no_errors	ENST00000265069	ensembl	human	known	69_37n	nonsense	96	25.95	34	SNP	1.000	A
ZMYND19	116225	genome.wustl.edu	37	9	140481541	140481542	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr9:140481541_140481542insC	ENST00000298585.2	-	4	462_463	c.236_237insG	c.(235-237)ggcfs	p.G79fs	ZMYND19_ENST00000471957.1_5'UTR	NM_138462.2	NP_612471.1	Q96E35	ZMY19_HUMAN	zinc finger, MYND-type containing 19	79						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synapse (GO:0045202)	metal ion binding (GO:0046872)	p.V80fs*34(2)		endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		CCGGGGCCACGCCCCCCCGGTG	0.634																																						dbGAP											2	Insertion - Frameshift(2)	large_intestine(2)																																								-	-	-	SO:0001589	frameshift_variant	0			BC012948	CCDS7048.1	9q34.3	2008-02-05			ENSG00000165724	ENSG00000165724		"""Zinc fingers, MYND-type"""	21146	protein-coding gene	gene with protein product		611424					Standard	NM_138462		Approved	MIZIP	uc004cno.1	Q96E35	OTTHUMG00000020992	ENST00000298585.2:c.237dupG	9.37:g.140481548_140481548dupC	ENSP00000298585:p.Gly79fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T366	Frame_Shift_Ins	INS	pfam_Znf_MYND,pfscan_Znf_MYND	p.V80fs	ENST00000298585.2	37	c.237_236	CCDS7048.1	9																																																																																			ZMYND19	-	NULL	ENSG00000165724		0.634	ZMYND19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND19	HGNC	protein_coding	OTTHUMT00000055356.1	12	0.00	0	-	NM_138462		140481541	140481542	-1	no_errors	ENST00000298585	ensembl	human	known	69_37n	frame_shift_ins	16	15.79	3	INS	0.508:0.986	C
ZNF208	7757	genome.wustl.edu	37	19	22156700	22156700	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:22156700T>C	ENST00000397126.4	-	4	1284	c.1136A>G	c.(1135-1137)aAg>aGg	p.K379R	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	379					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGAGGGCCACTTATAGGCTTT	0.378																																						dbGAP											0													38.0	42.0	41.0					19																	22156700		2062	4217	6279	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1136A>G	19.37:g.22156700T>C	ENSP00000380315:p.Lys379Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K379R	ENST00000397126.4	37	c.1136	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.139135	0.00335	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.07444	3.19	2.65	-5.3	0.02738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08268	0.0206	.	.	.	0.09310	N	1	D	0.61080	0.989	P	0.59288	0.855	T	0.02167	-1.1202	8	0.10902	T	0.67	.	1.648	0.02766	0.3161:0.3595:0.196:0.1283	.	379	O43345	ZN208_HUMAN	R	379	ENSP00000380315:K379R	ENSP00000380315:K379R	K	-	2	0	ZNF208	21948540	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.245000	0.00267	-2.407000	0.00574	-0.760000	0.03462	AAG	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	321	0.00	0	T	NM_007153		22156700	22156700	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	259	38.19	160	SNP	0.000	C
ZNF229	7772	genome.wustl.edu	37	19	44933197	44933197	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:44933197G>A	ENST00000588931.1	-	6	2192	c.1759C>T	c.(1759-1761)Ctt>Ttt	p.L587F	CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000591289.1_Intron|ZNF229_ENST00000291187.4_Missense_Mutation_p.L581F	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	587					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TGGCTGTGAAGGTCTGAATTC	0.572																																						dbGAP											0													52.0	57.0	55.0					19																	44933197		2188	4295	6483	-	-	-	SO:0001583	missense	0			AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1759C>T	19.37:g.44933197G>A	ENSP00000466519:p.Leu587Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L587F	ENST00000588931.1	37	c.1759	CCDS42574.1	19	.	.	.	.	.	.	.	.	.	.	G	9.113	1.006975	0.19199	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.5	-0.23	0.13090	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.51702	0.1690	M	0.72624	2.21	0.09310	N	1	B	0.33940	0.433	B	0.43123	0.409	T	0.52305	-0.8593	8	0.62326	D	0.03	.	8.4994	0.33148	0.1724:0.1307:0.6969:0.0	.	587	Q9UJW7	ZN229_HUMAN	F	587	.	ENSP00000291187:L587F	L	-	1	0	ZNF229	49625037	0.001000	0.12720	0.000000	0.03702	0.095000	0.18619	0.046000	0.14035	-0.529000	0.06358	-1.028000	0.02416	CTT	ZNF229	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167383		0.572	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	HGNC	protein_coding	OTTHUMT00000460833.1	160	0.62	1	G	NM_014518		44933197	44933197	-1	no_errors	ENST00000588931	ensembl	human	known	69_37n	missense	95	19.49	23	SNP	0.002	A
ZNF532	55205	genome.wustl.edu	37	18	56586092	56586092	+	Silent	SNP	G	G	T	rs371823083		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr18:56586092G>T	ENST00000336078.4	+	4	1349	c.573G>T	c.(571-573)acG>acT	p.T191T	ZNF532_ENST00000591230.1_Silent_p.T191T|ZNF532_ENST00000591083.1_Silent_p.T191T|ZNF532_ENST00000591808.1_Silent_p.T191T|ZNF532_ENST00000589288.1_Silent_p.T191T	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						GACTCTCTACGTCAGGCAATG	0.473																																						dbGAP											0													96.0	102.0	100.0					18																	56586092		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.573G>T	18.37:g.56586092G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T191	ENST00000336078.4	37	c.573	CCDS11969.1	18																																																																																			ZNF532	-	NULL	ENSG00000074657		0.473	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	HGNC	protein_coding	OTTHUMT00000256130.1	397	0.00	0	G	NM_018181		56586092	56586092	+1	no_errors	ENST00000336078	ensembl	human	known	69_37n	silent	369	37.56	222	SNP	0.000	T
ZNF585B	92285	genome.wustl.edu	37	19	37681051	37681051	+	Splice_Site	SNP	C	C	T	rs557814772		TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr19:37681051C>T	ENST00000532828.2	-	3	325	c.74G>A	c.(73-75)gGa>gAa	p.G25E	ZNF585B_ENST00000531805.1_5'UTR|ZNF585B_ENST00000586320.1_Splice_Site_p.G10E|CTC-454I21.3_ENST00000585860.2_Splice_Site_p.G25E|ZNF585B_ENST00000527838.1_Splice_Site_p.G25E	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGACACTGATCCCTGTAAGGG	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20847	0.0		0.0	False		,,,				2504	0.0				Melanoma(93;882 1454 18863 28917 48427)	dbGAP											0													92.0	80.0	84.0					19																	37681051		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.73-1G>A	19.37:g.37681051C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G25E	ENST00000532828.2	37	c.74	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	C	12.15	1.852946	0.32699	.	.	ENSG00000245680	ENST00000532828;ENST00000527838	T;T	0.00801	5.68;5.68	3.11	-1.95	0.07548	Krueppel-associated box (1);	.	.	.	.	T	0.00496	0.0016	N	0.17674	0.51	0.42943	D	0.994356	P	0.36959	0.575	B	0.24269	0.052	T	0.62163	-0.6912	9	0.09338	T	0.73	.	6.3104	0.21161	0.0:0.4608:0.0:0.5392	.	25	Q52M93	Z585B_HUMAN	E	25	ENSP00000433773:G25E;ENSP00000435268:G25E	ENSP00000435268:G25E	G	-	2	0	ZNF585B	42372891	0.000000	0.05858	0.389000	0.26208	0.846000	0.48090	-2.317000	0.01122	-0.429000	0.07329	-0.350000	0.07774	GGA	ZNF585B	-	superfamily_Krueppel-associated_box	ENSG00000245680		0.473	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	163	0.00	0	C	NM_152279	Missense_Mutation	37681051	37681051	-1	no_errors	ENST00000532828	ensembl	human	known	69_37n	missense	126	17.65	27	SNP	0.410	T
ZNF598	90850	genome.wustl.edu	37	16	2048361	2048361	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr16:2048361C>A	ENST00000563630.1	-	12	2664	c.2422G>T	c.(2422-2424)Gac>Tac	p.D808Y	ZNF598_ENST00000562103.1_Missense_Mutation_p.D808Y|AC005606.15_ENST00000567515.1_lincRNA|ZNF598_ENST00000431526.1_Missense_Mutation_p.D863Y			Q86UK7	ZN598_HUMAN	zinc finger protein 598	863							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						ACACGGCAGTCCAGGCCCGCC	0.662																																						dbGAP											0													45.0	57.0	53.0					16																	2048361		2053	4186	6239	-	-	-	SO:0001583	missense	0			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.2422G>T	16.37:g.2048361C>A	ENSP00000455882:p.Asp808Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.D863Y	ENST00000563630.1	37	c.2587		16	.	.	.	.	.	.	.	.	.	.	.	20.2	3.950151	0.73787	.	.	ENSG00000167962	ENST00000431526	T	0.20598	2.06	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.47728	0.1461	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.51276	-0.8726	10	0.72032	D	0.01	-36.9939	16.8975	0.86104	0.0:1.0:0.0:0.0	.	863;855	Q86UK7;Q86UK7-2	ZN598_HUMAN;.	Y	863	ENSP00000411409:D863Y	ENSP00000411409:D863Y	D	-	1	0	ZNF598	1988362	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.066000	0.76734	2.465000	0.83290	0.563000	0.77884	GAC	ZNF598	-	NULL	ENSG00000167962		0.662	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1	10	0.00	0	C	NM_178167		2048361	2048361	-1	no_errors	ENST00000431526	ensembl	human	known	69_37n	missense	0	100.00	4	SNP	1.000	A
ZNF76	7629	genome.wustl.edu	37	6	35258417	35258417	+	Splice_Site	SNP	G	G	A			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr6:35258417G>A	ENST00000373953.3	+	7	815		c.e7-1		ZNF76_ENST00000440666.2_Splice_Site|ZNF76_ENST00000339411.5_Splice_Site	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76						regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						TGTCCTCACAGGTGCATGAAC	0.512																																					Esophageal Squamous(52;92 1039 20612 23956 34676)	dbGAP											0													145.0	127.0	133.0					6																	35258417		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.550-1G>A	6.37:g.35258417G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQB2	Splice_Site	SNP	-	e6-1	ENST00000373953.3	37	c.550-1	CCDS4801.1	6	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760734	0.89932	.	.	ENSG00000065029	ENST00000469195;ENST00000448999;ENST00000373953;ENST00000417184;ENST00000440666;ENST00000339411	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2522	0.90007	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF76	35366395	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.411000	0.97342	2.797000	0.96272	0.561000	0.74099	.	ZNF76	-	-	ENSG00000065029		0.512	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	HGNC	protein_coding	OTTHUMT00000040279.2	190	0.00	0	G	NM_003427	Intron	35258417	35258417	+1	no_errors	ENST00000373953	ensembl	human	known	69_37n	splice_site	78	41.35	55	SNP	1.000	A
ZNF804B	219578	genome.wustl.edu	37	7	88963433	88963433	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0JD-01A-11W-A071-09	TCGA-AO-A0JD-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32	b3d6fcbb-a58c-488b-81d0-3af21736e84f	g.chr7:88963433G>T	ENST00000333190.4	+	4	1746	c.1137G>T	c.(1135-1137)agG>agT	p.R379S		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	379							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GTGATGCCAGGATATCTGAAT	0.388										HNSCC(36;0.09)																												dbGAP											0													44.0	50.0	48.0					7																	88963433		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1137G>T	7.37:g.88963433G>T	ENSP00000329638:p.Arg379Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.R379S	ENST00000333190.4	37	c.1137	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	6.440	0.449289	0.12223	.	.	ENSG00000182348	ENST00000333190	T	0.05025	3.51	5.06	3.2	0.36748	.	0.226724	0.31167	N	0.008125	T	0.06826	0.0174	M	0.65975	2.015	0.09310	N	1	P	0.43094	0.799	B	0.35859	0.212	T	0.31308	-0.9948	10	0.49607	T	0.09	-7.0405	5.578	0.17235	0.2536:0.1544:0.592:0.0	.	379	A4D1E1	Z804B_HUMAN	S	379	ENSP00000329638:R379S	ENSP00000329638:R379S	R	+	3	2	ZNF804B	88801369	0.000000	0.05858	0.905000	0.35620	0.859000	0.49053	0.143000	0.16115	0.685000	0.31468	-0.253000	0.11424	AGG	ZNF804B	-	NULL	ENSG00000182348		0.388	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	110	0.00	0	G	NM_181646		88963433	88963433	+1	no_errors	ENST00000333190	ensembl	human	known	69_37n	missense	161	19.50	39	SNP	0.038	T
