#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADD3	120	genome.wustl.edu	37	10	111892110	111892110	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr10:111892110A>T	ENST00000356080.4	+	14	2147	c.1780A>T	c.(1780-1782)Att>Ttt	p.I594F	ADD3_ENST00000277900.8_Intron|ADD3_ENST00000360162.3_Intron	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	594						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		TGTTTCACAAATTCAGTCTCA	0.383																																						dbGAP											0													103.0	100.0	101.0					10																	111892110		2203	4300	6503	-	-	-	SO:0001583	missense	0			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.1780A>T	10.37:g.111892110A>T	ENSP00000348381:p.Ile594Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.I594F	ENST00000356080.4	37	c.1780	CCDS7561.1	10	.	.	.	.	.	.	.	.	.	.	A	8.722	0.914603	0.17907	.	.	ENSG00000148700	ENST00000356080	T	0.17370	2.28	5.51	4.39	0.52855	.	0.277643	0.41605	D	0.000857	T	0.12220	0.0297	L	0.36672	1.1	0.80722	D	1	B	0.28128	0.201	B	0.29267	0.1	T	0.11817	-1.0572	10	0.22706	T	0.39	-7.0954	6.9705	0.24646	0.774:0.1506:0.0753:0.0	.	594	Q9UEY8	ADDG_HUMAN	F	594	ENSP00000348381:I594F	ENSP00000348381:I594F	I	+	1	0	ADD3	111882100	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.234000	0.58658	2.096000	0.63516	0.533000	0.62120	ATT	ADD3	-	NULL	ENSG00000148700		0.383	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD3	HGNC	protein_coding	OTTHUMT00000050289.1	184	0.00	0	A	NM_019903		111892110	111892110	+1	no_errors	ENST00000356080	ensembl	human	known	69_37n	missense	167	34.51	88	SNP	1.000	T
PRR27	401137	genome.wustl.edu	37	4	71024598	71024598	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr4:71024598C>A	ENST00000344526.5	+	3	818	c.629C>A	c.(628-630)cCt>cAt	p.P210H	C4orf40_ENST00000502294.1_Missense_Mutation_p.P210H	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		210	Ala/Pro-rich.					extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GAACCTCACCCTTCTCCCTCT	0.502																																						dbGAP											0													56.0	50.0	52.0					4																	71024598		2200	4298	6498	-	-	-	SO:0001583	missense	0																														ENST00000344526.5:c.629C>A	4.37:g.71024598C>A	ENSP00000343172:p.Pro210His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXP0|Q6MZR6	Missense_Mutation	SNP	NULL	p.P210H	ENST00000344526.5	37	c.629	CCDS3535.1	4	.	.	.	.	.	.	.	.	.	.	C	2.829	-0.243003	0.05906	.	.	ENSG00000187533	ENST00000502294;ENST00000344526	T;T	0.36699	1.24;1.24	3.71	0.0566	0.14319	.	.	.	.	.	T	0.27967	0.0689	N	0.14661	0.345	0.09310	N	1	D	0.53885	0.963	P	0.52267	0.694	T	0.15607	-1.0431	9	0.48119	T	0.1	1.0166	6.5717	0.22543	0.0:0.5689:0.0:0.4311	.	210	Q6MZM9	CD040_HUMAN	H	210	ENSP00000426249:P210H;ENSP00000343172:P210H	ENSP00000343172:P210H	P	+	2	0	C4orf40	71059187	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-0.017000	0.12590	-0.034000	0.13713	-1.206000	0.01644	CCT	C4orf40	-	NULL	ENSG00000187533		0.502	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf40	HGNC	protein_coding	OTTHUMT00000251558.1	23	0.00	0	C			71024598	71024598	+1	no_errors	ENST00000344526	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.000	A
CDCA4	55038	genome.wustl.edu	37	14	105477579	105477579	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr14:105477579C>T	ENST00000336219.3	-	2	843	c.688G>A	c.(688-690)Gag>Aag	p.E230K	CDCA4_ENST00000392590.3_Missense_Mutation_p.E230K	NM_017955.3	NP_060425.2	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	230						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		TGGTCCAGCTCGCCCAGGTCG	0.682																																						dbGAP											0													21.0	21.0	21.0					14																	105477579		2199	4297	6496	-	-	-	SO:0001583	missense	0			BG354577	CCDS9996.1	14q32.33	2014-02-14			ENSG00000170779	ENSG00000170779			14625	protein-coding gene	gene with protein product	"""hematopoietic progenitor protein"""	612270				12188893	Standard	NM_145701		Approved	FLJ20764, Hepp	uc001yqb.2	Q9BXL8	OTTHUMG00000170767	ENST00000336219.3:c.688G>A	14.37:g.105477579C>T	ENSP00000337226:p.Glu230Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB18|Q9NWK7	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.E230K	ENST00000336219.3	37	c.688	CCDS9996.1	14	.	.	.	.	.	.	.	.	.	.	c	29.5	5.011792	0.93346	.	.	ENSG00000170779	ENST00000336219;ENST00000392590	T;T	0.41758	0.99;0.99	4.64	3.74	0.42951	.	0.103551	0.64402	D	0.000004	T	0.57814	0.2079	M	0.77313	2.365	0.80722	D	1	D	0.76494	0.999	P	0.55345	0.774	T	0.65393	-0.6179	10	0.72032	D	0.01	-20.4159	13.9963	0.64405	0.0:0.8471:0.1529:0.0	.	230	Q9BXL8	CDCA4_HUMAN	K	230	ENSP00000337226:E230K;ENSP00000376369:E230K	ENSP00000337226:E230K	E	-	1	0	CDCA4	104548624	1.000000	0.71417	0.981000	0.43875	0.940000	0.58332	7.344000	0.79328	1.051000	0.40369	0.650000	0.86243	GAG	CDCA4	-	NULL	ENSG00000170779		0.682	CDCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA4	HGNC	protein_coding	OTTHUMT00000410311.1	24	0.00	0	C	NM_145701		105477579	105477579	-1	no_errors	ENST00000336219	ensembl	human	known	69_37n	missense	14	40.00	10	SNP	1.000	T
HELQ	113510	genome.wustl.edu	37	4	84368010	84368010	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr4:84368010A>T	ENST00000295488.3	-	4	1532	c.1370T>A	c.(1369-1371)cTg>cAg	p.L457Q	HELQ_ENST00000510985.1_Intron	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	457	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						AACCAGACCCAGACTGTCAAT	0.328								Other identified genes with known or suspected DNA repair function																														dbGAP											0													144.0	139.0	140.0					4																	84368010		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.1370T>A	4.37:g.84368010A>T	ENSP00000295488:p.Leu457Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L457Q	ENST00000295488.3	37	c.1370	CCDS3603.1	4	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414259	0.83449	.	.	ENSG00000163312	ENST00000295488	T	0.19250	2.16	5.64	5.64	0.86602	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.071590	0.56097	D	0.000039	T	0.57198	0.2037	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.68891	-0.5289	10	0.87932	D	0	-19.86	15.8614	0.79026	1.0:0.0:0.0:0.0	.	457	Q8TDG4	HELQ_HUMAN	Q	457	ENSP00000295488:L457Q	ENSP00000295488:L457Q	L	-	2	0	HELQ	84587034	1.000000	0.71417	0.987000	0.45799	0.913000	0.54294	9.056000	0.93881	2.142000	0.66516	0.477000	0.44152	CTG	HELQ	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000163312		0.328	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELQ	HGNC	protein_coding	OTTHUMT00000252810.1	179	0.00	0	A	NM_133636		84368010	84368010	-1	no_errors	ENST00000295488	ensembl	human	known	69_37n	missense	132	37.67	81	SNP	1.000	T
HRNR	388697	genome.wustl.edu	37	1	152189237	152189237	+	Missense_Mutation	SNP	C	C	G	rs200543988	byFrequency	TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr1:152189237C>G	ENST00000368801.2	-	3	4943	c.4868G>C	c.(4867-4869)aGc>aCc	p.S1623T	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1623					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGGCCACTGCTGGAAGACCG	0.617																																						dbGAP											0													5.0	1.0	3.0					1																	152189237		494	616	1110	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.4868G>C	1.37:g.152189237C>G	ENSP00000357791:p.Ser1623Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.S1623T	ENST00000368801.2	37	c.4868	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	7.019	0.558245	0.13436	.	.	ENSG00000197915	ENST00000368801	T	0.05199	3.48	4.35	-1.7	0.08159	.	.	.	.	.	T	0.01254	0.0041	L	0.48642	1.525	0.09310	N	1	B	0.30281	0.275	B	0.18263	0.021	T	0.46965	-0.9153	9	0.12766	T	0.61	.	6.3832	0.21546	0.0:0.3868:0.4467:0.1665	.	1623	Q86YZ3	HORN_HUMAN	T	1623	ENSP00000357791:S1623T	ENSP00000357791:S1623T	S	-	2	0	HRNR	150455861	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.035000	0.12205	-0.146000	0.11274	-0.241000	0.12123	AGC	HRNR	-	NULL	ENSG00000197915		0.617	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	12	0.00	0	C	XM_373868		152189237	152189237	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	5	37.50	3	SNP	0.000	G
ICOS	29851	genome.wustl.edu	37	2	204820385	204820385	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr2:204820385G>A	ENST00000316386.6	+	2	152	c.85G>A	c.(85-87)Gag>Aag	p.E29K	ICOS_ENST00000435193.1_Missense_Mutation_p.E29K	NM_012092.3	NP_036224.1	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator	29					immune response (GO:0006955)|single organismal cell-cell adhesion (GO:0016337)|T cell costimulation (GO:0031295)|T cell tolerance induction (GO:0002517)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6						TGCCAATTATGAGATGTTTAT	0.313																																						dbGAP											0													73.0	80.0	78.0					2																	204820385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023135	CCDS2363.1	2q33	2014-09-17			ENSG00000163600	ENSG00000163600		"""CD molecules"""	5351	protein-coding gene	gene with protein product	"""activation-inducible lymphocyte immunomediatory molecule"""	604558				9930702, 10617205	Standard	NM_012092		Approved	AILIM, CD278	uc002vam.3	Q9Y6W8	OTTHUMG00000132880	ENST00000316386.6:c.85G>A	2.37:g.204820385G>A	ENSP00000319476:p.Glu29Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6W8	Missense_Mutation	SNP	NULL	p.E29K	ENST00000316386.6	37	c.85	CCDS2363.1	2	.	.	.	.	.	.	.	.	.	.	G	5.810	0.333717	0.11013	.	.	ENSG00000163600	ENST00000316386;ENST00000435193	.	.	.	5.26	1.96	0.26148	.	1.012410	0.07895	N	0.971671	T	0.28764	0.0713	L	0.43152	1.355	0.09310	N	1	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.12156	0.007;0.007;0.007	T	0.34079	-0.9843	9	0.02654	T	1	-6.5321	5.674	0.17737	0.3786:0.0:0.6214:0.0	.	29;29;29	Q53QY6;Q9Y6W8-2;Q9Y6W8	.;.;ICOS_HUMAN	K	29	.	ENSP00000319476:E29K	E	+	1	0	ICOS	204528630	0.528000	0.26314	0.208000	0.23602	0.885000	0.51271	0.772000	0.26647	0.710000	0.31997	0.655000	0.94253	GAG	ICOS	-	NULL	ENSG00000163600		0.313	ICOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICOS	HGNC	protein_coding	OTTHUMT00000256369.1	122	0.00	0	G	NM_012092		204820385	204820385	+1	no_errors	ENST00000316386	ensembl	human	known	69_37n	missense	119	14.29	20	SNP	0.072	A
IPO11	51194	genome.wustl.edu	37	5	61781290	61781290	+	Splice_Site	SNP	G	G	T			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr5:61781290G>T	ENST00000325324.6	+	12	1387		c.e12+1		IPO11_ENST00000409296.3_Splice_Site|KIF2A_ENST00000509663.2_Intron	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11						ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		TAGTTTGAGGGTAAGTATTAA	0.318																																						dbGAP											0													92.0	107.0	102.0					5																	61781290		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.1218+1G>T	5.37:g.61781290G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	Splice_Site	SNP	-	e12+1	ENST00000325324.6	37	c.1338+1	CCDS34167.1	5	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572158	0.86542	.	.	ENSG00000086200	ENST00000325324;ENST00000409296	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.151	0.89674	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IPO11	61817047	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.647000	0.91057	2.375000	0.81037	0.585000	0.79938	.	IPO11	-	-	ENSG00000086200		0.318	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO11	HGNC	protein_coding	OTTHUMT00000335062.1	252	0.00	0	G	NM_016338	Intron	61781290	61781290	+1	no_errors	ENST00000409296	ensembl	human	known	69_37n	splice_site	129	31.38	59	SNP	1.000	T
KCNK9	51305	genome.wustl.edu	37	8	140631062	140631062	+	Silent	SNP	G	G	A			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr8:140631062G>A	ENST00000520439.1	-	2	627	c.564C>T	c.(562-564)caC>caT	p.H188H	KCNK9_ENST00000303015.1_Silent_p.H188H|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	188					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.H188H(2)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	AGTAGTAGGCGTGGAAGAAGC	0.592																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)											93.0	89.0	90.0					8																	140631062		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.564C>T	8.37:g.140631062G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M290|Q540F2	Silent	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TASK3,prints_2pore_dom_K_chnl	p.H188	ENST00000520439.1	37	c.564	CCDS6377.1	8																																																																																			KCNK9	-	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK	ENSG00000169427		0.592	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK9	HGNC	protein_coding	OTTHUMT00000378473.1	75	0.00	0	G	NM_016601		140631062	140631062	-1	no_errors	ENST00000303015	ensembl	human	known	69_37n	silent	45	31.82	21	SNP	1.000	A
MAGEE1	57692	genome.wustl.edu	37	X	75649280	75649280	+	Silent	SNP	C	C	T			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chrX:75649280C>T	ENST00000361470.2	+	1	1235	c.957C>T	c.(955-957)tcC>tcT	p.S319S		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	319	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CGAGCACCTCCGTGCCGCCCA	0.711																																						dbGAP											0													22.0	21.0	21.0					X																	75649280		2202	4294	6496	-	-	-	SO:0001819	synonymous_variant	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.957C>T	X.37:g.75649280C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.S319	ENST00000361470.2	37	c.957	CCDS14433.1	X																																																																																			MAGEE1	-	NULL	ENSG00000198934		0.711	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	12	0.00	0	C	NM_020932		75649280	75649280	+1	no_errors	ENST00000361470	ensembl	human	known	69_37n	silent	5	54.55	6	SNP	0.000	T
MYO7B	4648	genome.wustl.edu	37	2	128364879	128364879	+	Silent	SNP	C	C	A			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr2:128364879C>A	ENST00000409816.2	+	20	2555	c.2523C>A	c.(2521-2523)gcC>gcA	p.A841A	MYO7B_ENST00000428314.1_Silent_p.A841A|MYO7B_ENST00000389524.4_Silent_p.A841A			Q6PIF6	MYO7B_HUMAN	myosin VIIB	841	IQ 5. {ECO:0000255|PROSITE- ProRule:PRU00116}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGCTGCAGGCCCTGTGCAGGG	0.667																																						dbGAP											0													15.0	20.0	18.0					2																	128364879		1965	3964	5929	-	-	-	SO:0001819	synonymous_variant	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2523C>A	2.37:g.128364879C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14786|Q8TEE1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.A841	ENST00000409816.2	37	c.2523	CCDS46405.1	2																																																																																			MYO7B	-	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000169994		0.667	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	33	0.00	0	C	XM_291001		128364879	128364879	+1	no_errors	ENST00000389524	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.566	A
OBFC1	79991	genome.wustl.edu	37	10	105657473	105657473	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr10:105657473G>T	ENST00000224950.3	-	7	753	c.586C>A	c.(586-588)Cca>Aca	p.P196T	OBFC1_ENST00000369764.1_Missense_Mutation_p.P196T|OBFC1_ENST00000466828.1_5'UTR	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	196	Winged helix-turn-helix (wHTH) 1.				positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		AGGGCGCCTGGATTGCTGCGG	0.453																																						dbGAP											0													64.0	69.0	67.0					10																	105657473		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.586C>A	10.37:g.105657473G>T	ENSP00000224950:p.Pro196Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR99|Q5TCZ0	Missense_Mutation	SNP	pfam_DUF1879_CST_STN1,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pirsf_CST_STN1	p.P196T	ENST00000224950.3	37	c.586	CCDS7552.1	10	.	.	.	.	.	.	.	.	.	.	G	7.207	0.594668	0.13875	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.43688	0.94;0.94	5.39	4.45	0.53987	Domain of unknown function DUF1879, CTS complex STN1 subunit (1);	0.632758	0.17466	N	0.173250	T	0.41073	0.1143	M	0.63428	1.95	0.27725	N	0.945006	B	0.21071	0.051	B	0.20577	0.03	T	0.35500	-0.9786	10	0.46703	T	0.11	-1.0002	11.0295	0.47763	0.0:0.0:0.8068:0.1932	.	196	Q9H668	STN1_HUMAN	T	196	ENSP00000224950:P196T;ENSP00000358779:P196T	ENSP00000224950:P196T	P	-	1	0	OBFC1	105647463	1.000000	0.71417	0.482000	0.27366	0.199000	0.23934	3.354000	0.52254	1.191000	0.43056	0.650000	0.86243	CCA	OBFC1	-	pfam_DUF1879_CST_STN1,pirsf_CST_STN1	ENSG00000107960		0.453	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OBFC1	HGNC	protein_coding	OTTHUMT00000050174.1	110	0.00	0	G	NM_024928		105657473	105657473	-1	no_errors	ENST00000224950	ensembl	human	known	69_37n	missense	59	43.81	46	SNP	0.978	T
OR13G1	441933	genome.wustl.edu	37	1	247836219	247836219	+	Missense_Mutation	SNP	A	A	C	rs148119044		TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr1:247836219A>C	ENST00000359688.2	-	1	146	c.125T>G	c.(124-126)aTc>aGc	p.I42S	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GGCAATGATGATGAGCATGTT	0.418																																						dbGAP											0													90.0	76.0	81.0					1																	247836219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.125T>G	1.37:g.247836219A>C	ENSP00000352717:p.Ile42Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I42S	ENST00000359688.2	37	c.125	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.919197	0.52546	.	.	ENSG00000197437	ENST00000359688	T	0.00532	6.75	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	N	0.001242	T	0.03608	0.0103	H	0.96547	3.84	0.09310	N	1	D	0.76494	0.999	D	0.72625	0.978	T	0.09596	-1.0667	10	0.87932	D	0	-46.4336	11.7892	0.52059	1.0:0.0:0.0:0.0	.	42	Q8NGZ3	O13G1_HUMAN	S	42	ENSP00000352717:I42S	ENSP00000352717:I42S	I	-	2	0	OR13G1	245902842	0.202000	0.23423	0.019000	0.16419	0.019000	0.09904	3.086000	0.50159	1.943000	0.56356	0.533000	0.62120	ATC	OR13G1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197437		0.418	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	HGNC	protein_coding	OTTHUMT00000096869.1	97	0.00	0	A	NM_001005487		247836219	247836219	-1	no_errors	ENST00000359688	ensembl	human	known	69_37n	missense	65	32.29	31	SNP	0.058	C
PDP2	57546	genome.wustl.edu	37	16	66918915	66918915	+	Missense_Mutation	SNP	C	C	T	rs556993186		TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr16:66918915C>T	ENST00000311765.2	+	2	1062	c.728C>T	c.(727-729)tCg>tTg	p.S243L	PDP2_ENST00000568720.1_Intron	NM_020786.2	NP_065837.1	Q9P2J9	PDP2_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 2	243					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|magnesium-dependent protein serine/threonine phosphatase activity (GO:0004724)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		TCTGACATCTCGCTGGAAATC	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		23923	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													65.0	62.0	63.0					16																	66918915		2200	4300	6500	-	-	-	SO:0001583	missense	0			AB037769	CCDS10822.1	16q22.1	2012-04-17			ENSG00000172840	ENSG00000172840		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	30263	protein-coding gene	gene with protein product	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit 2"""	615499				9651365	Standard	NM_020786		Approved	KIAA1348, PPM2C2	uc002eqk.2	Q9P2J9	OTTHUMG00000137512	ENST00000311765.2:c.728C>T	16.37:g.66918915C>T	ENSP00000309548:p.Ser243Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K924	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.S243L	ENST00000311765.2	37	c.728	CCDS10822.1	16	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256599	0.59321	.	.	ENSG00000172840	ENST00000311765	T	0.16897	2.31	5.64	4.69	0.59074	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.24851	0.0603	N	0.20685	0.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.05338	-1.0891	10	0.10377	T	0.69	-7.1442	16.3763	0.83401	0.1329:0.8671:0.0:0.0	.	243	Q9P2J9	PDP2_HUMAN	L	243	ENSP00000309548:S243L	ENSP00000309548:S243L	S	+	2	0	PDP2	65476416	1.000000	0.71417	0.883000	0.34634	0.647000	0.38526	7.713000	0.84693	1.514000	0.48869	0.643000	0.83706	TCG	PDP2	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000172840		0.498	PDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDP2	HGNC	protein_coding	OTTHUMT00000268831.2	36	0.00	0	C	NM_020786		66918915	66918915	+1	no_errors	ENST00000311765	ensembl	human	known	69_37n	missense	12	66.67	24	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	173	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	116	32.37	56	SNP	1.000	A
PNCK	139728	genome.wustl.edu	37	X	152936838	152936838	+	Intron	SNP	C	C	T	rs182261010		TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chrX:152936838C>T	ENST00000370150.1	-	7	717				PNCK_ENST00000370145.4_Intron|PNCK_ENST00000447676.2_Intron|PNCK_ENST00000393831.2_Silent_p.A195A|PNCK_ENST00000340888.3_Intron|PNCK_ENST00000475172.1_5'Flank|PNCK_ENST00000370142.1_Silent_p.A195A			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GACAGACAGACGCACGCACAG	0.622													C|||	1	0.000264901	0.0	0.0014	3775	,	,		13019	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													70.0	71.0	70.0					X																	152936838		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.539-23G>A	X.37:g.152936838C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A195	ENST00000370150.1	37	c.585		X																																																																																			PNCK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000130822		0.622	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	PNCK	HGNC	protein_coding	OTTHUMT00000061044.2	48	0.00	0	C	NM_198452		152936838	152936838	-1	no_errors	ENST00000370142	ensembl	human	known	69_37n	silent	34	30.61	15	SNP	0.017	T
YPEL1	29799	genome.wustl.edu	37	22	22049730	22049730	+	IGR	SNP	T	T	C			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr22:22049730T>C	ENST00000339468.3	-	0	4329				PPIL2_ENST00000492445.2_Missense_Mutation_p.M505T|PPIL2_ENST00000406385.1_Missense_Mutation_p.M505T|PPIL2_ENST00000412327.1_Missense_Mutation_p.C504R|PPIL2_ENST00000398831.3_Missense_Mutation_p.M505T|PPIL2_ENST00000446951.1_3'UTR|PPIL2_ENST00000456792.2_Silent_p.H449H|PPIL2_ENST00000335025.8_Missense_Mutation_p.M505T	NM_013313.3	NP_037445.1	O60688	YPEL1_HUMAN	yippee-like 1 (Drosophila)							nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(1)	3	Colorectal(54;0.105)					ACTGTCCCCATGTCCAAGAAG	0.637																																						dbGAP											0													37.0	34.0	35.0					22																	22049730		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF060862	CCDS13794.1	22q11.2	2008-02-04	2001-11-28		ENSG00000100027	ENSG00000100027			12845	protein-coding gene	gene with protein product		608082	"""yippee (Drosophila) homolog-like 1"""			11473580	Standard	NM_013313		Approved		uc002zvl.3	O60688	OTTHUMG00000150830		22.37:g.22049730T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q65ZA1|Q6GLI6	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_Ubox_domain,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.C504R	ENST00000339468.3	37	c.1510	CCDS13794.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	1.346|1.346	-0.592696|-0.592696	0.03771|0.03771	.|.	.|.	ENSG00000100023|ENSG00000100023	ENST00000412327|ENST00000335025;ENST00000398831;ENST00000492445;ENST00000406385;ENST00000446951	T|T;T;T;T;T	0.25085|0.24538	1.82|1.85;1.85;1.85;1.85;1.85	4.32|4.32	-5.12|-5.12	0.02893|0.02893	.|.	.|2.151430	.|0.02046	.|N	.|0.049682	T|T	0.14141|0.14141	0.0342|0.0342	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.21348|0.21348	-1.0248|-1.0248	8|9	0.15952|0.15499	T|T	0.53|0.54	.|.	9.7898|9.7898	0.40699|0.40699	0.1404:0.6666:0.0:0.193|0.1404:0.6666:0.0:0.193	.|.	504|505	Q13356-2|Q13356	.|PPIL2_HUMAN	R|T	504|505;505;505;505;285	ENSP00000390427:C504R|ENSP00000334553:M505T;ENSP00000381812:M505T;ENSP00000445312:M505T;ENSP00000384299:M505T;ENSP00000405214:M285T	ENSP00000390427:C504R|ENSP00000334553:M505T	C|M	+|+	1|2	0|0	PPIL2|PPIL2	20379730|20379730	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.020000|0.020000	0.10135|0.10135	-0.535000|-0.535000	0.06142|0.06142	-1.155000|-1.155000	0.02822|0.02822	-1.118000|-1.118000	0.02043|0.02043	TGT|ATG	PPIL2	-	NULL	ENSG00000100023		0.637	YPEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL2	HGNC	protein_coding	OTTHUMT00000320245.1	54	0.00	0	T	NM_013313		22049730	22049730	+1	no_errors	ENST00000412327	ensembl	human	known	69_37n	missense	38	43.28	29	SNP	0.000	C
PPM1F	9647	genome.wustl.edu	37	22	22300420	22300420	+	Start_Codon_SNP	SNP	T	T	C			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr22:22300420T>C	ENST00000263212.5	-	2	106	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	PPM1F_ENST00000397495.4_Start_Codon_SNP_p.M1V|LL22NC03-86G7.1_ENST00000458178.1_RNA	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	1					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		CCAGAGGACATGCCCAAAGCA	0.627																																						dbGAP											0													39.0	36.0	37.0					22																	22300420		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.1A>G	22.37:g.22300420T>C	ENSP00000263212:p.Met1Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.M1V	ENST00000263212.5	37	c.1	CCDS13796.1	22	.	.	.	.	.	.	.	.	.	.	T	13.78	2.338485	0.41398	.	.	ENSG00000100034	ENST00000263212;ENST00000397495	T;T	0.22134	2.57;1.97	5.3	4.2	0.49525	.	.	.	.	.	T	0.17365	0.0417	.	.	.	0.80722	D	1	B;B	0.21905	0.062;0.005	B;B	0.18561	0.022;0.006	T	0.05451	-1.0884	8	0.87932	D	0	-9.3118	8.5651	0.33534	0.0:0.0:0.195:0.8049	.	1;1	A8MX49;P49593	.;PPM1F_HUMAN	V	1	ENSP00000263212:M1V;ENSP00000380632:M1V	ENSP00000263212:M1V	M	-	1	0	PPM1F	20630420	0.614000	0.27017	1.000000	0.80357	0.925000	0.55904	0.689000	0.25437	2.028000	0.59812	0.402000	0.26972	ATG	PPM1F	-	NULL	ENSG00000100034		0.627	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1F	HGNC	protein_coding	OTTHUMT00000320267.2	40	0.00	0	T	NM_014634	Missense_Mutation	22300420	22300420	-1	no_errors	ENST00000263212	ensembl	human	known	69_37n	missense	26	32.50	13	SNP	0.938	C
RERE	473	genome.wustl.edu	37	1	8421526	8421526	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr1:8421526A>G	ENST00000337907.3	-	19	2675	c.2041T>C	c.(2041-2043)Tct>Cct	p.S681P	RERE_ENST00000476556.1_Missense_Mutation_p.S127P|RERE_ENST00000377464.1_Missense_Mutation_p.S413P|RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.S681P	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	681					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TCACCTTCAGATGGCGAGTTG	0.597																																						dbGAP											0													100.0	90.0	93.0					1																	8421526		2193	4286	6479	-	-	-	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.2041T>C	1.37:g.8421526A>G	ENSP00000338629:p.Ser681Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.S681P	ENST00000337907.3	37	c.2041	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	A	18.35	3.605121	0.66445	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908;ENST00000505225	T;T;T;T	0.66099	-0.19;0.69;2.0;-0.19	5.6	5.6	0.85130	.	.	.	.	.	T	0.76371	0.3978	M	0.67953	2.075	0.45554	D	0.998502	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.995	T	0.74535	-0.3633	9	0.30854	T	0.27	-22.869	14.9577	0.71131	1.0:0.0:0.0:0.0	.	413;681	B1AKN3;Q9P2R6	.;RERE_HUMAN	P	681;413;127;681;101	ENSP00000338629:S681P;ENSP00000366684:S413P;ENSP00000422246:S127P;ENSP00000383700:S681P	ENSP00000338629:S681P	S	-	1	0	RERE	8344113	1.000000	0.71417	0.809000	0.32408	0.543000	0.35085	8.897000	0.92532	2.143000	0.66587	0.459000	0.35465	TCT	RERE	-	pfam_Atrophin-like	ENSG00000142599		0.597	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	195	0.00	0	A			8421526	8421526	-1	no_errors	ENST00000337907	ensembl	human	known	69_37n	missense	134	34.63	71	SNP	0.998	G
SHANK2	22941	genome.wustl.edu	37	11	70331577	70331577	+	Silent	SNP	G	G	A			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr11:70331577G>A	ENST00000423696.2	-	15	3720	c.3684C>T	c.(3682-3684)gaC>gaT	p.D1228D	SHANK2_ENST00000409161.1_Silent_p.D1011D|SHANK2_ENST00000449833.2_Silent_p.D1012D|SHANK2_ENST00000338508.4_Silent_p.D1608D			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1228					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TCTCTGTGACGTCGCCCCACA	0.567																																						dbGAP											0													81.0	86.0	85.0					11																	70331577		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.3684C>T	11.37:g.70331577G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.D1608	ENST00000423696.2	37	c.4824		11																																																																																			SHANK2	-	NULL	ENSG00000162105		0.567	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding		83	0.00	0	G	NM_012309		70331577	70331577	-1	no_errors	ENST00000338508	ensembl	human	known	69_37n	silent	158	18.88	37	SNP	0.026	A
SPINK5	11005	genome.wustl.edu	37	5	147505286	147505286	+	Splice_Site	SNP	G	G	T			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr5:147505286G>T	ENST00000256084.7	+	29	2782	c.2740G>T	c.(2740-2742)Gat>Tat	p.D914Y	SPINK5_ENST00000359874.3_Splice_Site_p.D944Y	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	914	Kazal-like 14. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTTTCTAGGATGAGTGCAG	0.413																																						dbGAP											0													177.0	174.0	175.0					5																	147505286		1907	4118	6025	-	-	-	SO:0001630	splice_region_variant	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2740-1G>T	5.37:g.147505286G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	p.D944Y	ENST00000256084.7	37	c.2830	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	G	14.86	2.661728	0.47572	.	.	ENSG00000133710	ENST00000359874;ENST00000256084	T;T	0.06768	3.26;3.26	5.1	4.15	0.48705	.	0.273076	0.26180	N	0.025871	T	0.25568	0.0622	M	0.78049	2.395	0.28028	N	0.934237	D;D	0.76494	0.998;0.999	D;D	0.70716	0.97;0.968	T	0.01520	-1.1334	9	.	.	.	-34.3992	10.147	0.42769	0.0:0.0:0.8011:0.1988	.	944;914	Q9NQ38-3;Q9NQ38	.;ISK5_HUMAN	Y	944;914	ENSP00000352936:D944Y;ENSP00000256084:D914Y	.	D	+	1	0	SPINK5	147485479	1.000000	0.71417	0.998000	0.56505	0.506000	0.33950	2.213000	0.42844	2.758000	0.94735	0.655000	0.94253	GAT	SPINK5	-	NULL	ENSG00000133710		0.413	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	137	0.72	1	G	NM_001127698	Missense_Mutation	147505286	147505286	+1	no_errors	ENST00000359874	ensembl	human	known	69_37n	missense	91	37.16	55	SNP	0.981	T
ZNF71	58491	genome.wustl.edu	37	19	57133612	57133612	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A126-01A-11D-A10M-09	TCGA-AO-A126-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85b39644-6f19-40dc-94c1-0afc93ee4981	329950fe-6d8e-4e48-85c8-f963868375bb	g.chr19:57133612C>A	ENST00000328070.6	+	3	1191	c.957C>A	c.(955-957)aaC>aaA	p.N319K		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		ACCAGAGGAACCACACCGGCG	0.652																																						dbGAP											0													80.0	75.0	77.0					19																	57133612		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.957C>A	19.37:g.57133612C>A	ENSP00000328245:p.Asn319Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N319K	ENST00000328070.6	37	c.957	CCDS12947.1	19	.	.	.	.	.	.	.	.	.	.	C	15.03	2.713737	0.48622	.	.	ENSG00000197951	ENST00000328070	T	0.00986	5.47	3.76	-0.106	0.13596	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00468	0.0015	N	0.01352	-0.895	0.18873	N	0.999985	P	0.39282	0.666	B	0.38106	0.265	T	0.49725	-0.8909	9	0.87932	D	0	.	4.5207	0.11958	0.0:0.5487:0.1914:0.2599	.	319	Q9NQZ8	ZNF71_HUMAN	K	319	ENSP00000328245:N319K	ENSP00000328245:N319K	N	+	3	2	ZNF71	61825424	0.000000	0.05858	0.438000	0.26821	0.970000	0.65996	-0.464000	0.06688	0.176000	0.19873	0.561000	0.74099	AAC	ZNF71	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197951		0.652	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF71	HGNC	protein_coding	OTTHUMT00000459798.2	79	0.00	0	C	NM_021216		57133612	57133612	+1	no_errors	ENST00000328070	ensembl	human	known	69_37n	missense	57	35.23	31	SNP	0.039	A
