#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGXT2	64902	genome.wustl.edu	37	5	35039475	35039475	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr5:35039475C>A	ENST00000231420.6	-	3	516	c.316G>T	c.(316-318)Gat>Tat	p.D106Y		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	106					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	GAAAAGAAATCCAGGTATCTG	0.463																																						dbGAP											0													95.0	103.0	100.0					5																	35039475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.316G>T	5.37:g.35039475C>A	ENSP00000231420:p.Asp106Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.D106Y	ENST00000231420.6	37	c.316	CCDS3908.1	5	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798484	0.90538	.	.	ENSG00000113492	ENST00000231420	T	0.64618	-0.11	5.67	5.67	0.87782	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.88291	0.6397	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92446	0.5966	10	0.87932	D	0	-2.3887	19.7635	0.96333	0.0:1.0:0.0:0.0	.	14;106;106	B7Z3M3;E9PDL7;Q9BYV1	.;.;AGT2_HUMAN	Y	106	ENSP00000231420:D106Y	ENSP00000231420:D106Y	D	-	1	0	AGXT2	35075232	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.561000	0.82288	2.669000	0.90835	0.655000	0.94253	GAT	AGXT2	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000113492		0.463	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2	HGNC	protein_coding	OTTHUMT00000207574.2	96	0.00	0	C	NM_031900		35039475	35039475	-1	no_errors	ENST00000231420	ensembl	human	known	69_37n	missense	80	13.98	13	SNP	1.000	A
BEND3	57673	genome.wustl.edu	37	6	107390228	107390228	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr6:107390228C>T	ENST00000369042.1	-	4	2357	c.2167G>A	c.(2167-2169)Gac>Aac	p.D723N	BEND3_ENST00000429433.2_Missense_Mutation_p.D723N			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	723	BEN 4. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						ACCTCCTTGTCAGACAGCAGG	0.632																																						dbGAP											0													52.0	54.0	53.0					6																	107390228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.2167G>A	6.37:g.107390228C>T	ENSP00000358038:p.Asp723Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRH2|Q9HCL9	Missense_Mutation	SNP	pfam_BEN_domain	p.D723N	ENST00000369042.1	37	c.2167	CCDS34507.1	6	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186091	0.78789	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	5.26	5.26	0.73747	BEN domain (1);	0.059783	0.64402	D	0.000004	T	0.51449	0.1675	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.64287	-0.6443	9	0.52906	T	0.07	-24.1704	18.8618	0.92275	0.0:1.0:0.0:0.0	.	723	Q5T5X7	BEND3_HUMAN	N	723	.	ENSP00000358038:D723N	D	-	1	0	BEND3	107496921	1.000000	0.71417	0.946000	0.38457	0.894000	0.52154	5.712000	0.68407	2.449000	0.82847	0.455000	0.32223	GAC	BEND3	-	NULL	ENSG00000178409		0.632	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND3	HGNC	protein_coding	OTTHUMT00000041686.1	42	0.00	0	C	NM_020913		107390228	107390228	-1	no_errors	ENST00000369042	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	T
BOD1L1	259282	genome.wustl.edu	37	4	13605938	13605938	+	Silent	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr4:13605938G>A	ENST00000040738.5	-	10	2721	c.2586C>T	c.(2584-2586)atC>atT	p.I862I		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	862	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										TCTGTAATGTGATACCATGTT	0.388																																						dbGAP											0													111.0	109.0	110.0					4																	13605938		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2586C>T	4.37:g.13605938G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	NULL	p.I862	ENST00000040738.5	37	c.2586	CCDS3411.2	4																																																																																			BOD1L1	-	NULL	ENSG00000038219		0.388	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	350	0.28	1	G	NM_148894		13605938	13605938	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	silent	214	15.42	39	SNP	0.000	A
CUX2	23316	genome.wustl.edu	37	12	111785675	111785675	+	Missense_Mutation	SNP	C	C	T	rs372685449		TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr12:111785675C>T	ENST00000261726.6	+	22	4161	c.4007C>T	c.(4006-4008)cCg>cTg	p.P1336L		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1336	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CCCGACCCTCCGGGTAATGAT	0.627																																						dbGAP											0													68.0	79.0	75.0					12																	111785675		1950	4127	6077	-	-	-	SO:0001583	missense	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.4007C>T	12.37:g.111785675C>T	ENSP00000261726:p.Pro1336Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.P1336L	ENST00000261726.6	37	c.4007	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.332099	0.01298	.	.	ENSG00000111249	ENST00000261726	T	0.40476	1.03	5.44	-3.39	0.04868	.	1.620060	0.03188	N	0.172976	T	0.21962	0.0529	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13602	-1.0503	10	0.25106	T	0.35	-0.9206	7.3685	0.26787	0.12:0.2747:0.0:0.6054	.	1336	O14529	CUX2_HUMAN	L	1336	ENSP00000261726:P1336L	ENSP00000261726:P1336L	P	+	2	0	CUX2	110270058	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.220000	0.17660	-1.169000	0.02772	-1.314000	0.01303	CCG	CUX2	-	NULL	ENSG00000111249		0.627	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	55	0.00	0	C	NM_015267		111785675	111785675	+1	no_errors	ENST00000261726	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	0.000	T
CYTH3	9265	genome.wustl.edu	37	7	6210581	6210581	+	Silent	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr7:6210581G>A	ENST00000350796.3	-	8	727	c.591C>T	c.(589-591)atC>atT	p.I197I	CYTH3_ENST00000396741.2_Silent_p.I112I|CYTH3_ENST00000488964.1_5'UTR	NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3	197	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				establishment of epithelial cell polarity (GO:0090162)|Golgi vesicle transport (GO:0048193)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19						TGAGCATGATGATGGCGAATG	0.637																																						dbGAP											0													179.0	128.0	145.0					7																	6210581		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256		"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3		9072969	Standard	NM_004227		Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.591C>T	7.37:g.6210581G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2N8	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.I197	ENST00000350796.3	37	c.591	CCDS5346.1	7																																																																																			CYTH3	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000008256		0.637	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH3	HGNC	protein_coding	OTTHUMT00000207396.2	123	0.00	0	G	NM_004227		6210581	6210581	-1	no_errors	ENST00000350796	ensembl	human	known	69_37n	silent	154	10.47	18	SNP	1.000	A
DCAF12	25853	genome.wustl.edu	37	9	34125232	34125232	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr9:34125232G>A	ENST00000361264.4	-	2	463	c.122C>T	c.(121-123)cCt>cTt	p.P41L	DCAF12_ENST00000463286.1_5'UTR	NM_015397.3	NP_056212.1	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	41					protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						TCTCTTCACAGGAGGAAGTCT	0.448																																						dbGAP											0													83.0	79.0	80.0					9																	34125232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067479	CCDS6549.1	9p11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000198876	ENSG00000198876		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	19911	protein-coding gene	gene with protein product	"""cancer/testis antigen 102"""		"""KIAA1892"", ""WD repeat domain 40A"""	KIAA1892, WDR40A		11572484, 9110174	Standard	NM_015397		Approved	DKFZP434O125, MGC1058, CT102, TCC52	uc003ztt.2	Q5T6F0	OTTHUMG00000019806	ENST00000361264.4:c.122C>T	9.37:g.34125232G>A	ENSP00000355114:p.Pro41Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA70|D3DRL6|Q5T6E9|Q5T6F1|Q6P3V0|Q7L4F8|Q96PZ5|Q9NXA9|Q9UFJ1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P41L	ENST00000361264.4	37	c.122	CCDS6549.1	9	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797914	0.50208	.	.	ENSG00000198876	ENST00000361264;ENST00000396990;ENST00000450964	T;T;T	0.56941	2.32;0.43;1.6	4.76	3.84	0.44239	.	0.344394	0.32106	N	0.006575	T	0.39517	0.1081	L	0.36672	1.1	0.51012	D	0.999909	B	0.31435	0.323	B	0.23716	0.048	T	0.17561	-1.0365	10	0.17832	T	0.49	-2.836	14.9484	0.71050	0.0:0.1436:0.8564:0.0	.	41	Q5T6F0	DCA12_HUMAN	L	41;23;20	ENSP00000355114:P41L;ENSP00000380187:P23L;ENSP00000415833:P20L	ENSP00000355114:P41L	P	-	2	0	DCAF12	34115232	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	6.314000	0.72848	1.192000	0.43071	0.655000	0.94253	CCT	DCAF12	-	NULL	ENSG00000198876		0.448	DCAF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12	HGNC	protein_coding	OTTHUMT00000052133.2	95	0.00	0	G	NM_015397		34125232	34125232	-1	no_errors	ENST00000361264	ensembl	human	known	69_37n	missense	82	28.70	33	SNP	0.974	A
EPDR1	54749	genome.wustl.edu	37	7	37960275	37960275	+	5'UTR	SNP	C	C	A	rs201513905|rs62443108|rs76859517	byFrequency	TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr7:37960275C>A	ENST00000199448.4	+	0	113				EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000423717.1_5'UTR|EPDR1_ENST00000559325.1_Missense_Mutation_p.Q32K|EPDR1_ENST00000476620.1_Intron	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.A36fs*79(3)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						GCAGTGGCAGCAGGCAGTGGC	0.637																																						dbGAP											3	Deletion - Frameshift(3)	urinary_tract(1)|ovary(1)|breast(1)											19.0	20.0	20.0					7																	37960275		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-267C>A	7.37:g.37960275C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	pfam_Ependymin,smart_Ependymin,prints_Ependymin	p.Q32K	ENST00000199448.4	37	c.94	CCDS5454.2	7	188	0.08608058608058608	8	0.016260162601626018	32	0.08839779005524862	36	0.06293706293706294	112	0.14775725593667546	C	7.882	0.730413	0.15507	.	.	ENSG00000086289	ENST00000199448;ENST00000423717	.	.	.	.	.	.	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.19300	N	0.999978	.	.	.	.	.	.	T	0.19976	-1.0289	4	0.54805	T	0.06	.	.	.	.	rs62443108	32	A4D1W8	.	K	32;6	.	ENSP00000199448:Q32K	Q	+	1	0	EPDR1	37926800	0.086000	0.21541	0.083000	0.20561	0.138000	0.21146	0.113000	0.15499	0.064000	0.16427	0.064000	0.15345	CAG	EPDR1	-	NULL	ENSG00000086289		0.637	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EPDR1	HGNC	protein_coding	OTTHUMT00000220037.3	28	0.00	0	C	NM_017549		37960275	37960275	+1	no_errors	ENST00000559325	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.095	A
EPHA6	285220	genome.wustl.edu	37	3	97185269	97185269	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr3:97185269C>G	ENST00000514100.1	+	4	255	c.13C>G	c.(13-15)Cca>Gca	p.P5A	EPHA6_ENST00000502694.1_Missense_Mutation_p.P5A|EPHA6_ENST00000442602.2_Intron|EPHA6_ENST00000389672.5_Intron	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						ATaggactctccatttcaagt	0.408																																						dbGAP											0													113.0	108.0	110.0					3																	97185269		1859	4102	5961	-	-	-	SO:0001583	missense	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.13C>G	3.37:g.97185269C>G	ENSP00000421711:p.Pro5Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RAL5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P5A	ENST00000514100.1	37	c.13		3	.	.	.	.	.	.	.	.	.	.	C	3.581	-0.085611	0.07097	.	.	ENSG00000080224	ENST00000514100;ENST00000502694	D;T	0.81739	-1.53;-1.26	3.45	-0.33	0.12683	.	.	.	.	.	T	0.59972	0.2233	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.50980	-0.8763	9	0.87932	D	0	.	6.209	0.20617	0.0:0.5348:0.0:0.4652	.	5;5	Q9UF33-2;D6RAL5	.;.	A	5	ENSP00000421711:P5A;ENSP00000423950:P5A	ENSP00000423950:P5A	P	+	1	0	EPHA6	98667959	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.015000	0.12634	-0.098000	0.12285	-0.507000	0.04495	CCA	EPHA6	-	NULL	ENSG00000080224		0.408	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000359997.1	297	0.00	0	C	NM_001080448		97185269	97185269	+1	no_errors	ENST00000502694	ensembl	human	known	69_37n	missense	169	10.58	20	SNP	0.001	G
EXOC4	60412	genome.wustl.edu	37	7	132937919	132937919	+	Missense_Mutation	SNP	C	C	T	rs183280115		TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr7:132937919C>T	ENST00000253861.4	+	1	91	c.62C>T	c.(61-63)tCg>tTg	p.S21L	EXOC4_ENST00000539845.1_5'Flank|EXOC4_ENST00000393161.2_Missense_Mutation_p.S21L	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	21					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				AAAGACCCCTCGGGGCTGCTC	0.617													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13313	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													74.0	77.0	76.0					7																	132937919		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.62C>T	7.37:g.132937919C>T	ENSP00000253861:p.Ser21Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	pfam_Sec8_exocyst	p.S21L	ENST00000253861.4	37	c.62	CCDS5829.1	7	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	21.7	4.185798	0.78789	.	.	ENSG00000131558	ENST00000253861;ENST00000393161	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.60766	0.2294	M	0.72894	2.215	0.80722	D	1	D;D	0.57899	0.98;0.981	B;P	0.46685	0.444;0.524	T	0.58014	-0.7711	9	0.10902	T	0.67	.	17.3791	0.87400	0.0:1.0:0.0:0.0	.	21;21	Q96A65;Q8TAR2	EXOC4_HUMAN;.	L	21	.	ENSP00000253861:S21L	S	+	2	0	EXOC4	132588459	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.571000	0.60879	2.861000	0.98227	0.650000	0.86243	TCG	EXOC4	-	NULL	ENSG00000131558		0.617	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC4	HGNC	protein_coding	OTTHUMT00000339182.1	86	0.00	0	C	NM_021807		132937919	132937919	+1	no_errors	ENST00000253861	ensembl	human	known	69_37n	missense	59	11.76	8	SNP	1.000	T
FAM192A	80011	genome.wustl.edu	37	16	57188235	57188235	+	Silent	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr16:57188235G>A	ENST00000309137.8	-	7	990	c.732C>T	c.(730-732)atC>atT	p.I244I	FAM192A_ENST00000569266.1_Silent_p.I244I|FAM192A_ENST00000566077.1_Silent_p.I167I|FAM192A_ENST00000564108.1_Silent_p.I244I|FAM192A_ENST00000567439.1_Silent_p.I244I|FAM192A_ENST00000389447.5_Silent_p.I244I	NM_024946.2	NP_079222.1	Q9GZU8	F192A_HUMAN	family with sequence similarity 192, member A	244						nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|lung(4)|prostate(2)	11						TGGTTCGGAAGATGGAGGAGA	0.597																																						dbGAP											0													67.0	79.0	75.0					16																	57188235		2012	4173	6185	-	-	-	SO:0001819	synonymous_variant	0				CCDS42168.1	16q13	2009-08-19	2009-08-19	2009-08-19		ENSG00000172775			29856	protein-coding gene	gene with protein product	"""NEFA interacting nuclear protein NIP30"""		"""chromosome 16 open reading frame 94"""	C16orf94		12477932	Standard	NM_024946		Approved	NIP30	uc021tiy.1	Q9GZU8		ENST00000309137.8:c.732C>T	16.37:g.57188235G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L144F	ENST00000309137.8	37	c.430	CCDS42168.1	16																																																																																			FAM192A	-	NULL	ENSG00000172775		0.597	FAM192A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM192A	HGNC	protein_coding	OTTHUMT00000433022.2	116	0.00	0	G	NM_024946		57188235	57188235	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000565956	ensembl	human	novel	69_37n	missense	59	14.49	10	SNP	1.000	A
FAM196B	100131897	genome.wustl.edu	37	5	169310560	169310560	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr5:169310560G>A	ENST00000377365.3	-	2	1724	c.343C>T	c.(343-345)Ctc>Ttc	p.L115F	DOCK2_ENST00000520908.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000540750.1_Intron|DOCK2_ENST00000256935.8_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	115										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						CTGGCTGTGAGTCTCTTCCTT	0.522																																						dbGAP											0													81.0	77.0	78.0					5																	169310560		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.343C>T	5.37:g.169310560G>A	ENSP00000366582:p.Leu115Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L115F	ENST00000377365.3	37	c.343	CCDS47336.1	5	.	.	.	.	.	.	.	.	.	.	G	17.11	3.304715	0.60305	.	.	ENSG00000204767	ENST00000377365	.	.	.	5.36	5.36	0.76844	.	0.092385	0.44902	D	0.000405	T	0.70780	0.3263	M	0.66939	2.045	0.37622	D	0.921325	D	0.76494	0.999	D	0.74023	0.982	T	0.74763	-0.3555	9	0.49607	T	0.09	-15.8005	10.0943	0.42466	0.0732:0.0:0.789:0.1378	.	115	A6NMK8	F196B_HUMAN	F	115	.	ENSP00000366582:L115F	L	-	1	0	FAM196B	169243138	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.977000	0.49297	2.516000	0.84829	0.655000	0.94253	CTC	FAM196B	-	NULL	ENSG00000204767		0.522	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196B	HGNC	protein_coding	OTTHUMT00000371629.1	167	0.00	0	G	NM_001129891		169310560	169310560	-1	no_errors	ENST00000377365	ensembl	human	known	69_37n	missense	105	16.00	20	SNP	0.999	A
FXR1	8087	genome.wustl.edu	37	3	180687950	180687950	+	Silent	SNP	C	C	G			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr3:180687950C>G	ENST00000357559.4	+	15	1791	c.1407C>G	c.(1405-1407)ctC>ctG	p.L469L	FXR1_ENST00000445140.2_Silent_p.L469L|FXR1_ENST00000480918.1_Silent_p.L456L|FXR1_ENST00000468861.1_Silent_p.L384L|FXR1_ENST00000491062.1_Silent_p.L420L|FXR1_ENST00000305586.7_Silent_p.L384L	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	469					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			ATATAGTGCTCAAAGATCCAG	0.363																																						dbGAP											0													82.0	76.0	78.0					3																	180687950		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1407C>G	3.37:g.180687950C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9B8|Q7Z450|Q8N6R8	Nonsense_Mutation	SNP	pfam_Frag_X_MRP_fam	p.S70*	ENST00000357559.4	37	c.209	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	C	8.243	0.807370	0.16467	.	.	ENSG00000114416	ENST00000482125	.	.	.	5.71	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-27.0938	5.3815	0.16194	0.0:0.6189:0.1975:0.1836	.	.	.	.	X	70	.	.	S	+	2	0	FXR1	182170644	0.988000	0.35896	1.000000	0.80357	0.999000	0.98932	0.135000	0.15952	2.694000	0.91930	0.650000	0.86243	TCA	FXR1	-	pfam_Frag_X_MRP_fam	ENSG00000114416		0.363	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	117	0.00	0	C			180687950	180687950	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000482125	ensembl	human	novel	69_37n	nonsense	57	30.49	25	SNP	1.000	G
GBP5	115362	genome.wustl.edu	37	1	89732775	89732775	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr1:89732775C>G	ENST00000370459.3	-	5	617	c.490G>C	c.(490-492)Gaa>Caa	p.E164Q	GBP5_ENST00000343435.5_Missense_Mutation_p.E164Q|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	164	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		GCAGGATCTTCAACCCTGTCA	0.473																																						dbGAP											0													131.0	122.0	125.0					1																	89732775		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.490G>C	1.37:g.89732775C>G	ENSP00000359488:p.Glu164Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCE1|Q86TM5	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.E164Q	ENST00000370459.3	37	c.490	CCDS722.1	1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250251	0.59212	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.75154	-0.91;-0.91;-0.91	4.05	3.12	0.35913	Guanylate-binding protein, N-terminal (1);	0.752267	0.12366	N	0.475226	T	0.59018	0.2163	M	0.71036	2.16	0.09310	N	1	B	0.19817	0.039	B	0.24155	0.051	T	0.61113	-0.7128	10	0.59425	D	0.04	-7.4822	10.6264	0.45510	0.0:0.9025:0.0:0.0975	.	164	Q96PP8	GBP5_HUMAN	Q	164	ENSP00000340396:E164Q;ENSP00000359488:E164Q;ENSP00000403010:E164Q	ENSP00000340396:E164Q	E	-	1	0	GBP5	89505363	0.000000	0.05858	0.004000	0.12327	0.770000	0.43624	0.241000	0.18065	1.309000	0.44985	0.449000	0.29647	GAA	GBP5	-	pfam_Guanylate-bd_N	ENSG00000154451		0.473	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP5	HGNC	protein_coding	OTTHUMT00000027700.1	139	0.00	0	C	NM_052942		89732775	89732775	-1	no_errors	ENST00000343435	ensembl	human	known	69_37n	missense	77	15.38	14	SNP	0.156	G
GFM1	85476	genome.wustl.edu	37	3	158376754	158376754	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr3:158376754G>A	ENST00000486715.1	+	9	1484	c.1127G>A	c.(1126-1128)gGa>gAa	p.G376E	GFM1_ENST00000264263.5_Missense_Mutation_p.G395E|GFM1_ENST00000478576.1_Missense_Mutation_p.G376E	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			AGTTATCAGGGAGAGCTAAAG	0.428																																						dbGAP											0													127.0	115.0	119.0					3																	158376754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.1127G>A	3.37:g.158376754G>A	ENSP00000419038:p.Gly376Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	p.G376E	ENST00000486715.1	37	c.1127	CCDS33885.1	3	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837580	0.91117	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	D;D;D	0.96745	-4.11;-4.11;-4.11	5.81	5.81	0.92471	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.99315	0.9760	H	0.99949	5.025	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98102	1.0415	10	0.87932	D	0	-17.6978	20.0688	0.97709	0.0:0.0:1.0:0.0	.	395;376;376	Q96RP9-2;Q96RP9;C9IZ01	.;EFGM_HUMAN;.	E	376;376;395	ENSP00000419038:G376E;ENSP00000418755:G376E;ENSP00000264263:G395E	ENSP00000264263:G395E	G	+	2	0	GFM1	159859448	1.000000	0.71417	0.955000	0.39395	0.676000	0.39594	9.218000	0.95166	2.739000	0.93911	0.655000	0.94253	GGA	GFM1	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Transl_elong_EFG/EF2	ENSG00000168827		0.428	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	HGNC	protein_coding	OTTHUMT00000352271.1	199	0.00	0	G	NM_024996		158376754	158376754	+1	no_errors	ENST00000486715	ensembl	human	known	69_37n	missense	138	13.21	21	SNP	1.000	A
GLRB	2743	genome.wustl.edu	37	4	158065056	158065056	+	Silent	SNP	C	C	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr4:158065056C>T	ENST00000264428.4	+	8	1119	c.849C>T	c.(847-849)ctC>ctT	p.L283L	GLRB_ENST00000512619.1_Intron|GLRB_ENST00000541722.1_Silent_p.L283L|GLRB_ENST00000509282.1_Silent_p.L283L	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	283					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	TTGTTGTTCTCTCCTGGCTTT	0.517																																						dbGAP											0													192.0	152.0	166.0					4																	158065056		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.849C>T	4.37:g.158065056C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3K2|D3DP23|F5GWE1	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Glycine_rcpt_B,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.L283	ENST00000264428.4	37	c.849	CCDS3796.1	4																																																																																			GLRB	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000109738		0.517	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLRB	HGNC	protein_coding	OTTHUMT00000366507.1	302	0.00	0	C	NM_000824		158065056	158065056	+1	no_errors	ENST00000264428	ensembl	human	known	69_37n	silent	147	14.04	24	SNP	0.751	T
GREB1L	80000	genome.wustl.edu	37	18	19019528	19019528	+	Silent	SNP	C	C	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr18:19019528C>T	ENST00000580732.2	+	8	1260	c.879C>T	c.(877-879)tcC>tcT	p.S293S	GREB1L_ENST00000578368.1_3'UTR|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000424526.1_Silent_p.S293S|GREB1L_ENST00000269218.6_Silent_p.S293S|GREB1L_ENST00000431264.1_Silent_p.S293S|GREB1L_ENST00000400483.4_Silent_p.S293S			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	293						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GCAGTGCATCCAGCTCCACTC	0.517																																						dbGAP											0													208.0	176.0	186.0					18																	19019528		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.879C>T	18.37:g.19019528C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4QN17|Q9H8F1	Nonsense_Mutation	SNP	NULL	p.Q134*	ENST00000580732.2	37	c.400	CCDS45836.1	18																																																																																			GREB1L	-	NULL	ENSG00000141449		0.517	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	255	0.00	0	C	NM_024935		19019528	19019528	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000579454	ensembl	human	putative	69_37n	nonsense	103	16.26	20	SNP	0.656	T
HIVEP2	3097	genome.wustl.edu	37	6	143091478	143091478	+	Silent	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr6:143091478G>A	ENST00000367604.1	-	4	5037	c.4398C>T	c.(4396-4398)taC>taT	p.Y1466Y	HIVEP2_ENST00000012134.2_Silent_p.Y1466Y|HIVEP2_ENST00000367603.2_Silent_p.Y1466Y			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CAATCTGTCCGTACATCTTTT	0.522																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	dbGAP											0													170.0	177.0	175.0					6																	143091478		2000	4167	6167	-	-	-	SO:0001819	synonymous_variant	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4398C>T	6.37:g.143091478G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q02646|Q5THT5|Q9NS05	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y1466	ENST00000367604.1	37	c.4398	CCDS43510.1	6																																																																																			HIVEP2	-	NULL	ENSG00000010818		0.522	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	442	0.00	0	G			143091478	143091478	-1	no_errors	ENST00000012134	ensembl	human	known	69_37n	silent	197	17.92	43	SNP	0.147	A
KAT6B	23522	genome.wustl.edu	37	10	76603067	76603067	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr10:76603067G>A	ENST00000287239.4	+	3	941	c.452G>A	c.(451-453)cGg>cAg	p.R151Q	KAT6B_ENST00000372711.1_Missense_Mutation_p.R151Q|KAT6B_ENST00000372725.1_Missense_Mutation_p.R151Q|KAT6B_ENST00000372714.1_Missense_Mutation_p.R151Q|KAT6B_ENST00000372724.1_Missense_Mutation_p.R151Q	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	151	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TTTCAGCAGCGGCTGCGACTG	0.527																																						dbGAP											0													64.0	65.0	65.0					10																	76603067		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.452G>A	10.37:g.76603067G>A	ENSP00000287239:p.Arg151Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R151Q	ENST00000287239.4	37	c.452	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	G	19.47	3.832998	0.71258	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98	6.04	6.04	0.98038	.	0.000000	0.40728	N	0.001040	T	0.10508	0.0257	N	0.02247	-0.625	0.29712	N	0.839288	D;D;D	0.56968	0.973;0.973;0.978	B;B;P	0.48270	0.314;0.314;0.572	T	0.10291	-1.0636	10	0.05721	T	0.95	-10.1241	13.7479	0.62887	0.0698:0.0:0.9302:0.0	.	151;151;151	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	Q	151	ENSP00000361810:R151Q;ENSP00000361809:R151Q;ENSP00000287239:R151Q;ENSP00000361799:R151Q;ENSP00000361796:R151Q	ENSP00000287239:R151Q	R	+	2	0	KAT6B	76273073	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.476000	0.66793	2.873000	0.98535	0.563000	0.77884	CGG	KAT6B	-	pfam_Histone_H1/H5,smart_Histone_H1/H5	ENSG00000156650		0.527	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	111	0.00	0	G	NM_012330		76603067	76603067	+1	no_errors	ENST00000287239	ensembl	human	known	69_37n	missense	62	29.55	26	SNP	1.000	A
MST1L	11223	genome.wustl.edu	37	1	17085995	17085996	+	RNA	INS	-	-	C	rs528252461	byFrequency	TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr1:17085995_17085996insC	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCCAACGCCCGCCCCCCCGCCC	0.658													|||unknown(NO_COVERAGE)	266	0.053115	0.0492	0.0821	5008	,	,		18719	0.002		0.0408	False		,,,				2504	0.1033					dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086002_17086002dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Frame_Shift_Ins	INS	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.A301fs	ENST00000455405.2	37	c.902_901		1																																																																																			MST1P9	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.658	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	12	0.00	0	-	NM_001271733		17085995	17085996	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	frame_shift_ins	10	33.33	5	INS	0.980:0.979	C
NYAP1	222950	genome.wustl.edu	37	7	100088184	100088184	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr7:100088184C>T	ENST00000300179.2	+	5	2149	c.1990C>T	c.(1990-1992)Cca>Tca	p.P664S	NYAP1_ENST00000454988.1_Missense_Mutation_p.P608S|NYAP1_ENST00000496985.1_3'UTR|NYAP1_ENST00000423930.1_Missense_Mutation_p.P665S	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	664					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												TGCCGAGGGTCCAGGCAAGGT	0.647																																						dbGAP											0													29.0	26.0	27.0					7																	100088184		2194	4291	6485	-	-	-	SO:0001583	missense	0			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.1990C>T	7.37:g.100088184C>T	ENSP00000300179:p.Pro664Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	NULL	p.P665S	ENST00000300179.2	37	c.1993	CCDS5696.1	7	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352460	0.82132	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.30981	1.51;1.51;1.52	5.38	4.5	0.54988	.	0.333231	0.21806	N	0.068850	T	0.24314	0.0589	N	0.24115	0.695	0.40710	D	0.982564	B;B	0.17038	0.02;0.02	B;B	0.24006	0.05;0.05	T	0.05162	-1.0902	10	0.54805	T	0.06	9.0E-4	14.0128	0.64507	0.0:0.8475:0.1525:0.0	.	608;664	C9JS30;Q6ZVC0	.;CG051_HUMAN	S	664;665;608	ENSP00000300179:P664S;ENSP00000411861:P665S;ENSP00000394424:P608S	ENSP00000300179:P664S	P	+	1	0	C7orf51	99926120	0.035000	0.19736	0.988000	0.46212	0.977000	0.68977	1.167000	0.31847	1.260000	0.44134	0.561000	0.74099	CCA	NYAP1	-	NULL	ENSG00000166924		0.647	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NYAP1	HGNC	protein_coding	OTTHUMT00000339335.2	32	0.00	0	C	NM_173564		100088184	100088184	+1	no_errors	ENST00000423930	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.995	T
TENM1	10178	genome.wustl.edu	37	X	123518516	123518516	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chrX:123518516C>T	ENST00000371130.3	-	29	6307	c.6244G>A	c.(6244-6246)Gta>Ata	p.V2082I	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.V2089I	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2082					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TAATTAATTACACTGAATTTT	0.368																																						dbGAP											0													152.0	134.0	140.0					X																	123518516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6244G>A	X.37:g.123518516C>T	ENSP00000360171:p.Val2082Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.V2089I	ENST00000371130.3	37	c.6265	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762728	0.69763	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86562	-2.14;-2.1	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.91026	0.7177	L	0.48642	1.525	0.80722	D	1	D;D;D	0.89917	0.994;0.994;1.0	D;D;D	0.83275	0.97;0.978;0.996	D	0.88285	0.2939	10	0.20519	T	0.43	.	18.6434	0.91402	0.0:1.0:0.0:0.0	.	2088;2089;2082	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	I	2082;2089	ENSP00000360171:V2082I;ENSP00000403954:V2089I	ENSP00000360171:V2082I	V	-	1	0	ODZ1	123346197	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.818000	0.86416	2.345000	0.79718	0.600000	0.82982	GTA	ODZ1	-	NULL	ENSG00000009694		0.368	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	336	0.00	0	C	NM_014253		123518516	123518516	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	127	33.51	64	SNP	1.000	T
PCDHA5	56143	genome.wustl.edu	37	5	140203377	140203377	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr5:140203377C>A	ENST00000529859.1	+	1	2017	c.2017C>A	c.(2017-2019)Cag>Aag	p.Q673K	PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.Q673K|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.Q673K	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	673	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAAGTGGCCAGGCGCCGAA	0.672																																						dbGAP											0													41.0	49.0	46.0					5																	140203377		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.2017C>A	5.37:g.140203377C>A	ENSP00000436557:p.Gln673Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75284|Q8N4R3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Q673K	ENST00000529859.1	37	c.2017	CCDS54917.1	5	.	.	.	.	.	.	.	.	.	.	C	8.297	0.819153	0.16607	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.49139	0.83;0.79;0.82	4.01	4.01	0.46588	Cadherin (2);	.	.	.	.	T	0.46718	0.1407	L	0.55481	1.735	0.09310	N	1	B;B;B	0.29988	0.083;0.136;0.264	B;B;B	0.33254	0.022;0.071;0.16	T	0.46803	-0.9165	9	0.59425	D	0.04	.	12.7034	0.57046	0.0:0.6965:0.3035:0.0	.	673;673;673	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	K	673	ENSP00000433416:Q673K;ENSP00000436557:Q673K;ENSP00000367366:Q673K	ENSP00000367366:Q673K	Q	+	1	0	PCDHA5	140183561	0.009000	0.17119	0.514000	0.27761	0.665000	0.39181	0.356000	0.20181	1.978000	0.57642	0.306000	0.20318	CAG	PCDHA5	-	smart_Cadherin,pfscan_Cadherin	ENSG00000204965		0.672	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	HGNC	protein_coding	OTTHUMT00000372883.2	26	0.00	0	C	NM_018908		140203377	140203377	+1	no_errors	ENST00000529859	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.073	A
PDGFRA	5156	genome.wustl.edu	37	4	55141065	55141065	+	Missense_Mutation	SNP	G	G	A	rs121913270|rs121913271		TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr4:55141065G>A	ENST00000257290.5	+	12	2042	c.1711G>A	c.(1711-1713)Gaa>Aaa	p.E571K	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	571					adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.S566_E571>R(39)|p.S566_E571>K(7)|p.S566_Y572>RIDDL(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	AGATGGACATGAATATATTTA	0.453			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	dbGAP		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	47	Complex - deletion inframe(47)	small_intestine(37)|soft_tissue(6)|stomach(4)											90.0	92.0	91.0					4																	55141065		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.1711G>A	4.37:g.55141065G>A	ENSP00000257290:p.Glu571Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR_rcpt_N	p.E571K	ENST00000257290.5	37	c.1711	CCDS3495.1	4	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393776	0.62066	.	.	ENSG00000134853	ENST00000257290	D	0.94537	-3.45	6.03	5.19	0.71726	Protein kinase-like domain (1);	0.000000	0.32401	U	0.006155	D	0.96969	0.9010	M	0.85710	2.77	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.983	D	0.96482	0.9357	10	0.15499	T	0.54	.	15.2809	0.73784	0.0667:0.0:0.9333:0.0	.	571;571	P16234-3;P16234	.;PGFRA_HUMAN	K	571	ENSP00000257290:E571K	ENSP00000257290:E571K	E	+	1	0	PDGFRA	54835822	1.000000	0.71417	1.000000	0.80357	0.057000	0.15508	6.555000	0.73928	1.567000	0.49668	-0.136000	0.14681	GAA	PDGFRA	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,superfamily_Kinase-like_dom	ENSG00000134853		0.453	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRA	HGNC	protein_coding	OTTHUMT00000250598.2	123	0.00	0	G	NM_006206		55141065	55141065	+1	no_errors	ENST00000257290	ensembl	human	known	69_37n	missense	78	24.27	25	SNP	1.000	A
PIEZO1	9780	genome.wustl.edu	37	16	88799821	88799821	+	Silent	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr16:88799821G>A	ENST00000301015.9	-	19	2775	c.2529C>T	c.(2527-2529)ttC>ttT	p.F843F	RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	843					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						AGGGCAGGGCGAAGGCCCACA	0.657																																						dbGAP											0													47.0	47.0	47.0					16																	88799821		692	1588	2280	-	-	-	SO:0001819	synonymous_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2529C>T	16.37:g.88799821G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.S359L	ENST00000301015.9	37	c.1076	CCDS54058.1	16	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341282	0.24339	.	.	ENSG00000103335	ENST00000451779	.	.	.	4.49	-1.23	0.09465	.	.	.	.	.	T	0.55970	0.1954	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52208	-0.8606	4	.	.	.	-29.6147	10.5238	0.44936	0.5393:0.0:0.4607:0.0	.	.	.	.	C	789	.	.	R	-	1	0	FAM38A	87327322	0.001000	0.12720	0.970000	0.41538	0.864000	0.49448	-1.251000	0.02882	-0.119000	0.11830	-0.271000	0.10264	CGC	PIEZO1	-	NULL	ENSG00000103335		0.657	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	13	0.00	0	G	NM_014745		88799821	88799821	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451779	ensembl	human	putative	69_37n	missense	16	23.81	5	SNP	0.994	A
PLCG1	5335	genome.wustl.edu	37	20	39802138	39802138	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr20:39802138G>A	ENST00000373271.1	+	28	3763	c.3358G>A	c.(3358-3360)Gag>Aag	p.E1120K	PLCG1_ENST00000608689.1_3'UTR|PLCG1_ENST00000244007.3_Missense_Mutation_p.E1120K|PLCG1_ENST00000373272.2_Missense_Mutation_p.E1120K	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	1120	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				GGCTGGAGCTGAGTATGACAG	0.567											OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													124.0	104.0	111.0					20																	39802138		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.3358G>A	20.37:g.39802138G>A	ENSP00000362368:p.Glu1120Lys	Somatic	888	WXS	Illumina GAIIx	Phase_IV	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,pfam_SH3_domain,pfam_SH3_2,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pirsf_PLC-gamma,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2	p.E1120K	ENST00000373271.1	37	c.3358	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918985	0.92249	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.68025	-0.3;-0.3;-0.3	5.2	5.2	0.72013	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.104875	0.64402	D	0.000006	T	0.68091	0.2963	L	0.38531	1.155	0.80722	D	1	B;B;B	0.27286	0.07;0.174;0.086	B;B;B	0.41174	0.127;0.349;0.201	T	0.67213	-0.5727	10	0.49607	T	0.09	.	18.7322	0.91739	0.0:0.0:1.0:0.0	.	1120;1120;1120	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	K	1120	ENSP00000244007:E1120K;ENSP00000362368:E1120K;ENSP00000362369:E1120K	ENSP00000244007:E1120K	E	+	1	0	PLCG1	39235552	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.869000	0.99810	2.430000	0.82344	0.455000	0.32223	GAG	PLCG1	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pirsf_PLC-gamma,pfscan_C2_membr_targeting	ENSG00000124181		0.567	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3	209	0.00	0	G	NM_182811		39802138	39802138	+1	no_errors	ENST00000244007	ensembl	human	known	69_37n	missense	143	11.18	18	SNP	1.000	A
PRKRIR	5612	genome.wustl.edu	37	11	76062204	76062204	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr11:76062204C>T	ENST00000260045.3	-	5	2095	c.1990G>A	c.(1990-1992)Gaa>Aaa	p.E664K	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	664					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TGGAGGGCTTCATAGATGGTG	0.458																																						dbGAP											0													111.0	104.0	106.0					11																	76062204		2200	4290	6490	-	-	-	SO:0001583	missense	0			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1990G>A	11.37:g.76062204C>T	ENSP00000260045:p.Glu664Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	pfam_Znf_C2CH,pfam_HATC,superfamily_RNaseH-like_dom,smart_Znf_C2CH,pfscan_Znf_C2CH	p.E664K	ENST00000260045.3	37	c.1990	CCDS8243.1	11	.	.	.	.	.	.	.	.	.	.	C	28.7	4.945615	0.92593	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	T;T	0.20332	2.08;2.08	5.18	5.18	0.71444	HAT dimerisation (1);Ribonuclease H-like (1);	0.084627	0.85682	D	0.000000	T	0.31888	0.0811	L	0.49640	1.575	0.80722	D	1	P	0.48998	0.918	P	0.52514	0.701	T	0.01720	-1.1288	10	0.13108	T	0.6	.	19.2235	0.93808	0.0:1.0:0.0:0.0	.	664	O43422	P52K_HUMAN	K	489;664	ENSP00000436249:E489K;ENSP00000260045:E664K	ENSP00000260045:E664K	E	-	1	0	PRKRIR	75739852	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.114000	0.77103	2.636000	0.89361	0.644000	0.83932	GAA	PRKRIR	-	pfam_HATC,superfamily_RNaseH-like_dom	ENSG00000137492		0.458	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRIR	HGNC	protein_coding	OTTHUMT00000383188.1	231	0.00	0	C	NM_004705		76062204	76062204	-1	no_errors	ENST00000260045	ensembl	human	known	69_37n	missense	152	14.12	25	SNP	1.000	T
SEC31B	25956	genome.wustl.edu	37	10	102255183	102255183	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr10:102255183C>G	ENST00000370345.3	-	19	2528	c.2431G>C	c.(2431-2433)Gag>Cag	p.E811Q	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	811					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GATGATGTCTCTTTAGAGTGG	0.483																																						dbGAP											0													66.0	59.0	61.0					10																	102255183		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2431G>C	10.37:g.102255183C>G	ENSP00000359370:p.Glu811Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E811Q	ENST00000370345.3	37	c.2431	CCDS7495.1	10	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752559	0.31046	.	.	ENSG00000075826	ENST00000370345	T	0.44482	0.92	5.76	5.76	0.90799	.	0.960732	0.08733	N	0.901781	T	0.25158	0.0611	N	0.08118	0	0.80722	D	1	B;B	0.21452	0.049;0.056	B;B	0.15052	0.012;0.009	T	0.04165	-1.0972	10	0.02654	T	1	-8.994	16.6903	0.85320	0.0:1.0:0.0:0.0	.	810;811	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	Q	811	ENSP00000359370:E811Q	ENSP00000359370:E811Q	E	-	1	0	SEC31B	102245173	0.749000	0.28305	0.469000	0.27204	0.456000	0.32438	1.401000	0.34589	2.715000	0.92844	0.561000	0.74099	GAG	SEC31B	-	NULL	ENSG00000075826		0.483	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	HGNC	protein_coding	OTTHUMT00000051198.1	121	0.00	0	C	NM_015490		102255183	102255183	-1	no_errors	ENST00000370345	ensembl	human	known	69_37n	missense	98	13.27	15	SNP	0.283	G
SLCO5A1	81796	genome.wustl.edu	37	8	70591657	70591657	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr8:70591657G>T	ENST00000260126.4	-	8	2686	c.1980C>A	c.(1978-1980)ttC>ttA	p.F660L	SLCO5A1_ENST00000524945.1_Missense_Mutation_p.F660L|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.F605L	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	660						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			ATGCTGTGATGAAGGTGACTA	0.423																																						dbGAP											0													208.0	209.0	209.0					8																	70591657		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1980C>A	8.37:g.70591657G>T	ENSP00000260126:p.Phe660Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.F660L	ENST00000260126.4	37	c.1980	CCDS6205.1	8	.	.	.	.	.	.	.	.	.	.	G	9.701	1.154402	0.21371	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.39997	1.05;1.05;1.05	5.46	4.59	0.56863	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.125962	0.53938	D	0.000044	T	0.20536	0.0494	N	0.04655	-0.195	0.46901	D	0.999245	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.001;0.003;0.004	T	0.05354	-1.0890	10	0.23302	T	0.38	.	10.8976	0.47031	0.1627:0.0:0.8373:0.0	.	605;660;660	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	L	660;660;605	ENSP00000260126:F660L;ENSP00000434422:F660L;ENSP00000431611:F605L	ENSP00000260126:F660L	F	-	3	2	SLCO5A1	70754211	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.307000	0.51888	1.294000	0.44707	0.655000	0.94253	TTC	SLCO5A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000137571		0.423	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	HGNC	protein_coding	OTTHUMT00000381990.3	307	0.00	0	G	NM_030958		70591657	70591657	-1	no_errors	ENST00000260126	ensembl	human	known	69_37n	missense	322	10.53	38	SNP	1.000	T
TGFBR1	7046	genome.wustl.edu	37	9	101900249	101900249	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr9:101900249A>T	ENST00000374994.4	+	4	800	c.683A>T	c.(682-684)gAa>gTa	p.E228V	TGFBR1_ENST00000552516.1_Missense_Mutation_p.E232V|TGFBR1_ENST00000374990.2_Missense_Mutation_p.E151V|TGFBR1_ENST00000550253.1_Missense_Mutation_p.E159V	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	228	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CGGGGAGAAGAAGTTGCTGTT	0.423																																						dbGAP											0			GRCh37	CD086260	TGFBR1	D							140.0	139.0	140.0					9																	101900249		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.683A>T	9.37:g.101900249A>T	ENSP00000364133:p.Glu228Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,superfamily_Quinolinate_PRibosylTrfase_C,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E228V	ENST00000374994.4	37	c.683	CCDS6738.1	9	.	.	.	.	.	.	.	.	.	.	A	17.26	3.343522	0.61073	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000549021;ENST00000550253	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	5.59	5.59	0.84812	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.090906	0.85682	D	0.000000	T	0.52581	0.1743	N	0.19112	0.55	0.80722	D	1	B;B	0.27264	0.173;0.04	B;B	0.29716	0.039;0.106	T	0.49661	-0.8916	9	.	.	.	.	14.7546	0.69554	1.0:0.0:0.0:0.0	.	151;228	P36897-3;P36897	.;TGFR1_HUMAN	V	228;228;151;232;82;159	ENSP00000364133:E228V;ENSP00000364129:E151V;ENSP00000447297:E232V;ENSP00000449028:E82V;ENSP00000450052:E159V	.	E	+	2	0	TGFBR1	100940070	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	9.284000	0.95882	2.134000	0.65973	0.528000	0.53228	GAA	TGFBR1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000106799		0.423	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR1	HGNC	protein_coding	OTTHUMT00000053390.3	267	0.00	0	A			101900249	101900249	+1	no_errors	ENST00000374994	ensembl	human	known	69_37n	missense	243	17.85	53	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577558	7577558	+	Frame_Shift_Del	DEL	G	G	-	rs397516437		TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr17:7577558delG	ENST00000269305.4	-	7	912	c.723delC	c.(721-723)tccfs	p.S241fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.S241fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.S241fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C242fs*5(9)|p.0?(8)|p.?(5)|p.S241del(5)|p.S241F(5)|p.N239_C242delNSSC(3)|p.S241S(3)|p.N239_C242>S(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*20(1)|p.C242fs*23(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCCCATGCAGGAACTGTTAC	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	50	Deletion - In frame(13)|Deletion - Frameshift(13)|Whole gene deletion(8)|Unknown(5)|Substitution - Missense(5)|Substitution - coding silent(3)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - deletion inframe(1)	large_intestine(8)|biliary_tract(6)|breast(5)|upper_aerodigestive_tract(4)|stomach(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|central_nervous_system(2)|urinary_tract(2)|oesophagus(2)|skin(2)|eye(2)|pancreas(2)|liver(1)											138.0	107.0	117.0					17																	7577558		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.723delC	17.37:g.7577558delG	ENSP00000269305:p.Ser241fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C242fs	ENST00000269305.4	37	c.723	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	138	0.00	0	G	NM_000546		7577558	7577558	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	53	30.26	23	DEL	1.000	-
TPO	7173	genome.wustl.edu	37	2	1500429	1500429	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr2:1500429G>A	ENST00000345913.4	+	13	2369	c.2278G>A	c.(2278-2280)Ggg>Agg	p.G760R	TPO_ENST00000382198.1_Missense_Mutation_p.G587R|TPO_ENST00000349624.3_Missense_Mutation_p.G587R|TPO_ENST00000329066.4_Missense_Mutation_p.G760R|TPO_ENST00000382201.3_Missense_Mutation_p.G703R|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.G760R|TPO_ENST00000346956.3_Missense_Mutation_p.G760R	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	760	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TGAGGAGTCTGGGAGGCGCGT	0.567																																						dbGAP											0													158.0	152.0	154.0					2																	1500429		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2278G>A	2.37:g.1500429G>A	ENSP00000318820:p.Gly760Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd,superfamily_Haem_peroxidase,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.G760R	ENST00000345913.4	37	c.2278	CCDS1643.1	2	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640369	0.47153	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607	T;T;T;T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.09;-0.09;-0.99;1.9;-0.09;-0.09;-0.09	4.9	4.9	0.64082	Complement control module (2);Sushi/SCR/CCP (2);	0.062808	0.64402	D	0.000006	D	0.84316	0.5445	M	0.69248	2.105	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.995;0.995;0.989	D	0.85786	0.1364	10	0.66056	D	0.02	-33.6962	15.1828	0.72972	0.0:0.0:1.0:0.0	.	760;587;703;760	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	R	760;760;760;587;760;703;587;689;234	ENSP00000337263:G760R;ENSP00000318820:G760R;ENSP00000263886:G760R;ENSP00000332044:G587R;ENSP00000329869:G760R;ENSP00000371636:G703R;ENSP00000371633:G587R;ENSP00000405788:G689R;ENSP00000419461:G234R	ENSP00000329869:G760R	G	+	1	0	TPO	1479436	1.000000	0.71417	0.076000	0.20297	0.024000	0.10985	5.924000	0.70054	2.439000	0.82584	0.591000	0.81541	GGG	TPO	-	superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000115705		0.567	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	211	0.00	0	G	NM_000547		1500429	1500429	+1	no_errors	ENST00000329066	ensembl	human	known	69_37n	missense	147	13.53	23	SNP	0.793	A
TRIM55	84675	genome.wustl.edu	37	8	67040682	67040682	+	Silent	SNP	C	C	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr8:67040682C>A	ENST00000315962.4	+	2	685	c.312C>A	c.(310-312)atC>atA	p.I104I	TRIM55_ENST00000276573.7_Silent_p.I104I|TRIM55_ENST00000350034.4_Silent_p.I104I|TRIM55_ENST00000353317.5_Silent_p.I104I	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	104					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TGGAAAATATCATTGACATCT	0.458																																						dbGAP											0													125.0	124.0	124.0					8																	67040682		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.312C>A	8.37:g.67040682C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Silent	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.I104	ENST00000315962.4	37	c.312	CCDS6184.1	8																																																																																			TRIM55	-	NULL	ENSG00000147573		0.458	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM55	HGNC	protein_coding	OTTHUMT00000378921.1	181	0.00	0	C	NM_184085		67040682	67040682	+1	no_errors	ENST00000315962	ensembl	human	known	69_37n	silent	145	10.49	17	SNP	1.000	A
UPK2	7379	genome.wustl.edu	37	11	118828354	118828354	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr11:118828354G>C	ENST00000264031.2	+	4	429	c.394G>C	c.(394-396)Gag>Cag	p.E132Q	UPK2_ENST00000534788.1_3'UTR	NM_006760.3	NP_006751.1	O00526	UPK2_HUMAN	uroplakin 2	132					epithelial cell differentiation (GO:0030855)|membrane organization (GO:0061024)|multicellular organismal development (GO:0007275)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)				kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.122)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		GTCCAGCAGAGAGATCCCAAT	0.532											OREG0021391	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													132.0	124.0	127.0					11																	118828354		2200	4295	6495	-	-	-	SO:0001583	missense	0			Y13645	CCDS8404.1	11q23	2008-07-21				ENSG00000110375			12579	protein-coding gene	gene with protein product	"""uroplakin II"", ""uroplakin-2"""	611558				9515818, 9846985	Standard	NM_006760		Approved	UP2, UPII, MGC138598	uc001puh.3	O00526		ENST00000264031.2:c.394G>C	11.37:g.118828354G>C	ENSP00000264031:p.Glu132Gln	Somatic	1491	WXS	Illumina GAIIx	Phase_IV	B0YJ92|O00457|Q53YV0	Missense_Mutation	SNP	pfam_Uroplakin_II,pirsf_Uroplakin_II	p.E132Q	ENST00000264031.2	37	c.394	CCDS8404.1	11	.	.	.	.	.	.	.	.	.	.	g	15.24	2.774072	0.49786	.	.	ENSG00000110375	ENST00000264031	T	0.39592	1.07	4.86	3.94	0.45596	.	0.320421	0.26995	N	0.021452	T	0.44159	0.1280	L	0.57536	1.79	0.09310	N	0.999994	P	0.45348	0.856	P	0.51055	0.657	T	0.22417	-1.0217	10	0.16420	T	0.52	-22.2142	8.3722	0.32421	0.1038:0.0:0.8962:0.0	.	132	O00526	UPK2_HUMAN	Q	132	ENSP00000264031:E132Q	ENSP00000264031:E132Q	E	+	1	0	UPK2	118333564	0.977000	0.34250	0.660000	0.29694	0.856000	0.48823	2.692000	0.47018	2.689000	0.91719	0.604000	0.83254	GAG	UPK2	-	pfam_Uroplakin_II,pirsf_Uroplakin_II	ENSG00000110375		0.532	UPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPK2	HGNC	protein_coding	OTTHUMT00000389311.1	201	0.00	0	G	NM_006760		118828354	118828354	+1	no_errors	ENST00000264031	ensembl	human	known	69_37n	missense	170	11.92	23	SNP	0.316	C
VPS33A	65082	genome.wustl.edu	37	12	122716807	122716807	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chr12:122716807C>G	ENST00000267199.4	-	13	1889	c.1777G>C	c.(1777-1779)Gaa>Caa	p.E593Q	RP11-512M8.5_ENST00000535844.1_Intron	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	593					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		AAAGGTTTTTCCATCAGAGCC	0.413																																						dbGAP											0													184.0	196.0	192.0					12																	122716807		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.1777G>C	12.37:g.122716807C>G	ENSP00000267199:p.Glu593Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q547V4|Q9H5Q0	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.E593Q	ENST00000267199.4	37	c.1777	CCDS9231.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.167407	0.94768	.	.	ENSG00000139719	ENST00000267199	T	0.32753	1.44	6.17	6.17	0.99709	.	0.094719	0.64402	D	0.000001	T	0.50599	0.1625	M	0.78637	2.42	0.80722	D	1	P	0.52577	0.954	P	0.50352	0.638	T	0.48658	-0.9016	10	0.54805	T	0.06	-35.25	20.8794	0.99867	0.0:1.0:0.0:0.0	.	593	Q96AX1	VP33A_HUMAN	Q	593	ENSP00000267199:E593Q	ENSP00000267199:E593Q	E	-	1	0	VPS33A	121282760	1.000000	0.71417	0.996000	0.52242	0.706000	0.40770	7.786000	0.85741	2.941000	0.99782	0.655000	0.94253	GAA	VPS33A	-	superfamily_Sec1-like	ENSG00000139719		0.413	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33A	HGNC	protein_coding	OTTHUMT00000401607.2	250	0.40	1	C			122716807	122716807	-1	no_errors	ENST00000267199	ensembl	human	known	69_37n	missense	219	11.69	29	SNP	1.000	G
ZNF157	7712	genome.wustl.edu	37	X	47270116	47270116	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chrX:47270116G>C	ENST00000377073.3	+	3	323	c.237G>C	c.(235-237)ttG>ttC	p.L79F		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	79	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						TCTTCAAGTTGGAGCGAGGAG	0.507																																						dbGAP											0													74.0	57.0	62.0					X																	47270116		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.237G>C	X.37:g.47270116G>C	ENSP00000366273:p.Leu79Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LE9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L79F	ENST00000377073.3	37	c.237	CCDS14278.1	X	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933748	0.52866	.	.	ENSG00000147117	ENST00000377073	T	0.01015	5.44	3.12	3.12	0.35913	Krueppel-associated box (3);	.	.	.	.	T	0.03178	0.0093	M	0.68317	2.08	0.25952	N	0.982739	D	0.69078	0.997	P	0.61397	0.888	T	0.39603	-0.9606	9	0.49607	T	0.09	.	7.5127	0.27583	0.0:0.2617:0.7382:0.0	.	79	P51786	ZN157_HUMAN	F	79	ENSP00000366273:L79F	ENSP00000366273:L79F	L	+	3	2	ZNF157	47155060	0.972000	0.33761	0.999000	0.59377	0.995000	0.86356	0.258000	0.18387	1.825000	0.53177	0.500000	0.49745	TTG	ZNF157	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000147117		0.507	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF157	HGNC	protein_coding	OTTHUMT00000056415.1	167	0.00	0	G	NM_003446		47270116	47270116	+1	no_errors	ENST00000377073	ensembl	human	known	69_37n	missense	134	14.10	22	SNP	1.000	C
ZNF41	7592	genome.wustl.edu	37	X	47307056	47307056	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12D-01A-11D-A10Y-09	TCGA-AO-A12D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3065cfe-3067-4f08-8c82-46f10c1ec279	d1f36155-9a05-4343-9a9a-c25286291304	g.chrX:47307056G>A	ENST00000377065.4	-	5	2752	c.2113C>T	c.(2113-2115)Cgc>Tgc	p.R705C	ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.R715C|ZNF41_ENST00000313116.7_Missense_Mutation_p.R705C	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	747					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				ATATTGAGGCGTGACTTCCAG	0.423																																						dbGAP											0													118.0	104.0	109.0					X																	47307056		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.2113C>T	X.37:g.47307056G>A	ENSP00000366265:p.Arg705Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R715C	ENST00000377065.4	37	c.2143	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	G	8.342	0.828891	0.16749	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.08102	3.13;3.13;3.13	3.69	1.86	0.25419	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35838	N	0.002958	T	0.11965	0.0291	L	0.35288	1.05	0.09310	N	1	D;D;B;D;D	0.76494	0.999;0.999;0.025;0.999;0.999	P;P;B;P;P	0.58928	0.764;0.764;0.004;0.764;0.848	T	0.07809	-1.0753	10	0.46703	T	0.11	.	7.1392	0.25546	0.0:0.1831:0.6251:0.1918	.	705;707;715;739;747	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	C	705;705;715	ENSP00000315173:R705C;ENSP00000366265:R705C;ENSP00000380243:R715C	ENSP00000315173:R705C	R	-	1	0	ZNF41	47192000	0.000000	0.05858	0.938000	0.37757	0.958000	0.62258	-3.923000	0.00333	0.370000	0.24538	0.600000	0.82982	CGC	ZNF41	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000147124		0.423	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	HGNC	protein_coding	OTTHUMT00000056429.1	223	0.00	0	G	NM_153380		47307056	47307056	-1	no_errors	ENST00000397050	ensembl	human	known	69_37n	missense	195	13.66	31	SNP	0.021	A
