#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ATAD2B	54454	genome.wustl.edu	37	2	24080330	24080330	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr2:24080330T>C	ENST00000238789.5	-	13	1866	c.1523A>G	c.(1522-1524)gAt>gGt	p.D508G		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	508						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTAATCCATCTATTTCATC	0.279																																						dbGAP											0													44.0	42.0	43.0					2																	24080330		1806	4065	5871	-	-	-	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1523A>G	2.37:g.24080330T>C	ENSP00000238789:p.Asp508Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.D508G	ENST00000238789.5	37	c.1523	CCDS46227.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.2|27.2	4.811074|4.811074	0.90707|0.90707	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000238789|ENST00000366438	D|.	0.95885|.	-3.84|.	5.64|5.64	5.64|5.64	0.86602|0.86602	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	.|.	.|.	.|.	.|.	D|D	0.88422|0.88422	0.6432|0.6432	H|H	0.97390|0.97390	3.995|3.995	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.92460|0.92460	0.5977|0.5977	9|5	0.87932|.	D|.	0|.	.|.	16.1729|16.1729	0.81831|0.81831	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	508|.	Q9ULI0|.	ATD2B_HUMAN|.	G|V	508|130	ENSP00000238789:D508G|.	ENSP00000238789:D508G|.	D|M	-|-	2|1	0|0	ATAD2B|ATAD2B	23933834|23933834	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.955000|7.955000	0.87856|0.87856	2.281000|2.281000	0.76405|0.76405	0.533000|0.533000	0.62120|0.62120	GAT|ATG	ATAD2B	-	pfam_ATPase_AAA_core,pfam_IstB_ATP-bd,smart_AAA+_ATPase	ENSG00000119778		0.279	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	138	0.00	0	T	NM_017552		24080330	24080330	-1	no_errors	ENST00000238789	ensembl	human	known	69_37n	missense	61	44.55	49	SNP	1.000	C
BTBD3	22903	genome.wustl.edu	37	20	11900400	11900400	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr20:11900400C>T	ENST00000405977.1	+	4	1077	c.452C>T	c.(451-453)gCg>gTg	p.A151V	RP4-742J24.2_ENST00000439529.1_RNA|BTBD3_ENST00000254977.3_Missense_Mutation_p.A90V|BTBD3_ENST00000378226.2_Missense_Mutation_p.A151V|BTBD3_ENST00000488503.1_3'UTR|BTBD3_ENST00000399006.2_Missense_Mutation_p.A90V	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	151	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.A151G(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						GTGTTCCATGCGATGTTTTAC	0.413																																						dbGAP											1	Substitution - Missense(1)	lung(1)											146.0	137.0	140.0					20																	11900400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.452C>T	20.37:g.11900400C>T	ENSP00000384545:p.Ala151Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW19|Q5JY73	Missense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.A151V	ENST00000405977.1	37	c.452	CCDS13113.1	20	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505263	0.85282	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000422390;ENST00000378226;ENST00000455911;ENST00000430557	T;T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	6.06	6.06	0.98353	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.86969	0.6061	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88861	0.3326	10	0.87932	D	0	.	19.6279	0.95687	0.0:1.0:0.0:0.0	.	151	Q9Y2F9	BTBD3_HUMAN	V	90;90;151;90;151;40;40	ENSP00000254977:A90V;ENSP00000381971:A90V;ENSP00000384545:A151V;ENSP00000397809:A90V;ENSP00000367471:A151V;ENSP00000408817:A40V;ENSP00000404582:A40V	ENSP00000254977:A90V	A	+	2	0	BTBD3	11848400	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.880000	0.98712	0.650000	0.86243	GCG	BTBD3	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000132640		0.413	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD3	HGNC	protein_coding	OTTHUMT00000078021.3	182	0.00	0	C			11900400	11900400	+1	no_errors	ENST00000378226	ensembl	human	known	69_37n	missense	77	18.95	18	SNP	1.000	T
CDX4	1046	genome.wustl.edu	37	X	72673370	72673371	+	Nonsense_Mutation	DNP	GA	GA	TG			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G|A	G|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chrX:72673370_72673371GA>TG	ENST00000373514.2	+	2	520_521	c.520_521GA>TG	c.(520-522)GAa>TGa	p.E174*		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	174					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					CAGGACAAAAGAAAAGTATCGT	0.366																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	Exception_encountered	X.37:g.72673370_72673371delinsTG	ENSP00000362613:p.Glu174*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A513|Q5JS20	Nonsense_Mutation|Missense_Mutation	SNP	pfam_Caudal_activation_dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.E174*|p.E174G	ENST00000373514.2	37	c.520|c.521	CCDS14424.1	X																																																																																			CDX4	-	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000131264		0.366	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDX4	HGNC	protein_coding	OTTHUMT00000057229.2	172|173	0.00	0	G|A	NM_005193		72673370|72673371	72673370|72673371	+1	no_errors	ENST00000373514	ensembl	human	known	69_37n	nonsense|missense	40|41	28.57|28.07	16	SNP	1.000	T|G
CLASRP	11129	genome.wustl.edu	37	19	45571725	45571725	+	Silent	SNP	G	G	C			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr19:45571725G>C	ENST00000221455.3	+	16	1853	c.1755G>C	c.(1753-1755)gcG>gcC	p.A585A	CLASRP_ENST00000544944.2_Intron|CLASRP_ENST00000391953.4_Silent_p.A523A	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	585	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						TGCAGAAGGCGCTGAACAGGC	0.607																																						dbGAP											0													114.0	96.0	102.0					19																	45571725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1755G>C	19.37:g.45571725G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	pfam_SWAP_N_domain	p.A587P	ENST00000221455.3	37	c.1759	CCDS12652.2	19	.	.	.	.	.	.	.	.	.	.	G	9.550	1.115650	0.20795	.	.	ENSG00000104859	ENST00000391952	T	0.33865	1.39	5.44	-10.9	0.00192	.	0.000000	0.36002	U	0.002852	T	0.26048	0.0635	.	.	.	0.48696	D	0.999691	.	.	.	.	.	.	T	0.55835	-0.8078	7	0.51188	T	0.08	-16.0134	1.2155	0.01913	0.4079:0.2552:0.1583:0.1786	.	.	.	.	P	587	ENSP00000375814:A587P	ENSP00000375814:A587P	A	+	1	0	CLASRP	50263565	0.002000	0.14202	0.159000	0.22649	0.993000	0.82548	-2.709000	0.00819	-2.885000	0.00317	-0.258000	0.10820	GCT	CLASRP	-	NULL	ENSG00000104859		0.607	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLASRP	HGNC	protein_coding	OTTHUMT00000316749.1	17	0.00	0	G	NM_007056		45571725	45571725	+1	no_errors	ENST00000391952	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	0.014	C
DMRT2	10655	genome.wustl.edu	37	9	1053792	1053792	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr9:1053792delC	ENST00000358146.2	+	2	596	c.596delC	c.(595-597)gccfs	p.A199fs	DMRT2_ENST00000259622.6_Frame_Shift_Del_p.A199fs|DMRT2_ENST00000302441.6_Frame_Shift_Del_p.A199fs|DMRT2_ENST00000412350.2_Frame_Shift_Del_p.A199fs|DMRT2_ENST00000382255.3_Frame_Shift_Del_p.A199fs|DMRT2_ENST00000382251.3_Frame_Shift_Del_p.A199fs			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	199					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		CAAGTCAGAGCCCCCAGTTTG	0.418																																						dbGAP											0													78.0	82.0	81.0					9																	1053792		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.596delC	9.37:g.1053792delC	ENSP00000350865:p.Ala199fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Frame_Shift_Del	DEL	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.S201fs	ENST00000358146.2	37	c.596	CCDS6444.1	9																																																																																			DMRT2	-	NULL	ENSG00000173253		0.418	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT2	HGNC	protein_coding	OTTHUMT00000051492.1	99	0.00	0	C	NM_006557		1053792	1053792	+1	no_errors	ENST00000302441	ensembl	human	known	69_37n	frame_shift_del	47	53.33	56	DEL	1.000	-
DUSP1	1843	genome.wustl.edu	37	5	172195858	172195858	+	Silent	SNP	G	G	A			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr5:172195858G>A	ENST00000239223.3	-	4	1253	c.1011C>T	c.(1009-1011)acC>acT	p.T337T	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	337	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		AGTTGAACACGGTGGTGGTGG	0.627																																						dbGAP											0													107.0	102.0	104.0					5																	172195858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.1011C>T	5.37:g.172195858G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQL9|Q2V508	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.T337	ENST00000239223.3	37	c.1011	CCDS4380.1	5																																																																																			DUSP1	-	pirsf_MKP	ENSG00000120129		0.627	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP1	HGNC	protein_coding	OTTHUMT00000252943.3	18	0.00	0	G	NM_004417		172195858	172195858	-1	no_errors	ENST00000239223	ensembl	human	known	69_37n	silent	61	21.79	17	SNP	0.000	A
EGR3	1960	genome.wustl.edu	37	8	22548379	22548379	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr8:22548379delC	ENST00000317216.2	-	2	1128	c.771delG	c.(769-771)cggfs	p.R257fs	RP11-459E5.1_ENST00000523627.1_RNA|EGR3_ENST00000519492.1_3'UTR|EGR3_ENST00000522910.1_Frame_Shift_Del_p.R219fs|EGR3_ENST00000524088.1_5'UTR	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	257					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		ACTTGCGGGGCCGGATGGGCT	0.667																																						dbGAP											0													42.0	50.0	47.0					8																	22548379		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0			X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.771delG	8.37:g.22548379delC	ENSP00000318057:p.Arg257fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Frame_Shift_Del	DEL	pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R259fs	ENST00000317216.2	37	c.771	CCDS6033.1	8																																																																																			EGR3	-	NULL	ENSG00000179388		0.667	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGR3	HGNC	protein_coding	OTTHUMT00000215098.1	12	0.00	0	C	NM_004430		22548379	22548379	-1	no_errors	ENST00000317216	ensembl	human	known	69_37n	frame_shift_del	88	22.12	25	DEL	0.999	-
FAM47B	170062	genome.wustl.edu	37	X	34960976	34960976	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chrX:34960976C>T	ENST00000329357.5	+	1	64	c.28C>T	c.(28-30)Cca>Tca	p.P10S		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	10										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						ACAGGACCGGCCAAGGTCCCA	0.622																																						dbGAP											0													26.0	21.0	23.0					X																	34960976		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.28C>T	X.37:g.34960976C>T	ENSP00000328307:p.Pro10Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	NULL	p.P10S	ENST00000329357.5	37	c.28	CCDS14236.1	X	.	.	.	.	.	.	.	.	.	.	C	7.253	0.603655	0.14002	.	.	ENSG00000189132	ENST00000329357	T	0.22134	1.97	0.776	0.776	0.18532	.	.	.	.	.	T	0.19967	0.0480	M	0.66939	2.045	0.09310	N	1	B	0.32753	0.383	B	0.27608	0.081	T	0.17501	-1.0367	8	0.59425	D	0.04	.	.	.	.	.	10	Q8NA70	FA47B_HUMAN	S	10	ENSP00000328307:P10S	ENSP00000328307:P10S	P	+	1	0	FAM47B	34870897	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-1.727000	0.01860	0.653000	0.30826	0.190000	0.17370	CCA	FAM47B	-	NULL	ENSG00000189132		0.622	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	HGNC	protein_coding	OTTHUMT00000056211.1	19	0.00	0	C	NM_152631		34960976	34960976	+1	no_errors	ENST00000329357	ensembl	human	known	69_37n	missense	2	83.33	10	SNP	0.006	T
FBXW10	10517	genome.wustl.edu	37	17	18682505	18682505	+	Missense_Mutation	SNP	T	T	C	rs1024657	byFrequency	TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr17:18682505T>C	ENST00000395665.4	+	14	3274	c.3053T>C	c.(3052-3054)gTc>gCc	p.V1018A	TVP23B_ENST00000307767.8_5'Flank|FBXW10_ENST00000308799.4_Missense_Mutation_p.V1027A|FBXW10_ENST00000395667.1_Missense_Mutation_p.V1017A|TVP23B_ENST00000574226.1_5'Flank|FBXW10_ENST00000301938.4_Missense_Mutation_p.V965A|TVP23B_ENST00000476139.1_5'Flank			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	1018								p.V1017A(1)		NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						CCAGGAAAAGTCAGCAAAGCT	0.488													N|||	744	0.148562	0.1846	0.2147	5008	,	,		13486	0.0903		0.2018	False		,,,				2504	0.0583					dbGAP											1	Substitution - Missense(1)	prostate(1)											42.0	40.0	41.0					17																	18682505		1906	3581	5487	-	-	-	SO:0001583	missense	0			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.3053T>C	17.37:g.18682505T>C	ENSP00000379025:p.Val1018Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V1027A	ENST00000395665.4	37	c.3080	CCDS11199.3	17	498	0.22802197802197802	92	0.18699186991869918	107	0.2955801104972376	65	0.11363636363636363	234	0.3087071240105541	C	0.015	-1.557317	0.00910	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84	3.38	2.36	0.29203	.	0.000000	0.31936	N	0.006834	T	0.00012	0.0000	N	0.00128	-2.045	0.58432	P	1.0000000000287557E-6	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.24693	-1.0153	9	0.02654	T	1	.	4.0906	0.09968	0.4063:0.4743:0.0:0.1194	.	965;1027;1018;1017	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	A	1017;1027;965;1018	ENSP00000379026:V1017A;ENSP00000310382:V1027A;ENSP00000306937:V965A;ENSP00000379025:V1018A	ENSP00000306937:V965A	V	+	2	0	FBXW10	18623230	0.407000	0.25352	0.286000	0.24833	0.737000	0.42083	0.661000	0.25023	0.116000	0.18110	-0.473000	0.04963	GTC	FBXW10	-	NULL	ENSG00000171931		0.488	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	HGNC	protein_coding	OTTHUMT00000313531.2	29	0.00	0	T	NM_031456		18682505	18682505	+1	no_errors	ENST00000308799	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.825	C
FLG	2312	genome.wustl.edu	37	1	152277404	152277404	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr1:152277404G>A	ENST00000368799.1	-	3	9993	c.9958C>T	c.(9958-9960)Cgt>Tgt	p.R3320C	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3320	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTTGTCCACGCGGAATGCCT	0.552									Ichthyosis																													dbGAP											0													408.0	398.0	402.0					1																	152277404		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9958C>T	1.37:g.152277404G>A	ENSP00000357789:p.Arg3320Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.R3320C	ENST00000368799.1	37	c.9958	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.405399	0.25378	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.04275	3.66	3.45	1.38	0.22167	.	.	.	.	.	T	0.06096	0.0158	L	0.54323	1.7	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.24476	-1.0159	9	0.72032	D	0.01	-0.0255	5.8393	0.18625	0.0:0.2169:0.5596:0.2234	.	3320	P20930	FILA_HUMAN	C	3320;258	ENSP00000357789:R3320C	ENSP00000357786:R258C	R	-	1	0	FLG	150544028	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.116000	0.15561	0.221000	0.20879	0.298000	0.19748	CGT	FLG	-	pfam_Filaggrin	ENSG00000143631		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	95	0.00	0	G	NM_002016		152277404	152277404	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	247	37.37	148	SNP	0.000	A
GGT3P	2679	genome.wustl.edu	37	22	18769677	18769677	+	RNA	SNP	C	C	T	rs201643425	byFrequency	TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr22:18769677C>T	ENST00000412448.1	-	0	1001							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										TGCTCGATGACGGTCCGCTTG	0.672																																						dbGAP											0																																										-	-	-			0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18769677C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.672	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1	10	0.00	0	C	NR_003267		18769677	18769677	-1	no_errors	ENST00000412448	ensembl	human	known	69_37n	rna	11	56.00	14	SNP	0.000	T
GLTSCR1L	23506	genome.wustl.edu	37	6	42832634	42832634	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr6:42832634delC	ENST00000314073.5	+	13	2866	c.2690delC	c.(2689-2691)acafs	p.T897fs	GLTSCR1L_ENST00000394168.1_Frame_Shift_Del_p.T897fs			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	897																	TCTAAAAAAACAGAATGCCTT	0.493																																						dbGAP											0													69.0	62.0	64.0					6																	42832634		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.2690delC	6.37:g.42832634delC	ENSP00000313933:p.Thr897fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3W2|Q5TFZ3|Q92514	Frame_Shift_Del	DEL	NULL	p.T897fs	ENST00000314073.5	37	c.2690	CCDS34451.1	6																																																																																			KIAA0240	-	NULL	ENSG00000112624		0.493	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	HGNC	protein_coding	OTTHUMT00000040562.3	48	0.00	0	C	NM_015349		42832634	42832634	+1	no_errors	ENST00000314073	ensembl	human	known	69_37n	frame_shift_del	86	26.27	31	DEL	0.042	-
KIAA1377	57562	genome.wustl.edu	37	11	101818866	101818866	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr11:101818866A>C	ENST00000263468.8	+	4	769	c.499A>C	c.(499-501)Aac>Cac	p.N167H		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	167										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		ACCAACAATAAACTGGAGGTA	0.363																																						dbGAP											0													58.0	57.0	58.0					11																	101818866		2202	4298	6500	-	-	-	SO:0001583	missense	0			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.499A>C	11.37:g.101818866A>C	ENSP00000263468:p.Asn167His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0U6	Missense_Mutation	SNP	NULL	p.N167H	ENST00000263468.8	37	c.499	CCDS31658.1	11	.	.	.	.	.	.	.	.	.	.	A	9.980	1.227906	0.22542	.	.	ENSG00000110318	ENST00000263468	T	0.08896	3.04	5.4	1.51	0.23008	.	0.185087	0.39759	N	0.001262	T	0.05960	0.0155	L	0.42245	1.32	0.22468	N	0.999076	B	0.21606	0.058	B	0.22601	0.04	T	0.35525	-0.9785	10	0.22706	T	0.39	-6.9493	2.9659	0.05908	0.6327:0.1469:0.0792:0.1412	.	167	Q9P2H0	K1377_HUMAN	H	167	ENSP00000263468:N167H	ENSP00000263468:N167H	N	+	1	0	KIAA1377	101324076	0.001000	0.12720	0.141000	0.22245	0.183000	0.23260	1.003000	0.29809	0.415000	0.25817	-0.291000	0.09656	AAC	KIAA1377	-	NULL	ENSG00000110318		0.363	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	199	0.00	0	A	NM_020802		101818866	101818866	+1	no_errors	ENST00000263468	ensembl	human	known	69_37n	missense	85	21.30	23	SNP	0.218	C
KRT14	3861	genome.wustl.edu	37	17	39742881	39742881	+	Missense_Mutation	SNP	T	T	A	rs374199640		TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr17:39742881T>A	ENST00000167586.6	-	1	292	c.206A>T	c.(205-207)tAt>tTt	p.Y69F		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	69	Head.				aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				GCCACCGCCATAGCCGCCCCC	0.682																																						dbGAP											0													29.0	36.0	34.0					17																	39742881		2192	4277	6469	-	-	-	SO:0001583	missense	0			BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.206A>T	17.37:g.39742881T>A	ENSP00000167586:p.Tyr69Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.Y69F	ENST00000167586.6	37	c.206	CCDS11400.1	17	.	.	.	.	.	.	.	.	.	.	T	9.247	1.039692	0.19669	.	.	ENSG00000186847	ENST00000167586	D	0.89270	-2.49	4.76	3.67	0.42095	.	0.536654	0.15706	N	0.248692	T	0.80763	0.4685	L	0.38531	1.155	0.38690	D	0.952749	P	0.47762	0.9	B	0.40410	0.328	T	0.77466	-0.2577	10	0.10111	T	0.7	.	9.9769	0.41789	0.0:0.0805:0.0:0.9195	.	69	P02533	K1C14_HUMAN	F	69	ENSP00000167586:Y69F	ENSP00000167586:Y69F	Y	-	2	0	KRT14	36996407	0.000000	0.05858	1.000000	0.80357	0.743000	0.42351	-0.148000	0.10219	1.899000	0.54978	0.448000	0.29417	TAT	KRT14	-	NULL	ENSG00000186847		0.682	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT14	HGNC	protein_coding	OTTHUMT00000257289.1	49	0.00	0	T	NM_000526		39742881	39742881	-1	no_errors	ENST00000167586	ensembl	human	known	69_37n	missense	89	51.89	96	SNP	1.000	A
KPNA2	3838	genome.wustl.edu	37	17	66033483	66033483	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr17:66033483C>T	ENST00000537025.2	+	3	705	c.85C>T	c.(85-87)Cgt>Tgt	p.R29C	KPNA2_ENST00000330459.3_Missense_Mutation_p.R29C			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	29	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.|Poly-Arg.				cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.R29C(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGAAATGAGGCGTCGCAGAAT	0.413																																						dbGAP											1	Substitution - Missense(1)	lung(1)											101.0	96.0	98.0					17																	66033483		2203	4296	6499	-	-	-	SO:0001583	missense	0			U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.85C>T	17.37:g.66033483C>T	ENSP00000438483:p.Arg29Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.R29C	ENST00000537025.2	37	c.85	CCDS32713.1	17	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149544	0.37923	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.59772	0.24;0.24	4.28	4.28	0.50868	Importin-alpha, importin-beta-binding domain (2);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	U	0.000001	T	0.80491	0.4633	H	0.94462	3.54	0.80722	D	1	D	0.69078	0.997	D	0.74348	0.983	D	0.85171	0.0998	10	0.87932	D	0	.	11.3359	0.49503	0.3118:0.6882:0.0:0.0	.	29	P52292	IMA2_HUMAN	C	29	ENSP00000332455:R29C;ENSP00000438483:R29C	ENSP00000332455:R29C	R	+	1	0	KPNA2	63463945	1.000000	0.71417	0.995000	0.50966	0.896000	0.52359	2.289000	0.43523	1.938000	0.56188	0.305000	0.20034	CGT	KPNA2	-	pfam_Importin-a_IBB,superfamily_ARM-type_fold,pfscan_Importin-a_IBB	ENSG00000182481		0.413	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KPNA2	HGNC	protein_coding	OTTHUMT00000448111.1	94	0.00	0	C	NM_002266		66033483	66033483	+1	no_errors	ENST00000330459	ensembl	human	known	69_37n	missense	36	45.59	31	SNP	1.000	T
MKRN2	23609	genome.wustl.edu	37	3	12623389	12623389	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr3:12623389G>A	ENST00000170447.7	+	7	1188	c.1051G>A	c.(1051-1053)Gat>Aat	p.D351N	MKRN2_ENST00000448482.1_Missense_Mutation_p.D349N|MKRN2_ENST00000411987.1_Missense_Mutation_p.D308N	NM_001271707.1|NM_014160.3	NP_001258636.1|NP_054879.3	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2	351					protein ubiquitination (GO:0016567)	intracellular (GO:0005622)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(3)	16						TGCTTACCCCGATGGGCGGCT	0.488																																						dbGAP											0													125.0	128.0	127.0					3																	12623389		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33702.1, CCDS63545.1	3p25	2008-08-13	2008-08-13		ENSG00000075975	ENSG00000075975		"""RING-type (C3HC4) zinc fingers"""	7113	protein-coding gene	gene with protein product		608426				11597136	Standard	NM_014160		Approved	RNF62, HSPC070	uc003bxd.4	Q9H000	OTTHUMG00000155371	ENST00000170447.7:c.1051G>A	3.37:g.12623389G>A	ENSP00000170447:p.Asp351Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIA2|B3KRC5|B4DPR4|Q8N391|Q96BD4|Q9BUY2|Q9NRY1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.D351N	ENST00000170447.7	37	c.1051	CCDS33702.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.632880	0.96682	.	.	ENSG00000075975	ENST00000170447;ENST00000411987;ENST00000448482	T;T;T	0.34275	2.36;1.37;1.54	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.58457	-0.7633	10	0.48119	T	0.1	-13.4571	19.9759	0.97304	0.0:0.0:1.0:0.0	.	308;349;351	B4DPR4;C9J494;Q9H000	.;.;MKRN2_HUMAN	N	351;308;349	ENSP00000170447:D351N;ENSP00000396340:D308N;ENSP00000397983:D349N	ENSP00000170447:D351N	D	+	1	0	MKRN2	12598389	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	9.470000	0.97683	2.713000	0.92767	0.655000	0.94253	GAT	MKRN2	-	NULL	ENSG00000075975		0.488	MKRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN2	HGNC	protein_coding	OTTHUMT00000339679.1	75	0.00	0	G	NM_014160		12623389	12623389	+1	no_errors	ENST00000170447	ensembl	human	known	69_37n	missense	77	17.20	16	SNP	1.000	A
MORN3	283385	genome.wustl.edu	37	12	122107317	122107317	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr12:122107317C>T	ENST00000355329.3	-	1	243	c.73G>A	c.(73-75)Ggc>Agc	p.G25S		NM_173855.4	NP_776254.3	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	25						nucleus (GO:0005634)				breast(2)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		CTCCGCAGGCCGTTCCTCTGG	0.617																																						dbGAP											0													128.0	107.0	114.0					12																	122107317		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC057760	CCDS31917.1	12q24.31	2006-01-17			ENSG00000139714	ENSG00000139714			29807	protein-coding gene	gene with protein product							Standard	NM_173855		Approved		uc001uax.3	Q6PF18	OTTHUMG00000169075	ENST00000355329.3:c.73G>A	12.37:g.122107317C>T	ENSP00000347486:p.Gly25Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YQ9	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.G25S	ENST00000355329.3	37	c.73	CCDS31917.1	12	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323940	0.60634	.	.	ENSG00000139714	ENST00000355329	T	0.76578	-1.03	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.88811	0.6538	M	0.85197	2.74	0.51012	D	0.999905	D	0.89917	1.0	D	0.91635	0.999	D	0.90070	0.4162	10	0.72032	D	0.01	.	14.8223	0.70082	0.0:1.0:0.0:0.0	.	25	Q6PF18	MORN3_HUMAN	S	25	ENSP00000347486:G25S	ENSP00000347486:G25S	G	-	1	0	MORN3	120591700	0.994000	0.37717	0.205000	0.23548	0.180000	0.23129	4.730000	0.62015	2.648000	0.89879	0.462000	0.41574	GGC	MORN3	-	NULL	ENSG00000139714		0.617	MORN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MORN3	HGNC	protein_coding	OTTHUMT00000402154.1	62	0.00	0	C	NM_173855		122107317	122107317	-1	no_errors	ENST00000355329	ensembl	human	known	69_37n	missense	39	38.10	24	SNP	0.726	T
NHLRC1	378884	genome.wustl.edu	37	6	18121861	18121861	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr6:18121861G>A	ENST00000340650.3	-	1	990	c.977C>T	c.(976-978)aCc>aTc	p.T326I		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	326					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			GTGATCAAAGGTCACAGCGGA	0.488																																						dbGAP											0													99.0	93.0	95.0					6																	18121861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.977C>T	6.37:g.18121861G>A	ENSP00000345464:p.Thr326Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYB1|Q5VUK7|Q6IMH1	Missense_Mutation	SNP	smart_Znf_RING,pfscan_NHL_repeat_subgr,pfscan_Znf_RING	p.T326I	ENST00000340650.3	37	c.977	CCDS4542.1	6	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828514	0.50845	.	.	ENSG00000187566	ENST00000340650	D	0.90955	-2.76	5.76	5.76	0.90799	Six-bladed beta-propeller, TolB-like (1);	0.258043	0.37530	N	0.002049	D	0.84133	0.5405	L	0.43152	1.355	0.45621	D	0.998555	P	0.43477	0.808	B	0.37267	0.245	D	0.85657	0.1286	10	0.48119	T	0.1	-14.9978	19.9857	0.97347	0.0:0.0:1.0:0.0	.	326	Q6VVB1	NHLC1_HUMAN	I	326	ENSP00000345464:T326I	ENSP00000345464:T326I	T	-	2	0	NHLRC1	18229840	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.260000	0.78391	2.706000	0.92434	0.655000	0.94253	ACC	NHLRC1	-	NULL	ENSG00000187566		0.488	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC1	HGNC	protein_coding	OTTHUMT00000039958.1	25	0.00	0	G			18121861	18121861	-1	no_errors	ENST00000340650	ensembl	human	known	69_37n	missense	10	60.00	15	SNP	1.000	A
OPCML	4978	genome.wustl.edu	37	11	132290114	132290114	+	Silent	SNP	G	G	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr11:132290114G>T	ENST00000331898.7	-	7	1589	c.1011C>A	c.(1009-1011)ctC>ctA	p.L337L	OPCML_ENST00000524381.1_Silent_p.L330L|OPCML_ENST00000374778.4_Silent_p.L296L|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000541867.1_Silent_p.L346L	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	337					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.L330L(1)|p.L337L(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		AGTGGGCTAAGAGGGTCCCTG	0.512																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											118.0	103.0	108.0					11																	132290114		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.1011C>A	11.37:g.132290114G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L346	ENST00000331898.7	37	c.1038	CCDS8492.1	11																																																																																			OPCML	-	NULL	ENSG00000183715		0.512	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	27	0.00	0	G	NM_001012393		132290114	132290114	-1	no_errors	ENST00000541867	ensembl	human	known	69_37n	silent	6	79.31	23	SNP	1.000	T
PLIN4	729359	genome.wustl.edu	37	19	4513446	4513446	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr19:4513446G>A	ENST00000301286.3	-	3	483	c.484C>T	c.(484-486)Ctc>Ttc	p.L162F		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	162	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GCCCCCGTGAGCCCAGTGGAC	0.632																																						dbGAP											0													69.0	73.0	72.0					19																	4513446		2011	4161	6172	-	-	-	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.484C>T	19.37:g.4513446G>A	ENSP00000301286:p.Leu162Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.L162F	ENST00000301286.3	37	c.484	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285283	0.59867	.	.	ENSG00000167676	ENST00000301286	T	0.06068	3.35	5.43	-5.5	0.02576	.	1.175880	0.06574	N	0.749160	T	0.07593	0.0191	M	0.72479	2.2	0.09310	N	1	B	0.22414	0.069	B	0.21151	0.033	T	0.43310	-0.9399	10	0.13470	T	0.59	-1.0712	9.5765	0.39461	0.0729:0.5184:0.3287:0.0799	.	162	Q96Q06	PLIN4_HUMAN	F	162	ENSP00000301286:L162F	ENSP00000301286:L162F	L	-	1	0	PLIN4	4464446	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.590000	0.02102	-1.084000	0.03092	-0.311000	0.09066	CTC	PLIN4	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000167676		0.632	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	19	0.00	0	G	XM_170901		4513446	4513446	-1	no_errors	ENST00000301286	ensembl	human	novel	69_37n	missense	30	36.73	18	SNP	0.000	A
POSTN	10631	genome.wustl.edu	37	13	38172818	38172818	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr13:38172818C>T	ENST00000379747.4	-	1	163	c.46G>A	c.(46-48)Gtt>Att	p.V16I	POSTN_ENST00000379742.4_Missense_Mutation_p.V16I|POSTN_ENST00000379743.4_Missense_Mutation_p.V16I|POSTN_ENST00000541179.1_Missense_Mutation_p.V16I|POSTN_ENST00000379749.4_Missense_Mutation_p.V16I|POSTN_ENST00000541481.1_Missense_Mutation_p.V16I	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	16					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		ATAGGGTTAACAATAAGCAGC	0.438																																						dbGAP											0													152.0	143.0	146.0					13																	38172818		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.46G>A	13.37:g.38172818C>T	ENSP00000369071:p.Val16Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.V16I	ENST00000379747.4	37	c.46	CCDS9364.1	13	.	.	.	.	.	.	.	.	.	.	C	7.007	0.555934	0.13436	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.90676	-2.7;-2.7;-2.71;-2.69;-2.7;-2.7	5.7	-0.148	0.13424	.	0.504726	0.22183	N	0.063462	T	0.68577	0.3016	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B;B;B	0.06786	0.0;0.0;0.001;0.001;0.0;0.0;0.001	B;B;B;B;B;B;B	0.12156	0.0;0.001;0.004;0.007;0.001;0.001;0.004	T	0.58165	-0.7684	10	0.17369	T	0.5	.	1.541	0.02555	0.3247:0.3505:0.0935:0.2313	.	16;16;16;16;16;16;16	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	I	16	ENSP00000437959:V16I;ENSP00000369073:V16I;ENSP00000369071:V16I;ENSP00000369067:V16I;ENSP00000369066:V16I;ENSP00000437953:V16I	ENSP00000369066:V16I	V	-	1	0	POSTN	37070818	0.582000	0.26749	0.250000	0.24296	0.357000	0.29423	1.032000	0.30178	0.015000	0.14971	0.650000	0.86243	GTT	POSTN	-	pirsf_TGFb-ind_bIGH3/osteoblast_fac2	ENSG00000133110		0.438	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2	242	0.00	0	C	NM_006475		38172818	38172818	-1	no_errors	ENST00000379747	ensembl	human	known	69_37n	missense	82	41.43	58	SNP	0.134	T
SESN2	83667	genome.wustl.edu	37	1	28598251	28598251	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr1:28598251C>T	ENST00000253063.3	+	3	544	c.223C>T	c.(223-225)Cga>Tga	p.R75*		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	75					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		GTCCTCTGGGCGAGTAGACAA	0.627																																						dbGAP											0													87.0	79.0	82.0					1																	28598251		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.223C>T	1.37:g.28598251C>T	ENSP00000253063:p.Arg75*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7D0|Q96SI5	Nonsense_Mutation	SNP	pfam_PA26	p.R75*	ENST00000253063.3	37	c.223	CCDS321.1	1	.	.	.	.	.	.	.	.	.	.	C	38	7.210178	0.98136	.	.	ENSG00000130766	ENST00000253063	.	.	.	5.08	4.14	0.48551	.	0.059184	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.1949	10.8197	0.46597	0.3427:0.6572:0.0:0.0	.	.	.	.	X	75	.	ENSP00000253063:R75X	R	+	1	2	SESN2	28470838	0.055000	0.20627	0.958000	0.39756	0.974000	0.67602	0.514000	0.22786	1.235000	0.43724	0.655000	0.94253	CGA	SESN2	-	pfam_PA26	ENSG00000130766		0.627	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESN2	HGNC	protein_coding	OTTHUMT00000009840.1	8	0.00	0	C			28598251	28598251	+1	no_errors	ENST00000253063	ensembl	human	known	69_37n	nonsense	19	20.83	5	SNP	0.973	T
TAF1	6872	genome.wustl.edu	37	X	70608656	70608656	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chrX:70608656A>G	ENST00000373790.4	+	17	2686	c.2635A>G	c.(2635-2637)Atg>Gtg	p.M879V	TAF1_ENST00000276072.3_Missense_Mutation_p.M900V|TAF1_ENST00000449580.1_Missense_Mutation_p.M879V|TAF1_ENST00000423759.1_Missense_Mutation_p.M900V	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	879	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GATCAGAGCTATGGTGTCACC	0.458																																						dbGAP											0													169.0	133.0	145.0					X																	70608656		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2635A>G	X.37:g.70608656A>G	ENSP00000362895:p.Met879Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.M879V	ENST00000373790.4	37	c.2635	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	16.28	3.079177	0.55753	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	5.11	5.11	0.69529	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	M	0.91090	3.175	0.80722	D	1	B;B;B	0.21147	0.052;0.036;0.013	B;B;B	0.32583	0.13;0.148;0.062	T	0.22417	-1.0217	10	0.72032	D	0.01	.	14.2044	0.65725	1.0:0.0:0.0:0.0	.	879;879;900	P21675-4;P21675;P21675-2	.;TAF1_HUMAN;.	V	879;879;900;900	ENSP00000362895:M879V;ENSP00000389000:M879V;ENSP00000406549:M900V;ENSP00000276072:M900V	ENSP00000276072:M900V	M	+	1	0	TAF1	70525381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	1.801000	0.52704	0.481000	0.45027	ATG	TAF1	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000147133		0.458	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	222	0.00	0	A	NM_004606		70608656	70608656	+1	no_errors	ENST00000449580	ensembl	human	known	69_37n	missense	30	77.94	106	SNP	1.000	G
TG	7038	genome.wustl.edu	37	8	133899602	133899602	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr8:133899602G>A	ENST00000220616.4	+	9	2025	c.1985G>A	c.(1984-1986)tGt>tAt	p.C662Y	TG_ENST00000377869.1_Missense_Mutation_p.C662Y	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	662	Thyroglobulin type-1 6. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCACAGACTGTGAAAAGCAA	0.557																																						dbGAP											0													60.0	55.0	57.0					8																	133899602		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1985G>A	8.37:g.133899602G>A	ENSP00000220616:p.Cys662Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.C662Y	ENST00000220616.4	37	c.1985	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288965	0.80914	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	D;D	0.87571	-2.27;-2.27	5.56	5.56	0.83823	Thyroglobulin type-1 (5);	0.092423	0.48767	D	0.000173	D	0.95765	0.8622	H	0.95328	3.655	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.96784	0.9577	10	0.87932	D	0	.	18.5144	0.90930	0.0:0.0:1.0:0.0	.	662	P01266	THYG_HUMAN	Y	662	ENSP00000367100:C662Y;ENSP00000220616:C662Y	ENSP00000220616:C662Y	C	+	2	0	TG	133968784	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	9.006000	0.93592	2.613000	0.88420	0.655000	0.94253	TGT	TG	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.557	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	38	0.00	0	G	NM_003235		133899602	133899602	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	70	15.66	13	SNP	1.000	A
TRIM6	117854	genome.wustl.edu	37	11	5632399	5632399	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr11:5632399C>T	ENST00000278302.5	+	8	1434	c.1294C>T	c.(1294-1296)Cgt>Tgt	p.R432C	TRIM6_ENST00000380097.3_Missense_Mutation_p.R460C|TRIM6_ENST00000481603.1_3'UTR|TRIM6-TRIM34_ENST00000354852.5_Intron|TRIM6_ENST00000380107.1_Missense_Mutation_p.R406C|HBG2_ENST00000380259.2_Intron|TRIM6_ENST00000507320.1_Missense_Mutation_p.R257C|TRIM6_ENST00000506134.1_Missense_Mutation_p.R257C|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000445329.1_Missense_Mutation_p.R257C|TRIM6_ENST00000515022.1_Missense_Mutation_p.R257C	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	432	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		GCCCCCTCGCCGTGTTGGGGT	0.458																																						dbGAP											0													138.0	131.0	134.0					11																	5632399		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.1294C>T	11.37:g.5632399C>T	ENSP00000278302:p.Arg432Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R460C	ENST00000278302.5	37	c.1378	CCDS31390.1	11	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189419	0.57909	.	.	ENSG00000121236	ENST00000278302;ENST00000507320;ENST00000380107;ENST00000380097;ENST00000445329;ENST00000396867;ENST00000515022;ENST00000506134	T;T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	3.91	3.91	0.45181	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.82889	0.5135	M	0.85462	2.755	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.79108	0.975;0.992;0.99	D	0.83593	0.0124	9	0.56958	D	0.05	.	9.153	0.36976	0.2172:0.7828:0.0:0.0	.	406;460;432	E9PFM0;Q9C030-2;Q9C030	.;.;TRIM6_HUMAN	C	432;257;406;460;257;339;257;257	ENSP00000278302:R432C;ENSP00000427704:R257C;ENSP00000369450:R406C;ENSP00000369440:R460C;ENSP00000399215:R257C;ENSP00000421802:R257C;ENSP00000421079:R257C	ENSP00000278302:R432C	R	+	1	0	TRIM6	5588975	0.003000	0.15002	0.948000	0.38648	0.921000	0.55340	0.534000	0.23098	2.487000	0.83934	0.313000	0.20887	CGT	TRIM6	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000121236		0.458	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6	HGNC	protein_coding	OTTHUMT00000143376.2	100	0.00	0	C	NM_001003818		5632399	5632399	+1	no_errors	ENST00000380097	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	0.682	T
TUBBP5	643224	genome.wustl.edu	37	9	141071524	141071524	+	RNA	DEL	C	C	-	rs145429844		TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr9:141071524delC	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		TCACGTGTGTCTCAGAGCAGT	0.537																																						dbGAP											0																																										-	-	-			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071524delC		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.537	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	73	0.00	0	C	NR_027156		141071524	141071524	+1	no_errors	ENST00000290377	ensembl	human	known	69_37n	rna	52	11.94	8	DEL	1.000	-
UNC13C	440279	genome.wustl.edu	37	15	54435218	54435218	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr15:54435218G>C	ENST00000260323.11	+	2	2987	c.2987G>C	c.(2986-2988)aGc>aCc	p.S996T	UNC13C_ENST00000537900.1_Missense_Mutation_p.S996T|UNC13C_ENST00000545554.1_Intron	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	996					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTTTCAGATAGCAGTTCTGTG	0.318																																						dbGAP											0													170.0	162.0	164.0					15																	54435218		1817	4081	5898	-	-	-	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2987G>C	15.37:g.54435218G>C	ENSP00000260323:p.Ser996Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.S996T	ENST00000260323.11	37	c.2987	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	12.04	1.820116	0.32145	.	.	ENSG00000137766	ENST00000260323;ENST00000537900	T;T	0.79749	-1.3;-1.3	5.56	4.65	0.58169	.	.	.	.	.	T	0.69387	0.3105	L	0.29908	0.895	0.39127	D	0.961789	B	0.31318	0.319	B	0.27076	0.076	T	0.67821	-0.5571	9	0.30854	T	0.27	.	13.2521	0.60057	0.0764:0.0:0.9236:0.0	.	996	Q8NB66	UN13C_HUMAN	T	996	ENSP00000260323:S996T;ENSP00000442569:S996T	ENSP00000260323:S996T	S	+	2	0	UNC13C	52222510	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.893000	0.63199	1.348000	0.45733	0.585000	0.79938	AGC	UNC13C	-	NULL	ENSG00000137766		0.318	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	415	0.00	0	G	NM_173166		54435218	54435218	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	missense	108	21.74	30	SNP	1.000	C
UNC93A	54346	genome.wustl.edu	37	6	167728785	167728785	+	Missense_Mutation	SNP	G	G	A	rs549125660	byFrequency	TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr6:167728785G>A	ENST00000230256.3	+	8	1394	c.1219G>A	c.(1219-1221)Gtg>Atg	p.V407M	UNC93A_ENST00000366829.2_Missense_Mutation_p.V365M	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	407						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V407M(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GTTTTTGTGCGTGCACGTCAA	0.572													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		16693	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	large_intestine(1)											111.0	159.0	143.0					6																	167728785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.1219G>A	6.37:g.167728785G>A	ENSP00000230256:p.Val407Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.V407M	ENST00000230256.3	37	c.1219	CCDS5300.1	6	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804664	0.31961	.	.	ENSG00000112494	ENST00000230256;ENST00000366829	T;T	0.80909	-1.43;-1.43	3.86	2.99	0.34606	Major facilitator superfamily domain, general substrate transporter (1);	0.153083	0.43919	D	0.000504	T	0.59404	0.2191	M	0.64170	1.965	0.50171	D	0.999856	P;P	0.42337	0.776;0.65	B;B	0.33121	0.158;0.158	T	0.58691	-0.7592	10	0.28530	T	0.3	-35.5019	10.358	0.43975	0.0996:0.0:0.9004:0.0	.	365;407	Q4QQJ4;Q86WB7	.;UN93A_HUMAN	M	407;365	ENSP00000230256:V407M;ENSP00000355794:V365M	ENSP00000230256:V407M	V	+	1	0	UNC93A	167648775	1.000000	0.71417	0.005000	0.12908	0.001000	0.01503	2.401000	0.44513	0.759000	0.33084	0.462000	0.41574	GTG	UNC93A	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000112494		0.572	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC93A	HGNC	protein_coding	OTTHUMT00000043125.2	48	0.00	0	G	NM_018974		167728785	167728785	+1	no_errors	ENST00000230256	ensembl	human	known	69_37n	missense	219	11.69	29	SNP	0.846	A
WNK1	65125	genome.wustl.edu	37	12	970296	970297	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr12:970296_970297insA	ENST00000315939.6	+	7	2381_2382	c.1738_1739insA	c.(1738-1740)gaafs	p.E580fs	WNK1_ENST00000340908.4_Frame_Shift_Ins_p.E173fs|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000530271.2_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000537687.1_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000535572.1_Frame_Shift_Ins_p.E580fs	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	580					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GGAGGAGCAAGAAAAAAAAAAG	0.47																																					Colon(19;451 567 6672 12618 28860)	dbGAP											1	Unknown(1)	skin(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1748dupA	12.37:g.970306_970306dupA	ENSP00000313059:p.Glu580fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K584fs	ENST00000315939.6	37	c.1738_1739	CCDS8506.1	12																																																																																			WNK1	-	NULL	ENSG00000060237		0.470	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	29	0.00	0	-	NM_018979		970296	970297	+1	no_errors	ENST00000530271	ensembl	human	known	69_37n	frame_shift_ins	41	12.77	6	INS	1.000:1.000	A
WRAP53	55135	genome.wustl.edu	37	17	7606441	7606441	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr17:7606441G>C	ENST00000316024.5	+	9	3747	c.1399G>C	c.(1399-1401)Gtg>Ctg	p.V467L	EFNB3_ENST00000226091.2_5'Flank|WRAP53_ENST00000431639.2_Missense_Mutation_p.V467L|WRAP53_ENST00000457584.2_Missense_Mutation_p.V467L|WRAP53_ENST00000396463.2_Missense_Mutation_p.V467L|WRAP53_ENST00000534050.1_Missense_Mutation_p.V434L			Q9BUR4	WAP53_HUMAN	WD repeat containing, antisense to TP53	467					positive regulation of telomerase activity (GO:0051973)|telomere formation via telomerase (GO:0032203)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(2)	18						CACCAATGGCGTGAGGTCCTC	0.592																																						dbGAP											0													49.0	47.0	48.0					17																	7606441		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001247, DQ431240	CCDS11119.1	17p13.1	2014-09-17	2009-02-16	2009-02-16	ENSG00000141499	ENSG00000141499		"""WD repeat domain containing"""	25522	protein-coding gene	gene with protein product	"""telomerase cajal body protein 1"", ""WD-encoding RNA antisense to p53"""	612661	"""WD repeat domain 79"""	WDR79		19179534, 19250907, 19571673, 19342896, 20494116, 21441950	Standard	NM_018081		Approved	FLJ10385, TCAB1	uc010vuh.2	Q9BUR4	OTTHUMG00000134323	ENST00000316024.5:c.1399G>C	17.37:g.7606441G>C	ENSP00000324203:p.Val467Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPR9|D3DTQ4|Q08ET9|Q9NW09	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V467L	ENST00000316024.5	37	c.1399	CCDS11119.1	17	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834667	0.50951	.	.	ENSG00000141499	ENST00000431639;ENST00000316024;ENST00000457584;ENST00000396463;ENST00000534050	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	5.16	3.14	0.36123	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.566887	0.17251	N	0.181157	T	0.54382	0.1855	M	0.74258	2.255	0.45087	D	0.998102	P;P	0.43973	0.823;0.823	B;B	0.33121	0.158;0.158	T	0.61476	-0.7055	10	0.66056	D	0.02	-12.2718	7.8597	0.29504	0.1895:0.0:0.8105:0.0	.	434;467	E9PMG4;Q9BUR4	.;WAP53_HUMAN	L	467;467;467;467;434	ENSP00000397219:V467L;ENSP00000324203:V467L;ENSP00000411061:V467L;ENSP00000379727:V467L;ENSP00000434999:V434L	ENSP00000324203:V467L	V	+	1	0	WRAP53	7547166	0.993000	0.37304	1.000000	0.80357	0.802000	0.45316	1.482000	0.35486	1.428000	0.47296	0.549000	0.68633	GTG	WRAP53	-	superfamily_WD40_repeat_dom	ENSG00000141499		0.592	WRAP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP53	HGNC	protein_coding	OTTHUMT00000259385.2	20	0.00	0	G	NM_018081		7606441	7606441	+1	no_errors	ENST00000316024	ensembl	human	known	69_37n	missense	37	30.19	16	SNP	1.000	C
ZNF320	162967	genome.wustl.edu	37	19	53385122	53385122	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr19:53385122C>G	ENST00000595635.1	-	8	758	c.257G>C	c.(256-258)tGc>tCc	p.C86S	ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.C86S|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TTCCTGGGAGCAAAATGCTCC	0.403																																						dbGAP											0													145.0	144.0	144.0					19																	53385122		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.257G>C	19.37:g.53385122C>G	ENSP00000473091:p.Cys86Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDR6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C86S	ENST00000595635.1	37	c.257	CCDS33095.1	19	.	.	.	.	.	.	.	.	.	.	-	0.086	-1.174544	0.01646	.	.	ENSG00000182986	ENST00000391781	T	0.06528	3.29	1.41	-2.82	0.05787	.	.	.	.	.	T	0.05547	0.0146	M	0.65975	2.015	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.49380	-0.8946	9	0.15952	T	0.53	.	0.0493	0.00011	0.2631:0.1881:0.2342:0.3146	.	86	A2RRD8	ZN320_HUMAN	S	86	ENSP00000375660:C86S	ENSP00000375660:C86S	C	-	2	0	ZNF320	58076934	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-3.057000	0.00625	-2.488000	0.00518	0.184000	0.17185	TGC	ZNF320	-	NULL	ENSG00000182986		0.403	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF320	HGNC	protein_coding	OTTHUMT00000463771.1	154	0.00	0	C	NM_207333		53385122	53385122	-1	no_errors	ENST00000391781	ensembl	human	known	69_37n	missense	102	16.39	20	SNP	0.000	G
ZXDC	79364	genome.wustl.edu	37	3	126180635	126180635	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A12F-01A-11D-A10Y-09	TCGA-AO-A12F-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1617673-57c2-40c1-a970-f3692ee13cf3	be77b3ee-bdc2-4208-8894-af0e15e43af0	g.chr3:126180635G>T	ENST00000389709.3	-	6	1923	c.1870C>A	c.(1870-1872)Cca>Aca	p.P624T	ZXDC_ENST00000336332.5_Missense_Mutation_p.P624T	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	624	Required for transcriptional activation.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		AAAGCCAGTGGGTCGTCACTC	0.557																																						dbGAP											0													114.0	121.0	119.0					3																	126180635		2179	4263	6442	-	-	-	SO:0001583	missense	0			AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.1870C>A	3.37:g.126180635G>T	ENSP00000374359:p.Pro624Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P624T	ENST00000389709.3	37	c.1870	CCDS43145.1	3	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845194	0.32606	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.09163	3.01;3.01	5.26	3.05	0.35203	.	1.056680	0.07292	N	0.872663	T	0.11750	0.0286	L	0.58101	1.795	0.28040	N	0.933772	B;B	0.32753	0.383;0.264	B;B	0.29785	0.107;0.072	T	0.31943	-0.9925	10	0.42905	T	0.14	.	4.4857	0.11788	0.1325:0.0:0.5124:0.3551	.	624;624	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	T	624	ENSP00000374359:P624T;ENSP00000337694:P624T	ENSP00000337694:P624T	P	-	1	0	ZXDC	127663325	0.392000	0.25229	0.553000	0.28255	0.613000	0.37349	0.835000	0.27531	0.453000	0.26858	0.591000	0.81541	CCA	ZXDC	-	NULL	ENSG00000070476		0.557	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZXDC	HGNC	protein_coding	OTTHUMT00000370327.2	38	0.00	0	G	NM_025112		126180635	126180635	-1	no_errors	ENST00000389709	ensembl	human	known	69_37n	missense	79	24.04	25	SNP	0.958	T
