#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADGB	79747	genome.wustl.edu	37	6	147073842	147073842	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr6:147073842G>A	ENST00000397944.3	+	27	3618	c.3542G>A	c.(3541-3543)aGc>aAc	p.S1181N	ADGB_ENST00000367493.3_Missense_Mutation_p.S600N	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1181					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AAAGGTTTGAGCTCCCAGTGT	0.363																																						dbGAP											0													72.0	57.0	62.0					6																	147073842		692	1591	2283	-	-	-	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.3542G>A	6.37:g.147073842G>A	ENSP00000381036:p.Ser1181Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.S1181N	ENST00000397944.3	37	c.3542		6	.	.	.	.	.	.	.	.	.	.	G	18.52	3.640756	0.67244	.	.	ENSG00000118492	ENST00000397944;ENST00000367493;ENST00000367490	T;T	0.47869	1.36;0.83	4.99	4.99	0.66335	.	.	.	.	.	T	0.31765	0.0807	M	0.68317	2.08	0.39019	D	0.959714	B;B	0.33103	0.397;0.136	B;B	0.24974	0.057;0.028	T	0.23084	-1.0198	9	0.29301	T	0.29	.	17.2825	0.87132	0.0:0.0:1.0:0.0	.	1181;230	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	N	1181;600;243	ENSP00000381036:S1181N;ENSP00000356460:S243N	ENSP00000356460:S243N	S	+	2	0	C6orf103	147115535	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	4.929000	0.63455	2.312000	0.78011	0.557000	0.71058	AGC	ADGB	-	NULL	ENSG00000118492		0.363	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	116	0.00	0	G	NM_024694		147073842	147073842	+1	no_errors	ENST00000397944	ensembl	human	known	69_37n	missense	77	35.83	43	SNP	1.000	A
CAPRIN1	4076	genome.wustl.edu	37	11	34113522	34113522	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr11:34113522C>G	ENST00000341394.4	+	15	1813	c.1624C>G	c.(1624-1626)Cag>Gag	p.Q542E	CAPRIN1_ENST00000529307.1_Missense_Mutation_p.Q461E|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.Q542E|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.Q542E|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.Q542E|CAPRIN1_ENST00000533657.1_3'UTR	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	542					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AAATCAGTACCAGGCCAGTTA	0.393																																						dbGAP											0													84.0	83.0	83.0					11																	34113522		2202	4298	6500	-	-	-	SO:0001583	missense	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1624C>G	11.37:g.34113522C>G	ENSP00000340329:p.Gln542Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	pfam_Caprin-1_C	p.Q542E	ENST00000341394.4	37	c.1624	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	C	26.5	4.748128	0.89663	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.42921	0.1224	M	0.63428	1.95	0.58432	D	0.999999	D;D	0.56746	0.977;0.971	P;P	0.57152	0.814;0.717	T	0.09707	-1.0662	10	0.13470	T	0.59	.	19.7408	0.96230	0.0:1.0:0.0:0.0	.	542;542	Q14444;Q14444-2	CAPR1_HUMAN;.	E	542;542;542;542;461	ENSP00000340329:Q542E;ENSP00000374296:Q542E;ENSP00000434150:Q542E;ENSP00000434204:Q542E;ENSP00000431581:Q461E	ENSP00000340329:Q542E	Q	+	1	0	CAPRIN1	34070098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.481000	0.81124	2.671000	0.90904	0.650000	0.86243	CAG	CAPRIN1	-	pfam_Caprin-1_C	ENSG00000135387		0.393	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	160	0.00	0	C	NM_005898		34113522	34113522	+1	no_errors	ENST00000341394	ensembl	human	known	69_37n	missense	112	39.25	73	SNP	1.000	G
CROCCP2	84809	genome.wustl.edu	37	1	16950783	16950783	+	lincRNA	SNP	T	T	A	rs2246249	byFrequency	TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr1:16950783T>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GTGTGTGGCCTCCTCTGACAC	0.706													.|||	770	0.153754	0.1225	0.2378	5008	,	,		60533	0.0129		0.1918	False		,,,				2504	0.2423					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950783T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.706	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	T	NR_026752.1		16950783	16950783	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	21	19.23	5	SNP	0.983	A
DCAF12L2	340578	genome.wustl.edu	37	X	125299410	125299410	+	Silent	SNP	G	G	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chrX:125299410G>A	ENST00000360028.2	-	1	524	c.498C>T	c.(496-498)acC>acT	p.T166T	DCAF12L2_ENST00000538699.1_Silent_p.T166T			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	166										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TTTCGCCGCCGGTGGCCAGAA	0.677																																						dbGAP											0													66.0	73.0	70.0					X																	125299410		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.498C>T	X.37:g.125299410G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN42	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T166	ENST00000360028.2	37	c.498	CCDS43991.1	X																																																																																			DCAF12L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198354		0.677	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	17	0.00	0	G	NM_001013628		125299410	125299410	-1	no_errors	ENST00000360028	ensembl	human	known	69_37n	silent	85	39.29	55	SNP	0.039	A
DIP2B	57609	genome.wustl.edu	37	12	51133229	51133229	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr12:51133229A>C	ENST00000301180.5	+	36	4248	c.4214A>C	c.(4213-4215)tAc>tCc	p.Y1405S		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1405						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						AGCGGCTACTACACCATCTAT	0.473																																						dbGAP											0													131.0	112.0	118.0					12																	51133229		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.4214A>C	12.37:g.51133229A>C	ENSP00000301180:p.Tyr1405Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.Y1405S	ENST00000301180.5	37	c.4214	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	A	26.0	4.692849	0.88735	.	.	ENSG00000066084	ENST00000301180	T	0.48522	0.81	5.21	5.21	0.72293	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.61924	0.2386	L	0.55990	1.75	0.80722	D	1	D	0.57571	0.98	P	0.62740	0.906	T	0.65059	-0.6260	10	0.72032	D	0.01	-12.5456	14.9078	0.70733	1.0:0.0:0.0:0.0	.	1405	Q9P265	DIP2B_HUMAN	S	1405	ENSP00000301180:Y1405S	ENSP00000301180:Y1405S	Y	+	2	0	DIP2B	49419496	1.000000	0.71417	0.991000	0.47740	0.987000	0.75469	9.087000	0.94110	2.193000	0.70182	0.402000	0.26972	TAC	DIP2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066084		0.473	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	88	0.00	0	A	NM_173602		51133229	51133229	+1	no_errors	ENST00000301180	ensembl	human	known	69_37n	missense	89	47.95	82	SNP	1.000	C
DNAH11	8701	genome.wustl.edu	37	7	21639512	21639512	+	Silent	SNP	C	C	T			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr7:21639512C>T	ENST00000409508.3	+	15	2806	c.2775C>T	c.(2773-2775)caC>caT	p.H925H	DNAH11_ENST00000328843.6_Silent_p.H925H	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	925	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H925H(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CTATAATGCACGACTTAGACT	0.398									Kartagener syndrome																													dbGAP											1	Substitution - coding silent(1)	kidney(1)											88.0	82.0	84.0					7																	21639512		1847	4089	5936	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.2775C>T	7.37:g.21639512C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.H925	ENST00000409508.3	37	c.2775		7																																																																																			DNAH11	-	NULL	ENSG00000105877		0.398	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	271	0.00	0	C	NM_003777		21639512	21639512	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	silent	163	36.08	92	SNP	0.995	T
ERC1	23085	genome.wustl.edu	37	12	1289751	1289751	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr12:1289751A>T	ENST00000397203.2	+	9	2189	c.1783A>T	c.(1783-1785)Agc>Tgc	p.S595C	ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000355446.5_Missense_Mutation_p.S595C|ERC1_ENST00000546231.2_Missense_Mutation_p.S595C|ERC1_ENST00000543086.3_Missense_Mutation_p.S567C|ERC1_ENST00000360905.4_Missense_Mutation_p.S595C|ERC1_ENST00000589028.1_Missense_Mutation_p.S595C			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	595					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			AAAGCAGATGAGCAGCTTGAA	0.413																																						dbGAP											0													113.0	106.0	109.0					12																	1289751		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.1783A>T	12.37:g.1289751A>T	ENSP00000380386:p.Ser595Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,pfam_Rab-bd_FIP-RBD,superfamily_Prefoldin	p.S595C	ENST00000397203.2	37	c.1783	CCDS8508.1	12	.	.	.	.	.	.	.	.	.	.	A	21.1	4.099611	0.76983	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971;ENST00000536573	T;T;D;T;D;T;T;D	0.83335	0.83;-1.17;-1.71;-1.19;-1.71;-1.17;-1.17;-1.71	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.88937	0.6573	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D	0.69078	0.995;0.98;0.997;0.997;0.984	P;P;P;P;D	0.64506	0.879;0.879;0.891;0.9;0.926	D	0.89652	0.3870	10	0.66056	D	0.02	-5.564	16.4075	0.83691	1.0:0.0:0.0:0.0	.	343;235;567;567;595	F5H327;F5GZU8;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;.;RB6I2_HUMAN	C	567;595;567;567;295;567;567;295;595;595;595;567;343;235	ENSP00000340054:S567C;ENSP00000380386:S595C;ENSP00000438546:S567C;ENSP00000442976:S295C;ENSP00000442739:S595C;ENSP00000347621:S595C;ENSP00000354158:S595C;ENSP00000410064:S567C	ENSP00000299183:S295C	S	+	1	0	ERC1	1160012	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.701000	0.54793	2.275000	0.75901	0.528000	0.53228	AGC	ERC1	-	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	ENSG00000082805		0.413	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC1	HGNC	protein_coding	OTTHUMT00000398380.2	124	0.00	0	A	NM_015064		1289751	1289751	+1	no_errors	ENST00000360905	ensembl	human	known	69_37n	missense	128	28.89	52	SNP	1.000	T
DPPA3	359787	genome.wustl.edu	37	12	7867799	7867799	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr12:7867799G>A	ENST00000345088.2	+	2	220	c.103G>A	c.(103-105)Gag>Aag	p.E35K		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	35					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		AATCTCCTCCGAGACGTTGAT	0.458																																						dbGAP											0													112.0	124.0	120.0					12																	7867799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.103G>A	12.37:g.7867799G>A	ENSP00000339250:p.Glu35Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P5U3|Q6JZS6	Missense_Mutation	SNP	NULL	p.E35K	ENST00000345088.2	37	c.103	CCDS8582.1	12	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708896	0.30322	.	.	ENSG00000187569	ENST00000345088	T	0.58358	0.34	2.61	2.61	0.31194	.	.	.	.	.	T	0.59797	0.2220	L	0.36672	1.1	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.43877	-0.9364	9	0.59425	D	0.04	-20.6076	8.8815	0.35378	0.0:0.0:1.0:0.0	.	35	Q6W0C5	DPPA3_HUMAN	K	35	ENSP00000339250:E35K	ENSP00000339250:E35K	E	+	1	0	DPPA3	7759066	0.011000	0.17503	0.026000	0.17262	0.002000	0.02628	0.952000	0.29149	1.801000	0.52704	0.561000	0.74099	GAG	DPPA3	-	NULL	ENSG00000187569		0.458	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA3	HGNC	protein_coding	OTTHUMT00000399718.1	158	0.00	0	G	NM_199286		7867799	7867799	+1	no_errors	ENST00000345088	ensembl	human	known	69_37n	missense	118	36.56	68	SNP	0.028	A
FOXD4L5	653427	genome.wustl.edu	37	9	70177977	70177977	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr9:70177977G>T	ENST00000377420.1	-	1	838	c.7C>A	c.(7-9)Ctg>Atg	p.L3M		NM_001126334.1	NP_001119806.1	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	3					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|lung(2)	7						GCTCTTGGCAGGTTCATGGAG	0.622																																						dbGAP											0													1.0	1.0	1.0					9																	70177977		184	435	619	-	-	-	SO:0001583	missense	0				CCDS47977.1	9q13	2008-07-21			ENSG00000204779	ENSG00000204779			18522	protein-coding gene	gene with protein product						12234674	Standard	NM_001126334		Approved	bA15J10.2, OTTHUMG00000013332	uc010moc.3	Q5VV16	OTTHUMG00000013332	ENST00000377420.1:c.7C>A	9.37:g.70177977G>T	ENSP00000366637:p.Leu3Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L3M	ENST00000377420.1	37	c.7	CCDS47977.1	9	.	.	.	.	.	.	.	.	.	.	g	8.641	0.896043	0.17686	.	.	ENSG00000204779	ENST00000377420	D	0.95238	-3.65	.	.	.	.	0.319884	0.16365	U	0.217577	D	0.87775	0.6262	L	0.27053	0.805	0.20821	N	0.999844	P	0.44578	0.838	B	0.41813	0.367	T	0.81019	-0.1122	9	0.87932	D	0	.	4.9608	0.14065	0.2661:0.0:0.7339:0.0	.	3	Q5VV16	FX4L5_HUMAN	M	3	ENSP00000366637:L3M	ENSP00000366637:L3M	L	-	1	2	FOXD4L5	69467797	0.001000	0.12720	0.515000	0.27774	0.000000	0.00434	0.010000	0.13242	-0.373000	0.07979	0.000000	0.15137	CTG	FOXD4L5	-	NULL	ENSG00000204779		0.622	FOXD4L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L5	HGNC	protein_coding	OTTHUMT00000037122.1	8	0.00	0	G	NM_001126334		70177977	70177977	-1	no_errors	ENST00000377420	ensembl	human	known	69_37n	missense	17	50.00	17	SNP	0.998	T
GOLGA6L6	727832	genome.wustl.edu	37	15	20739872	20739874	+	In_Frame_Del	DEL	CTC	CTC	-	rs59357493		TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr15:20739872_20739874delCTC	ENST00000427390.2	-	8	1966_1968	c.1876_1878delGAG	c.(1876-1878)gagdel	p.E626del		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	626	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						cccgtatcttctcctcctgctcc	0.552																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1876_1878delGAG	15.37:g.20739875_20739877delCTC	ENSP00000398615:p.Glu626del	Somatic		WXS	Illumina GAIIx	Phase_IV	D3YTC0	In_Frame_Del	DEL	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.E626in_frame_del	ENST00000427390.2	37	c.1878_1876	CCDS45184.1	15																																																																																			GOLGA6L6	-	NULL	ENSG00000215405		0.552	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	HGNC	protein_coding	OTTHUMT00000414660.3	47	0.00	0	CTC	NM_001145004		20739872	20739874	-1	no_errors	ENST00000427390	ensembl	human	known	69_37n	in_frame_del	11	38.89	7	DEL	0.974:0.984:0.988	-
KDM4D	55693	genome.wustl.edu	37	11	94730906	94730906	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr11:94730906A>T	ENST00000335080.5	+	3	1202	c.370A>T	c.(370-372)Aaa>Taa	p.K124*	KDM4D_ENST00000536741.1_Nonsense_Mutation_p.K124*	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	124					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TTTGGAGCGAAAATACTGGAA	0.408																																						dbGAP											0													91.0	89.0	90.0					11																	94730906		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.370A>T	11.37:g.94730906A>T	ENSP00000334181:p.Lys124*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPC4|Q0VF39|Q9NT41|Q9NW76	Nonsense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,smart_TF_JmjN,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom	p.K124*	ENST00000335080.5	37	c.370	CCDS8302.1	11	.	.	.	.	.	.	.	.	.	.	A	42	9.354595	0.99147	.	.	ENSG00000186280	ENST00000335080	.	.	.	3.91	1.45	0.22620	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.0775	9.271	0.37670	0.6513:0.3486:0.0:0.0	.	.	.	.	X	124	.	ENSP00000334181:K124X	K	+	1	0	KDM4D	94370554	1.000000	0.71417	0.004000	0.12327	0.835000	0.47333	5.498000	0.66931	0.290000	0.22444	0.460000	0.39030	AAA	KDM4D	-	NULL	ENSG00000186280		0.408	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4D	HGNC	protein_coding	OTTHUMT00000396558.2	81	0.00	0	A	NM_018039		94730906	94730906	+1	no_errors	ENST00000335080	ensembl	human	known	69_37n	nonsense	67	36.19	38	SNP	0.770	T
MINK1	50488	genome.wustl.edu	37	17	4788835	4788835	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr17:4788835T>A	ENST00000355280.6	+	7	762	c.566T>A	c.(565-567)aTt>aAt	p.I189N	RN7SL784P_ENST00000577319.1_RNA|MINK1_ENST00000347992.7_Missense_Mutation_p.I189N|MINK1_ENST00000453408.3_Missense_Mutation_p.I189N	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						AACACTTTCATTGGGACTCCC	0.562																																						dbGAP											0													106.0	112.0	110.0					17																	4788835		2080	4197	6277	-	-	-	SO:0001583	missense	0			AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.566T>A	17.37:g.4788835T>A	ENSP00000347427:p.Ile189Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.I189N	ENST00000355280.6	37	c.566	CCDS45588.1	17	.	.	.	.	.	.	.	.	.	.	T	28.8	4.950921	0.92660	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.65916	-0.18;-0.18;-0.18	5.54	5.54	0.83059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74543	0.3730	L	0.54965	1.715	0.80722	D	1	D;D;D;D	0.62365	0.988;0.988;0.991;0.988	D;D;D;D	0.78314	0.984;0.984;0.991;0.984	T	0.76854	-0.2805	10	0.87932	D	0	.	13.6804	0.62481	0.0:0.0:0.0:1.0	.	189;189;189;189	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	N	189	ENSP00000347427:I189N;ENSP00000406487:I189N;ENSP00000269296:I189N	ENSP00000269296:I189N	I	+	2	0	MINK1	4729618	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.326000	0.78906	0.533000	0.62120	ATT	MINK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000141503		0.562	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000439801.1	118	0.00	0	T	NM_015716		4788835	4788835	+1	no_errors	ENST00000355280	ensembl	human	known	69_37n	missense	116	36.90	69	SNP	1.000	A
NF1	4763	genome.wustl.edu	37	17	29562668	29562668	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr17:29562668C>T	ENST00000358273.4	+	28	4131	c.3748C>T	c.(3748-3750)Cgg>Tgg	p.R1250W	NF1_ENST00000356175.3_Missense_Mutation_p.R1250W	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1250	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.		R -> P (in NF1; dbSNP:rs199474765). {ECO:0000269|PubMed:10712197}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.S1249fs*8(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTTTGATTCTCGGCATTTACT	0.418			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(4)|Deletion - Frameshift(1)	soft_tissue(8)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)											227.0	221.0	223.0					17																	29562668		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3748C>T	17.37:g.29562668C>T	ENSP00000351015:p.Arg1250Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.R1250W	ENST00000358273.4	37	c.3748	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605237	0.87157	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.83419	-1.72;-1.72;-1.72	5.79	5.79	0.91817	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (2);	0.061907	0.64402	D	0.000004	D	0.90566	0.7043	M	0.76328	2.33	0.80722	D	1	D;D;D;D	0.89917	0.999;0.994;1.0;1.0	D;P;D;D	0.79108	0.937;0.698;0.992;0.973	D	0.91139	0.4944	10	0.87932	D	0	.	15.6175	0.76778	0.138:0.862:0.0:0.0	.	1250;300;1250;1250	E1P657;Q59FX3;P21359-2;P21359	.;.;.;NF1_HUMAN	W	1250;1250;916	ENSP00000351015:R1250W;ENSP00000348498:R1250W;ENSP00000389907:R916W	ENSP00000348498:R1250W	R	+	1	2	NF1	26586794	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.501000	0.53325	2.753000	0.94483	0.555000	0.69702	CGG	NF1	-	superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,smart_RasGAP,pfscan_RasGAP	ENSG00000196712		0.418	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	224	0.00	0	C	NM_000267		29562668	29562668	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	missense	187	30.74	83	SNP	1.000	T
PHLPP2	23035	genome.wustl.edu	37	16	71701217	71701217	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr16:71701217G>A	ENST00000568954.1	-	12	2026	c.1648C>T	c.(1648-1650)Ctt>Ttt	p.L550F	RNU6-208P_ENST00000362431.1_RNA|PHLPP2_ENST00000360429.3_Missense_Mutation_p.L550F|PHLPP2_ENST00000356272.3_Missense_Mutation_p.L550F|PHLPP2_ENST00000567016.1_Missense_Mutation_p.L585F|PHLPP2_ENST00000393524.2_Missense_Mutation_p.L550F			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	550					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						AGTTTTCTAAGACTCAAGCTA	0.428																																						dbGAP											0													83.0	73.0	77.0					16																	71701217		2198	4300	6498	-	-	-	SO:0001583	missense	0			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.1648C>T	16.37:g.71701217G>A	ENSP00000457991:p.Leu550Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	pfam_PP2C-like,pfam_Leu-rich_rpt,superfamily_PP2C-like,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like	p.L550F	ENST00000568954.1	37	c.1648	CCDS32479.1	16	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753922	0.69648	.	.	ENSG00000040199	ENST00000299971;ENST00000360429;ENST00000356272;ENST00000393524	T;T;T	0.70282	-0.47;-0.08;-0.04	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.90981	0.7164	H	0.98351	4.21	0.54753	D	0.999982	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	D	0.94074	0.7338	10	0.87932	D	0	-13.2395	18.8158	0.92076	0.0:0.0:1.0:0.0	.	550;550	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	F	357;550;550;550	ENSP00000353610:L550F;ENSP00000348611:L550F;ENSP00000377159:L550F	ENSP00000299971:L357F	L	-	1	0	PHLPP2	70258718	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.562000	0.67346	2.697000	0.92050	0.585000	0.79938	CTT	PHLPP2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000040199		0.428	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHLPP2	HGNC	protein_coding	OTTHUMT00000434139.1	72	0.00	0	G	NM_015020		71701217	71701217	-1	no_errors	ENST00000356272	ensembl	human	known	69_37n	missense	112	11.11	14	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	34078003	34078003	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr15:34078003A>G	ENST00000389232.4	+	66	9479	c.9409A>G	c.(9409-9411)Atg>Gtg	p.M3137V	RYR3_ENST00000415757.3_Missense_Mutation_p.M3137V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3137					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GATCTTACCCATGCTCTGCAA	0.597																																						dbGAP											0													164.0	181.0	175.0					15																	34078003		2178	4287	6465	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9409A>G	15.37:g.34078003A>G	ENSP00000373884:p.Met3137Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.M3137V	ENST00000389232.4	37	c.9409	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	A	16.06	3.014403	0.54468	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.64260	-0.09;-0.09	5.13	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.70369	0.3216	M	0.78916	2.43	0.51767	D	0.999933	B;P	0.50443	0.119;0.935	B;P	0.52309	0.067;0.695	T	0.72164	-0.4373	10	0.49607	T	0.09	.	11.0756	0.48030	0.9274:0.0:0.0726:0.0	.	3137;3137	Q15413-2;Q15413	.;RYR3_HUMAN	V	3137	ENSP00000373884:M3137V;ENSP00000399610:M3137V	ENSP00000354735:M3137V	M	+	1	0	RYR3	31865295	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.087000	0.94110	1.082000	0.41137	0.533000	0.62120	ATG	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.597	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	40	0.00	0	A			34078003	34078003	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	76	36.67	44	SNP	1.000	G
SALL1	6299	genome.wustl.edu	37	16	51175176	51175176	+	Silent	SNP	G	G	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr16:51175176G>A	ENST00000251020.4	-	2	990	c.957C>T	c.(955-957)atC>atT	p.I319I	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.I222I|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	319					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAGGTAGCTGGATTGGGGGTA	0.542																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													118.0	120.0	119.0					16																	51175176		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.957C>T	16.37:g.51175176G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q99881|Q9NSC3|Q9P1R0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I319	ENST00000251020.4	37	c.957	CCDS10747.1	16																																																																																			SALL1	-	NULL	ENSG00000103449		0.542	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	64	0.00	0	G	NM_002968		51175176	51175176	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	silent	109	30.57	48	SNP	0.681	A
SLFN5	162394	genome.wustl.edu	37	17	33592829	33592829	+	Silent	SNP	G	G	A	rs199777740		TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr17:33592829G>A	ENST00000299977.4	+	5	2746	c.2598G>A	c.(2596-2598)ccG>ccA	p.P866P	SLFN5_ENST00000542451.1_3'UTR	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	866					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		TAGCCCCACCGGCTGGGGCCT	0.468																																						dbGAP											0													60.0	65.0	63.0					17																	33592829		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.2598G>A	17.37:g.33592829G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AF2|Q8WU54|Q96A82	Silent	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.P866	ENST00000299977.4	37	c.2598	CCDS32619.1	17																																																																																			SLFN5	-	NULL	ENSG00000166750		0.468	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN5	HGNC	protein_coding	OTTHUMT00000448649.2	42	0.00	0	G	NM_144975		33592829	33592829	+1	no_errors	ENST00000299977	ensembl	human	known	69_37n	silent	48	36.00	27	SNP	0.000	A
SRRD	402055	genome.wustl.edu	37	22	26884108	26884108	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr22:26884108G>A	ENST00000215917.7	+	3	378	c.364G>A	c.(364-366)Gtg>Atg	p.V122M		NM_001013694.2	NP_001013716.2	Q9UH36	SRR1L_HUMAN	SRR1 domain containing	122					rhythmic process (GO:0048511)					endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						GGAGTCAGATGTGGCCACTGA	0.488																																						dbGAP											0													105.0	103.0	104.0					22																	26884108		1991	4185	6176	-	-	-	SO:0001583	missense	0			BC066962	CCDS42995.1	22q12.1	2008-10-31			ENSG00000100104	ENSG00000100104			33910	protein-coding gene	gene with protein product	"""hepatocellular carcinoma complicating hemochromatosis"""	602254					Standard	NM_001013694		Approved	HC/HCC, SRR1L	uc010gve.3	Q9UH36	OTTHUMG00000150885	ENST00000215917.7:c.364G>A	22.37:g.26884108G>A	ENSP00000215917:p.Val122Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NXP8	Missense_Mutation	SNP	pfam_SRR1-like	p.V122M	ENST00000215917.7	37	c.364	CCDS42995.1	22	.	.	.	.	.	.	.	.	.	.	G	13.22	2.170706	0.38315	.	.	ENSG00000100104	ENST00000215917	T	0.51071	0.72	4.03	0.737	0.18314	.	1.227210	0.06019	N	0.651028	T	0.44664	0.1304	L	0.46157	1.445	0.09310	N	1	B;D	0.56968	0.131;0.978	B;P	0.49012	0.023;0.598	T	0.26677	-1.0096	10	0.33940	T	0.23	-5.6072	3.3175	0.07039	0.2221:0.0:0.5738:0.2041	.	122;115	Q9UH36;B4DF37	SRR1L_HUMAN;.	M	122	ENSP00000215917:V122M	ENSP00000215917:V122M	V	+	1	0	SRRD	25214108	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.845000	0.27668	0.046000	0.15833	-0.140000	0.14226	GTG	SRRD	-	NULL	ENSG00000100104		0.488	SRRD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRD	HGNC	protein_coding	OTTHUMT00000320423.2	104	0.00	0	G	NM_001013694		26884108	26884108	+1	no_errors	ENST00000215917	ensembl	human	known	69_37n	missense	130	40.64	89	SNP	0.000	A
SWT1	54823	genome.wustl.edu	37	1	185153956	185153956	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr1:185153956G>A	ENST00000367500.4	+	9	1487	c.1322G>A	c.(1321-1323)cGt>cAt	p.R441H	SWT1_ENST00000367501.3_Missense_Mutation_p.R441H	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	441	PINc.									breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						CTACTAAAACGTGCCCAGCAC	0.373																																						dbGAP											0													124.0	121.0	122.0					1																	185153956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.1322G>A	1.37:g.185153956G>A	ENSP00000356470:p.Arg441His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	smart_PINc_nuc-bd	p.R441H	ENST00000367500.4	37	c.1322	CCDS1367.1	1	.	.	.	.	.	.	.	.	.	.	G	1.813	-0.474256	0.04414	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.17054	2.3;2.3	5.34	2.97	0.34412	Nucleotide binding protein, PINc (1);	0.337832	0.31821	N	0.007015	T	0.04137	0.0115	N	0.01048	-1.04	0.20563	N	0.999882	B	0.02656	0.0	B	0.01281	0.0	T	0.44065	-0.9352	10	0.02654	T	1	.	8.6804	0.34205	0.8472:0.0:0.1528:0.0	.	441	Q5T5J6	SWT1_HUMAN	H	441	ENSP00000356471:R441H;ENSP00000356470:R441H	ENSP00000356470:R441H	R	+	2	0	SWT1	183420579	1.000000	0.71417	0.966000	0.40874	0.737000	0.42083	4.156000	0.58138	0.323000	0.23307	-0.350000	0.07774	CGT	SWT1	-	smart_PINc_nuc-bd	ENSG00000116668		0.373	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWT1	HGNC	protein_coding	OTTHUMT00000085790.1	176	0.56	1	G	NM_017673		185153956	185153956	+1	no_errors	ENST00000367500	ensembl	human	known	69_37n	missense	91	47.40	82	SNP	0.873	A
USP9X	8239	genome.wustl.edu	37	X	41084197	41084198	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chrX:41084197_41084198insA	ENST00000324545.8	+	40	7587_7588	c.6954_6955insA	c.(6955-6957)agtfs	p.S2319fs	USP9X_ENST00000378308.2_Frame_Shift_Ins_p.S2319fs	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2319					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CTACTGTCCTCAGTGAACTTCT	0.351																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.6955dupA	X.37:g.41084198_41084198dupA	ENSP00000316357:p.Ser2319fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Frame_Shift_Ins	INS	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.S2318fs	ENST00000324545.8	37	c.6954_6955	CCDS43930.1	X																																																																																			USP9X	-	NULL	ENSG00000124486		0.351	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	354	0.00	0	-	NM_004652		41084197	41084198	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	frame_shift_ins	210	38.24	130	INS	1.000:1.000	A
WDR26	80232	genome.wustl.edu	37	1	224607232	224607232	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A12H-01A-11D-A10Y-09	TCGA-AO-A12H-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5a535c49-d42e-43c6-9d32-dc76f28d4f0f	ef348ec7-f3d5-41d6-af09-65f81ebd2b46	g.chr1:224607232C>A	ENST00000414423.2	-	5	1043	c.850G>T	c.(850-852)Gat>Tat	p.D284Y	WDR26_ENST00000295024.6_Missense_Mutation_p.D137Y|WDR26_ENST00000366852.2_3'UTR	NM_001115113.2|NM_025160.6	NP_001108585.2|NP_079436.4	Q9H7D7	WDR26_HUMAN	WD repeat domain 26	284						cytoplasm (GO:0005737)|nucleus (GO:0005634)				biliary_tract(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	18				GBM - Glioblastoma multiforme(131;0.0104)		TGAAGTTTATCCAATAGTTTA	0.378																																						dbGAP											0													118.0	105.0	110.0					1																	224607232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024669	CCDS31037.1, CCDS31037.2	1q42.13	2013-01-09			ENSG00000162923	ENSG00000162923		"""WD repeat domain containing"""	21208	protein-coding gene	gene with protein product	"""GID complex subunit 7 homolog (S. cerevisiae)"""						Standard	NM_001115113		Approved	FLJ21016, GID7	uc001hop.4	Q9H7D7	OTTHUMG00000037636	ENST00000414423.2:c.850G>T	1.37:g.224607232C>A	ENSP00000408108:p.Asp284Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0MNN3|Q4G100|Q59EC4|Q5GLZ9|Q86UY4|Q9H3C2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D284Y	ENST00000414423.2	37	c.850	CCDS31037.2	1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573979	0.86542	.	.	ENSG00000162923	ENST00000414423;ENST00000295024	T;T	0.69806	-0.43;-0.16	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.83280	0.5220	M	0.80616	2.505	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72075	0.962;0.976	D	0.84102	0.0396	10	0.56958	D	0.05	.	19.6702	0.95909	0.0:1.0:0.0:0.0	.	284;268	Q9H7D7;Q9H7D7-2	WDR26_HUMAN;.	Y	284;137	ENSP00000408108:D284Y;ENSP00000295024:D137Y	ENSP00000295024:D137Y	D	-	1	0	WDR26	222673855	1.000000	0.71417	0.980000	0.43619	0.657000	0.38888	7.818000	0.86416	2.664000	0.90586	0.655000	0.94253	GAT	WDR26	-	NULL	ENSG00000162923		0.378	WDR26-001	KNOWN	basic|CCDS	protein_coding	WDR26	HGNC	protein_coding	OTTHUMT00000091760.2	214	0.47	1	C	NM_025160		224607232	224607232	-1	no_errors	ENST00000414423	ensembl	human	known	69_37n	missense	123	43.12	94	SNP	1.000	A
