#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AFF3	3899	genome.wustl.edu	37	2	100170901	100170901	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr2:100170901G>A	ENST00000409236.2	-	22	3543	c.3431C>T	c.(3430-3432)cCg>cTg	p.P1144L	AFF3_ENST00000356421.2_Missense_Mutation_p.P1169L|AFF3_ENST00000317233.4_Missense_Mutation_p.P1144L|AFF3_ENST00000409579.1_Missense_Mutation_p.P1169L			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	1144					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GATGGTCGACGGGGACAGGGC	0.642																																						dbGAP											0													89.0	80.0	83.0					2																	100170901		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.3431C>T	2.37:g.100170901G>A	ENSP00000387207:p.Pro1144Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P1169L	ENST00000409236.2	37	c.3506	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376940	0.82682	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000445815	T;T;T;T;T	0.70986	-0.52;-0.53;-0.53;-0.52;0.94	5.49	5.49	0.81192	.	0.116062	0.39274	N	0.001412	T	0.81004	0.4733	L	0.60455	1.87	0.80722	D	1	P;D	0.89917	0.461;1.0	B;D	0.66847	0.33;0.947	T	0.79313	-0.1855	10	0.38643	T	0.18	.	17.5415	0.87849	0.0:0.0:1.0:0.0	.	1144;1169	P51826;P51826-2	AFF3_HUMAN;.	L	1144;1169;1169;1144;170	ENSP00000317421:P1144L;ENSP00000348793:P1169L;ENSP00000386834:P1169L;ENSP00000387207:P1144L;ENSP00000416685:P170L	ENSP00000317421:P1144L	P	-	2	0	AFF3	99537333	1.000000	0.71417	0.958000	0.39756	0.991000	0.79684	6.855000	0.75445	2.569000	0.86673	0.655000	0.94253	CCG	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.642	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	96	0.00	0	G	NM_002285		100170901	100170901	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	40	47.37	36	SNP	0.994	A
ASB5	140458	genome.wustl.edu	37	4	177190238	177190238	+	Missense_Mutation	SNP	G	G	C	rs200442347	byFrequency	TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr4:177190238G>C	ENST00000296525.3	-	1	135	c.22C>G	c.(22-24)Cgg>Ggg	p.R8G		NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	8					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.R8W(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		GCAAACGGCCGATTTTCTTCT	0.443																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											80.0	76.0	78.0					4																	177190238		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.22C>G	4.37:g.177190238G>C	ENSP00000296525:p.Arg8Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7B5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.R8G	ENST00000296525.3	37	c.22	CCDS3827.1	4	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259402	0.23051	.	.	ENSG00000164122	ENST00000296525;ENST00000505299	T	0.42513	0.97	5.57	5.57	0.84162	.	0.252420	0.37809	N	0.001921	T	0.32406	0.0828	L	0.36672	1.1	0.80722	D	1	P	0.44877	0.845	B	0.40285	0.325	T	0.15065	-1.0450	10	0.02654	T	1	-26.3287	17.7463	0.88422	0.0:0.0:1.0:0.0	.	8	Q8WWX0	ASB5_HUMAN	G	8	ENSP00000296525:R8G	ENSP00000296525:R8G	R	-	1	2	ASB5	177427232	1.000000	0.71417	0.637000	0.29366	0.312000	0.27988	4.628000	0.61282	2.630000	0.89119	0.591000	0.81541	CGG	ASB5	-	NULL	ENSG00000164122		0.443	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB5	HGNC	protein_coding	OTTHUMT00000362344.1	38	0.00	0	G			177190238	177190238	-1	no_errors	ENST00000296525	ensembl	human	known	69_37n	missense	36	48.57	34	SNP	0.997	C
CACNA1F	778	genome.wustl.edu	37	X	49082871	49082871	+	Splice_Site	SNP	A	A	T			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chrX:49082871A>T	ENST00000376265.2	-	11	1557	c.1496T>A	c.(1495-1497)cTa>cAa	p.L499Q	CACNA1F_ENST00000323022.5_Splice_Site_p.L488Q|CACNA1F_ENST00000376251.1_Splice_Site_p.L434Q	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	499					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGCCCTCACAGGCAGCGTGT	0.612																																						dbGAP											0													36.0	33.0	34.0					X																	49082871		2200	4280	6480	-	-	-	SO:0001630	splice_region_variant	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.1496+1T>A	X.37:g.49082871A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.L499Q	ENST00000376265.2	37	c.1496	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	A	11.07	1.530673	0.27387	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.96554	-4.05;-3.97;-3.98	5.14	3.94	0.45596	.	1.035570	0.07622	N	0.927148	D	0.97328	0.9126	M	0.70595	2.14	0.31829	N	0.625016	D;P	0.64830	0.994;0.94	P;B	0.62435	0.902;0.36	D	0.91368	0.5117	9	.	.	.	.	8.0967	0.30833	0.7977:0.2023:0.0:0.0	.	488;499	F5CIQ9;O60840	.;CAC1F_HUMAN	Q	434;488;499	ENSP00000365427:L434Q;ENSP00000321618:L488Q;ENSP00000365441:L499Q	.	L	-	2	0	CACNA1F	48969815	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.398000	0.52579	0.593000	0.29745	0.352000	0.21897	CTA	CACNA1F	-	NULL	ENSG00000102001		0.612	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	124	0.00	0	A	NM_005183	Missense_Mutation	49082871	49082871	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	14	42.31	11	SNP	0.691	T
CLSTN3	9746	genome.wustl.edu	37	12	7293852	7293852	+	Silent	SNP	G	G	A			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr12:7293852G>A	ENST00000266546.6	+	9	1788	c.1338G>A	c.(1336-1338)gaG>gaA	p.E446E	CLSTN3_ENST00000537408.1_Silent_p.E458E	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	446					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GTGATGATGAGTGGCACCACT	0.562											OREG0021650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													332.0	248.0	276.0					12																	7293852		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1338G>A	12.37:g.7293852G>A		Somatic	640	WXS	Illumina GAIIx	Phase_IV	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E446	ENST00000266546.6	37	c.1338	CCDS8575.1	12																																																																																			CLSTN3	-	superfamily_ConA-like_lec_gl	ENSG00000139182		0.562	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	HGNC	protein_coding	OTTHUMT00000398560.2	262	0.00	0	G	NM_014718		7293852	7293852	+1	no_errors	ENST00000266546	ensembl	human	known	69_37n	silent	29	48.21	27	SNP	0.997	A
CMYA5	202333	genome.wustl.edu	37	5	79033437	79033437	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr5:79033437G>T	ENST00000446378.2	+	2	8880	c.8849G>T	c.(8848-8850)gGc>gTc	p.G2950V		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2950					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATTTCTGAAGGCTGTGAGATA	0.378																																						dbGAP											0													42.0	39.0	40.0					5																	79033437		1824	4076	5900	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.8849G>T	5.37:g.79033437G>T	ENSP00000394770:p.Gly2950Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.G2950V	ENST00000446378.2	37	c.8849	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049323	0.75846	.	.	ENSG00000164309	ENST00000446378	T	0.21543	2.0	5.93	5.93	0.95920	.	0.000000	0.53938	D	0.000058	T	0.49643	0.1569	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.44467	-0.9326	10	0.87932	D	0	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	2950	Q8N3K9	CMYA5_HUMAN	V	2950	ENSP00000394770:G2950V	ENSP00000394770:G2950V	G	+	2	0	CMYA5	79069193	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.769000	0.91742	2.798000	0.96311	0.655000	0.94253	GGC	CMYA5	-	NULL	ENSG00000164309		0.378	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	24	0.00	0	G	NM_153610		79033437	79033437	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	1.000	T
CROCCP2	84809	genome.wustl.edu	37	1	16950807	16950807	+	lincRNA	SNP	C	C	T	rs11590427	byFrequency	TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr1:16950807C>T	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCTGCCTTCACGCTCCGCAGG	0.692													.|||	1027	0.205072	0.2587	0.1196	5008	,	,		59386	0.2748		0.162	False		,,,				2504	0.1656					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950807C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.692	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	C	NR_026752.1		16950807	16950807	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	3	76.92	10	SNP	0.483	T
DNAH17	8632	genome.wustl.edu	37	17	76501415	76501415	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr17:76501415T>G	ENST00000585328.1	-	31	5031	c.4907A>C	c.(4906-4908)gAg>gCg	p.E1636A	DNAH17_ENST00000389840.5_Missense_Mutation_p.E1635A	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1635	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AACCATGTACTCGTCCTCCTT	0.562																																						dbGAP											0													81.0	82.0	82.0					17																	76501415		2109	4221	6330	-	-	-	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4907A>C	17.37:g.76501415T>G	ENSP00000465516:p.Glu1636Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.E1635A	ENST00000585328.1	37	c.4904		17	.	.	.	.	.	.	.	.	.	.	T	19.75	3.885095	0.72410	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.78126	-1.15	4.02	4.02	0.46733	Dynein heavy chain, domain-2 (1);	.	.	.	.	D	0.92714	0.7684	H	0.99104	4.43	0.47245	D	0.999369	D	0.89917	1.0	D	0.87578	0.998	D	0.95026	0.8165	9	0.87932	D	0	.	13.1032	0.59233	0.0:0.0:0.0:1.0	.	1635	Q9UFH2	DYH17_HUMAN	A	1636;1635	ENSP00000374490:E1635A	ENSP00000300671:E1636A	E	-	2	0	DNAH17	74013010	1.000000	0.71417	0.986000	0.45419	0.627000	0.37826	7.379000	0.79691	1.669000	0.50854	0.454000	0.30748	GAG	DNAH17	-	pfam_Dynein_heavy_dom-2	ENSG00000187775		0.562	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	42	0.00	0	T	NM_173628		76501415	76501415	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	33	44.26	27	SNP	1.000	G
DPY19L4	286148	genome.wustl.edu	37	8	95796032	95796032	+	Splice_Site	SNP	T	T	A			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr8:95796032T>A	ENST00000414645.2	+	17	1947		c.e17+2			NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					AATGAAAATGTAAGACATTTT	0.358																																						dbGAP											0													77.0	72.0	74.0					8																	95796032		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.1848+2T>A	8.37:g.95796032T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZW32|Q6ZW42|Q7Z329	Splice_Site	SNP	-	e17+2	ENST00000414645.2	37	c.1848+2	CCDS34924.1	8	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858870	0.71834	.	.	ENSG00000156162	ENST00000414645	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8825	0.70545	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPY19L4	95865208	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	6.861000	0.75478	1.987000	0.57996	0.528000	0.53228	.	DPY19L4	-	-	ENSG00000156162		0.358	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L4	HGNC	protein_coding	OTTHUMT00000379339.1	43	0.00	0	T	NM_181787	Intron	95796032	95796032	+1	no_errors	ENST00000414645	ensembl	human	known	69_37n	splice_site	117	35.00	63	SNP	1.000	A
DYRK3	8444	genome.wustl.edu	37	1	206810308	206810308	+	Intron	SNP	A	A	G			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr1:206810308A>G	ENST00000367109.2	+	2	245				DYRK3_ENST00000489878.1_3'UTR|DYRK3_ENST00000367106.1_Silent_p.K4K|DYRK3_ENST00000367108.3_Silent_p.K4K|RP11-343H5.6_ENST00000425161.1_RNA	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3						erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TGAAGTGGAAAGAGAAGTAAA	0.368																																					Melanoma(164;427 2622 26826 51707)	dbGAP											0													106.0	109.0	108.0					1																	206810308		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.78-687A>G	1.37:g.206810308A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K4	ENST00000367109.2	37	c.12	CCDS30999.1	1																																																																																			DYRK3	-	NULL	ENSG00000143479		0.368	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK3	HGNC	protein_coding	OTTHUMT00000088458.1	82	0.00	0	A	NM_003582		206810308	206810308	+1	no_errors	ENST00000367106	ensembl	human	known	69_37n	silent	101	54.71	122	SNP	0.001	G
FGF6	2251	genome.wustl.edu	37	12	4554416	4554416	+	Silent	SNP	G	G	A			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr12:4554416G>A	ENST00000228837.2	-	1	364	c.321C>T	c.(319-321)agC>agT	p.S107S		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	107					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CGTGGGTCCCGCTGATCCGGC	0.637																																						dbGAP											0													31.0	30.0	30.0					12																	4554416		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.321C>T	12.37:g.4554416G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAE1	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.S107	ENST00000228837.2	37	c.321	CCDS8527.1	12																																																																																			FGF6	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF	ENSG00000111241		0.637	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF6	HGNC	protein_coding	OTTHUMT00000398939.1	32	0.00	0	G	NM_020996		4554416	4554416	-1	no_errors	ENST00000228837	ensembl	human	known	69_37n	silent	15	23.81	5	SNP	1.000	A
FRYL	285527	genome.wustl.edu	37	4	48542474	48542474	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr4:48542474A>C	ENST00000503238.1	-	43	6190	c.6191T>G	c.(6190-6192)cTt>cGt	p.L2064R	FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000358350.4_Missense_Mutation_p.L2064R|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.L2064R			O94915	FRYL_HUMAN	FRY-like	2064					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AAAACCCTTAAGGAAGAGCTG	0.403																																						dbGAP											0													128.0	115.0	119.0					4																	48542474		1875	4105	5980	-	-	-	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.6191T>G	4.37:g.48542474A>C	ENSP00000426064:p.Leu2064Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L2064R	ENST00000503238.1	37	c.6191	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	A	15.68	2.903900	0.52333	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810	T;T;T	0.37235	1.21;1.21;1.21	6.16	6.16	0.99307	Armadillo-type fold (1);	0.062223	0.64402	D	0.000005	T	0.61375	0.2342	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.63681	-0.6582	10	0.72032	D	0.01	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	894;2064;2064	Q6ZR29;O94915;F5GX82	.;FRYL_HUMAN;.	R	2064	ENSP00000426064:L2064R;ENSP00000351113:L2064R;ENSP00000441114:L2064R	ENSP00000351113:L2064R	L	-	2	0	FRYL	48237231	1.000000	0.71417	0.997000	0.53966	0.089000	0.18198	9.255000	0.95524	2.367000	0.80283	0.528000	0.53228	CTT	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.403	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	23	0.00	0	A			48542474	48542474	-1	no_errors	ENST00000358350	ensembl	human	known	69_37n	missense	35	50.70	36	SNP	1.000	C
KIF1B	23095	genome.wustl.edu	37	1	10386254	10386254	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr1:10386254A>G	ENST00000377086.1	+	27	2963	c.2761A>G	c.(2761-2763)Act>Gct	p.T921A	KIF1B_ENST00000263934.6_Missense_Mutation_p.T875A|KIF1B_ENST00000377081.1_Missense_Mutation_p.T921A			O60333	KIF1B_HUMAN	kinesin family member 1B	921					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TTCCGACATCACTGAGCTGGC	0.582																																						dbGAP											0													146.0	139.0	141.0					1																	10386254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2761A>G	1.37:g.10386254A>G	ENSP00000366290:p.Thr921Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T875A	ENST00000377086.1	37	c.2623		1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580544	0.65992	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.72725	-0.6;-0.67;-0.68	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.70911	0.3278	N	0.14661	0.345	0.58432	D	0.999998	B;P;P;B;P;D	0.56035	0.329;0.524;0.765;0.435;0.956;0.974	B;B;B;B;P;D	0.67725	0.122;0.095;0.285;0.115;0.899;0.953	T	0.69450	-0.5142	10	0.22706	T	0.39	.	16.0502	0.80755	1.0:0.0:0.0:0.0	.	907;881;921;895;921;875	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	A	921;875;921;921	ENSP00000263934:T875A;ENSP00000366290:T921A;ENSP00000366284:T921A	ENSP00000263934:T875A	T	+	1	0	KIF1B	10308841	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.197000	0.70478	0.528000	0.53228	ACT	KIF1B	-	NULL	ENSG00000054523		0.582	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	86	0.00	0	A			10386254	10386254	+1	no_errors	ENST00000263934	ensembl	human	known	69_37n	missense	6	87.50	49	SNP	1.000	G
KRTAP23-1	337963	genome.wustl.edu	37	21	31720857	31720857	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr21:31720857C>T	ENST00000334160.4	-	1	67	c.68G>A	c.(67-69)gGc>gAc	p.G23D		NM_181624.1	NP_853655.1	A1A580	KR231_HUMAN	keratin associated protein 23-1	23						intermediate filament (GO:0005882)				large_intestine(1)|lung(4)|prostate(1)	6						ACGGGAGTAGCCTGAGTAGCA	0.562																																						dbGAP											0													151.0	119.0	130.0					21																	31720857		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708	CCDS33533.1	21q22.1	2008-05-21			ENSG00000186980	ENSG00000186980		"""Keratin associated proteins"""	18928	protein-coding gene	gene with protein product						12359730	Standard	NM_181624		Approved	KAP23.1	uc002yny.1	A1A580	OTTHUMG00000057792	ENST00000334160.4:c.68G>A	21.37:g.31720857C>T	ENSP00000346536:p.Gly23Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PMG	p.G23D	ENST00000334160.4	37	c.68	CCDS33533.1	21	.	.	.	.	.	.	.	.	.	.	C	7.487	0.649823	0.14516	.	.	ENSG00000186980	ENST00000334160	T	0.03212	4.01	3.9	-1.09	0.09904	.	.	.	.	.	T	0.05731	0.0150	.	.	.	0.09310	N	1	P	0.43826	0.818	P	0.47102	0.537	T	0.34153	-0.9840	8	0.87932	D	0	.	6.9011	0.24283	0.236:0.2936:0.4704:0.0	.	23	A1A580	KR231_HUMAN	D	23	ENSP00000346536:G23D	ENSP00000346536:G23D	G	-	2	0	KRTAP23-1	30642728	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.989000	0.03736	-0.022000	0.13986	0.655000	0.94253	GGC	KRTAP23-1	-	pfam_PMG	ENSG00000186980		0.562	KRTAP23-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP23-1	HGNC	protein_coding	OTTHUMT00000128244.4	180	0.00	0	C			31720857	31720857	-1	no_errors	ENST00000334160	ensembl	human	known	69_37n	missense	60	43.93	47	SNP	0.000	T
LAMA1	284217	genome.wustl.edu	37	18	6959369	6959369	+	Silent	SNP	C	C	T			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr18:6959369C>T	ENST00000389658.3	-	54	7842	c.7749G>A	c.(7747-7749)gcG>gcA	p.A2583A	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2583	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.A2583A(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGATGGAATGCGCTTGTCCAT	0.562																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											161.0	132.0	142.0					18																	6959369		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7749G>A	18.37:g.6959369C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.A2583	ENST00000389658.3	37	c.7749	CCDS32787.1	18																																																																																			LAMA1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000101680		0.562	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	41	0.00	0	C	NM_005559		6959369	6959369	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	silent	37	33.93	19	SNP	0.001	T
MUC4	4585	genome.wustl.edu	37	3	195508115	195508115	+	Missense_Mutation	SNP	T	T	G	rs77145082	byFrequency	TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr3:195508115T>G	ENST00000463781.3	-	2	10795	c.10336A>C	c.(10336-10338)Act>Cct	p.T3446P	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3446P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGCTGGTGACA	0.597													.|||	46	0.0091853	0.0015	0.0014	5008	,	,		20035	0.001		0.002	False		,,,				2504	0.0409					dbGAP											0													27.0	23.0	24.0					3																	195508115		684	1577	2261	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10336A>C	3.37:g.195508115T>G	ENSP00000417498:p.Thr3446Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T3446P	ENST00000463781.3	37	c.10336	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	t	3.677	-0.066237	0.07273	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37915	1.17;1.23	0.743	-1.49	0.08718	.	.	.	.	.	T	0.19167	0.0460	N	0.03608	-0.345	0.09310	N	1	D	0.57257	0.979	P	0.51487	0.671	T	0.37314	-0.9711	8	.	.	.	.	3.3392	0.07113	0.0:0.4056:0.2303:0.3641	.	3318	E7ESK3	.	P	3446	ENSP00000417498:T3446P;ENSP00000420243:T3446P	.	T	-	1	0	MUC4	196992894	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.063000	0.14410	-4.128000	0.00071	-4.106000	0.00011	ACT	MUC4	-	NULL	ENSG00000145113		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	35	0.00	0	T	NM_018406		195508115	195508115	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	764	14.92	137	SNP	0.077	G
OTUD4	54726	genome.wustl.edu	37	4	146059245	146059245	+	Silent	SNP	C	C	T	rs373270757		TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr4:146059245C>T	ENST00000447906.2	-	21	2869	c.2682G>A	c.(2680-2682)ctG>ctA	p.L894L	OTUD4_ENST00000454497.2_Silent_p.L829L|OTUD4_ENST00000455611.2_Intron			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	894					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					CCAGATTTTCCAGAGACAGAT	0.423																																						dbGAP											0													39.0	40.0	40.0					4																	146059245		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2682G>A	4.37:g.146059245C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	pfam_OTU,pfscan_OTU	p.L894	ENST00000447906.2	37	c.2682		4																																																																																			OTUD4	-	NULL	ENSG00000164164		0.423	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365117.2	19	0.00	0	C	NM_017493		146059245	146059245	-1	no_errors	ENST00000447906	ensembl	human	known	69_37n	silent	26	46.94	23	SNP	1.000	T
PCDHA4	56144	genome.wustl.edu	37	5	140188293	140188293	+	Silent	SNP	C	C	T			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr5:140188293C>T	ENST00000530339.1	+	1	1521	c.1521C>T	c.(1519-1521)taC>taT	p.Y507Y	PCDHA4_ENST00000512229.2_Silent_p.Y507Y|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Silent_p.Y507Y|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	507	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCGAGCTACGTTTCGGTGC	0.662																																						dbGAP											0													67.0	68.0	67.0					5																	140188293		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1521C>T	5.37:g.140188293C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75285|Q2M253	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Y507	ENST00000530339.1	37	c.1521	CCDS54916.1	5																																																																																			PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.662	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	22	0.00	0	C	NM_018907		140188293	140188293	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	silent	10	47.37	9	SNP	0.999	T
POTEF	728378	genome.wustl.edu	37	2	130832835	130832835	+	Missense_Mutation	SNP	C	C	T	rs551180706		TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr2:130832835C>T	ENST00000409914.2	-	17	2609	c.2210G>A	c.(2209-2211)cGc>cAc	p.R737H	POTEF_ENST00000357462.5_Missense_Mutation_p.R737H	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	737	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R737H(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTGCCTGGGGCGCCCCACGAT	0.627													.|||	1	0.000199681	0.0	0.0014	5008	,	,		18117	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	endometrium(1)											8.0	9.0	9.0					2																	130832835		1882	3874	5756	-	-	-	SO:0001583	missense	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2210G>A	2.37:g.130832835C>T	ENSP00000386786:p.Arg737His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC34	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R737H	ENST00000409914.2	37	c.2210	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	7.678	0.688491	0.14973	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.92048	-2.96;-2.96	.	.	.	.	.	.	.	.	D	0.88437	0.6436	M	0.82056	2.57	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.66889	-0.5809	8	0.33940	T	0.23	.	4.5331	0.12015	0.0:0.6752:0.0:0.3248	.	737	A5A3E0	POTEF_HUMAN	H	737	ENSP00000350052:R737H;ENSP00000386786:R737H	ENSP00000350052:R737H	R	-	2	0	POTEF	130549305	1.000000	0.71417	0.045000	0.18777	0.046000	0.14306	1.483000	0.35497	-1.708000	0.01401	-1.709000	0.00716	CGC	POTEF	-	pfam_Actin-like,smart_Actin-like	ENSG00000196604		0.627	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	42	0.00	0	C	NM_001099771		130832835	130832835	-1	no_errors	ENST00000357462	ensembl	human	known	69_37n	missense	37	47.89	34	SNP	1.000	T
RBBP5	5929	genome.wustl.edu	37	1	205073004	205073004	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr1:205073004G>A	ENST00000264515.6	-	5	644	c.503C>T	c.(502-504)aCg>aTg	p.T168M	RBBP5_ENST00000484379.1_5'Flank|RBBP5_ENST00000367164.1_Missense_Mutation_p.T168M	NM_001193273.1|NM_005057.3	NP_001180202.1|NP_005048.2	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	168					cellular response to DNA damage stimulus (GO:0006974)|histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	methylated histone binding (GO:0035064)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	27	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			TGCGTTTCCCGTATAAATATA	0.408																																						dbGAP											0													191.0	187.0	188.0					1																	205073004		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC053856	CCDS30983.1, CCDS53463.1	1q32	2013-01-10	2001-11-28		ENSG00000117222	ENSG00000117222		"""WD repeat domain containing"""	9888	protein-coding gene	gene with protein product	"""SWD1, Set1c WD40 repeat protein, homolog (S. cerevisiae)"""	600697	"""retinoblastoma-binding protein 5"""			7558034	Standard	NM_005057		Approved	RBQ3, SWD1	uc001hbu.2	Q15291	OTTHUMG00000037104	ENST00000264515.6:c.503C>T	1.37:g.205073004G>A	ENSP00000264515:p.Thr168Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K272|Q7Z6D8|Q8NDZ7	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T168M	ENST00000264515.6	37	c.503	CCDS30983.1	1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928970	0.73327	.	.	ENSG00000117222	ENST00000264515;ENST00000367164	T;T	0.22743	1.94;1.94	6.14	6.14	0.99180	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.45836	0.1362	M	0.85542	2.76	0.80722	D	1	D;P;P;D	0.62365	0.985;0.731;0.811;0.991	P;B;B;P	0.52267	0.517;0.085;0.165;0.694	T	0.47674	-0.9099	10	0.66056	D	0.02	.	20.4548	0.99139	0.0:0.0:1.0:0.0	.	41;203;168;168	B4DLF8;B4DMM7;Q15291-2;Q15291	.;.;.;RBBP5_HUMAN	M	168	ENSP00000264515:T168M;ENSP00000356132:T168M	ENSP00000264515:T168M	T	-	2	0	RBBP5	203339627	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	9.288000	0.96055	2.937000	0.99478	0.650000	0.86243	ACG	RBBP5	-	NULL	ENSG00000117222		0.408	RBBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP5	HGNC	protein_coding	OTTHUMT00000090077.1	127	0.00	0	G	NM_005057		205073004	205073004	-1	no_errors	ENST00000264515	ensembl	human	known	69_37n	missense	155	27.23	58	SNP	1.000	A
SLC9A5	6553	genome.wustl.edu	37	16	67289834	67289834	+	Splice_Site	SNP	G	G	A			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr16:67289834G>A	ENST00000299798.11	+	5	976		c.e5+1		SLC9A5_ENST00000561472.2_Splice_Site	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5						ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CCATTCTTGCGTGAGTTCTGG	0.602																																						dbGAP											0													25.0	25.0	25.0					16																	67289834		2077	4225	6302	-	-	-	SO:0001630	splice_region_variant	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.911+1G>A	16.37:g.67289834G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY7|Q9Y626	Splice_Site	SNP	-	e5+1	ENST00000299798.11	37	c.911+1	CCDS42178.1	16	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283399	0.80803	.	.	ENSG00000135740	ENST00000299798	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1065	0.93299	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC9A5	65847335	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.775000	0.95449	0.650000	0.86243	.	SLC9A5	-	-	ENSG00000135740		0.602	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1	21	0.00	0	G		Intron	67289834	67289834	+1	no_errors	ENST00000299798	ensembl	human	known	69_37n	splice_site	2	75.00	6	SNP	1.000	A
SYNPO2L	79933	genome.wustl.edu	37	10	75406951	75406951	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr10:75406951A>G	ENST00000394810.2	-	4	2608	c.2459T>C	c.(2458-2460)tTt>tCt	p.F820S	SYNPO2L_ENST00000372873.4_Missense_Mutation_p.F596S	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	820	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					CTGGGGGAAAAAGGGAGAGAG	0.582																																						dbGAP											0													61.0	73.0	69.0					10																	75406951		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.2459T>C	10.37:g.75406951A>G	ENSP00000378289:p.Phe820Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV9|Q68A20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.F820S	ENST00000394810.2	37	c.2459	CCDS44438.1	10	.	.	.	.	.	.	.	.	.	.	A	12.54	1.969674	0.34754	.	.	ENSG00000166317	ENST00000372873;ENST00000394810	T;T	0.19938	2.11;2.44	4.98	3.83	0.44106	.	0.119748	0.64402	D	0.000019	T	0.12135	0.0295	L	0.27053	0.805	0.39782	D	0.972318	B;B	0.31435	0.134;0.323	B;B	0.30572	0.03;0.117	T	0.05468	-1.0883	10	0.05525	T	0.97	-5.368	11.1478	0.48440	0.8619:0.0:0.0:0.1381	.	820;596	Q9H987;Q9H987-2	SYP2L_HUMAN;.	S	596;820	ENSP00000361964:F596S;ENSP00000378289:F820S	ENSP00000361964:F596S	F	-	2	0	SYNPO2L	75076957	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.437000	0.52863	0.890000	0.36211	0.402000	0.26972	TTT	SYNPO2L	-	NULL	ENSG00000166317		0.582	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNPO2L	HGNC	protein_coding	OTTHUMT00000316562.2	27	0.00	0	A	NM_024875		75406951	75406951	-1	no_errors	ENST00000394810	ensembl	human	known	69_37n	missense	5	61.54	8	SNP	1.000	G
UHRF1BP1L	23074	genome.wustl.edu	37	12	100482869	100482869	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KP-01A-11D-A13L-09	TCGA-AO-A1KP-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bc36db60-3f6b-42c4-b03e-b7c74c3dda5c	ca375523-be3b-4d91-a319-227b0c988d7c	g.chr12:100482869G>A	ENST00000279907.7	-	8	1057	c.845C>T	c.(844-846)tCt>tTt	p.S282F	UHRF1BP1L_ENST00000545232.2_5'UTR|UHRF1BP1L_ENST00000356828.3_Missense_Mutation_p.S282F	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	282										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GACTACTGTAGAGCTCTAAAA	0.343																																						dbGAP											0													80.0	78.0	79.0					12																	100482869		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.845C>T	12.37:g.100482869G>A	ENSP00000279907:p.Ser282Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.S282F	ENST00000279907.7	37	c.845	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431677	0.43122	.	.	ENSG00000111647	ENST00000279907;ENST00000356828	T;T	0.32023	2.84;1.47	5.02	4.1	0.47936	.	0.199673	0.44902	D	0.000405	T	0.41003	0.1140	L	0.47716	1.5	0.41614	D	0.988922	D;P	0.59767	0.986;0.74	P;B	0.53809	0.735;0.397	T	0.41342	-0.9514	10	0.87932	D	0	-6.5729	15.248	0.73521	0.0:0.1411:0.8589:0.0	.	282;282	A0JNW5-2;A0JNW5	.;UH1BL_HUMAN	F	282	ENSP00000279907:S282F;ENSP00000349285:S282F	ENSP00000279907:S282F	S	-	2	0	UHRF1BP1L	99007000	0.999000	0.42202	0.978000	0.43139	0.223000	0.24884	2.922000	0.48860	1.077000	0.40990	0.460000	0.39030	TCT	UHRF1BP1L	-	NULL	ENSG00000111647		0.343	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	40	0.00	0	G	NM_001006947		100482869	100482869	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	missense	30	57.75	41	SNP	0.999	A
