#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AIM1L	55057	genome.wustl.edu	37	1	26658074	26658074	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:26658074T>C	ENST00000308182.5	-	14	1514	c.1085A>G	c.(1084-1086)gAc>gGc	p.D362G	AIM1L_ENST00000527815.1_Missense_Mutation_p.D533G			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	362	Beta/gamma crystallin 'Greek key' 8. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		AATGTGCTGGTCACCCTCGAA	0.587																																						dbGAP											0													113.0	93.0	100.0					1																	26658074		2203	4300	6503	-	-	-	SO:0001583	missense	0					1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.1085A>G	1.37:g.26658074T>C	ENSP00000310435:p.Asp362Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNG3|Q5T137|Q5T150	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.D533G	ENST00000308182.5	37	c.1598		1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.617497	0.46736	.	.	ENSG00000176092	ENST00000527815;ENST00000308182	T;T	0.76060	-0.99;-0.99	5.49	5.49	0.81192	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.518020	0.23330	N	0.049355	T	0.67021	0.2849	L	0.36672	1.1	0.80722	D	1	B	0.09022	0.002	B	0.14023	0.01	T	0.62770	-0.6784	10	0.44086	T	0.13	.	15.2648	0.73651	0.0:0.0:0.0:1.0	.	362	Q8N1P7	AIM1L_HUMAN	G	533;362	ENSP00000433931:D533G;ENSP00000310435:D362G	ENSP00000310435:D362G	D	-	2	0	AIM1L	26530661	1.000000	0.71417	0.997000	0.53966	0.813000	0.45954	3.981000	0.56902	2.096000	0.63516	0.383000	0.25322	GAC	AIM1L	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000176092		0.587	AIM1L-201	KNOWN	basic	protein_coding	AIM1L	HGNC	protein_coding		29	0.00	0	T	NM_001039775.2		26658074	26658074	-1	no_errors	ENST00000527815	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	0.929	C
APOBEC1	339	genome.wustl.edu	37	12	7802275	7802275	+	Silent	SNP	T	T	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr12:7802275T>C	ENST00000229304.4	-	5	599	c.579A>G	c.(577-579)ttA>ttG	p.L193L		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	193	Leu-rich.				cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						TTGAAATCTTTAAACAGGGTG	0.308																																					Pancreas(135;929 1826 4531 10527 41012)	dbGAP											0													100.0	93.0	95.0					12																	7802275		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.579A>G	12.37:g.7802275T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UE64|Q9UM71	Silent	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.L193	ENST00000229304.4	37	c.579	CCDS8579.1	12																																																																																			APOBEC1	-	NULL	ENSG00000111701		0.308	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC1	HGNC	protein_coding	OTTHUMT00000280523.1	51	0.00	0	T	NM_001644		7802275	7802275	-1	no_errors	ENST00000229304	ensembl	human	known	69_37n	silent	40	16.67	8	SNP	0.058	C
ASNSD1	54529	genome.wustl.edu	37	2	190530910	190530910	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:190530910G>C	ENST00000260952.4	+	4	465	c.52G>C	c.(52-54)Gat>Cat	p.D18H	ASNSD1_ENST00000607690.1_3'UTR|ASNSD1_ENST00000607535.1_3'UTR|ASNSD1_ENST00000607062.1_Intron|ASNSD1_ENST00000607829.1_3'UTR	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	18	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			TTTCAGTCAAGATTTAAAAGA	0.338																																						dbGAP											0													101.0	100.0	101.0					2																	190530910		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.52G>C	2.37:g.190530910G>C	ENSP00000260952:p.Asp18His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	pfam_Asn_synthase	p.D18H	ENST00000260952.4	37	c.52	CCDS2300.1	2	.	.	.	.	.	.	.	.	.	.	G	5.062	0.197099	0.09599	.	.	ENSG00000138381	ENST00000260952;ENST00000425590;ENST00000420250	T;T	0.32753	1.44;1.44	5.76	4.89	0.63831	Glutamine amidotransferase, type II (1);	0.621254	0.18393	N	0.142584	T	0.28200	0.0696	L	0.53249	1.67	0.09310	N	1	B	0.22276	0.067	B	0.18871	0.023	T	0.18085	-1.0348	10	0.46703	T	0.11	-0.9709	8.6306	0.33917	0.0697:0.0:0.6705:0.2598	.	18	Q9NWL6	ASND1_HUMAN	H	18	ENSP00000260952:D18H;ENSP00000406790:D18H	ENSP00000260952:D18H	D	+	1	0	ASNSD1	190239155	0.004000	0.15560	0.401000	0.26359	0.079000	0.17450	1.345000	0.33953	1.579000	0.49836	0.650000	0.86243	GAT	ASNSD1	-	NULL	ENSG00000138381		0.338	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASNSD1	HGNC	protein_coding	OTTHUMT00000255919.3	30	0.00	0	G	NM_019048		190530910	190530910	+1	no_errors	ENST00000260952	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.081	C
ASTE1	28990	genome.wustl.edu	37	3	130743882	130743882	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr3:130743882G>T	ENST00000264992.3	-	3	710	c.269C>A	c.(268-270)aCa>aAa	p.T90K	ASTE1_ENST00000514044.1_Missense_Mutation_p.T90K|NEK11_ENST00000356918.4_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000507910.1_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000510688.1_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	90					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						CTTTAAAGTTGTAAGCTTTTT	0.398																																						dbGAP											0													120.0	116.0	117.0					3																	130743882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.269C>A	3.37:g.130743882G>T	ENSP00000264992:p.Thr90Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	pfam_XPG_DNA_repair_N	p.T90K	ENST00000264992.3	37	c.269	CCDS3068.1	3	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.327178	0.00229	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	T;T	0.62105	0.05;0.05	5.45	0.936	0.19488	XPG N-terminal (1);	1.033080	0.07554	N	0.915878	T	0.28267	0.0698	N	0.01297	-0.9	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.21724	-1.0237	10	0.09084	T	0.74	-0.3402	6.6684	0.23054	0.1481:0.0:0.4838:0.3681	.	90;90	D6RG30;Q2TB18	.;ASTE1_HUMAN	K	90	ENSP00000426421:T90K;ENSP00000264992:T90K	ENSP00000264992:T90K	T	-	2	0	ASTE1	132226572	0.000000	0.05858	0.009000	0.14445	0.063000	0.16089	0.073000	0.14640	0.235000	0.21160	0.655000	0.94253	ACA	ASTE1	-	pfam_XPG_DNA_repair_N	ENSG00000034533		0.398	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1	60	0.00	0	G	NM_014065		130743882	130743882	-1	no_errors	ENST00000264992	ensembl	human	known	69_37n	missense	75	17.58	16	SNP	0.000	T
ASTN1	460	genome.wustl.edu	37	1	176926869	176926869	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:176926869C>A	ENST00000367654.3	-	11	2067	c.1856G>T	c.(1855-1857)tGc>tTc	p.C619F	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.C611F|ASTN1_ENST00000424564.2_Missense_Mutation_p.C611F|ASTN1_ENST00000361833.2_Missense_Mutation_p.C611F	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	619	EGF-like 2.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						ATTCTTACTGCAGCCCCCGTT	0.532																																						dbGAP											0													80.0	76.0	77.0					1																	176926869		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1856G>T	1.37:g.176926869C>A	ENSP00000356626:p.Cys619Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.C619F	ENST00000367654.3	37	c.1856		1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816877	0.90790	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	D;D;T;D	0.96427	-4.01;-4.01;2.69;-4.01	5.58	5.58	0.84498	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.96824	0.8963	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.988;0.988	D;D;D	0.83275	0.996;0.989;0.989	D	0.97855	1.0277	10	0.87932	D	0	-28.1151	19.1684	0.93567	0.0:1.0:0.0:0.0	.	619;611;611	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	F	611;611;619;611;611	ENSP00000356629:C611F;ENSP00000354536:C611F;ENSP00000356626:C619F;ENSP00000395041:C611F	ENSP00000354536:C611F	C	-	2	0	ASTN1	175193492	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.348000	0.79366	2.618000	0.88619	0.563000	0.77884	TGC	ASTN1	-	smart_EGF-like	ENSG00000152092		0.532	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		22	0.00	0	C	NM_004319		176926869	176926869	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	1.000	A
BRCA1	672	genome.wustl.edu	37	17	41245615	41245617	+	In_Frame_Del	DEL	AAC	AAC	-	rs587782739|rs397508918		TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr17:41245615_41245617delAAC	ENST00000357654.3	-	10	2049_2051	c.1931_1933delGTT	c.(1930-1935)tgttct>tct	p.C644del	BRCA1_ENST00000354071.3_In_Frame_Del_p.C644del|BRCA1_ENST00000471181.2_In_Frame_Del_p.C644del|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000493795.1_In_Frame_Del_p.C597del|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_In_Frame_Del_p.C348del|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000346315.3_In_Frame_Del_p.C644del	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	644					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCACTGCTAGAACAACTATCAAT	0.414			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			GRCh37	CM995147	BRCA1	M																																				-	-	-	SO:0001651	inframe_deletion	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.1931_1933delGTT	17.37:g.41245618_41245620delAAC	ENSP00000350283:p.Cys644del	Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	In_Frame_Del	DEL	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.C644in_frame_del	ENST00000357654.3	37	c.1933_1931	CCDS11453.1	17																																																																																			BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.414	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	44	0.00	0	AAC	NM_007294		41245615	41245617	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	in_frame_del	22	14.29	4	DEL	0.863:0.861:0.848	-
C9orf163	158055	genome.wustl.edu	37	9	139379382	139379382	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr9:139379382G>A	ENST00000354376.1	+	1	1436	c.482G>A	c.(481-483)tGg>tAg	p.W161*		NM_152571.2	NP_689784.1	Q8N9P6	CI163_HUMAN	chromosome 9 open reading frame 163	161										kidney(1)|lung(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.36e-06)|Epithelial(140;5.65e-06)		ATGCAGAGGTGGATGCTGCCT	0.627											OREG0019617	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													69.0	71.0	71.0					9																	139379382		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AK055336	CCDS7001.1	9q34.3	2006-03-21			ENSG00000196366	ENSG00000196366			26718	protein-coding gene	gene with protein product							Standard	NM_152571		Approved	FLJ36779	uc004chy.3	Q8N9P6	OTTHUMG00000131725	ENST00000354376.1:c.482G>A	9.37:g.139379382G>A	ENSP00000346345:p.Trp161*	Somatic	1648	WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.W161*	ENST00000354376.1	37	c.482	CCDS7001.1	9	.	.	.	.	.	.	.	.	.	.	G	39	7.649175	0.98412	.	.	ENSG00000196366	ENST00000354376	.	.	.	2.17	-0.904	0.10530	.	.	.	.	.	.	.	.	.	.	.	0.37732	D	0.925329	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.2145	0.15334	0.4646:0.0:0.5354:0.0	.	.	.	.	X	161	.	ENSP00000346345:W161X	W	+	2	0	C9orf163	138499203	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.739000	0.04866	-0.238000	0.09724	-0.291000	0.09656	TGG	C9orf163	-	NULL	ENSG00000196366		0.627	C9orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf163	HGNC	protein_coding	OTTHUMT00000254644.1	31	0.00	0	G	NM_152571		139379382	139379382	+1	no_errors	ENST00000354376	ensembl	human	known	69_37n	nonsense	17	26.09	6	SNP	0.000	A
CACNG5	27091	genome.wustl.edu	37	17	64876780	64876780	+	Silent	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr17:64876780G>A	ENST00000533854.1	+	4	627	c.390G>A	c.(388-390)ctG>ctA	p.L130L	CACNG5_ENST00000307139.3_Silent_p.L130L|CACNG5_ENST00000169565.3_Silent_p.L130L			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5	130					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GGACGATACTGGCCTTTGTCT	0.443																																						dbGAP											0													256.0	223.0	234.0					17																	64876780		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.390G>A	17.37:g.64876780G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g5su	p.L130	ENST00000533854.1	37	c.390	CCDS11665.1	17																																																																																			CACNG5	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000075429		0.443	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG5	HGNC	protein_coding	OTTHUMT00000389882.1	69	0.00	0	G	NM_014404, NM_145811		64876780	64876780	+1	no_errors	ENST00000169565	ensembl	human	known	69_37n	silent	63	13.70	10	SNP	1.000	A
CERS5	91012	genome.wustl.edu	37	12	50524370	50524370	+	Silent	SNP	C	C	G			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr12:50524370C>G	ENST00000317551.6	-	10	1261	c.1137G>C	c.(1135-1137)cgG>cgC	p.R379R	CERS5_ENST00000422340.2_Silent_p.R321R	NM_147190.2	NP_671723.1	Q8N5B7	CERS5_HUMAN	ceramide synthase 5	379					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										GACCATTCACCCGATTGGCAC	0.522																																						dbGAP											0													232.0	187.0	203.0					12																	50524370		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8801.1, CCDS61120.1	12q13.12	2014-09-04	2011-07-08	2011-07-08	ENSG00000139624			"""Homeoboxes / CERS class"""	23749	protein-coding gene	gene with protein product		615335	"""LAG1 longevity assurance homolog 5 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 5"""	LASS5			Standard	NM_147190		Approved	Trh4, MGC45411, FLJ25304	uc001rwd.4	Q8N5B7	OTTHUMG00000169819	ENST00000317551.6:c.1137G>C	12.37:g.50524370C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DV54	Silent	SNP	pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeodomain	p.R379	ENST00000317551.6	37	c.1137	CCDS8801.1	12																																																																																			CERS5	-	NULL	ENSG00000139624		0.522	CERS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERS5	HGNC	protein_coding	OTTHUMT00000406069.3	59	0.00	0	C	NM_147190		50524370	50524370	-1	no_errors	ENST00000317551	ensembl	human	known	69_37n	silent	48	10.91	6	SNP	0.346	G
CIT	11113	genome.wustl.edu	37	12	120150414	120150414	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr12:120150414C>A	ENST00000261833.7	-	35	4592	c.4540G>T	c.(4540-4542)Gca>Tca	p.A1514S	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.A1556S|MIR1178_ENST00000408396.1_RNA	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1514	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.A1542T(1)|p.A1514T(1)		breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GCTGTATTTGCGAGTTCGGAA	0.602																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											65.0	64.0	64.0					12																	120150414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.4540G>T	12.37:g.120150414C>A	ENSP00000261833:p.Ala1514Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.A1514S	ENST00000261833.7	37	c.4540	CCDS9192.1	12	.	.	.	.	.	.	.	.	.	.	C	12.38	1.919696	0.33908	.	.	ENSG00000122966	ENST00000392521;ENST00000261833	T;T	0.63096	0.01;-0.02	5.92	5.92	0.95590	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.366802	0.28754	N	0.014248	T	0.35335	0.0928	N	0.02539	-0.55	0.24569	N	0.993939	B;B;B	0.18610	0.029;0.01;0.001	B;B;B	0.17433	0.018;0.004;0.003	T	0.17561	-1.0365	10	0.45353	T	0.12	.	9.2144	0.37337	0.1482:0.7733:0.0:0.0784	.	1556;1514;1032	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	S	1556;1514	ENSP00000376306:A1556S;ENSP00000261833:A1514S	ENSP00000261833:A1514S	A	-	1	0	CIT	118634797	0.018000	0.18449	1.000000	0.80357	0.987000	0.75469	0.222000	0.17699	2.795000	0.96236	0.655000	0.94253	GCA	CIT	-	smart_Pleckstrin_homology,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology	ENSG00000122966		0.602	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	HGNC	protein_coding	OTTHUMT00000259410.4	15	0.00	0	C	NM_007174		120150414	120150414	-1	no_errors	ENST00000261833	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.754	A
CTNNA2	1496	genome.wustl.edu	37	2	80773146	80773146	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:80773146G>C	ENST00000402739.4	+	10	1503	c.1498G>C	c.(1498-1500)Gtg>Ctg	p.V500L	CTNNA2_ENST00000540488.1_Missense_Mutation_p.V500L|CTNNA2_ENST00000541047.1_Missense_Mutation_p.V500L|CTNNA2_ENST00000466387.1_Missense_Mutation_p.V500L|CTNNA2_ENST00000361291.4_Missense_Mutation_p.V534L|CTNNA2_ENST00000343114.3_Missense_Mutation_p.V179L|CTNNA2_ENST00000496558.1_Missense_Mutation_p.V500L	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	500					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GACAGAGGCCGTGGATGACAT	0.527																																						dbGAP											0													68.0	79.0	75.0					2																	80773146		2073	4199	6272	-	-	-	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1498G>C	2.37:g.80773146G>C	ENSP00000384638:p.Val500Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.V534L	ENST00000402739.4	37	c.1600		2	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366526	0.82463	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.9	5.9	0.94986	.	0.141330	0.47093	D	0.000250	T	0.62792	0.2457	M	0.77313	2.365	0.80722	D	1	P;P;P;P	0.46327	0.874;0.798;0.876;0.753	B;B;P;B	0.49502	0.385;0.33;0.613;0.436	T	0.61997	-0.6947	9	.	.	.	.	20.2664	0.98460	0.0:0.0:1.0:0.0	.	132;500;500;500	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	L	500;500;534;500;500;500;179;165	ENSP00000418191:V500L;ENSP00000419295:V500L;ENSP00000355398:V534L;ENSP00000384638:V500L;ENSP00000444675:V500L;ENSP00000441705:V500L;ENSP00000341500:V179L;ENSP00000386587:V165L	.	V	+	1	0	CTNNA2	80626657	1.000000	0.71417	0.966000	0.40874	0.949000	0.60115	9.869000	0.99810	2.786000	0.95864	0.561000	0.74099	GTG	CTNNA2	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	ENSG00000066032		0.527	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	23	0.00	0	G	NM_004389		80773146	80773146	+1	no_errors	ENST00000361291	ensembl	human	known	69_37n	missense	32	30.43	14	SNP	1.000	C
CYBRD1	79901	genome.wustl.edu	37	2	172411303	172411303	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:172411303C>T	ENST00000321348.4	+	4	1025	c.827C>T	c.(826-828)gCt>gTt	p.A276V	CYBRD1_ENST00000375252.3_3'UTR|CYBRD1_ENST00000409484.1_Missense_Mutation_p.A218V	NM_024843.3	NP_079119.3	Q53TN4	CYBR1_HUMAN	cytochrome b reductase 1	276					cellular iron ion homeostasis (GO:0006879)|response to iron ion (GO:0010039)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|oxidoreductase activity, oxidizing metal ions (GO:0016722)			endometrium(1)|kidney(1)|large_intestine(3)|liver(2)|lung(3)	10						AGAAACTTAGCTCTGGATGAG	0.438																																						dbGAP											0													66.0	64.0	65.0					2																	172411303		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027115	CCDS2244.1, CCDS46449.1, CCDS58736.1	2q31	2013-03-14			ENSG00000071967	ENSG00000071967		"""Cytochrome b genes"""	20797	protein-coding gene	gene with protein product	"""ferric-chelate reductase 3"", ""cytochrome b561 family, member A2"""	605745				11230685	Standard	NM_001127383		Approved	DCYTB, FLJ23462, FRRS3, CYB561A2	uc002ugy.4	Q53TN4	OTTHUMG00000132260	ENST00000321348.4:c.827C>T	2.37:g.172411303C>T	ENSP00000319141:p.Ala276Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE79|B4DWD7|Q6KC16|Q6KC17|Q6P147|Q6ZR51|Q9H0Q8|Q9H5G5	Missense_Mutation	SNP	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM	p.A276V	ENST00000321348.4	37	c.827	CCDS2244.1	2	.	.	.	.	.	.	.	.	.	.	C	7.665	0.685813	0.14973	.	.	ENSG00000071967	ENST00000409484;ENST00000321348	T;T	0.55588	0.51;0.51	5.16	0.824	0.18818	.	0.890365	0.09636	N	0.775640	T	0.30634	0.0771	N	0.22421	0.69	0.09310	N	1	B	0.21071	0.051	B	0.14023	0.01	T	0.20472	-1.0274	10	0.31617	T	0.26	1.0802	0.3961	0.00418	0.2616:0.2966:0.1272:0.3146	.	276	Q53TN4	CYBR1_HUMAN	V	218;276	ENSP00000386739:A218V;ENSP00000319141:A276V	ENSP00000319141:A276V	A	+	2	0	CYBRD1	172119549	0.002000	0.14202	0.003000	0.11579	0.353000	0.29299	1.006000	0.29847	0.201000	0.20466	0.655000	0.94253	GCT	CYBRD1	-	NULL	ENSG00000071967		0.438	CYBRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBRD1	HGNC	protein_coding	OTTHUMT00000255344.2	27	0.00	0	C	NM_024843		172411303	172411303	+1	no_errors	ENST00000321348	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	0.000	T
DDX55	57696	genome.wustl.edu	37	12	124104154	124104155	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr12:124104154_124104155delAA	ENST00000238146.4	+	13	1559_1560	c.1509_1510delAA	c.(1507-1512)agaagafs	p.RR503fs	DDX55_ENST00000421670.3_Frame_Shift_Del_p.RR110fs|DDX55_ENST00000541259.1_3'UTR|DDX55_ENST00000538744.1_Frame_Shift_Del_p.RR472fs|SNORA9_ENST00000384170.1_RNA	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	503	Lys-rich.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		AGCAACaaagaagagagaaaac	0.356																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1509_1510delAA	12.37:g.124104154_124104155delAA	ENSP00000238146:p.Arg503fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658L6|Q8IYH0|Q9HCH7	Frame_Shift_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.K506fs	ENST00000238146.4	37	c.1509_1510	CCDS9251.1	12																																																																																			DDX55	-	NULL	ENSG00000111364		0.356	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX55	HGNC	protein_coding	OTTHUMT00000400616.2	23	0.00	0	AA			124104154	124104155	+1	no_errors	ENST00000238146	ensembl	human	known	69_37n	frame_shift_del	23	14.29	4	DEL	0.942:0.875	-
DMGDH	29958	genome.wustl.edu	37	5	78338302	78338302	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr5:78338302A>T	ENST00000255189.3	-	7	1025	c.997T>A	c.(997-999)Ttt>Att	p.F333I	DMGDH_ENST00000540686.1_Intron|DMGDH_ENST00000380311.4_Missense_Mutation_p.F132I	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	333					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		TCCTTTCCAAAACCTAAAAAG	0.428																																						dbGAP											0													82.0	80.0	80.0					5																	78338302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.997T>A	5.37:g.78338302A>T	ENSP00000255189:p.Phe333Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBN0|B4E1J9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_SoxG	p.F333I	ENST00000255189.3	37	c.997	CCDS4044.1	5	.	.	.	.	.	.	.	.	.	.	A	26.6	4.754004	0.89843	.	.	ENSG00000132837	ENST00000255189;ENST00000523732;ENST00000380311;ENST00000539598	T;T;T	0.33865	1.39;1.39;1.39	5.25	5.25	0.73442	FAD dependent oxidoreductase (1);	0.050084	0.85682	D	0.000000	T	0.54549	0.1865	M	0.84326	2.69	0.80722	D	1	P;P;P	0.41710	0.684;0.511;0.76	P;B;P	0.49332	0.607;0.373;0.507	T	0.61840	-0.6980	10	0.72032	D	0.01	.	14.8638	0.70399	1.0:0.0:0.0:0.0	.	132;183;333	F8W6P8;F5H1C7;Q9UI17	.;.;M2GD_HUMAN	I	333;172;132;183	ENSP00000255189:F333I;ENSP00000430972:F172I;ENSP00000369667:F132I	ENSP00000255189:F333I	F	-	1	0	DMGDH	78374058	1.000000	0.71417	0.994000	0.49952	0.769000	0.43574	8.965000	0.93393	1.992000	0.58205	0.529000	0.55759	TTT	DMGDH	-	pfam_FAD-dep_OxRdtase	ENSG00000132837		0.428	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMGDH	HGNC	protein_coding	OTTHUMT00000226963.3	29	0.00	0	A	NM_013391		78338302	78338302	-1	no_errors	ENST00000255189	ensembl	human	known	69_37n	missense	2	76.92	10	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76482127	76482127	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr17:76482127T>A	ENST00000585328.1	-	46	7299	c.7175A>T	c.(7174-7176)tAc>tTc	p.Y2392F	RP11-559N14.5_ENST00000588565.1_RNA|DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.Y2383F|RP11-559N14.5_ENST00000585969.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2383					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ATCAATGTAGTAGTCAAAAAT	0.468																																						dbGAP											0													99.0	95.0	96.0					17																	76482127		1936	4138	6074	-	-	-	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.7175A>T	17.37:g.76482127T>A	ENSP00000465516:p.Tyr2392Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.Y2383F	ENST00000585328.1	37	c.7148		17	.	.	.	.	.	.	.	.	.	.	T	13.91	2.377869	0.42105	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.29655	1.56	4.95	4.95	0.65309	.	.	.	.	.	T	0.40145	0.1105	L	0.52126	1.63	0.44417	D	0.997332	.	.	.	.	.	.	T	0.10451	-1.0629	7	0.27785	T	0.31	.	14.6284	0.68638	0.0:0.0:0.0:1.0	.	.	.	.	F	2392;2383	ENSP00000374490:Y2383F	ENSP00000300671:Y2392F	Y	-	2	0	DNAH17	73993722	1.000000	0.71417	1.000000	0.80357	0.189000	0.23516	7.868000	0.87116	1.873000	0.54277	0.459000	0.35465	TAC	DNAH17	-	NULL	ENSG00000187775		0.468	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	32	0.00	0	T	NM_173628		76482127	76482127	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	44	19.30	11	SNP	1.000	A
DNMT3L	29947	genome.wustl.edu	37	21	45670749	45670749	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr21:45670749C>A	ENST00000418993.1	-	10	1336	c.853G>T	c.(853-855)Gtg>Ttg	p.V285L	DNMT3L_ENST00000270172.3_Missense_Mutation_p.V285L|AP001059.5_ENST00000442785.1_RNA	NM_175867.2	NP_787063.1	Q9UJW3	DNM3L_HUMAN	DNA (cytosine-5-)-methyltransferase 3-like	285					chorionic trophoblast cell differentiation (GO:0060718)|DNA methylation (GO:0006306)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|placenta development (GO:0001890)|positive regulation of catalytic activity (GO:0043085)|regulation of gene expression by genetic imprinting (GO:0006349)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	11				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		AGATTGTCCACGAACATCCAG	0.652																																						dbGAP											0													72.0	63.0	66.0					21																	45670749		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF194032	CCDS13705.1	21q22.3	2008-07-31			ENSG00000142182	ENSG00000142182			2980	protein-coding gene	gene with protein product	"""cytosine-5-methyltransferase 3-like protein"", ""human cytosine-5-methyltransferase 3-like protein"""	606588				10857753	Standard	NM_013369		Approved	MGC1090	uc002zeh.2	Q9UJW3	OTTHUMG00000086914	ENST00000418993.1:c.853G>T	21.37:g.45670749C>A	ENSP00000412862:p.Val285Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PB42|Q9BUJ4	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.V285L	ENST00000418993.1	37	c.853	CCDS46650.1	21	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246668	0.22796	.	.	ENSG00000142182	ENST00000270172;ENST00000418993;ENST00000431166	T;T;T	0.38401	1.14;1.14;1.14	2.87	0.969	0.19686	.	0.176729	0.36591	N	0.002507	T	0.27559	0.0677	M	0.65975	2.015	0.23174	N	0.998171	P;P	0.43857	0.819;0.819	B;B	0.35413	0.202;0.202	T	0.19778	-1.0295	10	0.51188	T	0.08	-11.585	5.194	0.15225	0.0:0.7128:0.0:0.2872	.	285;285	Q9UJW3-2;Q9UJW3	.;DNM3L_HUMAN	L	285;285;270	ENSP00000270172:V285L;ENSP00000412862:V285L;ENSP00000400242:V270L	ENSP00000270172:V285L	V	-	1	0	DNMT3L	44495177	0.983000	0.35010	0.696000	0.30242	0.573000	0.36030	2.866000	0.48420	0.231000	0.21079	0.555000	0.69702	GTG	DNMT3L	-	NULL	ENSG00000142182		0.652	DNMT3L-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	DNMT3L	HGNC	protein_coding	OTTHUMT00000195820.1	15	0.00	0	C	NM_013369		45670749	45670749	-1	no_errors	ENST00000270172	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.948	A
DSG4	147409	genome.wustl.edu	37	18	28991149	28991149	+	Intron	SNP	T	T	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr18:28991149T>C	ENST00000308128.4	+	15	2272				DSG4_ENST00000359747.4_Missense_Mutation_p.L717P|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4						anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AGATGCGCGCTGCAGGCAACT	0.572																																						dbGAP											0													71.0	67.0	69.0					18																	28991149		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2138-45T>C	18.37:g.28991149T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin,pfscan_Cadherin	p.L717P	ENST00000308128.4	37	c.2150	CCDS11897.1	18	.	.	.	.	.	.	.	.	.	.	T	7.803	0.713955	0.15306	.	.	ENSG00000175065	ENST00000359747	T	0.59224	0.28	3.61	-1.02	0.10135	.	.	.	.	.	T	0.34803	0.0910	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.15235	-1.0444	8	0.29301	T	0.29	.	2.6666	0.05053	0.2165:0.3805:0.0:0.403	.	717	Q86SJ6-2	.	P	717	ENSP00000352785:L717P	ENSP00000352785:L717P	L	+	2	0	DSG4	27245147	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.931000	0.01556	-0.300000	0.08895	0.528000	0.53228	CTG	DSG4	-	NULL	ENSG00000175065		0.572	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	HGNC	protein_coding	OTTHUMT00000254941.1	56	0.00	0	T	NM_177986		28991149	28991149	+1	no_errors	ENST00000359747	ensembl	human	known	69_37n	missense	47	11.11	6	SNP	0.000	C
EIF2AK4	440275	genome.wustl.edu	37	15	40265856	40265856	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr15:40265856T>C	ENST00000263791.5	+	11	1767	c.1724T>C	c.(1723-1725)tTc>tCc	p.F575S	EIF2AK4_ENST00000559624.1_Missense_Mutation_p.F575S|EIF2AK4_ENST00000382727.2_Missense_Mutation_p.F575S	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	575					cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		AGTGCTGCCTTCTTTAGTGAG	0.433																																						dbGAP											0													168.0	159.0	162.0					15																	40265856		1894	4113	6007	-	-	-	SO:0001583	missense	0			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1724T>C	15.37:g.40265856T>C	ENSP00000263791:p.Phe575Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RWD-domain,superfamily_Kinase-like_dom,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Anticodon-bd,smart_RWD-domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_GCN2,pfscan_RWD-domain,pfscan_Prot_kinase_cat_dom	p.F575S	ENST00000263791.5	37	c.1724	CCDS42016.1	15	.	.	.	.	.	.	.	.	.	.	T	15.10	2.733518	0.48939	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.70516	-0.49;-0.49	5.74	3.32	0.38043	.	0.213174	0.49916	N	0.000126	T	0.61438	0.2347	L	0.59436	1.845	0.44825	D	0.997832	B;B	0.11235	0.001;0.004	B;B	0.17098	0.003;0.017	T	0.52734	-0.8536	10	0.17832	T	0.49	-6.1932	8.087	0.30777	0.0:0.0701:0.1357:0.7942	.	575;575	Q9P2K8;Q9P2K8-3	E2AK4_HUMAN;.	S	575	ENSP00000263791:F575S;ENSP00000372174:F575S	ENSP00000263791:F575S	F	+	2	0	EIF2AK4	38053148	1.000000	0.71417	0.947000	0.38551	0.940000	0.58332	4.024000	0.57218	1.012000	0.39366	0.482000	0.46254	TTC	EIF2AK4	-	pirsf_Ser/Thr_kinase_GCN2	ENSG00000128829		0.433	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK4	HGNC	protein_coding	OTTHUMT00000418395.1	34	0.00	0	T			40265856	40265856	+1	no_errors	ENST00000263791	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	C
EPS8L1	54869	genome.wustl.edu	37	19	55597838	55597838	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr19:55597838C>G	ENST00000201647.6	+	17	1785	c.1729C>G	c.(1729-1731)Cgc>Ggc	p.R577G	EPS8L1_ENST00000245618.5_Missense_Mutation_p.R450G|EPS8L1_ENST00000586329.1_Intron|EPS8L1_ENST00000540810.1_Missense_Mutation_p.R513G|EPS8L1_ENST00000588359.1_Missense_Mutation_p.R263G	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	577					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GGACAGGCCCCGCTGGGACAG	0.672																																					Ovarian(149;255 1863 3636 27051 29647)	dbGAP											0													26.0	21.0	23.0					19																	55597838		2056	4029	6085	-	-	-	SO:0001583	missense	0			AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.1729C>G	19.37:g.55597838C>G	ENSP00000201647:p.Arg577Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_SH3_domain	p.R577G	ENST00000201647.6	37	c.1729	CCDS12914.1	19	.	.	.	.	.	.	.	.	.	.	c	8.358	0.832394	0.16820	.	.	ENSG00000131037	ENST00000201647;ENST00000540810;ENST00000245618;ENST00000539118	T;T;T	0.06449	3.58;3.3;3.3	3.97	3.97	0.46021	.	11.584200	0.00357	U	0.000025	T	0.07324	0.0185	L	0.29908	0.895	0.26666	N	0.971825	B;B;B	0.29253	0.0;0.239;0.0	B;B;B	0.23018	0.001;0.043;0.0	T	0.31308	-0.9948	10	0.22706	T	0.39	-0.3251	12.4234	0.55532	0.0:1.0:0.0:0.0	.	356;450;577	Q8TE68-4;Q8TE68-2;Q8TE68	.;.;ES8L1_HUMAN	G	577;513;450;263	ENSP00000201647:R577G;ENSP00000437541:R513G;ENSP00000245618:R450G	ENSP00000201647:R577G	R	+	1	0	EPS8L1	60289650	0.001000	0.12720	0.968000	0.41197	0.588000	0.36517	-0.150000	0.10189	2.214000	0.71695	0.289000	0.19496	CGC	EPS8L1	-	NULL	ENSG00000131037		0.672	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8L1	HGNC	protein_coding	OTTHUMT00000451713.1	22	0.00	0	C	NM_017729		55597838	55597838	+1	no_errors	ENST00000201647	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	0.990	G
FAM47A	158724	genome.wustl.edu	37	X	34148765	34148765	+	Missense_Mutation	SNP	C	C	T	rs45577239		TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chrX:34148765C>T	ENST00000346193.3	-	1	1682	c.1631G>A	c.(1630-1632)cGc>cAc	p.R544H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	544										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AAGCTCCGGGCGGAGACTGGA	0.632																																						dbGAP											0													46.0	50.0	49.0					X																	34148765		2197	4293	6490	-	-	-	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1631G>A	X.37:g.34148765C>T	ENSP00000345029:p.Arg544His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.R544H	ENST00000346193.3	37	c.1631	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	c	0.578	-0.838197	0.02692	.	.	ENSG00000185448	ENST00000346193	T	0.21191	2.02	0.673	-0.659	0.11424	.	.	.	.	.	T	0.23210	0.0561	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	D	0.64237	0.923	T	0.15549	-1.0433	8	0.42905	T	0.14	.	.	.	.	rs45577239	544	Q5JRC9	FA47A_HUMAN	H	544	ENSP00000345029:R544H	ENSP00000345029:R544H	R	-	2	0	FAM47A	34058686	0.085000	0.21516	0.001000	0.08648	0.015000	0.08874	-0.567000	0.05916	-0.334000	0.08463	0.271000	0.19318	CGC	FAM47A	-	NULL	ENSG00000185448		0.632	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	39	0.00	0	C	NM_203408		34148765	34148765	-1	no_errors	ENST00000346193	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	0.010	T
FAM49B	51571	genome.wustl.edu	37	8	130891704	130891704	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr8:130891704C>A	ENST00000519824.2	-	3	277	c.4G>T	c.(4-6)Ggg>Tgg	p.G2W	FAM49B_ENST00000401979.2_Missense_Mutation_p.G2W|FAM49B_ENST00000522941.1_Intron|FAM49B_ENST00000519540.1_Missense_Mutation_p.G2W|FAM49B_ENST00000519110.1_Missense_Mutation_p.G2W|FAM49B_ENST00000522746.1_Missense_Mutation_p.G2W|FAM49B_ENST00000522250.1_Intron|FAM49B_ENST00000517654.1_Missense_Mutation_p.G2W|FAM49B_ENST00000523509.1_Missense_Mutation_p.G2W|FAM49B_ENST00000518879.1_Intron	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	2						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			AGAAGATTCCCCATGTTAAGG	0.323																																						dbGAP											0													80.0	81.0	81.0					8																	130891704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.4G>T	8.37:g.130891704C>A	ENSP00000429150:p.Gly2Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AZ5|Q9NW21|Q9NZE7	Missense_Mutation	SNP	pfam_DUF1394	p.G2W	ENST00000519824.2	37	c.4	CCDS6361.1	8	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382106	0.61845	.	.	ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000519142;ENST00000520204;ENST00000518283;ENST00000523993;ENST00000520254;ENST00000519020;ENST00000518167;ENST00000517672;ENST00000519070;ENST00000522361	T;T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.85474	0.5705	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87423	0.2383	10	0.87932	D	0	-12.4728	19.0666	0.93114	0.0:1.0:0.0:0.0	.	2	Q9NUQ9	FA49B_HUMAN	W	2	ENSP00000428117:G2W;ENSP00000429802:G2W;ENSP00000384880:G2W;ENSP00000429078:G2W;ENSP00000429150:G2W;ENSP00000430674:G2W;ENSP00000429499:G2W	ENSP00000384880:G2W	G	-	1	0	FAM49B	130960886	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.579000	0.67457	2.736000	0.93811	0.655000	0.94253	GGG	FAM49B	-	NULL	ENSG00000153310		0.323	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49B	HGNC	protein_coding	OTTHUMT00000380390.2	44	0.00	0	C	NM_016623		130891704	130891704	-1	no_errors	ENST00000401979	ensembl	human	known	69_37n	missense	67	12.99	10	SNP	1.000	A
FBXL7	23194	genome.wustl.edu	37	5	15500794	15500794	+	Silent	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr5:15500794G>C	ENST00000504595.1	+	1	490	c.9G>C	c.(7-9)gcG>gcC	p.A3A	FBXL7_ENST00000510662.1_5'Flank	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	3					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GGATGGGCGCGAACAATGGCA	0.701																																						dbGAP											0													97.0	122.0	114.0					5																	15500794		2105	4216	6321	-	-	-	SO:0001819	synonymous_variant	0			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.9G>C	5.37:g.15500794G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGF1|D6RDY7|O94926	Silent	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.A3	ENST00000504595.1	37	c.9	CCDS54833.1	5																																																																																			FBXL7	-	NULL	ENSG00000183580		0.701	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	HGNC	protein_coding	OTTHUMT00000366117.1	20	0.00	0	G	NM_012304		15500794	15500794	+1	no_errors	ENST00000504595	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	1.000	C
FRG1	2483	genome.wustl.edu	37	4	190878577	190878577	+	Missense_Mutation	SNP	A	A	G	rs200267221		TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr4:190878577A>G	ENST00000226798.4	+	6	679	c.457A>G	c.(457-459)Aat>Gat	p.N153D	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	153					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GTTGGCCTCAAATAGCTGCTT	0.353																																						dbGAP											0													14.0	18.0	17.0					4																	190878577		2154	4261	6415	-	-	-	SO:0001583	missense	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.457A>G	4.37:g.190878577A>G	ENSP00000226798:p.Asn153Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K775	Missense_Mutation	SNP	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	p.N153D	ENST00000226798.4	37	c.457	CCDS34121.1	4	.	.	.	.	.	.	.	.	.	.	.	16.34	3.096595	0.56075	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.50548	1.75;0.74	4.19	2.99	0.34606	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	M	0.88105	2.93	0.58432	D	0.999994	P	0.35033	0.481	P	0.49085	0.6	T	0.60182	-0.7313	10	0.38643	T	0.18	-7.9248	8.2154	0.31507	0.9006:0.0:0.0994:0.0	.	153	Q14331	FRG1_HUMAN	D	153;25;90	ENSP00000226798:N153D;ENSP00000435943:N90D	ENSP00000226798:N153D	N	+	1	0	FRG1	191115571	1.000000	0.71417	1.000000	0.80357	0.430000	0.31655	9.035000	0.93752	0.593000	0.29745	-0.580000	0.04137	AAT	FRG1	-	pfam_FRG1,superfamily_Actin_cross-linking	ENSG00000109536		0.353	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	HGNC	protein_coding	OTTHUMT00000359622.4	68	0.00	0	A	NM_004477		190878577	190878577	+1	no_errors	ENST00000226798	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	G
GNAI3	2773	genome.wustl.edu	37	1	110121878	110121878	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:110121878T>C	ENST00000369851.4	+	4	466	c.356T>C	c.(355-357)aTg>aCg	p.M119T		NM_006496.3	NP_006487.1	P08754	GNAI3_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3	119					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|negative regulation of adenylate cyclase activity (GO:0007194)|platelet activation (GO:0030168)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle fusion (GO:0006906)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|plasma membrane (GO:0005886)|zymogen granule (GO:0042588)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.046)|Colorectal(144;0.119)|Epithelial(280;0.139)|all cancers(265;0.147)|LUSC - Lung squamous cell carcinoma(189;0.237)		GAAGGAGTCATGACTCCAGAA	0.443																																						dbGAP											0													155.0	141.0	145.0					1																	110121878		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27543	CCDS802.1	1p13	2012-10-02			ENSG00000065135	ENSG00000065135			4387	protein-coding gene	gene with protein product		139370				3109953	Standard	NM_006496		Approved	87U6	uc001dxz.3	P08754	OTTHUMG00000011648	ENST00000369851.4:c.356T>C	1.37:g.110121878T>C	ENSP00000358867:p.Met119Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	P17539|Q5TZX1	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I,prints_Fungi_GproteinA	p.M119T	ENST00000369851.4	37	c.356	CCDS802.1	1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.442267	0.63067	.	.	ENSG00000065135	ENST00000369851	D	0.88586	-2.4	5.62	5.62	0.85841	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.83977	0.5371	L	0.42529	1.33	0.80722	D	1	B	0.21309	0.054	B	0.35931	0.214	D	0.83781	0.0225	10	0.87932	D	0	.	15.4862	0.75569	0.0:0.0:0.0:1.0	.	119	P08754	GNAI3_HUMAN	T	119	ENSP00000358867:M119T	ENSP00000358867:M119T	M	+	2	0	GNAI3	109923401	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.953000	0.87836	2.140000	0.66376	0.482000	0.46254	ATG	GNAI3	-	pfam_Gprotein_alpha_su,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000065135		0.443	GNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI3	HGNC	protein_coding	OTTHUMT00000032222.1	45	0.00	0	T	NM_006496		110121878	110121878	+1	no_errors	ENST00000369851	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	C
HERC3	8916	genome.wustl.edu	37	4	89577057	89577057	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr4:89577057G>A	ENST00000402738.1	+	9	1179	c.940G>A	c.(940-942)Gga>Aga	p.G314R	HERC3_ENST00000407637.1_Missense_Mutation_p.G314R|HERC3_ENST00000264345.3_Missense_Mutation_p.G314R|HERC3_ENST00000543130.1_5'Flank	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	314					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GCCTTCTTCTGGACTCATCTA	0.433																																						dbGAP											0													223.0	203.0	210.0					4																	89577057		2203	4300	6503	-	-	-	SO:0001583	missense	0			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.940G>A	4.37:g.89577057G>A	ENSP00000385684:p.Gly314Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1S5|Q8IXX3	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.G314R	ENST00000402738.1	37	c.940	CCDS34028.1	4	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966269	0.92855	.	.	ENSG00000138641	ENST00000402738;ENST00000407637;ENST00000264345	D;D;D	0.98060	-4.69;-4.69;-4.69	4.9	4.9	0.64082	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.055836	0.64402	D	0.000001	D	0.99089	0.9687	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.75020	0.977;0.985	D	0.99342	1.0912	10	0.87932	D	0	.	18.2929	0.90136	0.0:0.0:1.0:0.0	.	314;314	Q15034;Q8IXX3	HERC3_HUMAN;.	R	314	ENSP00000385684:G314R;ENSP00000384005:G314R;ENSP00000264345:G314R	ENSP00000264345:G314R	G	+	1	0	HERC3	89796080	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	5.295000	0.65692	2.547000	0.85894	0.655000	0.94253	GGA	HERC3	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	ENSG00000138641		0.433	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC3	HGNC	protein_coding	OTTHUMT00000318081.2	96	0.00	0	G	NM_014606		89577057	89577057	+1	no_errors	ENST00000264345	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	1.000	A
HRC	3270	genome.wustl.edu	37	19	49656737	49656737	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr19:49656737G>C	ENST00000252825.4	-	1	1944	c.1758C>G	c.(1756-1758)atC>atG	p.I586M	HRC_ENST00000595625.1_Missense_Mutation_p.I586M	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	586					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		GGTTGGGGATGATGGTGAAGC	0.642																																					Melanoma(37;75 1097 24567 25669 30645)	dbGAP											0													56.0	46.0	49.0					19																	49656737		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1758C>G	19.37:g.49656737G>C	ENSP00000252825:p.Ile586Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.I586M	ENST00000252825.4	37	c.1758	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317446	0.40996	.	.	ENSG00000130528	ENST00000252825;ENST00000391863	T	0.46819	0.86	2.84	1.78	0.24846	.	.	.	.	.	T	0.53351	0.1791	L	0.60455	1.87	0.31121	N	0.708803	D	0.61080	0.989	P	0.59221	0.854	T	0.54146	-0.8337	9	0.42905	T	0.14	-2.946	5.0915	0.14710	0.1757:0.0:0.8243:0.0	.	586	P23327	SRCH_HUMAN	M	586;276	ENSP00000252825:I586M	ENSP00000252825:I586M	I	-	3	3	HRC	54348549	0.983000	0.35010	0.998000	0.56505	0.697000	0.40408	1.109000	0.31135	0.741000	0.32674	0.462000	0.41574	ATC	HRC	-	NULL	ENSG00000130528		0.642	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	16	0.00	0	G	NM_002152		49656737	49656737	-1	no_errors	ENST00000252825	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	1.000	C
INTS6	26512	genome.wustl.edu	37	13	51948544	51948544	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr13:51948544A>C	ENST00000311234.4	-	15	2376	c.1904T>G	c.(1903-1905)gTg>gGg	p.V635G	INTS6_ENST00000497989.1_Missense_Mutation_p.V457G|INTS6_ENST00000463928.1_Intron|INTS6_ENST00000490542.1_Missense_Mutation_p.V319G|INTS6_ENST00000425000.1_Missense_Mutation_p.V203G|INTS6_ENST00000398119.2_Missense_Mutation_p.V622G	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	635					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		AGGTCCAGCCACAAATTCATC	0.388																																						dbGAP											0													110.0	113.0	112.0					13																	51948544		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.1904T>G	13.37:g.51948544A>C	ENSP00000310260:p.Val635Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense_Mutation	SNP	pfam_VWF_A,pfscan_VWF_A	p.V635G	ENST00000311234.4	37	c.1904	CCDS9428.1	13	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630536	0.67015	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000497989;ENST00000425000;ENST00000490542	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.51092	0.1654	M	0.67397	2.05	0.80722	D	1	D	0.59357	0.985	P	0.58660	0.843	T	0.45731	-0.9241	10	0.20046	T	0.44	-10.3181	14.4952	0.67683	1.0:0.0:0.0:0.0	.	635	Q9UL03	INT6_HUMAN	G	635;622;457;203;319	ENSP00000310260:V635G;ENSP00000381187:V622G;ENSP00000419871:V457G;ENSP00000406915:V203G;ENSP00000419984:V319G	ENSP00000310260:V635G	V	-	2	0	INTS6	50846545	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.287000	0.95975	2.065000	0.61736	0.482000	0.46254	GTG	INTS6	-	NULL	ENSG00000102786		0.388	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS6	HGNC	protein_coding	OTTHUMT00000045023.1	60	0.00	0	A	NM_012141		51948544	51948544	-1	no_errors	ENST00000311234	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	C
ITGB4	3691	genome.wustl.edu	37	17	73723282	73723282	+	Silent	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr17:73723282C>A	ENST00000200181.3	+	3	274	c.87C>A	c.(85-87)cgC>cgA	p.R29R	ITGB4_ENST00000449880.2_Silent_p.R29R|ITGB4_ENST00000339591.3_Silent_p.R29R|ITGB4_ENST00000450894.3_Silent_p.R29R|ITGB4_ENST00000579662.1_Silent_p.R29R|ITGB4_ENST00000584558.1_3'UTR	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	29	PSI.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGCAAACCGCTGCAAGAAGG	0.602																																						dbGAP											0													72.0	54.0	60.0					17																	73723282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.87C>A	17.37:g.73723282C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Silent	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,pfscan_Fibronectin_type3,prints_Integrin_bsu	p.R29	ENST00000200181.3	37	c.87	CCDS11727.1	17																																																																																			ITGB4	-	pirsf_Integrin_bsu-4,superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000132470		0.602	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	17	0.00	0	C			73723282	73723282	+1	no_errors	ENST00000200181	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	1.000	A
KIAA1429	25962	genome.wustl.edu	37	8	95504889	95504889	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr8:95504889A>T	ENST00000297591.5	-	21	4874	c.4799T>A	c.(4798-4800)aTa>aAa	p.I1600K	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1600					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CCTTGACGTTATAAAGGTCTC	0.383																																						dbGAP											0													149.0	143.0	145.0					8																	95504889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4799T>A	8.37:g.95504889A>T	ENSP00000297591:p.Ile1600Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.I1600K	ENST00000297591.5	37	c.4799	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629624	0.46944	.	.	ENSG00000164944	ENST00000297591	T	0.46063	0.88	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.60495	0.2273	L	0.59436	1.845	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.59653	-0.7414	10	0.41790	T	0.15	-17.3735	15.505	0.75731	1.0:0.0:0.0:0.0	.	1600	Q69YN4	VIR_HUMAN	K	1600	ENSP00000297591:I1600K	ENSP00000297591:I1600K	I	-	2	0	KIAA1429	95574065	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.905000	0.92613	2.060000	0.61445	0.477000	0.44152	ATA	KIAA1429	-	NULL	ENSG00000164944		0.383	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2	82	0.00	0	A	NM_015496		95504889	95504889	-1	no_errors	ENST00000297591	ensembl	human	known	69_37n	missense	105	11.76	14	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	GL000209.1	95619	95619	+	IGR	SNP	G	G	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chrGL000209.1:95619G>T								None (None upstream) : None (None downstream)																							CAAATGCTAAGCCAAGATCAT	0.502																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															GL000209.1.37:g.95619G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.K335N		37	c.1005		GL000209.1																																																																																			KIR2DL2	-	NULL	ENSG00000215764	0	0.502					KIR2DL2	HGNC			62	0.00	0	G			95619	95619	+1	no_errors	ENST00000391731	ensembl	human	known	69_37n	missense	46	25.81	16	SNP	NULL	T
KRT9	3857	genome.wustl.edu	37	17	39724452	39724452	+	Silent	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr17:39724452C>T	ENST00000246662.4	-	6	1421	c.1356G>A	c.(1354-1356)gaG>gaA	p.E452E	KRT9_ENST00000588431.1_Silent_p.E219E	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	452	Coil 2.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				TGTGGTAGGTCTCGATTTCCT	0.552																																						dbGAP											0													89.0	83.0	85.0					17																	39724452		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.1356G>A	17.37:g.39724452C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00109|Q0IJ47|Q14665	Silent	SNP	pfam_F,prints_Keratin_I	p.E452	ENST00000246662.4	37	c.1356	CCDS32654.1	17																																																																																			KRT9	-	pfam_F	ENSG00000171403		0.552	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT9	HGNC	protein_coding	OTTHUMT00000257707.1	49	0.00	0	C	NM_000226		39724452	39724452	-1	no_errors	ENST00000246662	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	0.004	T
LRRC40	55631	genome.wustl.edu	37	1	70621394	70621394	+	Missense_Mutation	SNP	G	G	C	rs374870819		TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:70621394G>C	ENST00000370952.3	-	11	1385	c.1306C>G	c.(1306-1308)Caa>Gaa	p.Q436E		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	436						membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TCACATAGTTGATTCTTACTG	0.328																																						dbGAP											0													155.0	150.0	152.0					1																	70621394		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.1306C>G	1.37:g.70621394G>C	ENSP00000359990:p.Gln436Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q436E	ENST00000370952.3	37	c.1306	CCDS646.1	1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.454441	0.26161	.	.	ENSG00000066557	ENST00000370952	T	0.52526	0.66	5.8	3.9	0.45041	.	0.220081	0.47852	D	0.000208	T	0.31734	0.0806	M	0.72894	2.215	0.51767	D	0.999934	B	0.02656	0.0	B	0.01281	0.0	T	0.19386	-1.0307	10	0.26408	T	0.33	.	16.3097	0.82864	0.0:0.2496:0.7504:0.0	.	436	Q9H9A6	LRC40_HUMAN	E	436	ENSP00000359990:Q436E	ENSP00000359990:Q436E	Q	-	1	0	LRRC40	70393982	1.000000	0.71417	0.982000	0.44146	0.237000	0.25408	5.150000	0.64869	0.768000	0.33290	0.650000	0.86243	CAA	LRRC40	-	NULL	ENSG00000066557		0.328	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC40	HGNC	protein_coding	OTTHUMT00000025914.1	104	0.00	0	G	NM_017768		70621394	70621394	-1	no_errors	ENST00000370952	ensembl	human	known	69_37n	missense	67	23.86	21	SNP	1.000	C
METTL21A	151194	genome.wustl.edu	37	2	208477909	208477909	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:208477909C>T	ENST00000411432.1	-	4	734	c.518G>A	c.(517-519)tGc>tAc	p.C173Y	METTL21A_ENST00000448823.2_3'UTR|METTL21A_ENST00000272839.3_Missense_Mutation_p.C191Y|METTL21A_ENST00000477919.1_5'Flank|METTL21A_ENST00000406927.2_Missense_Mutation_p.C173Y|METTL21A_ENST00000425132.1_Intron|METTL21A_ENST00000426075.1_Missense_Mutation_p.C173Y|METTL21A_ENST00000442521.1_Missense_Mutation_p.C173Y|METTL21A_ENST00000432416.1_Intron|METTL21A_ENST00000458426.1_Intron|METTL21A_ENST00000448007.2_Missense_Mutation_p.C173Y	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	173					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						GCGAATTCGGCATGCTAAAAG	0.378																																						dbGAP											0													148.0	148.0	148.0					2																	208477909		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.518G>A	2.37:g.208477909C>T	ENSP00000415115:p.Cys173Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53RV0|Q8N1Z9|Q96GH6	Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom	p.C173Y	ENST00000411432.1	37	c.518	CCDS2376.1	2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580910	0.86748	.	.	ENSG00000144401	ENST00000411432;ENST00000448007;ENST00000272839;ENST00000406927;ENST00000426075;ENST00000442521	T;T;T;T;T;T	0.04970	3.52;3.52;3.52;3.52;3.52;3.52	5.36	5.36	0.76844	.	0.041245	0.85682	D	0.000000	T	0.11239	0.0274	N	0.17594	0.5	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.08827	-1.0703	10	0.02654	T	1	-11.9203	19.2753	0.94029	0.0:1.0:0.0:0.0	.	173	Q8WXB1	MT21A_HUMAN	Y	173;173;191;173;173;173	ENSP00000415115:C173Y;ENSP00000407622:C173Y;ENSP00000272839:C191Y;ENSP00000385481:C173Y;ENSP00000403317:C173Y;ENSP00000392062:C173Y	ENSP00000272839:C191Y	C	-	2	0	METTL21A	208186154	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.443000	0.80521	2.797000	0.96272	0.561000	0.74099	TGC	METTL21A	-	pfam_Nicotinamide_N-MeTfrase-like,pfam_Ribosomal-L11_MeTrfase_PrmA	ENSG00000144401		0.378	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21A	HGNC	protein_coding	OTTHUMT00000337044.1	64	0.00	0	C	NM_145280		208477909	208477909	-1	no_errors	ENST00000406927	ensembl	human	known	69_37n	missense	31	41.51	22	SNP	1.000	T
MPG	4350	genome.wustl.edu	37	16	129524	129524	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr16:129524G>C	ENST00000219431.4	+	3	371	c.140G>C	c.(139-141)aGc>aCc	p.S47T	MPG_ENST00000397817.1_Missense_Mutation_p.S30T|MPG_ENST00000475280.1_3'UTR	NM_002434.3	NP_002425.2	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase	47					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)	alkylbase DNA N-glycosylase activity (GO:0003905)|damaged DNA binding (GO:0003684)|DNA-3-methyladenine glycosylase activity (GO:0008725)|DNA-3-methylguanine glycosylase activity (GO:0052822)|DNA-7-methyladenine glycosylase activity (GO:0052821)|DNA-7-methylguanine glycosylase activity (GO:0043916)			endometrium(4)|kidney(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				CAGCCACACAGCTCGTCCGAT	0.642								Base excision repair (BER), DNA glycosylases																														dbGAP											0													41.0	44.0	43.0					16																	129524		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS32345.1, CCDS32346.1, CCDS42087.1	16p13.3	2008-07-29			ENSG00000103152	ENSG00000103152	3.2.2.21		7211	protein-coding gene	gene with protein product	"""alkyladenine DNA glycosylase"""	156565				1874728	Standard	NM_002434		Approved	MDG	uc002cfo.4	P29372	OTTHUMG00000047887	ENST00000219431.4:c.140G>C	16.37:g.129524G>C	ENSP00000219431:p.Ser47Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9E2|Q13770|Q15275|Q15961|Q5J9I4|Q96BZ6|Q96S33|Q9NNX5	Missense_Mutation	SNP	pfam_PurDNA_glycsylse,superfamily_Formyl_transferase_C-like,tigrfam_PurDNA_glycsylse	p.S47T	ENST00000219431.4	37	c.140	CCDS32346.1	16	.	.	.	.	.	.	.	.	.	.	g	4.073	0.011483	0.07912	.	.	ENSG00000103152	ENST00000436333;ENST00000397817;ENST00000356432;ENST00000219431	T;T;T;T	0.09817	2.94;3.12;3.11;3.1	2.32	-0.988	0.10245	.	1.314480	0.05300	N	0.522866	T	0.06962	0.0177	N	0.24115	0.695	0.09310	N	1	B;B;B	0.17852	0.024;0.011;0.024	B;B;B	0.10450	0.005;0.005;0.005	T	0.40251	-0.9573	10	0.44086	T	0.13	-3.1258	2.318	0.04203	0.3003:0.0:0.4588:0.2409	.	30;42;47	A2IDA3;Q5J9I4;P29372	.;.;3MG_HUMAN	T	30;30;42;47	ENSP00000388097:S30T;ENSP00000380918:S30T;ENSP00000348809:S42T;ENSP00000219431:S47T	ENSP00000219431:S47T	S	+	2	0	MPG	69524	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.858000	0.04281	-0.162000	0.10964	0.538000	0.68166	AGC	MPG	-	NULL	ENSG00000103152		0.642	MPG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPG	HGNC	protein_coding	OTTHUMT00000109121.4	17	0.00	0	G			129524	129524	+1	no_errors	ENST00000219431	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.000	C
MTR	4548	genome.wustl.edu	37	1	237015844	237015844	+	Silent	SNP	A	A	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:237015844A>C	ENST00000366577.5	+	17	2113	c.1719A>C	c.(1717-1719)atA>atC	p.I573I	MTR_ENST00000535889.1_Silent_p.I573I	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	573	Pterin-binding. {ECO:0000255|PROSITE- ProRule:PRU00334}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GAGCCAGAATAAGTGGAGGTC	0.393																																						dbGAP											0													70.0	72.0	72.0					1																	237015844		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.1719A>C	1.37:g.237015844A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Silent	SNP	pfam_S_MeTrfase,pfam_VitB12-dep_Met_synth_activ_dom,pfam_Pterin-binding,pfam_Cbl-bd_cap,pfam_Cobalamin-bd,superfamily_VitB12-dep_Met_synth_activ_dom,superfamily_S_MeTrfase,superfamily_Dihydropteroate_synth-like,superfamily_Cobalamin-bd,superfamily_Cbl-bd_cap,pirsf_MetH,pfscan_VitB12-dep_Met_synth_activ_dom,pfscan_S_MeTrfase,pfscan_Pterin-binding,tigrfam_MetH	p.I573	ENST00000366577.5	37	c.1719	CCDS1614.1	1																																																																																			MTR	-	pfam_Pterin-binding,superfamily_Dihydropteroate_synth-like,pirsf_MetH,pfscan_Pterin-binding,tigrfam_MetH	ENSG00000116984		0.393	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	HGNC	protein_coding	OTTHUMT00000096632.2	29	0.00	0	A	NM_000254		237015844	237015844	+1	no_errors	ENST00000366577	ensembl	human	known	69_37n	silent	26	23.53	8	SNP	1.000	C
NLRP12	91662	genome.wustl.edu	37	19	54299149	54299149	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr19:54299149C>T	ENST00000324134.6	-	9	3230	c.3062G>A	c.(3061-3063)cGg>cAg	p.R1021Q	NLRP12_ENST00000345770.5_Intron|NLRP12_ENST00000351894.4_Missense_Mutation_p.R909Q|NLRP12_ENST00000391773.1_Missense_Mutation_p.R1022Q|NLRP12_ENST00000391775.3_Missense_Mutation_p.R964Q|NLRP12_ENST00000535162.1_Intron|NLRP12_ENST00000354278.3_Intron|NLRP12_ENST00000391772.1_Intron	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	1021					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		ATGGCTCAGCCGCTTGCAAAG	0.562																																						dbGAP											0													88.0	68.0	75.0					19																	54299149		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.3062G>A	19.37:g.54299149C>T	ENSP00000319377:p.Arg1021Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R1022Q	ENST00000324134.6	37	c.3065	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	C	9.919	1.211591	0.22289	.	.	ENSG00000142405	ENST00000324134;ENST00000351894;ENST00000358661;ENST00000391775;ENST00000391773	T;T;T;T	0.52754	0.71;0.65;0.66;0.71	4.15	3.1	0.35709	.	0.862246	0.09479	U	0.796587	T	0.57301	0.2044	L	0.36672	1.1	0.09310	N	1	D;D;D;P	0.89917	0.961;0.995;1.0;0.933	B;P;D;B	0.74674	0.345;0.722;0.984;0.326	T	0.44787	-0.9305	10	0.52906	T	0.07	.	10.0299	0.42094	0.0:0.7943:0.2057:0.0	.	247;1021;964;1021	P59046-5;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	Q	1021;909;247;964;1022	ENSP00000319377:R1021Q;ENSP00000340473:R909Q;ENSP00000375655:R964Q;ENSP00000375653:R1022Q	ENSP00000319377:R1021Q	R	-	2	0	NLRP12	58990961	0.048000	0.20356	0.006000	0.13384	0.082000	0.17680	1.528000	0.35985	1.106000	0.41623	-0.555000	0.04198	CGG	NLRP12	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000142405		0.562	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	21	0.00	0	C	NM_144687		54299149	54299149	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.507	T
OR6K6	128371	genome.wustl.edu	37	1	158725496	158725496	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:158725496G>C	ENST00000368144.2	+	1	987	c.891G>C	c.(889-891)tgG>tgC	p.W297C		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W297*(1)		endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					CAGTGTTTTGGGACACAGCAA	0.448																																						dbGAP											1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											189.0	156.0	167.0					1																	158725496		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.891G>C	1.37:g.158725496G>C	ENSP00000357126:p.Trp297Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.W297C	ENST00000368144.2	37	c.891	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.221926	0.39300	.	.	ENSG00000180433	ENST00000368144	T	0.00069	8.77	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41294	D	0.000910	T	0.00178	0.0005	L	0.29908	0.895	0.53005	D	0.999966	D	0.76494	0.999	D	0.75484	0.986	D	0.99896	1.1147	10	0.39692	T	0.17	-7.2762	16.8781	0.86057	0.0:0.0:1.0:0.0	.	297	Q8NGW6	OR6K6_HUMAN	C	297	ENSP00000357126:W297C	ENSP00000357126:W297C	W	+	3	0	OR6K6	156992120	.	.	1.000000	0.80357	0.998000	0.95712	.	.	2.848000	0.98002	0.655000	0.94253	TGG	OR6K6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000180433		0.448	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	79	0.00	0	G	NM_001005184		158725496	158725496	+1	no_errors	ENST00000368144	ensembl	human	known	69_37n	missense	97	17.09	20	SNP	1.000	C
PCDHB8	56128	genome.wustl.edu	37	5	140558924	140558924	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr5:140558924A>T	ENST00000239444.2	+	1	1554	c.1309A>T	c.(1309-1311)Aat>Tat	p.N437Y	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	437	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACACATCTCAATATGACCGT	0.557																																						dbGAP											0													195.0	244.0	227.0					5																	140558924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1309A>T	5.37:g.140558924A>T	ENSP00000239444:p.Asn437Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N437Y	ENST00000239444.2	37	c.1309	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	A	5.657	0.305893	0.10733	.	.	ENSG00000120322	ENST00000239444	T	0.03524	3.9	3.95	2.73	0.32206	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.11452	0.0279	M	0.69463	2.115	0.09310	N	1	P	0.48294	0.908	P	0.58210	0.835	T	0.08617	-1.0713	9	0.45353	T	0.12	.	8.6614	0.34095	0.8062:0.1938:0.0:0.0	.	437	Q9UN66	PCDB8_HUMAN	Y	437	ENSP00000239444:N437Y	ENSP00000239444:N437Y	N	+	1	0	PCDHB8	140539108	0.000000	0.05858	0.003000	0.11579	0.011000	0.07611	0.438000	0.21559	0.379000	0.24794	0.254000	0.18369	AAT	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120322		0.557	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	82	0.00	0	A	NM_019120		140558924	140558924	+1	no_errors	ENST00000239444	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	0.002	T
PDE4B	5142	genome.wustl.edu	37	1	66833528	66833528	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:66833528G>A	ENST00000329654.4	+	14	1721	c.1534G>A	c.(1534-1536)Gac>Aac	p.D512N	PDE4B_ENST00000371049.3_Missense_Mutation_p.D512N|PDE4B_ENST00000371045.5_Missense_Mutation_p.D340N|PDE4B_ENST00000423207.2_Missense_Mutation_p.D497N|PDE4B_ENST00000480109.2_Missense_Mutation_p.D279N	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	512					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	GATGGTTATTGACATGGTAAG	0.408																																						dbGAP											0													204.0	199.0	201.0					1																	66833528		2203	4300	6503	-	-	-	SO:0001583	missense	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.1534G>A	1.37:g.66833528G>A	ENSP00000332116:p.Asp512Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.D512N	ENST00000329654.4	37	c.1534	CCDS632.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.147152	0.94603	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000371045;ENST00000480109	T;T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51;-0.51	5.29	5.29	0.74685	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.79311	0.4424	L	0.56396	1.775	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.99;0.991;0.999;0.997	D;P;P;D;D	0.69307	0.963;0.899;0.903;0.961;0.946	T	0.80462	-0.1372	10	0.87932	D	0	.	19.1258	0.93384	0.0:0.0:1.0:0.0	.	279;497;382;502;512	A5YW33;Q07343-3;Q13945;Q59GM8;Q07343	.;.;.;.;PDE4B_HUMAN	N	512;512;512;497;340;279	ENSP00000332116:D512N;ENSP00000342637:D512N;ENSP00000360088:D512N;ENSP00000392947:D497N;ENSP00000360084:D340N;ENSP00000432592:D279N	ENSP00000332116:D512N	D	+	1	0	PDE4B	66606116	1.000000	0.71417	0.999000	0.59377	0.903000	0.53119	9.643000	0.98464	2.755000	0.94549	0.591000	0.81541	GAC	PDE4B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000184588		0.408	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	76	0.00	0	G	NM_002600		66833528	66833528	+1	no_errors	ENST00000329654	ensembl	human	known	69_37n	missense	44	21.05	12	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178951957	178951957	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr3:178951957G>A	ENST00000263967.3	+	21	3169	c.3012G>A	c.(3010-3012)atG>atA	p.M1004I	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1004	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.M1004I(4)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTTTCTCAATGATGCTTGGCT	0.388		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Substitution - Missense(4)	large_intestine(1)|lung(1)|endometrium(1)|central_nervous_system(1)											113.0	103.0	106.0					3																	178951957		1889	4106	5995	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3012G>A	3.37:g.178951957G>A	ENSP00000263967:p.Met1004Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.M1004I	ENST00000263967.3	37	c.3012	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047054	0.55110	.	.	ENSG00000121879	ENST00000263967	T	0.74526	-0.85	6.07	6.07	0.98685	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	T	0.68751	0.3035	L	0.31294	0.92	0.80722	D	1	B	0.24092	0.097	B	0.23574	0.047	T	0.64300	-0.6440	10	0.72032	D	0.01	-19.3218	20.6525	0.99598	0.0:0.0:1.0:0.0	.	1004	P42336	PK3CA_HUMAN	I	1004	ENSP00000263967:M1004I	ENSP00000263967:M1004I	M	+	3	0	PIK3CA	180434651	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.325000	0.96381	2.890000	0.99128	0.585000	0.79938	ATG	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.388	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	40	0.00	0	G			178951957	178951957	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	36	41.94	26	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	31	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	25	43.18	19	SNP	1.000	G
PLEKHH2	130271	genome.wustl.edu	37	2	43924309	43924309	+	Splice_Site	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:43924309G>C	ENST00000282406.4	+	7	612		c.e7-1			NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2						negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CGATGTTGTAGAAGTTCAAGG	0.363																																						dbGAP											0													102.0	105.0	104.0					2																	43924309		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.503-1G>C	2.37:g.43924309G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPJ6|Q6P4Q1|Q8N3Q3	Splice_Site	SNP	-	e6-1	ENST00000282406.4	37	c.503-1	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666370	0.47677	.	.	ENSG00000152527	ENST00000282406	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4294	0.87535	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLEKHH2	43777813	1.000000	0.71417	0.988000	0.46212	0.487000	0.33371	7.698000	0.84413	2.326000	0.78906	0.557000	0.71058	.	PLEKHH2	-	-	ENSG00000152527		0.363	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	38	0.00	0	G	NM_172069	Intron	43924309	43924309	+1	no_errors	ENST00000282406	ensembl	human	known	69_37n	splice_site	39	23.53	12	SNP	1.000	C
PLXNA2	5362	genome.wustl.edu	37	1	208224737	208224737	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:208224737G>C	ENST00000367033.3	-	16	3782	c.3025C>G	c.(3025-3027)Ccc>Gcc	p.P1009A		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1009	IPT/TIG 2.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GATGATGGGGGTGAGACACAC	0.552																																						dbGAP											0													83.0	70.0	74.0					1																	208224737		2203	4300	6503	-	-	-	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3025C>G	1.37:g.208224737G>C	ENSP00000356000:p.Pro1009Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.P1009A	ENST00000367033.3	37	c.3025	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223951	0.39300	.	.	ENSG00000076356	ENST00000367033	D	0.86097	-2.07	5.09	5.09	0.68999	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.051265	0.85682	D	0.000000	T	0.75554	0.3865	N	0.20328	0.56	0.40656	D	0.982089	B	0.11235	0.004	B	0.17979	0.02	T	0.71361	-0.4616	10	0.35671	T	0.21	.	13.2728	0.60170	0.0:0.295:0.705:0.0	.	1009	O75051	PLXA2_HUMAN	A	1009	ENSP00000356000:P1009A	ENSP00000356000:P1009A	P	-	1	0	PLXNA2	206291360	1.000000	0.71417	0.980000	0.43619	0.714000	0.41099	5.225000	0.65294	2.363000	0.80096	0.557000	0.71058	CCC	PLXNA2	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000076356		0.552	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	16	0.00	0	G	NM_025179		208224737	208224737	-1	no_errors	ENST00000367033	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.996	C
PORCN	64840	genome.wustl.edu	37	X	48372917	48372917	+	Silent	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chrX:48372917C>T	ENST00000326194.6	+	9	893	c.850C>T	c.(850-852)Ctg>Ttg	p.L284L	PORCN_ENST00000359882.4_Silent_p.L278L|PORCN_ENST00000367574.4_Silent_p.L202L|PORCN_ENST00000361988.3_Silent_p.L273L|PORCN_ENST00000355961.4_Silent_p.L279L|PORCN_ENST00000355092.3_Silent_p.L278L|PORCN_ENST00000537758.1_Silent_p.L284L	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	284					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCCAGGGACCTGACGGTGTC	0.542																																						dbGAP											0													87.0	62.0	71.0					X																	48372917		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.850C>T	X.37:g.48372917C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Silent	SNP	pfam_MBOAT_fam	p.L284	ENST00000326194.6	37	c.850	CCDS14299.1	X																																																																																			PORCN	-	pfam_MBOAT_fam	ENSG00000102312		0.542	PORCN-011	KNOWN	basic|CCDS	protein_coding	PORCN	HGNC	protein_coding	OTTHUMT00000356990.1	28	0.00	0	C	NM_022825		48372917	48372917	+1	no_errors	ENST00000326194	ensembl	human	known	69_37n	silent	14	58.82	20	SNP	1.000	T
PRSS27	83886	genome.wustl.edu	37	16	2763623	2763623	+	Silent	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr16:2763623G>A	ENST00000302641.3	-	5	639	c.585C>T	c.(583-585)taC>taT	p.Y195Y	AC092117.1_ENST00000410123.1_RNA	NM_031948.3	NP_114154.1	Q9BQR3	PRS27_HUMAN	protease, serine 27	195	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8						TGTCTTTGCTGTAGAGCAGGT	0.587																																						dbGAP											0													242.0	169.0	194.0					16																	2763623		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AB056161	CCDS10476.1	16p13.3	2010-05-07			ENSG00000172382	ENSG00000172382		"""Serine peptidases / Serine peptidases"""	15475	protein-coding gene	gene with protein product		608018					Standard	NM_031948		Approved	MPN, pancreasin, CAPH2, marapsin	uc002crf.3	Q9BQR3	OTTHUMG00000128929	ENST00000302641.3:c.585C>T	16.37:g.2763623G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.Y195	ENST00000302641.3	37	c.585	CCDS10476.1	16																																																																																			PRSS27	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000172382		0.587	PRSS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS27	HGNC	protein_coding	OTTHUMT00000250908.1	83	0.00	0	G	NM_031948		2763623	2763623	-1	no_errors	ENST00000302641	ensembl	human	known	69_37n	silent	55	21.43	15	SNP	0.994	A
RAB1A	5861	genome.wustl.edu	37	2	65315695	65315695	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:65315695C>A	ENST00000409784.3	-	6	740	c.550G>T	c.(550-552)Ggt>Tgt	p.G184C	RAB1A_ENST00000398529.3_Missense_Mutation_p.G108C|RAB1A_ENST00000494188.1_Intron|RAB1A_ENST00000409751.1_Missense_Mutation_p.G152C|RAB1A_ENST00000356214.7_Missense_Mutation_p.G152C|RAB1A_ENST00000409892.1_Missense_Mutation_p.G120C|RAB1A_ENST00000260638.8_Missense_Mutation_p.G108C	NM_004161.4	NP_004152.1	P62820	RAB1A_HUMAN	RAB1A, member RAS oncogene family	184					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cargo loading into COPII-coated vesicle (GO:0090110)|cell migration (GO:0016477)|defense response to bacterium (GO:0042742)|endocytosis (GO:0006897)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|growth hormone secretion (GO:0030252)|GTP catabolic process (GO:0006184)|interleukin-8 secretion (GO:0072606)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|positive regulation of glycoprotein metabolic process (GO:1903020)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle transport along microtubule (GO:0047496)|vesicle-mediated transport (GO:0016192)|virion assembly (GO:0019068)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|melanosome (GO:0042470)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|lung(3)|prostate(1)	6						TTCTCAGCACCACCAGCTGTT	0.458																																						dbGAP											0													61.0	57.0	59.0					2																	65315695		1964	4150	6114	-	-	-	SO:0001583	missense	0			M28209	CCDS46305.1, CCDS46306.1	2p14	2008-02-05		2002-03-17	ENSG00000138069	ENSG00000138069		"""RAB, member RAS oncogene"""	9758	protein-coding gene	gene with protein product	"""Rab GTPase YPT1 homolog (yeast)"""	179508		RAB1		2501306	Standard	NM_004161		Approved	YPT1	uc002sdm.3	P62820	OTTHUMG00000152725	ENST00000409784.3:c.550G>T	2.37:g.65315695C>A	ENSP00000387286:p.Gly184Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P11476|Q6FIE7|Q96N61|Q9Y3T2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G184C	ENST00000409784.3	37	c.550	CCDS46306.1	2	.	.	.	.	.	.	.	.	.	.	C	17.36	3.368835	0.61624	.	.	ENSG00000138069	ENST00000409784;ENST00000409892;ENST00000409751;ENST00000398529;ENST00000260638;ENST00000356214	T;T;T;D;T;T	0.86769	-1.33;-1.33;-1.33;-2.17;-1.33;-1.33	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.87637	0.6227	N	0.19112	0.55	0.58432	D	0.999998	B;D;D;B	0.65815	0.358;0.964;0.995;0.358	B;P;P;B	0.61003	0.246;0.669;0.882;0.345	D	0.86150	0.1587	10	0.30078	T	0.28	.	19.6466	0.95778	0.0:1.0:0.0:0.0	.	152;120;108;184	B7Z8M7;P62820-2;P62820-3;P62820	.;.;.;RAB1A_HUMAN	C	184;120;152;108;108;152	ENSP00000387286:G184C;ENSP00000386451:G120C;ENSP00000386672:G152C;ENSP00000381540:G108C;ENSP00000260638:G108C;ENSP00000348546:G152C	ENSP00000260638:G108C	G	-	1	0	RAB1A	65169199	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.982000	0.70532	2.690000	0.91761	0.557000	0.71058	GGT	RAB1A	-	smart_Ran_GTPase	ENSG00000138069		0.458	RAB1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB1A	HGNC	protein_coding	OTTHUMT00000327572.1	42	0.00	0	C	NM_004161		65315695	65315695	-1	no_errors	ENST00000409784	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	A
RASL11B	65997	genome.wustl.edu	37	4	53731600	53731600	+	Silent	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr4:53731600C>T	ENST00000248706.3	+	4	593	c.375C>T	c.(373-375)agC>agT	p.S125S	RASL11B_ENST00000505041.1_3'UTR	NM_023940.2	NP_076429.1			RAS-like, family 11, member B											autonomic_ganglia(1)|central_nervous_system(1)|lung(5)|ovary(1)|stomach(1)	9			LUSC - Lung squamous cell carcinoma(32;0.0302)			ACTACAAGAGCTATGAACTCA	0.557																																						dbGAP											0													94.0	87.0	90.0					4																	53731600		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK001672	CCDS3490.1	4q12	2014-05-09			ENSG00000128045	ENSG00000128045			23804	protein-coding gene	gene with protein product		612404					Standard	NM_023940		Approved		uc003gzt.3	Q9BPW5	OTTHUMG00000102097	ENST00000248706.3:c.375C>T	4.37:g.53731600C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S125	ENST00000248706.3	37	c.375	CCDS3490.1	4																																																																																			RASL11B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000128045		0.557	RASL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL11B	HGNC	protein_coding	OTTHUMT00000219931.2	20	0.00	0	C	NM_023940		53731600	53731600	+1	no_errors	ENST00000248706	ensembl	human	known	69_37n	silent	25	24.24	8	SNP	1.000	T
RIMS2	9699	genome.wustl.edu	37	8	104897774	104897774	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr8:104897774G>A	ENST00000436393.2	+	2	522	c.281G>A	c.(280-282)aGc>aAc	p.S94N	RIMS2_ENST00000406091.3_Missense_Mutation_p.S316N|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000507740.1_Missense_Mutation_p.S124N|RIMS2_ENST00000262231.10_Missense_Mutation_p.S124N			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	347	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GATGTGGAAAGCAGAGATGAA	0.423										HNSCC(12;0.0054)																												dbGAP											0													98.0	95.0	96.0					8																	104897774		1991	4151	6142	-	-	-	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.281G>A	8.37:g.104897774G>A	ENSP00000390665:p.Ser94Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.S316N	ENST00000436393.2	37	c.947		8	.	.	.	.	.	.	.	.	.	.	G	8.949	0.967708	0.18659	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.39787	1.06;1.06;2.35;2.45;2.44;2.35;2.75	5.32	3.25	0.37280	.	.	.	.	.	T	0.12944	0.0314	N	0.00926	-1.1	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.08055	0.001;0.001;0.003;0.001;0.001	T	0.06232	-1.0838	9	0.30854	T	0.27	.	3.5403	0.07808	0.2519:0.0:0.5325:0.2156	.	347;94;124;124;316	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	N	316;347;316;347;124;124;124;124;94	ENSP00000427018:S316N;ENSP00000384892:S316N;ENSP00000425205:S124N;ENSP00000262231:S124N;ENSP00000423559:S124N;ENSP00000386228:S124N;ENSP00000390665:S94N	ENSP00000262231:S124N	S	+	2	0	RIMS2	104966950	0.996000	0.38824	1.000000	0.80357	0.943000	0.58893	1.669000	0.37492	1.230000	0.43646	-0.470000	0.05040	AGC	RIMS2	-	NULL	ENSG00000176406		0.423	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	49	0.00	0	G	NM_001100117		104897774	104897774	+1	no_errors	ENST00000406091	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.982	A
SCNN1B	6338	genome.wustl.edu	37	16	23360076	23360076	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr16:23360076G>A	ENST00000343070.2	+	2	332	c.156G>A	c.(154-156)tgG>tgA	p.W52*	SCNN1B_ENST00000307331.5_Nonsense_Mutation_p.W97*|SCNN1B_ENST00000569789.1_3'UTR|SCNN1B_ENST00000568923.1_Nonsense_Mutation_p.W52*|SCNN1B_ENST00000568085.1_Nonsense_Mutation_p.W52*	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	52					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	AAGCCATGTGGTTCCTGCTCA	0.602																																						dbGAP											0													84.0	70.0	75.0					16																	23360076		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.156G>A	16.37:g.23360076G>A	ENSP00000345751:p.Trp52*	Somatic		WXS	Illumina GAIIx	Phase_IV	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Nonsense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.W97*	ENST00000343070.2	37	c.291	CCDS10609.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.327925	0.97476	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	.	.	.	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.8724	17.3103	0.87207	0.0:0.0:1.0:0.0	.	.	.	.	X	52;97	.	ENSP00000302874:W97X	W	+	3	0	SCNN1B	23267577	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.216000	0.77974	2.315000	0.78130	0.561000	0.74099	TGG	SCNN1B	-	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	ENSG00000168447		0.602	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1B	HGNC	protein_coding	OTTHUMT00000254495.2	51	0.00	0	G			23360076	23360076	+1	no_errors	ENST00000307331	ensembl	human	known	69_37n	nonsense	26	23.53	8	SNP	1.000	A
SENP3	26168	genome.wustl.edu	37	17	7468905	7468905	+	Splice_Site	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr17:7468905G>C	ENST00000429205.2	+	5	1264		c.e5+1		SENP3_ENST00000321337.7_Splice_Site|SENP3_ENST00000578868.1_Splice_Site|SENP3-EIF4A1_ENST00000579777.1_RNA			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				CAATGACCAGGTGAGAAAGGG	0.587																																						dbGAP											0													60.0	62.0	61.0					17																	7468905		2013	4170	6183	-	-	-	SO:0001630	splice_region_variant	0			AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.1215+1G>C	17.37:g.7468905G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Splice_Site	SNP	-	e4+1	ENST00000429205.2	37	c.1215+1		17	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859817	0.71834	.	.	ENSG00000161956	ENST00000321337;ENST00000429205	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8364	0.78801	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SENP3	7409629	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.934000	0.92915	2.814000	0.96858	0.563000	0.77884	.	SENP3	-	-	ENSG00000161956		0.587	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	HGNC	protein_coding		38	0.00	0	G	NM_015670	Intron	7468905	7468905	+1	no_errors	ENST00000429205	ensembl	human	known	69_37n	splice_site	16	44.83	13	SNP	1.000	C
SERTAD4	56256	genome.wustl.edu	37	1	210415039	210415039	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:210415039T>C	ENST00000367012.3	+	4	658	c.428T>C	c.(427-429)aTt>aCt	p.I143T	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	143	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.					nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		CATGGAGAAATTATCATGCAG	0.423																																						dbGAP											0													114.0	117.0	116.0					1																	210415039		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.428T>C	1.37:g.210415039T>C	ENSP00000355979:p.Ile143Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD32	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.I143T	ENST00000367012.3	37	c.428	CCDS1494.1	1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.805912	0.50421	.	.	ENSG00000082497	ENST00000367012	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.74504	0.3725	L	0.50333	1.59	0.47153	D	0.999335	D	0.76494	0.999	D	0.85130	0.997	T	0.74309	-0.3707	9	0.44086	T	0.13	-17.237	15.9023	0.79387	0.0:0.0:0.0:1.0	.	143	Q9NUC0	SRTD4_HUMAN	T	143	.	ENSP00000355979:I143T	I	+	2	0	SERTAD4	208481662	1.000000	0.71417	0.944000	0.38274	0.994000	0.84299	6.426000	0.73374	2.153000	0.67306	0.533000	0.62120	ATT	SERTAD4	-	pfam_SERTA,pfscan_SERTA	ENSG00000082497		0.423	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD4	HGNC	protein_coding	OTTHUMT00000088577.1	34	0.00	0	T	NM_019605		210415039	210415039	+1	no_errors	ENST00000367012	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.999	C
SNTG2	54221	genome.wustl.edu	37	2	1079205	1079205	+	Splice_Site	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:1079205C>T	ENST00000308624.5	+	2	203	c.74C>T	c.(73-75)aCg>aTg	p.T25M	SNTG2_ENST00000407292.1_Splice_Site_p.T25M	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	25					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TCCCTACAGACGAAAACCACT	0.473																																						dbGAP											0													114.0	114.0	114.0					2																	1079205		2027	4181	6208	-	-	-	SO:0001630	splice_region_variant	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.73-1C>T	2.37:g.1079205C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T25M	ENST00000308624.5	37	c.74	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	C	7.129	0.579550	0.13686	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.73897	0.99;-0.79	3.78	1.94	0.25998	.	0.262600	0.37857	N	0.001910	T	0.69913	0.3164	M	0.68593	2.085	0.22354	N	0.999174	P;P	0.51057	0.941;0.814	B;B	0.43838	0.433;0.221	T	0.64106	-0.6485	10	0.72032	D	0.01	.	7.7748	0.29030	0.0:0.7127:0.0:0.2873	.	25;25	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	M	25	ENSP00000311837:T25M;ENSP00000385020:T25M	ENSP00000311837:T25M	T	+	2	0	SNTG2	1069205	0.989000	0.36119	0.038000	0.18304	0.001000	0.01503	1.604000	0.36804	0.573000	0.29400	-0.216000	0.12614	ACG	SNTG2	-	NULL	ENSG00000172554		0.473	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	44	0.00	0	C	NM_018968	Missense_Mutation	1079205	1079205	+1	no_errors	ENST00000308624	ensembl	human	known	69_37n	missense	37	24.49	12	SNP	0.995	T
SORBS1	10580	genome.wustl.edu	37	10	97096374	97096374	+	Silent	SNP	C	C	G			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr10:97096374C>G	ENST00000361941.3	-	28	3569	c.3543G>C	c.(3541-3543)ctG>ctC	p.L1181L	SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000277982.5_Silent_p.L1040L|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000371227.4_Silent_p.L1135L|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000371246.2_Silent_p.L1040L|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371247.2_Silent_p.L1181L	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AAGCGCTACCCAGGGGCTTGC	0.612																																						dbGAP											0													79.0	84.0	82.0					10																	97096374		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3543G>C	10.37:g.97096374C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.L1181	ENST00000361941.3	37	c.3543	CCDS31255.1	10																																																																																			SORBS1	-	NULL	ENSG00000095637		0.612	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	21	0.00	0	C			97096374	97096374	-1	no_errors	ENST00000361941	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.984	G
SPTA1	6708	genome.wustl.edu	37	1	158608032	158608032	+	Splice_Site	SNP	C	C	G			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:158608032C>G	ENST00000368147.4	-	36	5161		c.e36-1			NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGAGTGCATCCTAGAAAGTCT	0.433																																						dbGAP											0													60.0	56.0	57.0					1																	158608032		1876	4112	5988	-	-	-	SO:0001630	splice_region_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4981-1G>C	1.37:g.158608032C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Splice_Site	SNP	-	e36-1	ENST00000368147.4	37	c.4981-1	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268798	0.80469	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5629	0.87912	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTA1	156874656	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.130000	0.77235	2.729000	0.93468	0.591000	0.81541	.	SPTA1	-	-	ENSG00000163554		0.433	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	33	0.00	0	C	NM_003126	Intron	158608032	158608032	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	splice_site	20	28.57	8	SNP	1.000	G
SRRD	402055	genome.wustl.edu	37	22	26884128	26884128	+	Silent	SNP	A	A	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr22:26884128A>C	ENST00000215917.7	+	3	398	c.384A>C	c.(382-384)ccA>ccC	p.P128P		NM_001013694.2	NP_001013716.2	Q9UH36	SRR1L_HUMAN	SRR1 domain containing	128					rhythmic process (GO:0048511)					endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						ATTCTATCCCAAGAGAGATCT	0.483																																						dbGAP											0													119.0	117.0	117.0					22																	26884128		1996	4192	6188	-	-	-	SO:0001819	synonymous_variant	0			BC066962	CCDS42995.1	22q12.1	2008-10-31			ENSG00000100104	ENSG00000100104			33910	protein-coding gene	gene with protein product	"""hepatocellular carcinoma complicating hemochromatosis"""	602254					Standard	NM_001013694		Approved	HC/HCC, SRR1L	uc010gve.3	Q9UH36	OTTHUMG00000150885	ENST00000215917.7:c.384A>C	22.37:g.26884128A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NXP8	Silent	SNP	pfam_SRR1-like	p.P128	ENST00000215917.7	37	c.384	CCDS42995.1	22																																																																																			SRRD	-	NULL	ENSG00000100104		0.483	SRRD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRD	HGNC	protein_coding	OTTHUMT00000320423.2	53	0.00	0	A	NM_001013694		26884128	26884128	+1	no_errors	ENST00000215917	ensembl	human	known	69_37n	silent	42	19.23	10	SNP	0.000	C
SS18	6760	genome.wustl.edu	37	18	23612480	23612480	+	Silent	SNP	A	A	G			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr18:23612480A>G	ENST00000415083.2	-	10	1168	c.1113T>C	c.(1111-1113)ggT>ggC	p.G371G	SS18_ENST00000542743.1_Silent_p.G288G|SS18_ENST00000542420.2_Silent_p.G348G|SS18_ENST00000269137.7_Silent_p.G340G|SS18_ENST00000539849.1_Silent_p.G289G|SS18_ENST00000545952.1_Silent_p.G288G	NM_001007559.1|NM_005637.2	NP_001007560.1|NP_005628.2	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	371	Gln-rich.				cell morphogenesis (GO:0000902)|ephrin receptor signaling pathway (GO:0048013)|intracellular signal transduction (GO:0035556)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)		SS18/SSX2(706)|SS18/SSX1(1169)|SS18/SSX4(12)	endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(1)	19	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					GAGGACCTGGACCACCCTGTG	0.488			T	"""SSX1,  SSX2"""	synovial sarcoma																																	dbGAP		Dom	yes		18	18q11.2	6760	"""synovial sarcoma translocation, chromosome 18"""		M	0													160.0	136.0	144.0					18																	23612480		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X79201	CCDS32807.1, CCDS54183.1	18q11.2	2008-07-28				ENSG00000141380			11340	protein-coding gene	gene with protein product		600192		SSXT		8152806, 7951320, 16484776	Standard	XM_005258334		Approved	SYT	uc002kvm.3	Q15532		ENST00000415083.2:c.1113T>C	18.37:g.23612480A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ95|Q16404|Q4VAX1|Q9BXC6	Silent	SNP	pfam_SSXT	p.G371	ENST00000415083.2	37	c.1113	CCDS32807.1	18																																																																																			SS18	-	NULL	ENSG00000141380		0.488	SS18-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SS18	HGNC	protein_coding	OTTHUMT00000446226.1	46	0.00	0	A			23612480	23612480	-1	no_errors	ENST00000415083	ensembl	human	known	69_37n	silent	28	30.00	12	SNP	0.970	G
SSRP1	6749	genome.wustl.edu	37	11	57099707	57099707	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr11:57099707G>A	ENST00000278412.2	-	8	1186	c.920C>T	c.(919-921)tCa>tTa	p.S307L		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	307					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						GAGGGATCCTGACATGTTCTT	0.532																																					Colon(89;1000 1340 6884 23013 41819)	dbGAP											0													114.0	98.0	103.0					11																	57099707		2201	4296	6497	-	-	-	SO:0001583	missense	0			M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.920C>T	11.37:g.57099707G>A	ENSP00000278412:p.Ser307Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BJG8	Missense_Mutation	SNP	pfam_SSRP1_dom,pfam_DUF1747,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,prints_SSrcognition	p.S307L	ENST00000278412.2	37	c.920	CCDS7952.1	11	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383722	0.82792	.	.	ENSG00000149136	ENST00000278412	T	0.49139	0.79	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.56848	0.2013	M	0.80746	2.51	0.80722	D	1	P	0.37548	0.599	B	0.38156	0.266	T	0.62530	-0.6835	10	0.66056	D	0.02	-1.1526	19.5069	0.95121	0.0:0.0:1.0:0.0	.	307	Q08945	SSRP1_HUMAN	L	307	ENSP00000278412:S307L	ENSP00000278412:S307L	S	-	2	0	SSRP1	56856283	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.157000	0.94714	2.941000	0.99782	0.655000	0.94253	TCA	SSRP1	-	pfam_SSRP1_dom	ENSG00000149136		0.532	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSRP1	HGNC	protein_coding	OTTHUMT00000392460.1	28	0.00	0	G	NM_003146		57099707	57099707	-1	no_errors	ENST00000278412	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	A
STK31	56164	genome.wustl.edu	37	7	23827704	23827704	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr7:23827704C>T	ENST00000355870.3	+	21	2712	c.2593C>T	c.(2593-2595)Cgt>Tgt	p.R865C	STK31_ENST00000433467.2_Missense_Mutation_p.R865C|STK31_ENST00000354639.3_Missense_Mutation_p.R842C|STK31_ENST00000428484.1_Missense_Mutation_p.R842C|STK31_ENST00000405627.3_3'UTR	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	865	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TGCTTTAAACCGTGAACAAGG	0.343																																						dbGAP											0													120.0	112.0	115.0					7																	23827704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2593C>T	7.37:g.23827704C>T	ENSP00000348132:p.Arg865Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	pfam_Tudor,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tudor,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Tudor,pfscan_Prot_kinase_cat_dom	p.R865C	ENST00000355870.3	37	c.2593	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	C	26.0	4.693409	0.88735	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.74421	-0.84;-0.23;-0.84;-0.84	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84347	0.5452	L	0.49256	1.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.84549	0.0643	10	0.87932	D	0	-9.7778	19.9687	0.97276	0.0:1.0:0.0:0.0	.	865;865;865	B4DZ06;A4D159;Q9BXU1	.;.;STK31_HUMAN	C	865;865;842;842	ENSP00000348132:R865C;ENSP00000411852:R865C;ENSP00000346660:R842C;ENSP00000406146:R842C	ENSP00000346660:R842C	R	+	1	0	STK31	23794229	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.972000	0.70448	2.820000	0.97059	0.650000	0.86243	CGT	STK31	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196335		0.343	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2	36	0.00	0	C	NM_031414		23827704	23827704	+1	no_errors	ENST00000355870	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	1.000	T
TLR5	7100	genome.wustl.edu	37	1	223286092	223286092	+	Silent	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:223286092C>A	ENST00000540964.1	-	4	743	c.282G>T	c.(280-282)ctG>ctT	p.L94L	TLR5_ENST00000342210.6_Silent_p.L94L			O60602	TLR5_HUMAN	toll-like receptor 5	94					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		TAAGGTTGGGCAGGTTTCTGA	0.478																																						dbGAP											0													84.0	85.0	84.0					1																	223286092		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.282G>T	1.37:g.223286092C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Silent	SNP	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L94	ENST00000540964.1	37	c.282	CCDS31033.1	1																																																																																			TLR5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000187554		0.478	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR5	HGNC	protein_coding		24	0.00	0	C	NM_003268		223286092	223286092	-1	no_errors	ENST00000342210	ensembl	human	known	69_37n	silent	31	20.00	8	SNP	1.000	A
TNFAIP3	7128	genome.wustl.edu	37	6	138197148	138197148	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr6:138197148G>C	ENST00000237289.4	+	5	716	c.650G>C	c.(649-651)aGt>aCt	p.S217T	TNFAIP3_ENST00000485192.1_3'UTR	NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	217	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		ATGCTAAGAAGTTTGGAATCA	0.438			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	dbGAP		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)											86.0	92.0	90.0					6																	138197148		2203	4300	6503	-	-	-	SO:0001583	missense	0			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.650G>C	6.37:g.138197148G>C	ENSP00000237289:p.Ser217Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	pfam_Znf_A20,pfam_OTU,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.S217T	ENST00000237289.4	37	c.650	CCDS5187.1	6	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886375	0.91814	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000535332;ENST00000544646	T	0.31769	1.48	5.92	5.92	0.95590	Ovarian tumour, otubain (2);	0.075666	0.85682	D	0.000000	T	0.34803	0.0910	M	0.67953	2.075	0.80722	D	1	P	0.49783	0.928	P	0.48227	0.571	T	0.13282	-1.0515	10	0.66056	D	0.02	-8.6813	18.487	0.90833	0.0:0.0:1.0:0.0	.	217	P21580	TNAP3_HUMAN	T	217	ENSP00000237289:S217T	ENSP00000237289:S217T	S	+	2	0	TNFAIP3	138238841	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.102000	0.94226	2.809000	0.96659	0.650000	0.86243	AGT	TNFAIP3	-	pfam_OTU,pfscan_OTU	ENSG00000118503		0.438	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP3	HGNC	protein_coding	OTTHUMT00000042414.1	31	0.00	0	G			138197148	138197148	+1	no_errors	ENST00000237289	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	C
TNPO2	30000	genome.wustl.edu	37	19	12816348	12816348	+	Silent	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr19:12816348C>T	ENST00000592287.1	-	16	1929	c.1821G>A	c.(1819-1821)caG>caA	p.Q607Q	TNPO2_ENST00000450764.2_Silent_p.Q607Q|TNPO2_ENST00000441499.1_Silent_p.Q607Q|TNPO2_ENST00000588216.1_Silent_p.Q607Q|TNPO2_ENST00000425528.1_Silent_p.Q607Q|SNORD41_ENST00000386967.1_RNA|TNPO2_ENST00000356861.5_Silent_p.Q607Q	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	607					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TGACACAGCGCTGGTAGACGG	0.637																																						dbGAP											0													25.0	29.0	27.0					19																	12816348		2114	4211	6325	-	-	-	SO:0001819	synonymous_variant	0			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1821G>A	19.37:g.12816348C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O14655|Q6IN77	Silent	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.Q607	ENST00000592287.1	37	c.1821	CCDS45991.1	19																																																																																			TNPO2	-	superfamily_ARM-type_fold	ENSG00000105576		0.637	TNPO2-002	KNOWN	basic|CCDS	protein_coding	TNPO2	HGNC	protein_coding	OTTHUMT00000450785.1	14	0.00	0	C	NM_013433		12816348	12816348	-1	no_errors	ENST00000425528	ensembl	human	known	69_37n	silent	15	25.00	5	SNP	1.000	T
UGT2B15	7366	genome.wustl.edu	37	4	69512933	69512933	+	Silent	SNP	C	C	G	rs191582403	byFrequency	TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr4:69512933C>G	ENST00000338206.5	-	6	1491	c.1482G>C	c.(1480-1482)gtG>gtC	p.V494V		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	494					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	GGAATGCTATCACATCCAAAG	0.463																																						dbGAP											0													145.0	136.0	139.0					4																	69512933		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.1482G>C	4.37:g.69512933C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V494	ENST00000338206.5	37	c.1482	CCDS3524.1	4																																																																																			UGT2B15	-	pfam_UDP_glucos_trans	ENSG00000196620		0.463	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	75	0.00	0	C	NM_001076		69512933	69512933	-1	no_errors	ENST00000338206	ensembl	human	known	69_37n	silent	45	21.05	12	SNP	0.949	G
UNC80	285175	genome.wustl.edu	37	2	210860284	210860284	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr2:210860284delA	ENST00000439458.1	+	64	9822	c.9742delA	c.(9742-9744)aaafs	p.K3248fs	UNC80_ENST00000272845.6_Frame_Shift_Del_p.K3224fs	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	3248					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TGAGCTGGGGAAAACGGATGC	0.433																																						dbGAP											0													70.0	60.0	63.0					2																	210860284		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.9742delA	2.37:g.210860284delA	ENSP00000391088:p.Lys3248fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Frame_Shift_Del	DEL	NULL	p.T3249fs	ENST00000439458.1	37	c.9742	CCDS46504.1	2																																																																																			UNC80	-	NULL	ENSG00000144406		0.433	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		18	0.00	0	A	NM_182587		210860284	210860284	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.998	-
VAV3	10451	genome.wustl.edu	37	1	108292204	108292204	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr1:108292204T>G	ENST00000370056.4	-	14	1546	c.1272A>C	c.(1270-1272)ttA>ttC	p.L424F	VAV3_ENST00000371846.4_Missense_Mutation_p.L359F|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.L424F	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	424	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		CCAAATCAAATAAGAAGATAT	0.303																																						dbGAP											0													103.0	93.0	97.0					1																	108292204		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1272A>C	1.37:g.108292204T>G	ENSP00000359073:p.Leu424Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain,prints_SM22_calponin	p.L424F	ENST00000370056.4	37	c.1272	CCDS785.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.67|17.67	3.447261|3.447261	0.63178|0.63178	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000490388	D;D;D|.	0.91792|.	-2.91;-2.91;-2.91|.	5.83|5.83	-2.03|-2.03	0.07365|0.07365	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.47948|0.47948	0.1473|0.1473	M|M	0.78049|0.78049	2.395|2.395	0.52099|0.52099	D|D	0.999946|0.999946	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999|.	D;D;D;D|.	0.97110|.	0.993;1.0;0.984;0.984|.	T|T	0.54997|0.54997	-0.8209|-0.8209	10|5	0.87932|.	D|.	0|.	.|.	4.7913|4.7913	0.13250|0.13250	0.1145:0.482:0.1176:0.2858|0.1145:0.482:0.1176:0.2858	.|.	424;424;359;424|.	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4|.	.;.;.;VAV3_HUMAN|.	F|S	424;424;359|419	ENSP00000359073:L424F;ENSP00000432540:L424F;ENSP00000360912:L359F|.	ENSP00000359073:L424F|.	L|Y	-|-	3|2	2|0	VAV3|VAV3	108093727|108093727	0.743000|0.743000	0.28239|0.28239	0.997000|0.997000	0.53966|0.53966	0.983000|0.983000	0.72400|0.72400	-0.110000|-0.110000	0.10824|0.10824	-0.126000|-0.126000	0.11682|0.11682	-0.417000|-0.417000	0.06048|0.06048	TTA|TAT	VAV3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000134215		0.303	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	HGNC	protein_coding	OTTHUMT00000030242.2	82	0.00	0	T	NM_006113		108292204	108292204	-1	no_errors	ENST00000370056	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.983	G
WBP11P1	441818	genome.wustl.edu	37	18	30092638	30092638	+	RNA	SNP	G	G	A	rs568013144		TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr18:30092638G>A	ENST00000567636.1	+	0	1013					NR_003558.1				WW domain binding protein 11 pseudogene 1																		CAGTGACACCGACGGATCAGA	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		21450	0.001		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30092638G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			WBP11P1	-	-	ENSG00000260389		0.453	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	46	0.00	0	G			30092638	30092638	+1	no_errors	ENST00000567636	ensembl	human	known	69_37n	rna	35	25.53	12	SNP	0.329	A
WDR90	197335	genome.wustl.edu	37	16	705776	705776	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr16:705776C>T	ENST00000293879.4	+	17	1853	c.1853C>T	c.(1852-1854)cCc>cTc	p.P618L	WDR90_ENST00000549091.1_Missense_Mutation_p.P618L|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	618										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CCCCCAGGCCCCGGCATTGCC	0.677																																						dbGAP											0													19.0	23.0	22.0					16																	705776		2123	4215	6338	-	-	-	SO:0001583	missense	0			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1853C>T	16.37:g.705776C>T	ENSP00000293879:p.Pro618Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_DUF667,pfam_Nucleoporin_Nup160,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P618L	ENST00000293879.4	37	c.1853	CCDS42092.1	16	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884783	0.51908	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.60424	0.19;0.19	4.61	3.66	0.41972	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.365681	0.24233	U	0.040337	T	0.68961	0.3058	M	0.68952	2.095	0.80722	D	1	D;P;B;P	0.63046	0.992;0.863;0.059;0.775	D;P;B;B	0.64410	0.925;0.627;0.054;0.306	T	0.65936	-0.6047	10	0.26408	T	0.33	.	12.0092	0.53278	0.0:0.9154:0.0:0.0846	.	618;618;619;618	F8VUX9;Q96KV7;C9JMK1;Q96KV7-3	.;WDR90_HUMAN;.;.	L	618	ENSP00000448122:P618L;ENSP00000293879:P618L	ENSP00000293879:P618L	P	+	2	0	WDR90	645777	0.767000	0.28508	0.015000	0.15790	0.017000	0.09413	4.533000	0.60615	1.072000	0.40860	0.561000	0.74099	CCC	WDR90	-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat	ENSG00000161996		0.677	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR90	HGNC	protein_coding	OTTHUMT00000404335.1	18	0.00	0	C	NM_145294		705776	705776	+1	no_errors	ENST00000549091	ensembl	human	novel	69_37n	missense	5	64.29	9	SNP	0.913	T
ZFP64	55734	genome.wustl.edu	37	20	50701561	50701561	+	Silent	SNP	G	G	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr20:50701561G>A	ENST00000361387.2	-	9	1533	c.1473C>T	c.(1471-1473)gcC>gcT	p.A491A	ZFP64_ENST00000371523.4_Silent_p.A272A|ZFP64_ENST00000371518.2_Intron	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CCGGGTGGTCGGCCTGGTGCA	0.637																																						dbGAP											0													54.0	57.0	56.0					20																	50701561		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1473C>T	20.37:g.50701561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTS7|Q9NVH4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A491	ENST00000361387.2	37	c.1473	CCDS13439.1	20																																																																																			ZFP64	-	pfscan_Znf_C2H2	ENSG00000020256		0.637	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079743.2	17	0.00	0	G	NM_018197		50701561	50701561	-1	no_errors	ENST00000361387	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	0.996	A
ZFR	51663	genome.wustl.edu	37	5	32420120	32420120	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr5:32420120C>A	ENST00000265069.8	-	3	328	c.226G>T	c.(226-228)Gtt>Ttt	p.V76F		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	76	Ala-rich.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		GCAGCAGTAACTGTGTGAGCA	0.552																																						dbGAP											0													53.0	49.0	50.0					5																	32420120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.226G>T	5.37:g.32420120C>A	ENSP00000265069:p.Val76Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.V76F	ENST00000265069.8	37	c.226	CCDS34139.1	5	.	.	.	.	.	.	.	.	.	.	C	28.0	4.880238	0.91740	.	.	ENSG00000056097	ENST00000265069;ENST00000382126;ENST00000416900	T	0.07327	3.2	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	L	0.39898	1.24	0.80722	D	1	D;D	0.61697	0.99;0.99	D;D	0.70487	0.954;0.969	T	0.00037	-1.2250	10	0.66056	D	0.02	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	76;76	B2RNR6;Q96KR1	.;ZFR_HUMAN	F	76;54;76	ENSP00000265069:V76F	ENSP00000265069:V76F	V	-	1	0	ZFR	32455877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.142000	0.77339	2.873000	0.98535	0.563000	0.77884	GTT	ZFR	-	NULL	ENSG00000056097		0.552	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	28	0.00	0	C			32420120	32420120	-1	no_errors	ENST00000265069	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	A
ZNF229	7772	genome.wustl.edu	37	19	44934254	44934254	+	Silent	SNP	A	A	G			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr19:44934254A>G	ENST00000588931.1	-	6	1135	c.702T>C	c.(700-702)ccT>ccC	p.P234P	CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000291187.4_Silent_p.P228P|ZNF229_ENST00000591289.1_Intron	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TGTCTATTTCAGGGAATCTGT	0.378																																						dbGAP											0													110.0	103.0	105.0					19																	44934254		1875	4103	5978	-	-	-	SO:0001819	synonymous_variant	0			AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.702T>C	19.37:g.44934254A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWN3|Q59FV2|Q86WL9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P234	ENST00000588931.1	37	c.702	CCDS42574.1	19																																																																																			ZNF229	-	NULL	ENSG00000167383		0.378	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	HGNC	protein_coding	OTTHUMT00000460833.1	40	0.00	0	A	NM_014518		44934254	44934254	-1	no_errors	ENST00000588931	ensembl	human	known	69_37n	silent	36	16.28	7	SNP	0.001	G
ZNF175	7728	genome.wustl.edu	37	19	52090259	52090259	+	Silent	SNP	C	C	T			TCGA-AO-A1KR-01A-12D-A142-09	TCGA-AO-A1KR-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d3b598d8-8a3b-4506-aa98-9fbc5b51afd4	de361418-e012-49b7-b32c-25ba92e5fd7c	g.chr19:52090259C>T	ENST00000262259.2	+	5	1033	c.675C>T	c.(673-675)gaC>gaT	p.D225D	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	225					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		AGCTTGATGACGTTGTTGGGT	0.413																																						dbGAP											0													78.0	72.0	74.0					19																	52090259		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.675C>T	19.37:g.52090259C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9H2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D225	ENST00000262259.2	37	c.675	CCDS12837.1	19																																																																																			ZNF175	-	NULL	ENSG00000105497		0.413	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF175	HGNC	protein_coding	OTTHUMT00000396205.1	20	0.00	0	C	NM_007147		52090259	52090259	+1	no_errors	ENST00000262259	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	0.482	T
