#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANAPC7	51434	genome.wustl.edu	37	12	110834204	110834204	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr12:110834204G>A	ENST00000455511.3	-	2	257	c.257C>T	c.(256-258)tCt>tTt	p.S86F	RP11-478C19.2_ENST00000550231.1_RNA|ANAPC7_ENST00000450008.2_Missense_Mutation_p.S86F	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	86					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						ATGAAAGAGAGAATCTGCATG	0.383																																						dbGAP											0													84.0	72.0	76.0					12																	110834204		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.257C>T	12.37:g.110834204G>A	ENSP00000394394:p.Ser86Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S86F	ENST00000455511.3	37	c.257	CCDS9145.2	12	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409451	0.83340	.	.	ENSG00000196510	ENST00000455511;ENST00000450008	T;T	0.73789	1.17;-0.78	5.85	5.85	0.93711	Tetratricopeptide-like helical (1);	0.049134	0.85682	D	0.000000	T	0.80696	0.4672	L	0.39245	1.2	0.80722	D	1	D;D	0.67145	0.969;0.996	P;P	0.60012	0.833;0.867	T	0.79780	-0.1659	10	0.49607	T	0.09	-0.0031	20.1731	0.98165	0.0:0.0:1.0:0.0	.	86;86	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	F	86	ENSP00000394394:S86F;ENSP00000402314:S86F	ENSP00000402314:S86F	S	-	2	0	ANAPC7	109318587	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.338000	0.96553	2.768000	0.95171	0.655000	0.94253	TCT	ANAPC7	-	NULL	ENSG00000196510		0.383	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	27	0.00	0	G	NM_016238		110834204	110834204	-1	no_errors	ENST00000455511	ensembl	human	known	69_37n	missense	61	18.67	14	SNP	1.000	A
ANKDD1A	348094	genome.wustl.edu	37	15	65239671	65239671	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr15:65239671delC	ENST00000380230.3	+	13	1238	c.1209delC	c.(1207-1209)gacfs	p.D403fs	ANKDD1A_ENST00000395723.1_Frame_Shift_Del_p.D280fs|ANKDD1A_ENST00000395720.1_Frame_Shift_Del_p.D403fs|ANKDD1A_ENST00000357698.3_Frame_Shift_Del_p.D371fs	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	403					signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						TTAAGCAGGACCATCGGCAGG	0.582																																						dbGAP											0													52.0	48.0	49.0					15																	65239671		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0				CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.1209delC	15.37:g.65239671delC	ENSP00000369579:p.Asp403fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,prints_Ankyrin_rpt	p.H404fs	ENST00000380230.3	37	c.1209	CCDS10197.2	15																																																																																			ANKDD1A	-	superfamily_DEATH-like	ENSG00000166839		0.582	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKDD1A	HGNC	protein_coding	OTTHUMT00000256705.2	62	0.00	0	C	NM_182703		65239671	65239671	+1	no_errors	ENST00000380230	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	1.000	-
ANKRD11	29123	genome.wustl.edu	37	16	89350800	89350800	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr16:89350800G>A	ENST00000301030.4	-	9	2610	c.2150C>T	c.(2149-2151)tCa>tTa	p.S717L	ANKRD11_ENST00000378330.2_Missense_Mutation_p.S717L	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	717	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCTCTTCAGTGATTTTTCATC	0.363																																						dbGAP											0													58.0	56.0	57.0					16																	89350800		2197	4299	6496	-	-	-	SO:0001583	missense	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2150C>T	16.37:g.89350800G>A	ENSP00000301030:p.Ser717Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S717L	ENST00000301030.4	37	c.2150	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	G	2.790	-0.251612	0.05867	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000330736	T;T	0.39229	1.09;1.09	5.7	3.67	0.42095	.	0.815833	0.10960	N	0.615053	T	0.24005	0.0581	N	0.14661	0.345	0.22112	N	0.999354	P;P	0.38078	0.617;0.483	B;B	0.30029	0.11;0.035	T	0.04373	-1.0956	10	0.29301	T	0.29	.	11.7482	0.51832	0.0674:0.1237:0.8089:0.0	.	336;717	Q7Z5E5;Q6UB99	.;ANR11_HUMAN	L	717;717;336	ENSP00000301030:S717L;ENSP00000367581:S717L	ENSP00000301030:S717L	S	-	2	0	ANKRD11	87878301	0.172000	0.23043	0.001000	0.08648	0.244000	0.25665	2.099000	0.41767	0.712000	0.32039	0.561000	0.74099	TCA	ANKRD11	-	NULL	ENSG00000167522		0.363	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	50	0.00	0	G	NM_013275		89350800	89350800	-1	no_errors	ENST00000301030	ensembl	human	known	69_37n	missense	18	67.86	38	SNP	0.023	A
ARHGAP11A	9824	genome.wustl.edu	37	15	32908481	32908481	+	Silent	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr15:32908481G>A	ENST00000361627.3	+	1	791	c.69G>A	c.(67-69)gtG>gtA	p.V23V	RP11-1000B6.5_ENST00000500941.2_lincRNA|ARHGAP11A_ENST00000563864.1_Silent_p.V23V|ARHGAP11A_ENST00000565905.1_Intron|AC123768.4_ENST00000576873.1_lincRNA|ARHGAP11A_ENST00000543522.1_Intron|ARHGAP11A_ENST00000567348.1_Silent_p.V23V	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	23					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GTATTAAGGTGAAGGGTGTCC	0.517																																					Colon(45;757 1134 30003 36652)	dbGAP											0													65.0	62.0	63.0					15																	32908481		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.69G>A	15.37:g.32908481G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZN9|Q6PI96|Q9Y3S6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.V23	ENST00000361627.3	37	c.69	CCDS10028.1	15																																																																																			ARHGAP11A	-	NULL	ENSG00000198826		0.517	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11A	HGNC	protein_coding	OTTHUMT00000251417.1	102	0.00	0	G	NM_014783		32908481	32908481	+1	no_errors	ENST00000361627	ensembl	human	known	69_37n	silent	49	23.44	15	SNP	0.990	A
B3GALTL	145173	genome.wustl.edu	37	13	31903672	31903672	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr13:31903672C>T	ENST00000343307.4	+	15	1513	c.1364C>T	c.(1363-1365)tCt>tTt	p.S455F		NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	455					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		GACTACCTTTCTCATCAAGTT	0.458																																						dbGAP											0													130.0	123.0	125.0					13																	31903672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.1364C>T	13.37:g.31903672C>T	ENSP00000343002:p.Ser455Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5F8|Q5W0H2|Q6NUI3	Missense_Mutation	SNP	pfam_Fringe-like	p.S455F	ENST00000343307.4	37	c.1364	CCDS9341.1	13	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721006	0.89205	.	.	ENSG00000187676	ENST00000343307	T	0.64260	-0.09	5.7	5.7	0.88788	.	0.240823	0.42682	D	0.000678	T	0.73992	0.3658	L	0.59436	1.845	0.48901	D	0.999729	D	0.61080	0.989	D	0.66716	0.946	T	0.66093	-0.6009	10	0.09590	T	0.72	-12.4477	19.8276	0.96624	0.0:1.0:0.0:0.0	.	455	Q6Y288	B3GLT_HUMAN	F	455	ENSP00000343002:S455F	ENSP00000343002:S455F	S	+	2	0	B3GALTL	30801672	0.995000	0.38212	0.683000	0.30040	0.992000	0.81027	5.801000	0.69115	2.697000	0.92050	0.585000	0.79938	TCT	B3GALTL	-	pfam_Fringe-like	ENSG00000187676		0.458	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALTL	HGNC	protein_coding	OTTHUMT00000044396.3	39	0.00	0	C	NM_194318		31903672	31903672	+1	no_errors	ENST00000343307	ensembl	human	known	69_37n	missense	84	64.41	152	SNP	0.946	T
CD69	969	genome.wustl.edu	37	12	9907739	9907739	+	Silent	SNP	C	C	T			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr12:9907739C>T	ENST00000228434.3	-	3	386	c.306G>A	c.(304-306)gtG>gtA	p.V102V	CD69_ENST00000536709.1_Silent_p.V102V	NM_001781.2	NP_001772.1	Q07108	CD69_HUMAN	CD69 molecule	102	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular response to drug (GO:0035690)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10						AGCTCCTCTTCACAGTAGAAA	0.423																																						dbGAP											0													101.0	105.0	103.0					12																	9907739		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z22576	CCDS8604.1	12p13	2011-08-30	2006-03-28		ENSG00000110848	ENSG00000110848		"""C-type lectin domain containing"", ""CD molecules"""	1694	protein-coding gene	gene with protein product		107273	"""CD69 antigen (p60, early T-cell activation antigen)"""			1612643	Standard	NM_001781		Approved	CLEC2C	uc001qwk.3	Q07108	OTTHUMG00000168481	ENST00000228434.3:c.306G>A	12.37:g.9907739C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.V102	ENST00000228434.3	37	c.306	CCDS8604.1	12																																																																																			CD69	-	pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000110848		0.423	CD69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD69	HGNC	protein_coding	OTTHUMT00000399876.1	50	0.00	0	C			9907739	9907739	-1	no_errors	ENST00000228434	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	0.000	T
CLK1	1195	genome.wustl.edu	37	2	201726041	201726041	+	Missense_Mutation	SNP	A	A	C	rs111674898		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr2:201726041A>C	ENST00000321356.4	-	3	445	c.310T>G	c.(310-312)Tct>Gct	p.S104A	Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000434813.2_Missense_Mutation_p.S146A|CLK1_ENST00000492793.1_5'UTR	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	104					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CTACCAGAAGACTTGCTACTA	0.418																																						dbGAP											0													188.0	186.0	187.0					2																	201726041		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.310T>G	2.37:g.201726041A>C	ENSP00000326830:p.Ser104Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S104A	ENST00000321356.4	37	c.310	CCDS2331.1	2	.	.	.	.	.	.	.	.	.	.	A	17.61	3.432687	0.62844	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000434813	T;T	0.67698	-0.25;-0.28	4.66	4.66	0.58398	.	0.295967	0.32819	N	0.005618	T	0.76644	0.4016	M	0.68317	2.08	0.29795	N	0.832884	D;D	0.64830	0.994;0.99	D;P	0.72338	0.977;0.817	T	0.72268	-0.4343	10	0.34782	T	0.22	.	9.8247	0.40905	0.8282:0.1718:0.0:0.0	.	146;104	B4DFW7;P49759	.;CLK1_HUMAN	A	104;104;146	ENSP00000326830:S104A;ENSP00000394734:S146A	ENSP00000326830:S104A	S	-	1	0	CLK1	201434286	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.338000	0.79269	1.863000	0.54032	0.528000	0.53228	TCT	CLK1	-	NULL	ENSG00000013441		0.418	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK1	HGNC	protein_coding	OTTHUMT00000256192.2	71	0.00	0	A			201726041	201726041	-1	no_errors	ENST00000321356	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	C
COL6A6	131873	genome.wustl.edu	37	3	130290018	130290018	+	Missense_Mutation	SNP	G	G	A	rs567427258		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr3:130290018G>A	ENST00000358511.6	+	6	2789	c.2758G>A	c.(2758-2760)Gat>Aat	p.D920N	COL6A6_ENST00000453409.2_Missense_Mutation_p.D920N	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	920	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.D920N(2)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TGTGATCACCGATGGGGAATC	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		18006	0.0		0.0	False		,,,				2504	0.001					dbGAP											2	Substitution - Missense(2)	urinary_tract(1)|lung(1)											59.0	59.0	59.0					3																	130290018		1924	4128	6052	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2758G>A	3.37:g.130290018G>A	ENSP00000351310:p.Asp920Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D920N	ENST00000358511.6	37	c.2758	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002877	0.93287	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.92149	-2.98;-2.98	4.92	4.92	0.64577	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000012	D	0.95968	0.8687	M	0.78049	2.395	0.54753	D	0.999982	D	0.89917	1.0	D	0.97110	1.0	D	0.95984	0.8980	10	0.54805	T	0.06	.	18.0758	0.89426	0.0:0.0:1.0:0.0	.	920	A6NMZ7	CO6A6_HUMAN	N	920	ENSP00000351310:D920N;ENSP00000399236:D920N	ENSP00000351310:D920N	D	+	1	0	COL6A6	131772708	1.000000	0.71417	0.960000	0.40013	0.915000	0.54546	9.369000	0.97156	2.460000	0.83146	0.561000	0.74099	GAT	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.557	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	41	0.00	0	G	NM_001102608		130290018	130290018	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	3	86.96	20	SNP	1.000	A
CSN2	1447	genome.wustl.edu	37	4	70823234	70823234	+	Silent	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr4:70823234G>A	ENST00000353151.3	-	5	444	c.433C>T	c.(433-435)Ctg>Ttg	p.L145L		NM_001891.2	NP_001882.1	P61201	CSN2_HUMAN	casein beta	0					cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|skin(2)	12						GGCTGGAGCAGAGGCAGAGGA	0.527																																						dbGAP											0													83.0	89.0	87.0					4																	70823234		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X17070	CCDS3532.1	4q21.1	2008-02-05			ENSG00000135222	ENSG00000135222			2447	protein-coding gene	gene with protein product		115460		CASB		1577486	Standard	NM_001891		Approved		uc003hes.4	P05814	OTTHUMG00000129409	ENST00000353151.3:c.433C>T	4.37:g.70823234G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Silent	SNP	pfam_Casein,pirsf_Casein_beta	p.L145	ENST00000353151.3	37	c.433	CCDS3532.1	4																																																																																			CSN2	-	pfam_Casein,pirsf_Casein_beta	ENSG00000135222		0.527	CSN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSN2	HGNC	protein_coding	OTTHUMT00000251565.1	93	0.00	0	G			70823234	70823234	-1	no_errors	ENST00000353151	ensembl	human	known	69_37n	silent	39	22.00	11	SNP	0.000	A
CYYR1	116159	genome.wustl.edu	37	21	27840937	27840937	+	Silent	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr21:27840937G>A	ENST00000299340.4	-	4	691	c.348C>T	c.(346-348)taC>taT	p.Y116Y	AP001596.6_ENST00000421771.1_RNA|AP001596.6_ENST00000444306.1_RNA|CYYR1_ENST00000435845.2_3'UTR|AP001597.1_ENST00000357401.3_RNA|AP001597.1_ENST00000414486.1_RNA|AP001596.6_ENST00000429340.1_RNA	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	116						integral component of membrane (GO:0016021)				large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						GGTCGTGACCGTAGGGTGGTG	0.517																																						dbGAP											0													107.0	89.0	95.0					21																	27840937		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.348C>T	21.37:g.27840937G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Silent	SNP	pfam_CYYR1	p.Y116	ENST00000299340.4	37	c.348	CCDS13578.1	21																																																																																			CYYR1	-	pfam_CYYR1	ENSG00000166265		0.517	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYYR1	HGNC	protein_coding	OTTHUMT00000171654.2	37	0.00	0	G	NM_052954		27840937	27840937	-1	no_errors	ENST00000299340	ensembl	human	known	69_37n	silent	20	23.08	6	SNP	0.029	A
EVC2	132884	genome.wustl.edu	37	4	5692993	5692993	+	Splice_Site	DEL	A	A	-			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr4:5692993delA	ENST00000344408.5	-	4	571	c.518delT	c.(517-519)ctg>cg	p.L173fs	EVC2_ENST00000310917.2_Splice_Site_p.L93fs|EVC2_ENST00000344938.1_Splice_Site_p.L173fs	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	173					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GAAACTTACCAGTGCACATTT	0.313																																						dbGAP											0													73.0	76.0	75.0					4																	5692993		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.519+1T>-	4.37:g.5692993delA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YT3|Q86YT4|Q8NG49	Frame_Shift_Del	DEL	pfam_EVC2-like	p.L173fs	ENST00000344408.5	37	c.518	CCDS3382.2	4																																																																																			EVC2	-	NULL	ENSG00000173040		0.313	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	37	0.00	0	A	NM_147127	Frame_Shift_Del	5692993	5692993	-1	no_errors	ENST00000344408	ensembl	human	known	69_37n	frame_shift_del	21	54.17	26	DEL	0.965	-
FGB	2244	genome.wustl.edu	37	4	155490686	155490686	+	Missense_Mutation	SNP	G	G	A	rs368867072		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr4:155490686G>A	ENST00000302068.4	+	7	1042	c.979G>A	c.(979-981)Gat>Aat	p.D327N	FGB_ENST00000502545.1_Intron|FGB_ENST00000509493.1_Missense_Mutation_p.D108N	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	327	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GCTTGGAAATGATAAAATTAG	0.358																																					NSCLC(106;1133 1613 21870 46110 52656)	dbGAP											0													59.0	62.0	61.0					4																	155490686		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.979G>A	4.37:g.155490686G>A	ENSP00000306099:p.Asp327Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.D327N	ENST00000302068.4	37	c.979	CCDS3786.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.646963	0.96714	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	D;D	0.83075	-1.68;-1.68	5.53	5.53	0.82687	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.087171	0.85682	D	0.000000	D	0.91640	0.7358	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;0.966	D;P	0.91635	0.999;0.798	D	0.91991	0.5603	10	0.87932	D	0	.	19.8195	0.96586	0.0:0.0:1.0:0.0	.	310;327	B4E1D3;P02675	.;FIBB_HUMAN	N	327;310;108	ENSP00000306099:D327N;ENSP00000426757:D108N	ENSP00000306099:D327N	D	+	1	0	FGB	155710136	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.834000	0.86773	2.756000	0.94617	0.655000	0.94253	GAT	FGB	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000171564		0.358	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	HGNC	protein_coding	OTTHUMT00000317595.1	37	0.00	0	G	NM_005141		155490686	155490686	+1	no_errors	ENST00000302068	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	1.000	A
GBX2	2637	genome.wustl.edu	37	2	237074835	237074835	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr2:237074835C>T	ENST00000306318.4	-	2	1166	c.769G>A	c.(769-771)Gag>Aag	p.E257K	AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000465889.1_5'UTR|GBX2_ENST00000551105.1_3'UTR|AC079135.1_ENST00000415226.1_RNA	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	257					autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		AGCAGCTGCTCGCTGGTGAAG	0.677																																						dbGAP											0													34.0	39.0	37.0					2																	237074835		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.769G>A	2.37:g.237074835C>T	ENSP00000302251:p.Glu257Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPH7|O43833|Q53RX5|Q9Y5Y1	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.E257K	ENST00000306318.4	37	c.769	CCDS2515.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.445985	0.96187	.	.	ENSG00000168505	ENST00000306318	D	0.96587	-4.06	4.42	4.42	0.53409	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96473	0.8849	L	0.28400	0.85	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96704	0.9520	10	0.44086	T	0.13	-15.6503	17.0285	0.86454	0.0:1.0:0.0:0.0	.	257	P52951	GBX2_HUMAN	K	257	ENSP00000302251:E257K	ENSP00000302251:E257K	E	-	1	0	GBX2	236739574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.989000	0.70587	2.013000	0.59113	0.561000	0.74099	GAG	GBX2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000168505		0.677	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBX2	HGNC	protein_coding	OTTHUMT00000257078.3	8	0.00	0	C	NM_001485		237074835	237074835	-1	no_errors	ENST00000306318	ensembl	human	known	69_37n	missense	10	56.52	13	SNP	1.000	T
GOLGA6L6	727832	genome.wustl.edu	37	15	20740459	20740461	+	In_Frame_Del	DEL	TCG	TCG	-			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	TCG	TCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr15:20740459_20740461delTCG	ENST00000427390.2	-	8	1379_1381	c.1289_1291delCGA	c.(1288-1293)gcgaag>gag	p.430_431AK>E		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	430	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctccacatcttcgcctcctgctc	0.552																																						dbGAP											0										16,452		5,6,223							0.0			1	60,546		25,10,268	no	coding	GOLGA6L6	NM_001145004.1		30,16,491	A1A1,A1R,RR		9.901,3.4188,7.0764				76,998				-	-	-	SO:0001651	inframe_deletion	0			AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1289_1291delCGA	15.37:g.20740459_20740461delTCG	ENSP00000398615:p.Ala430_Lys431delinsGlu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3YTC0	In_Frame_Del	DEL	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.AK430in_frame_delE	ENST00000427390.2	37	c.1291_1289	CCDS45184.1	15																																																																																			GOLGA6L6	-	NULL	ENSG00000215405		0.552	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	HGNC	protein_coding	OTTHUMT00000414660.3	22	0.00	0	TCG	NM_001145004		20740459	20740461	-1	no_errors	ENST00000427390	ensembl	human	known	69_37n	in_frame_del	6	41.67	5	DEL	0.966:0.963:0.960	-
IGHMBP2	3508	genome.wustl.edu	37	11	68678993	68678993	+	Silent	SNP	C	C	T			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr11:68678993C>T	ENST00000255078.3	+	5	744	c.633C>T	c.(631-633)atC>atT	p.I211I	IGHMBP2_ENST00000539224.1_Missense_Mutation_p.H179Y	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	211					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AACTTGCCATCATCCATGGAC	0.507																																						dbGAP											0													116.0	102.0	107.0					11																	68678993		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.633C>T	11.37:g.68678993C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	NULL	p.H179Y	ENST00000255078.3	37	c.535	CCDS8187.1	11	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194664	0.38806	.	.	ENSG00000132740	ENST00000539224	T	0.66099	-0.19	4.93	2.92	0.33932	.	.	.	.	.	T	0.58366	0.2117	.	.	.	0.23649	N	0.997207	.	.	.	.	.	.	T	0.53732	-0.8397	6	0.72032	D	0.01	-11.4507	5.782	0.18312	0.0:0.6597:0.1615:0.1788	.	.	.	.	Y	179	ENSP00000440465:H179Y	ENSP00000440465:H179Y	H	+	1	0	IGHMBP2	68435569	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	1.218000	0.32467	1.063000	0.40649	0.478000	0.44815	CAT	IGHMBP2	-	NULL	ENSG00000132740		0.507	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	60	0.00	0	C	NM_002180		68678993	68678993	+1	no_errors	ENST00000539224	ensembl	human	novel	69_37n	missense	44	32.31	21	SNP	1.000	T
ISLR2	57611	genome.wustl.edu	37	15	74425574	74425574	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr15:74425574G>A	ENST00000361742.3	+	4	1248	c.479G>A	c.(478-480)cGt>cAt	p.R160H	ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000565540.1_Missense_Mutation_p.R160H|ISLR2_ENST00000565159.1_Missense_Mutation_p.R160H|ISLR2_ENST00000435464.1_Missense_Mutation_p.R160H|ISLR2_ENST00000453268.2_Missense_Mutation_p.R160H|ISLR2_ENST00000419208.1_Missense_Mutation_p.R160H|ISLR2_ENST00000445793.1_Missense_Mutation_p.R160H	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	160					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						AACCGGCTGCGTACGCTGGCG	0.632																																						dbGAP											0													55.0	60.0	58.0					15																	74425574		2198	4297	6495	-	-	-	SO:0001583	missense	0				CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.479G>A	15.37:g.74425574G>A	ENSP00000355402:p.Arg160His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K352|Q9P263	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Ig-like	p.R160H	ENST00000361742.3	37	c.479	CCDS10259.1	15	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923823	0.34002	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000419208	T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41	4.46	4.46	0.54185	.	0.136685	0.47852	U	0.000211	T	0.36880	0.0983	L	0.28344	0.845	0.40248	D	0.978032	B	0.30973	0.302	B	0.24394	0.053	T	0.31447	-0.9943	10	0.37606	T	0.19	.	12.2432	0.54555	0.0:0.3317:0.6683:0.0	.	160	Q6UXK2	ISLR2_HUMAN	H	160	ENSP00000403244:R160H;ENSP00000355402:R160H;ENSP00000411443:R160H;ENSP00000411834:R160H;ENSP00000408872:R160H	ENSP00000355402:R160H	R	+	2	0	ISLR2	72212627	0.993000	0.37304	0.974000	0.42286	0.564000	0.35744	5.513000	0.67037	2.042000	0.60477	0.407000	0.27541	CGT	ISLR2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000167178		0.632	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISLR2	HGNC	protein_coding	OTTHUMT00000269046.1	13	0.00	0	G	NM_020851		74425574	74425574	+1	no_errors	ENST00000361742	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	0.994	A
KNTC1	9735	genome.wustl.edu	37	12	123073362	123073365	+	Splice_Site	DEL	AAGT	AAGT	-			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	AAGT	AAGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr12:123073362_123073365delAAGT	ENST00000333479.7	+	40	4175_4176	c.3998_3999delAAGT	c.(3997-3999)aaa>a	p.K1333fs	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1333					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.?(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CTACTGCACAAAGTAAGTATTTGT	0.299																																						dbGAP											1	Unknown(1)	kidney(1)																																								-	-	-	SO:0001630	splice_region_variant	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3999+1AAGT>-	12.37:g.123073366_123073369delAAGT		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C4|B3KSG2	Frame_Shift_Del	DEL	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.K1333fs	ENST00000333479.7	37	c.3998_3999	CCDS45002.1	12																																																																																			KNTC1	-	NULL	ENSG00000184445		0.299	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	29	0.00	0	AAGT		Frame_Shift_Del	123073362	123073365	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	frame_shift_del	63	22.22	18	DEL	1.000:1.000	-
LINC00200	399706	genome.wustl.edu	37	10	1205736	1205736	+	lincRNA	SNP	A	A	G	rs60415666		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr10:1205736A>G	ENST00000425630.1	+	0	29					NR_015376.2				long intergenic non-protein coding RNA 200																		ATGAGGGATGACGCAGGCACA	0.667																																						dbGAP											0													15.0	18.0	17.0					10																	1205736		687	1591	2278	-	-	-			0			AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1205736A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			LINC00200	-	-	ENSG00000229205		0.667	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	HGNC	lincRNA	OTTHUMT00000046417.2	8	0.00	0	A	NR_015376		1205736	1205736	+1	no_errors	ENST00000425630	ensembl	human	known	69_37n	rna	20	23.08	6	SNP	0.155	G
LPA	4018	genome.wustl.edu	37	6	161056225	161056225	+	Silent	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr6:161056225G>A	ENST00000316300.5	-	7	1049	c.1005C>T	c.(1003-1005)gaC>gaT	p.D335D	LPA_ENST00000447678.1_Silent_p.D335D			P08519	APOA_HUMAN	lipoprotein, Lp(a)	2843	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TCCCTTCTGCGTCTGAGCATT	0.562																																						dbGAP											0													20.0	28.0	25.0					6																	161056225		1305	3274	4579	-	-	-	SO:0001819	synonymous_variant	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.1005C>T	6.37:g.161056225G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTD7|Q9UD88	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.D335	ENST00000316300.5	37	c.1005	CCDS43523.1	6																																																																																			LPA	-	superfamily_Kringle-like,smart_Kringle	ENSG00000198670		0.562	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	25	0.00	0	G	NM_005577		161056225	161056225	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	silent	13	31.58	6	SNP	0.005	A
LRRIQ1	84125	genome.wustl.edu	37	12	85515540	85515540	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr12:85515540C>T	ENST00000393217.2	+	16	3504	c.3443C>T	c.(3442-3444)tCa>tTa	p.S1148L		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1148	LRRCT.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AACTCTAATTCAGAAAGCCGC	0.368																																						dbGAP											0													82.0	78.0	80.0					12																	85515540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3443C>T	12.37:g.85515540C>T	ENSP00000376910:p.Ser1148Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.S1148L	ENST00000393217.2	37	c.3443	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	C	8.037	0.762990	0.15914	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.52983	0.64	5.44	3.62	0.41486	.	0.678460	0.12844	N	0.434585	T	0.30978	0.0782	N	0.14661	0.345	0.09310	N	1	B;B	0.18461	0.013;0.028	B;B	0.15870	0.007;0.014	T	0.20009	-1.0288	10	0.45353	T	0.12	.	10.2059	0.43112	0.0:0.844:0.0:0.156	.	1148;1123	Q96JM4;C9JI57	LRIQ1_HUMAN;.	L	1148;1123;1148	ENSP00000376910:S1148L	ENSP00000256007:S1148L	S	+	2	0	LRRIQ1	84039671	0.012000	0.17670	0.004000	0.12327	0.058000	0.15608	0.973000	0.29422	0.791000	0.33826	0.579000	0.79373	TCA	LRRIQ1	-	NULL	ENSG00000133640		0.368	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	42	0.00	0	C	NM_032165		85515540	85515540	+1	no_errors	ENST00000393217	ensembl	human	known	69_37n	missense	60	24.05	19	SNP	0.002	T
MTRR	4552	genome.wustl.edu	37	5	7878145	7878145	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr5:7878145A>C	ENST00000264668.2	+	5	601	c.571A>C	c.(571-573)Agt>Cgt	p.S191R	MTRR_ENST00000502509.1_3'UTR|MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Missense_Mutation_p.S164R	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	191					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	AGAGGAGATAAGTGGCGCACT	0.507																																						dbGAP											0													62.0	60.0	61.0					5																	7878145		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.571A>C	5.37:g.7878145A>C	ENSP00000264668:p.Ser191Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin,pfscan_Flavodoxin/NO_synth	p.S191R	ENST00000264668.2	37	c.571	CCDS3874.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.534|9.534	1.111598|1.111598	0.20714|0.20714	.|.	.|.	ENSG00000124275|ENSG00000124275	ENST00000514220|ENST00000264668;ENST00000440940	.|T;T	.|0.02197	.|4.4;4.4	5.91|5.91	3.26|3.26	0.37387|0.37387	.|.	.|1.536540	.|0.03689	.|N	.|0.246744	T|T	0.03915|0.03915	0.0110|0.0110	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	0.999995|0.999995	.|B	.|0.27625	.|0.183	.|B	.|0.24541	.|0.054	T|T	0.52764|0.52764	-0.8532|-0.8532	5|10	.|0.17832	.|T	.|0.49	-3.7125|-3.7125	8.9274|8.9274	0.35650|0.35650	0.7813:0.0:0.2187:0.0|0.7813:0.0:0.2187:0.0	.|.	.|191	.|Q9UBK8	.|MTRR_HUMAN	T|R	92|191;164	.|ENSP00000264668:S191R;ENSP00000402510:S164R	.|ENSP00000264668:S191R	K|S	+|+	2|1	0|0	MTRR|MTRR	7931145|7931145	0.006000|0.006000	0.16342|0.16342	0.005000|0.005000	0.12908|0.12908	0.010000|0.010000	0.07245|0.07245	1.209000|1.209000	0.32357|0.32357	0.936000|0.936000	0.37367|0.37367	0.533000|0.533000	0.62120|0.62120	AAG|AGT	MTRR	-	NULL	ENSG00000124275		0.507	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	HGNC	protein_coding	OTTHUMT00000206931.1	34	0.00	0	A			7878145	7878145	+1	no_errors	ENST00000264668	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.004	C
MX2	4600	genome.wustl.edu	37	21	42770841	42770841	+	Silent	SNP	A	A	G			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr21:42770841A>G	ENST00000330714.3	+	9	1351	c.1167A>G	c.(1165-1167)ttA>ttG	p.L389L	MX2_ENST00000496774.1_3'UTR|MX2_ENST00000543692.1_3'UTR	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	389					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				TCCCGTTGTTAGAAGGACAAA	0.493																																						dbGAP											0													92.0	94.0	94.0					21																	42770841		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.1167A>G	21.37:g.42770841A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5D3|D3DSI7	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_CH-domain,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.L389	ENST00000330714.3	37	c.1167	CCDS13672.1	21																																																																																			MX2	-	pfam_Dynamin_central	ENSG00000183486		0.493	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX2	HGNC	protein_coding	OTTHUMT00000195147.1	70	0.00	0	A	NM_002463		42770841	42770841	+1	no_errors	ENST00000330714	ensembl	human	known	69_37n	silent	33	51.47	35	SNP	0.008	G
MYOCD	93649	genome.wustl.edu	37	17	12655755	12655755	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr17:12655755C>T	ENST00000343344.4	+	10	1150	c.1150C>T	c.(1150-1152)Cga>Tga	p.R384*	MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Nonsense_Mutation_p.R384*|AC005358.1_ENST00000609971.1_Nonsense_Mutation_p.R288*			Q8IZQ8	MYCD_HUMAN	myocardin	384	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		ACAACAGCTTCGAATTCGGGG	0.453																																						dbGAP											0													66.0	68.0	68.0					17																	12655755		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1150C>T	17.37:g.12655755C>T	ENSP00000341835:p.Arg384*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5UBU5|Q8N7Q1	Nonsense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.R384*	ENST00000343344.4	37	c.1150	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.762712	0.96906	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	.	.	.	5.68	3.65	0.41850	.	0.060804	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-8.6895	7.5792	0.27955	0.2931:0.6302:0.0:0.0767	.	.	.	.	X	103;384;384;288;89	.	ENSP00000341835:R384X	R	+	1	2	MYOCD	12596480	0.999000	0.42202	0.994000	0.49952	0.793000	0.44817	1.370000	0.34238	0.708000	0.31955	-0.218000	0.12543	CGA	MYOCD	-	pfam_SAP_DNA-bd,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	ENSG00000141052		0.453	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	41	0.00	0	C	NM_153604		12655755	12655755	+1	no_errors	ENST00000425538	ensembl	human	known	69_37n	nonsense	6	66.67	12	SNP	1.000	T
PCLO	27445	genome.wustl.edu	37	7	82784867	82784867	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr7:82784867G>A	ENST00000333891.9	-	2	1427	c.1090C>T	c.(1090-1092)Cag>Tag	p.Q364*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.Q364*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCAAGAGGCTGAGCTGGAGGC	0.597																																						dbGAP											0													46.0	48.0	47.0					7																	82784867		1970	4162	6132	-	-	-	SO:0001587	stop_gained	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1090C>T	7.37:g.82784867G>A	ENSP00000334319:p.Gln364*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.Q364*	ENST00000333891.9	37	c.1090	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.017268	0.98006	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	.	.	.	2.96	2.96	0.34315	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.3765	0.38286	0.0:0.0:0.7858:0.2141	.	.	.	.	X	364	.	ENSP00000334319:Q364X	Q	-	1	0	PCLO	82622803	0.969000	0.33509	0.936000	0.37596	0.554000	0.35429	5.648000	0.67930	2.000000	0.58554	0.650000	0.86243	CAG	PCLO	-	NULL	ENSG00000186472		0.597	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	81	0.00	0	G	NM_014510		82784867	82784867	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	nonsense	62	13.89	10	SNP	1.000	A
PLA2G4A	5321	genome.wustl.edu	37	1	186934718	186934718	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr1:186934718C>T	ENST00000367466.3	+	15	1909	c.1757C>T	c.(1756-1758)cCg>cTg	p.P586L	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.P526L	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	586	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TCTAGTCCTCCGTTCAAGGTA	0.428																																						dbGAP											0													137.0	126.0	130.0					1																	186934718		2203	4300	6503	-	-	-	SO:0001583	missense	0			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1757C>T	1.37:g.186934718C>T	ENSP00000356436:p.Pro586Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG4|Q29R80	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.P586L	ENST00000367466.3	37	c.1757	CCDS1372.1	1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493289	0.64186	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.49432	0.78;0.78	5.59	5.59	0.84812	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.72851	0.3512	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76547	-0.2919	10	0.87932	D	0	-9.1598	18.5768	0.91158	0.0:1.0:0.0:0.0	.	526;586	E7EU42;P47712	.;PA24A_HUMAN	L	586;526	ENSP00000356436:P586L;ENSP00000406892:P526L	ENSP00000356436:P586L	P	+	2	0	PLA2G4A	185201341	1.000000	0.71417	0.870000	0.34147	0.132000	0.20833	7.311000	0.78958	2.641000	0.89580	0.591000	0.81541	CCG	PLA2G4A	-	pfam_LysoPLipase_cat_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000116711		0.428	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4A	HGNC	protein_coding	OTTHUMT00000086236.1	53	0.00	0	C	NM_024420		186934718	186934718	+1	no_errors	ENST00000367466	ensembl	human	known	69_37n	missense	32	43.86	25	SNP	1.000	T
PLEKHG2	64857	genome.wustl.edu	37	19	39905706	39905706	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr19:39905706G>C	ENST00000409794.3	+	3	1034	c.184G>C	c.(184-186)Ggg>Cgg	p.G62R	PLEKHG2_ENST00000458508.2_Intron|PLEKHG2_ENST00000378550.1_Missense_Mutation_p.G62R|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.G62R|PLEKHG2_ENST00000409797.2_Missense_Mutation_p.G62R	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	62					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGGCTCTGAGGGGGATCCAGC	0.682																																						dbGAP											0													12.0	12.0	12.0					19																	39905706		2194	4292	6486	-	-	-	SO:0001583	missense	0			AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.184G>C	19.37:g.39905706G>C	ENSP00000386733:p.Gly62Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G62R	ENST00000409794.3	37	c.184	CCDS33022.2	19	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245183	0.59103	.	.	ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000378550;ENST00000438123;ENST00000409797;ENST00000451354	T;T;T;T;T	0.72282	-0.32;-0.24;-0.64;-0.64;1.82	4.98	4.98	0.66077	.	0.124410	0.32028	N	0.006694	T	0.75406	0.3845	L	0.29908	0.895	0.36573	D	0.873107	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80016	-0.1559	10	0.49607	T	0.09	.	13.7276	0.62767	0.0:0.0:1.0:0.0	.	62;62	Q9H7P9;Q9H7P9-2	PKHG2_HUMAN;.	R	62;62;62;63;62;63	ENSP00000386733:G62R;ENSP00000392906:G62R;ENSP00000367812:G62R;ENSP00000386492:G62R;ENSP00000412818:G63R	ENSP00000367812:G62R	G	+	1	0	PLEKHG2	44597546	0.977000	0.34250	1.000000	0.80357	0.401000	0.30781	0.780000	0.26760	2.321000	0.78463	0.313000	0.20887	GGG	PLEKHG2	-	NULL	ENSG00000090924		0.682	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG2	HGNC	protein_coding	OTTHUMT00000326802.1	9	0.00	0	G	NM_022835		39905706	39905706	+1	no_errors	ENST00000409794	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	1.000	C
PTPN9	5780	genome.wustl.edu	37	15	75815503	75815503	+	Silent	SNP	T	T	C	rs372646050		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr15:75815503T>C	ENST00000306726.2	-	4	893	c.381A>G	c.(379-381)gtA>gtG	p.V127V		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	127	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)	p.V127V(1)		central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAGCCTGAAGTACCACATGTT	0.428																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											108.0	106.0	107.0					15																	75815503		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0				CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.381A>G	15.37:g.75815503T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XR9	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_CRAL-TRIO_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_CRAL-bd_toc_tran	p.V127	ENST00000306726.2	37	c.381	CCDS10280.1	15																																																																																			PTPN9	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000169410		0.428	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN9	HGNC	protein_coding	OTTHUMT00000286474.1	63	0.00	0	T			75815503	75815503	-1	no_errors	ENST00000306726	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.817	C
RBBP7	5931	genome.wustl.edu	37	X	16871848	16871848	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chrX:16871848C>G	ENST00000380087.2	-	6	1075	c.715G>C	c.(715-717)Gag>Cag	p.E239Q	RBBP7_ENST00000404022.1_Missense_Mutation_p.E230Q|RBBP7_ENST00000380084.4_Missense_Mutation_p.E283Q			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	239					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					AACAATGACTCGTGCAGCAGG	0.443																																						dbGAP											0													154.0	111.0	125.0					X																	16871848		2203	4300	6503	-	-	-	SO:0001583	missense	0			U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.715G>C	X.37:g.16871848C>G	ENSP00000369427:p.Glu239Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JP00	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Histone-bd_RBBP4,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E239Q	ENST00000380087.2	37	c.715	CCDS14179.1	X	.	.	.	.	.	.	.	.	.	.	C	19.82	3.899064	0.72754	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000444437;ENST00000416035	T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	M	0.66560	2.04	0.80722	D	1	P;B;P;B	0.41159	0.74;0.343;0.581;0.382	B;B;B;B	0.33454	0.164;0.112;0.16;0.16	T	0.64837	-0.6313	10	0.87932	D	0	-4.1341	16.9806	0.86326	0.0:1.0:0.0:0.0	.	225;230;239;283	B0R0W4;E9PC52;Q16576;Q5JP00	.;.;RBBP7_HUMAN;.	Q	239;283;230;43;159	ENSP00000369427:E239Q;ENSP00000369424:E283Q;ENSP00000386068:E230Q;ENSP00000402796:E43Q;ENSP00000392714:E159Q	ENSP00000369424:E283Q	E	-	1	0	RBBP7	16781769	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	7.772000	0.85439	2.409000	0.81822	0.600000	0.82982	GAG	RBBP7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000102054		0.443	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP7	HGNC	protein_coding	OTTHUMT00000055920.2	92	0.00	0	C	NM_002893		16871848	16871848	-1	no_errors	ENST00000380087	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	G
RUNDC3A	10900	genome.wustl.edu	37	17	42390802	42390802	+	Missense_Mutation	SNP	G	G	A	rs563233289		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr17:42390802G>A	ENST00000426726.3	+	4	663	c.389G>A	c.(388-390)cGg>cAg	p.R130Q	AC003102.3_ENST00000588097.1_RNA|RUNDC3A_ENST00000590941.1_Missense_Mutation_p.R125Q|RUNDC3A_ENST00000225441.7_Missense_Mutation_p.R130Q	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	130	Interaction with RAP2A. {ECO:0000250}.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)			large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCATGGATCCGGGTGGCACTG	0.597													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18674	0.0		0.0	False		,,,				2504	0.0				Pancreas(82;1061 1416 11136 20771 23901)	dbGAP											0													65.0	69.0	68.0					17																	42390802		2035	4190	6225	-	-	-	SO:0001583	missense	0			AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.389G>A	17.37:g.42390802G>A	ENSP00000410862:p.Arg130Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.R130Q	ENST00000426726.3	37	c.389	CCDS45698.1	17	.	.	.	.	.	.	.	.	.	.	g	32	5.117967	0.94385	.	.	ENSG00000108309	ENST00000426726;ENST00000225441	T;T	0.38240	1.15;1.15	4.56	4.56	0.56223	RUN (3);	0.000000	0.64402	D	0.000001	T	0.65512	0.2698	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.996;0.996	T	0.73877	-0.3844	10	0.87932	D	0	-20.1616	16.0991	0.81158	0.0:0.0:1.0:0.0	.	130;130;125;130	Q59EK9;Q59EK9-4;Q59EK9-2;Q59EK9-3	RUN3A_HUMAN;.;.;.	Q	130	ENSP00000410862:R130Q;ENSP00000225441:R130Q	ENSP00000225441:R130Q	R	+	2	0	RUNDC3A	39746328	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.236000	0.95360	2.098000	0.63641	0.462000	0.41574	CGG	RUNDC3A	-	pfam_Run,smart_Run,pfscan_Run	ENSG00000108309		0.597	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC3A	HGNC	protein_coding	OTTHUMT00000403173.2	52	0.00	0	G	NM_006695		42390802	42390802	+1	no_errors	ENST00000426726	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	A
SEC63	11231	genome.wustl.edu	37	6	108218930	108218930	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr6:108218930C>G	ENST00000369002.4	-	14	1542	c.1363G>C	c.(1363-1365)Gat>Cat	p.D455H		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	455	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TCTTCATCATCTAACACTGTT	0.328																																						dbGAP											0													183.0	176.0	178.0					6																	108218930		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.1363G>C	6.37:g.108218930C>G	ENSP00000357998:p.Asp455His	Somatic		WXS	Illumina GAIIx	Phase_IV	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_ARM-type_fold,smart_DnaJ_N,smart_Sec63-dom,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.D455H	ENST00000369002.4	37	c.1363	CCDS5061.1	6	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319134	0.81469	.	.	ENSG00000025796	ENST00000369002;ENST00000437345;ENST00000423697	T	0.61627	0.09	4.96	4.96	0.65561	Sec63 domain (3);	0.000000	0.85682	D	0.000000	T	0.71643	0.3364	M	0.72353	2.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74463	-0.3657	10	0.62326	D	0.03	-20.2663	18.569	0.91128	0.0:1.0:0.0:0.0	.	455;455	Q9UGP8;B3KQF0	SEC63_HUMAN;.	H	455;106;315	ENSP00000357998:D455H	ENSP00000357998:D455H	D	-	1	0	SEC63	108325623	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.385000	0.79763	2.468000	0.83385	0.557000	0.71058	GAT	SEC63	-	pfam_Sec63-dom,superfamily_ARM-type_fold,smart_Sec63-dom	ENSG00000025796		0.328	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC63	HGNC	protein_coding	OTTHUMT00000041705.4	128	0.00	0	C	NM_007214		108218930	108218930	-1	no_errors	ENST00000369002	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	1.000	G
SLC10A5	347051	genome.wustl.edu	37	8	82606131	82606131	+	Silent	SNP	C	C	T	rs143046260		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr8:82606131C>T	ENST00000518568.1	-	1	2278	c.1077G>A	c.(1075-1077)acG>acA	p.T359T		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	359						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						GAAGAGGCAGCGTACAAACTT	0.403																																						dbGAP											0													75.0	73.0	74.0					8																	82606131		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.1077G>A	8.37:g.82606131C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN26	Silent	SNP	pfam_BilAc/Na_symport	p.T359	ENST00000518568.1	37	c.1077	CCDS34915.1	8																																																																																			SLC10A5	-	NULL	ENSG00000253598		0.403	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A5	HGNC	protein_coding	OTTHUMT00000379736.1	48	0.00	0	C	XM_294493		82606131	82606131	-1	no_errors	ENST00000518568	ensembl	human	known	69_37n	silent	79	35.71	45	SNP	0.976	T
SUV420H1	51111	genome.wustl.edu	37	11	67941347	67941347	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr11:67941347T>A	ENST00000304363.4	-	6	930	c.577A>T	c.(577-579)Agt>Tgt	p.S193C	SUV420H1_ENST00000402185.2_Missense_Mutation_p.S170C|SUV420H1_ENST00000401547.2_Missense_Mutation_p.S193C|SUV420H1_ENST00000405515.1_Missense_Mutation_p.S193C|SUV420H1_ENST00000402789.1_Missense_Mutation_p.S193C	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	193	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TCAAATCCACTGTCAGTTGCA	0.308																																						dbGAP											0													96.0	90.0	92.0					11																	67941347		2199	4292	6491	-	-	-	SO:0001583	missense	0			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.577A>T	11.37:g.67941347T>A	ENSP00000305899:p.Ser193Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.S193C	ENST00000304363.4	37	c.577	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081142	0.76528	.	.	ENSG00000110066	ENST00000304363;ENST00000401547;ENST00000405515;ENST00000402789;ENST00000402185;ENST00000533271	T;T;T;T;T;D	0.86497	0.9;0.9;0.9;0.9;0.9;-2.13	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.87791	0.6266	N	0.16743	0.435	0.80722	D	1	P;B;D;D	0.89917	0.887;0.413;0.999;1.0	P;P;D;D	0.87578	0.713;0.518;0.995;0.998	D	0.87848	0.2656	10	0.36615	T	0.2	-29.716	15.2769	0.73748	0.0:0.0:0.0:1.0	.	170;193;193;193	B7WNX0;B5MCB3;Q4FZB7-2;Q4FZB7	.;.;.;SV421_HUMAN	C	193;193;193;193;170;21	ENSP00000305899:S193C;ENSP00000385965:S193C;ENSP00000385640:S193C;ENSP00000385005:S193C;ENSP00000384724:S170C;ENSP00000433589:S21C	ENSP00000305899:S193C	S	-	1	0	SUV420H1	67697923	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.972000	0.88022	2.157000	0.67596	0.482000	0.46254	AGT	SUV420H1	-	NULL	ENSG00000110066		0.308	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	HGNC	protein_coding	OTTHUMT00000318319.1	71	0.00	0	T	NM_017635		67941347	67941347	-1	no_errors	ENST00000304363	ensembl	human	known	69_37n	missense	68	37.04	40	SNP	1.000	A
SYCE1	93426	genome.wustl.edu	37	10	135373612	135373612	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr10:135373612A>C	ENST00000343131.5	-	2	223	c.119T>G	c.(118-120)gTg>gGg	p.V40G	SYCE1_ENST00000432597.2_Missense_Mutation_p.V4G|SPRN_ENST00000541506.1_Intron|SYCE1_ENST00000368517.3_Missense_Mutation_p.V4G	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	40					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CAGCTTTTGCACCATTTCCAT	0.512																																						dbGAP											0													192.0	133.0	153.0					10																	135373612		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.119T>G	10.37:g.135373612A>C	ENSP00000341282:p.Val40Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	NULL	p.V40G	ENST00000343131.5	37	c.119	CCDS44501.1	10	.	.	.	.	.	.	.	.	.	.	.	16.67	3.186590	0.57909	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.53640	0.61;0.71;0.71;0.99	4.42	3.28	0.37604	.	0.584505	0.15426	N	0.262949	T	0.47377	0.1442	L	0.55990	1.75	0.51233	D	0.999911	P;P	0.47302	0.893;0.705	P;B	0.47981	0.563;0.261	T	0.46735	-0.9170	10	0.72032	D	0.01	-9.0544	6.7072	0.23257	0.8956:0.0:0.1044:0.0	.	40;4	Q8N0S2;Q8N0S2-2	SYCE1_HUMAN;.	G	40;4;4;40	ENSP00000303978:V40G;ENSP00000411779:V4G;ENSP00000357503:V4G;ENSP00000341282:V40G	ENSP00000303978:V40G	V	-	2	0	SYCE1	135223602	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.771000	0.47670	1.032000	0.39892	0.460000	0.39030	GTG	SYCE1	-	NULL	ENSG00000171772		0.512	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYCE1	HGNC	protein_coding		57	0.00	0	A	NM_201564		135373612	135373612	-1	no_errors	ENST00000343131	ensembl	human	known	69_37n	missense	38	42.42	28	SNP	1.000	C
TDRKH	11022	genome.wustl.edu	37	1	151751327	151751327	+	Silent	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr1:151751327G>A	ENST00000368822.1	-	6	1350	c.717C>T	c.(715-717)aaC>aaT	p.N239N	TDRKH_ENST00000484421.1_5'UTR|TDRKH_ENST00000368827.6_Silent_p.N239N|TDRKH_ENST00000458431.2_Silent_p.N239N|TDRKH_ENST00000368824.3_Silent_p.N239N|TDRKH_ENST00000368823.1_Silent_p.N235N|TDRKH_ENST00000368825.3_Silent_p.N194N|TDRKH_ENST00000440583.2_Silent_p.N15N			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	239					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)			breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TAGAACTGGTGTTTTTCCATA	0.542																																						dbGAP											0													120.0	117.0	118.0					1																	151751327		2032	4177	6209	-	-	-	SO:0001819	synonymous_variant	0			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.717C>T	1.37:g.151751327G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Silent	SNP	pfam_KH_dom_type_1,pfam_Tudor,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.N239	ENST00000368822.1	37	c.717	CCDS41394.1	1																																																																																			TDRKH	-	NULL	ENSG00000182134		0.542	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TDRKH	HGNC	protein_coding	OTTHUMT00000036648.2	93	0.00	0	G	NM_006862		151751327	151751327	-1	no_errors	ENST00000368822	ensembl	human	known	69_37n	silent	34	52.78	38	SNP	0.000	A
TDRD10	126668	genome.wustl.edu	37	1	154493890	154493890	+	Missense_Mutation	SNP	G	G	A	rs543994368		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr1:154493890G>A	ENST00000368480.3	+	6	389	c.304G>A	c.(304-306)Gtg>Atg	p.V102M	TDRD10_ENST00000479937.1_3'UTR|TDRD10_ENST00000368482.4_Missense_Mutation_p.V102M			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	102	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			AAAACTGTTCGTGAATACAAG	0.522																																						dbGAP											0													154.0	164.0	161.0					1																	154493890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.304G>A	1.37:g.154493890G>A	ENSP00000357465:p.Val102Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	pfam_Tudor,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V102M	ENST00000368480.3	37	c.304	CCDS41406.1	1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869110	0.72065	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	D;D	0.84298	-1.83;-1.83	3.79	-2.65	0.06095	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	.	.	.	.	D	0.88370	0.6418	M	0.92077	3.27	0.09310	N	1	D;D	0.76494	0.998;0.999	P;P	0.62014	0.791;0.897	T	0.81953	-0.0697	9	0.72032	D	0.01	-2.7528	9.0328	0.36269	0.0:0.5861:0.2615:0.1523	.	102;102	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	M	102	ENSP00000357467:V102M;ENSP00000357465:V102M	ENSP00000357465:V102M	V	+	1	0	TDRD10	152760514	0.092000	0.21681	0.013000	0.15412	0.742000	0.42306	-0.029000	0.12329	-0.294000	0.08973	0.557000	0.71058	GTG	TDRD10	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000163239		0.522	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD10	HGNC	protein_coding	OTTHUMT00000090700.2	114	0.00	0	G	NM_182499		154493890	154493890	+1	no_errors	ENST00000368480	ensembl	human	known	69_37n	missense	74	15.91	14	SNP	0.021	A
TFDP2	7029	genome.wustl.edu	37	3	141671811	141671811	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr3:141671811A>G	ENST00000489671.1	-	12	1529	c.1099T>C	c.(1099-1101)Tct>Cct	p.S367P	TFDP2_ENST00000317104.7_Missense_Mutation_p.S291P|TFDP2_ENST00000477292.1_Missense_Mutation_p.S231P|TFDP2_ENST00000486111.1_Missense_Mutation_p.S307P|TFDP2_ENST00000467072.1_Missense_Mutation_p.S307P|TFDP2_ENST00000495310.1_Missense_Mutation_p.S270P|TFDP2_ENST00000310282.6_Missense_Mutation_p.S307P|TFDP2_ENST00000499676.2_Missense_Mutation_p.S307P|TFDP2_ENST00000479040.1_Missense_Mutation_p.S306P|TFDP2_ENST00000397991.4_Missense_Mutation_p.S339P			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	367					gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			kidney(1)|upper_aerodigestive_tract(2)	3						GATTGGGTAGAGTTCAGAAGT	0.443																																						dbGAP											0													129.0	129.0	129.0					3																	141671811		1864	4097	5961	-	-	-	SO:0001583	missense	0			U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.1099T>C	3.37:g.141671811A>G	ENSP00000420616:p.Ser367Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Missense_Mutation	SNP	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcription_factor_DP_subgr	p.S367P	ENST00000489671.1	37	c.1099	CCDS54650.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.3|20.3	3.965743|3.965743	0.74131|0.74131	.|.	.|.	ENSG00000114126|ENSG00000114126	ENST00000474279|ENST00000499676;ENST00000489671;ENST00000486111;ENST00000477292;ENST00000495310;ENST00000467072;ENST00000317104;ENST00000310282;ENST00000479040;ENST00000397991	.|T;T;T;T;T;T;T;T;T;T	.|0.50001	.|1.75;1.75;1.75;0.77;0.76;1.75;1.74;1.75;1.76;1.72	5.96|5.96	4.78|4.78	0.61160|0.61160	.|.	.|0.202363	.|0.36444	.|N	.|0.002589	T|T	0.53481|0.53481	0.1799|0.1799	L|L	0.53249|0.53249	1.67|1.67	0.49915|0.49915	D|D	0.999836|0.999836	.|P;D;P	.|0.54964	.|0.954;0.969;0.95	.|P;P;P	.|0.52424	.|0.649;0.638;0.698	T|T	0.54370|0.54370	-0.8304|-0.8304	5|10	.|0.54805	.|T	.|0.06	-5.4775|-5.4775	11.663|11.663	0.51358|0.51358	0.8517:0.1483:0.0:0.0|0.8517:0.1483:0.0:0.0	.|.	.|270;367;307	.|B7Z8L5;Q14188;Q14188-5	.|.;TFDP2_HUMAN;.	P|P	80|307;367;307;231;270;307;291;307;306;339	.|ENSP00000439782:S307P;ENSP00000420616:S367P;ENSP00000420599:S307P;ENSP00000418971:S231P;ENSP00000419036:S270P;ENSP00000418590:S307P;ENSP00000315668:S291P;ENSP00000309622:S307P;ENSP00000417585:S306P;ENSP00000381078:S339P	.|ENSP00000309622:S307P	L|S	-|-	2|1	0|0	TFDP2|TFDP2	143154501|143154501	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.981000|0.981000	0.71138|0.71138	2.502000|2.502000	0.45398|0.45398	1.048000|1.048000	0.40298|0.40298	0.533000|0.533000	0.62120|0.62120	CTC|TCT	TFDP2	-	pirsf_Transcription_factor_DP_subgr	ENSG00000114126		0.443	TFDP2-001	KNOWN	basic|CCDS	protein_coding	TFDP2	HGNC	protein_coding	OTTHUMT00000353294.4	54	0.00	0	A	NM_006286		141671811	141671811	-1	no_errors	ENST00000489671	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	G
TIPRL	261726	genome.wustl.edu	37	1	168165856	168165856	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr1:168165856G>A	ENST00000367833.2	+	5	733	c.588G>A	c.(586-588)atG>atA	p.M196I		NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	196	Interaction with PPP2CA.				DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					TTATCAGAATGAATGACACGA	0.328																																						dbGAP											0													123.0	125.0	124.0					1																	168165856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.588G>A	1.37:g.168165856G>A	ENSP00000356807:p.Met196Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V3|Q5HYB2|Q8IZ86	Missense_Mutation	SNP	pfam_TIP41-like	p.M196I	ENST00000367833.2	37	c.588	CCDS1270.1	1	.	.	.	.	.	.	.	.	.	.	G	6.098	0.386395	0.11524	.	.	ENSG00000143155	ENST00000367833	.	.	.	5.63	5.63	0.86233	.	0.038411	0.85682	D	0.000000	T	0.11495	0.0280	N	0.01535	-0.81	0.40307	D	0.978672	B	0.10296	0.003	B	0.10450	0.005	T	0.30031	-0.9992	8	0.02654	T	1	-21.8237	19.3046	0.94155	0.0:0.0:1.0:0.0	.	196	O75663	TIPRL_HUMAN	I	196	.	ENSP00000356807:M196I	M	+	3	0	TIPRL	166432480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.526000	0.67116	2.652000	0.90054	0.655000	0.94253	ATG	TIPRL	-	pfam_TIP41-like	ENSG00000143155		0.328	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIPRL	HGNC	protein_coding	OTTHUMT00000083822.1	69	0.00	0	G	NM_152902		168165856	168165856	+1	no_errors	ENST00000367833	ensembl	human	known	69_37n	missense	136	12.74	20	SNP	1.000	A
TNMD	64102	genome.wustl.edu	37	X	99849000	99849000	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chrX:99849000G>A	ENST00000373031.4	+	3	506	c.289G>A	c.(289-291)Gat>Aat	p.D97N	TNMD_ENST00000485971.1_3'UTR	NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	97	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						AAATGGCACTGATGAAACATT	0.378																																						dbGAP											0													109.0	100.0	103.0					X																	99849000		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.289G>A	X.37:g.99849000G>A	ENSP00000362122:p.Asp97Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HBX0|Q9UJG0	Missense_Mutation	SNP	pfam_BRICHOS_dom,superfamily_Chitin-bd_1,pfscan_BRICHOS_dom	p.D97N	ENST00000373031.4	37	c.289	CCDS14469.1	X	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704160	0.68615	.	.	ENSG00000000005	ENST00000373031	T	0.80033	-1.33	5.96	5.1	0.69264	BRICHOS (2);	0.322217	0.34002	N	0.004341	T	0.79240	0.4412	L	0.48642	1.525	0.50632	D	0.999882	P	0.42078	0.77	P	0.45449	0.481	T	0.81011	-0.1126	10	0.59425	D	0.04	-25.1719	13.6528	0.62320	0.0752:0.0:0.9248:0.0	.	97	Q9H2S6	TNMD_HUMAN	N	97	ENSP00000362122:D97N	ENSP00000362122:D97N	D	+	1	0	TNMD	99735656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.450000	0.73477	2.523000	0.85059	0.594000	0.82650	GAT	TNMD	-	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	ENSG00000000005		0.378	TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNMD	HGNC	protein_coding	OTTHUMT00000057481.1	92	0.00	0	G	NM_022144		99849000	99849000	+1	no_errors	ENST00000373031	ensembl	human	known	69_37n	missense	65	19.75	16	SNP	1.000	A
UBE2O	63893	genome.wustl.edu	37	17	74401326	74401326	+	Silent	SNP	G	G	A			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr17:74401326G>A	ENST00000319380.7	-	3	613	c.549C>T	c.(547-549)atC>atT	p.I183I		NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	183					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						CGGGATAGATGATGCAGTTGG	0.592																																						dbGAP											0													188.0	122.0	144.0					17																	74401326		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.549C>T	17.37:g.74401326G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.I183	ENST00000319380.7	37	c.549	CCDS32742.1	17																																																																																			UBE2O	-	NULL	ENSG00000175931		0.592	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	HGNC	protein_coding	OTTHUMT00000450123.1	46	0.00	0	G	NM_022066		74401326	74401326	-1	no_errors	ENST00000319380	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	1.000	A
WDR44	54521	genome.wustl.edu	37	X	117577583	117577583	+	Silent	SNP	C	C	G			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chrX:117577583C>G	ENST00000254029.3	+	18	2840	c.2445C>G	c.(2443-2445)acC>acG	p.T815T	WDR44_ENST00000371825.3_Silent_p.T807T|WDR44_ENST00000371822.5_Silent_p.T726T	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	815						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						TCTGGAGTACCTACCATGACC	0.363																																						dbGAP											0													191.0	171.0	178.0					X																	117577583		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.2445C>G	X.37:g.117577583C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L715V	ENST00000254029.3	37	c.2143	CCDS14572.1	X	.	.	.	.	.	.	.	.	.	.	T	8.764	0.924293	0.18056	.	.	ENSG00000131725	ENST00000371848	.	.	.	5.83	-1.94	0.07571	.	.	.	.	.	T	0.37919	0.1021	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31280	-0.9949	4	.	.	.	-16.8601	0.2435	0.00195	0.2656:0.1904:0.2684:0.2755	.	.	.	.	V	715	.	.	L	+	1	2	WDR44	117461611	0.007000	0.16637	0.996000	0.52242	0.990000	0.78478	-1.292000	0.02772	-0.269000	0.09298	-0.325000	0.08501	CTA	WDR44	-	pfscan_WD40_repeat_dom	ENSG00000131725		0.363	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR44	HGNC	protein_coding	OTTHUMT00000058001.1	106	0.00	0	C	NM_019045		117577583	117577583	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000371848	ensembl	human	known	69_37n	missense	49	45.56	41	SNP	0.424	G
WDR91	29062	genome.wustl.edu	37	7	134889109	134889109	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr7:134889109delG	ENST00000354475.4	-	6	833	c.802delC	c.(802-804)cagfs	p.Q268fs	AC009542.2_ENST00000595902.1_RNA|WDR91_ENST00000344400.5_Frame_Shift_Del_p.Q268fs|WDR91_ENST00000423565.1_Frame_Shift_Del_p.Q233fs|WDR91_ENST00000485942.1_5'UTR	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	268										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						TTCTTACTCTGAGGCAGCAGC	0.592																																						dbGAP											0													65.0	57.0	60.0					7																	134889109		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.802delC	7.37:g.134889109delG	ENSP00000346466:p.Gln268fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q268fs	ENST00000354475.4	37	c.802	CCDS34758.1	7																																																																																			WDR91	-	NULL	ENSG00000105875		0.592	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR91	HGNC	protein_coding	OTTHUMT00000340019.1	54	0.00	0	G	NM_014149		134889109	134889109	-1	no_errors	ENST00000354475	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	1.000	-
WHSC1L1	54904	genome.wustl.edu	37	8	38146045	38146045	+	Missense_Mutation	SNP	C	C	T	rs200818177		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr8:38146045C>T	ENST00000317025.8	-	19	3978	c.3461G>A	c.(3460-3462)cGg>cAg	p.R1154Q	WHSC1L1_ENST00000527502.1_Missense_Mutation_p.R1154Q|WHSC1L1_ENST00000433384.2_Missense_Mutation_p.R1105Q	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	1154	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CCAGCCTCTCCGCTCCGTTTT	0.527			T	NUP98	AML								C|||	1	0.000199681	0.0008	0.0	5008	,	,		18278	0.0		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													118.0	116.0	117.0					8																	38146045		1935	4137	6072	-	-	-	SO:0001583	missense	0			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.3461G>A	8.37:g.38146045C>T	ENSP00000313983:p.Arg1154Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.R1154Q	ENST00000317025.8	37	c.3461	CCDS43729.1	8	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	23.9	4.465355	0.84425	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502	D;D;D	0.89270	-2.49;-2.49;-2.49	6.08	6.08	0.98989	SET domain (2);	0.000000	0.41500	U	0.000869	D	0.83225	0.5208	N	0.05351	-0.065	0.80722	D	1	D;D;D	0.62365	0.984;0.991;0.984	B;P;B	0.48901	0.389;0.594;0.389	T	0.80830	-0.1207	10	0.15066	T	0.55	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	1154;1105;1154	B7ZL11;Q9BZ95-2;Q9BZ95	.;.;NSD3_HUMAN	Q	1105;1154;1091;1154	ENSP00000393284:R1105Q;ENSP00000313983:R1154Q;ENSP00000434730:R1154Q	ENSP00000313983:R1154Q	R	-	2	0	WHSC1L1	38265202	1.000000	0.71417	0.970000	0.41538	0.987000	0.75469	4.961000	0.63681	2.894000	0.99253	0.591000	0.81541	CGG	WHSC1L1	-	smart_SET_dom,pfscan_SET_dom	ENSG00000147548		0.527	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1L1	HGNC	protein_coding	OTTHUMT00000381924.3	51	0.00	0	C	NM_023034		38146045	38146045	-1	no_errors	ENST00000317025	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	0.995	T
ZNF586	54807	genome.wustl.edu	37	19	58291158	58291158	+	Silent	SNP	T	T	C	rs192302381		TCGA-AO-A1KS-01A-11D-A13L-09	TCGA-AO-A1KS-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21074661-4b0f-4adc-b406-5801688a3ae9	460a9133-a189-42d2-acf0-ae61ca265d76	g.chr19:58291158T>C	ENST00000396154.2	+	3	1376	c.1203T>C	c.(1201-1203)taT>taC	p.Y401Y	ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000391702.3_Silent_p.Y358Y|ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000396150.4_3'UTR|ZNF586_ENST00000599802.1_Intron	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGAGGCCTTATAAGTGAAGCA	0.443																																						dbGAP											0													62.0	60.0	60.0					19																	58291158		2085	4237	6322	-	-	-	SO:0001819	synonymous_variant	0			AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.1203T>C	19.37:g.58291158T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y401	ENST00000396154.2	37	c.1203	CCDS42640.1	19																																																																																			ZNF586	-	NULL	ENSG00000083828		0.443	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF586	HGNC	protein_coding	OTTHUMT00000466825.2	25	0.00	0	T	NM_017652		58291158	58291158	+1	no_errors	ENST00000396154	ensembl	human	known	69_37n	silent	54	46.00	46	SNP	0.287	C
