#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AACS	65985	genome.wustl.edu	37	12	125576043	125576043	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr12:125576043T>A	ENST00000316519.6	+	5	750	c.544T>A	c.(544-546)Tcc>Acc	p.S182T	AACS_ENST00000261686.6_Missense_Mutation_p.S182T	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	182					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		CATCTGGAGCTCCACGTCCCC	0.587																																						dbGAP											0													87.0	73.0	77.0					12																	125576043		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.544T>A	12.37:g.125576043T>A	ENSP00000324842:p.Ser182Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Acac_CoA_synth	p.S182T	ENST00000316519.6	37	c.544	CCDS9263.1	12	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876616	0.72180	.	.	ENSG00000081760	ENST00000316519;ENST00000261686;ENST00000535001;ENST00000537477	T;T;T	0.47528	1.14;1.14;0.84	5.08	3.9	0.45041	AMP-dependent synthetase/ligase (1);	0.061133	0.64402	D	0.000002	T	0.63034	0.2477	M	0.80422	2.495	0.80722	D	1	D;P	0.54397	0.966;0.952	P;P	0.57679	0.731;0.825	T	0.65512	-0.6150	10	0.62326	D	0.03	.	10.6699	0.45751	0.0:0.0:0.4567:0.5433	.	182;182	Q86V21-2;Q86V21	.;AACS_HUMAN	T	182;182;38;13	ENSP00000324842:S182T;ENSP00000261686:S182T;ENSP00000439931:S13T	ENSP00000261686:S182T	S	+	1	0	AACS	124141996	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	3.186000	0.50942	0.744000	0.32741	0.533000	0.62120	TCC	AACS	-	pfam_AMP-dep_Synth/Lig,tigrfam_Acac_CoA_synth	ENSG00000081760		0.587	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AACS	HGNC	protein_coding	OTTHUMT00000400202.1	71	0.00	0	T	NM_023928		125576043	125576043	+1	no_errors	ENST00000316519	ensembl	human	known	69_37n	missense	91	11.65	12	SNP	1.000	A
ACTR1A	10121	genome.wustl.edu	37	10	104247996	104247996	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr10:104247996C>T	ENST00000369905.4	-	4	289	c.226G>A	c.(226-228)Gag>Aag	p.E76K	ACTR1A_ENST00000487599.1_Missense_Mutation_p.E76K|ACTR1A_ENST00000446605.2_Missense_Mutation_p.E29K|ACTR1A_ENST00000545684.1_Missense_Mutation_p.E2K	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	76					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)	p.E76*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		ATGCCATGCTCCATGGGATAG	0.527																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											155.0	125.0	135.0					10																	104247996		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.226G>A	10.37:g.104247996C>T	ENSP00000358921:p.Glu76Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6B0|P42024	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.E76K	ENST00000369905.4	37	c.226	CCDS7536.1	10	.	.	.	.	.	.	.	.	.	.	C	37	6.098141	0.97281	.	.	ENSG00000138107	ENST00000369905;ENST00000545684;ENST00000446605	D;D;D	0.97328	-4.34;-4.34;-4.34	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.98223	0.9412	M	0.65320	2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98725	1.0710	10	0.87932	D	0	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	76	P61163	ACTZ_HUMAN	K	76;2;29	ENSP00000358921:E76K;ENSP00000438890:E2K;ENSP00000406028:E29K	ENSP00000358921:E76K	E	-	1	0	ACTR1A	104237986	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	GAG	ACTR1A	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like	ENSG00000138107		0.527	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR1A	HGNC	protein_coding	OTTHUMT00000050053.1	85	0.00	0	C			104247996	104247996	-1	no_errors	ENST00000369905	ensembl	human	known	69_37n	missense	100	34.21	52	SNP	1.000	T
ANKRD30B	374860	genome.wustl.edu	37	18	14803817	14803817	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr18:14803817T>G	ENST00000358984.4	+	24	2458	c.2278T>G	c.(2278-2280)Tta>Gta	p.L760V	ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	760										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAGTGGAAAATTAGAAGGTAA	0.333																																						dbGAP											0													10.0	14.0	13.0					18																	14803817		680	1552	2232	-	-	-	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2278T>G	18.37:g.14803817T>G	ENSP00000351875:p.Leu760Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L760V	ENST00000358984.4	37	c.2278	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	1.064	-0.672063	0.03403	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.12984	2.63	1.35	-2.7	0.06004	.	.	.	.	.	T	0.06280	0.0162	N	0.14661	0.345	0.09310	N	1	B	0.23058	0.079	B	0.15052	0.012	T	0.27773	-1.0064	9	0.46703	T	0.11	.	3.5994	0.08019	0.3145:0.0:0.4747:0.2109	.	760	F8WAG3	.	V	760;35;28	ENSP00000351875:L760V	ENSP00000277669:L28V	L	+	1	2	ANKRD30B	14793817	0.641000	0.27251	0.000000	0.03702	0.010000	0.07245	-0.774000	0.04684	-1.866000	0.01145	-1.372000	0.01188	TTA	ANKRD30B	-	NULL	ENSG00000180777		0.333	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	289	0.34	1	T	NM_001145029		14803817	14803817	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	missense	79	19.39	19	SNP	0.000	G
ANKRD30BL	554226	genome.wustl.edu	37	2	133015302	133015302	+	5'UTR	SNP	T	T	G	rs75692539		TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr2:133015302T>G	ENST00000470729.1	-	0	240				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCAGAGGCGCTCAGGGACGCC	0.677																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1185A>C	2.37:g.133015302T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.677	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	17	0.00	0	T	NR_027019		133015302	133015302	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	40	20.00	10	SNP	0.013	G
ARHGAP17	55114	genome.wustl.edu	37	16	24979688	24979688	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr16:24979688C>G	ENST00000289968.6	-	6	514	c.445G>C	c.(445-447)Gat>Cat	p.D149H	ARHGAP17_ENST00000575975.1_5'UTR|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.D149H|ARHGAP17_ENST00000441763.2_Missense_Mutation_p.D149H	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	149	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CTGACTGAATCCCAGTCTAAC	0.498																																						dbGAP											0													145.0	111.0	123.0					16																	24979688		2197	4300	6497	-	-	-	SO:0001583	missense	0			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.445G>C	16.37:g.24979688C>G	ENSP00000289968:p.Asp149His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.D149H	ENST00000289968.6	37	c.445	CCDS32409.1	16	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599202	0.87055	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000441763;ENST00000455311	D;D;D	0.84146	-1.81;-1.81;-1.81	5.53	5.53	0.82687	BAR (3);	0.000000	0.45867	D	0.000332	D	0.93304	0.7866	M	0.87456	2.885	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.93974	0.7252	10	0.66056	D	0.02	.	16.9874	0.86344	0.0:1.0:0.0:0.0	.	149;149;149;149	Q68EM7-4;C9IZD3;Q68EM7-2;Q68EM7	.;.;.;RHG17_HUMAN	H	149	ENSP00000289968:D149H;ENSP00000303130:D149H;ENSP00000406950:D149H	ENSP00000289968:D149H	D	-	1	0	ARHGAP17	24887189	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.390000	0.79816	2.605000	0.88082	0.655000	0.94253	GAT	ARHGAP17	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000140750		0.498	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP17	HGNC	protein_coding	OTTHUMT00000436548.3	174	0.00	0	C	NM_018054		24979688	24979688	-1	no_errors	ENST00000289968	ensembl	human	known	69_37n	missense	125	18.18	28	SNP	1.000	G
ARHGEF1	9138	genome.wustl.edu	37	19	42410774	42410774	+	Splice_Site	SNP	T	T	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr19:42410774T>C	ENST00000354532.3	+	27	2803		c.e27+2		ARHGEF1_ENST00000378152.4_Intron|ARHGEF1_ENST00000347545.4_Splice_Site|ARHGEF1_ENST00000337665.4_Splice_Site|CTD-2575K13.6_ENST00000597630.1_RNA|ARHGEF1_ENST00000599846.1_Splice_Site	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1						cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CAGCTGGAGGTGGGGCGGGAC	0.677																																						dbGAP											0													20.0	19.0	19.0					19																	42410774		2202	4297	6499	-	-	-	SO:0001630	splice_region_variant	0			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2655+2T>C	19.37:g.42410774T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Splice_Site	SNP	-	e27+2	ENST00000354532.3	37	c.2700+2	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	T	16.28	3.079202	0.55753	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000337665	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3497	0.49581	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF1	47102614	0.996000	0.38824	0.848000	0.33437	0.628000	0.37860	2.537000	0.45702	1.624000	0.50355	0.397000	0.26171	.	ARHGEF1	-	-	ENSG00000076928		0.677	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	HGNC	protein_coding	OTTHUMT00000463360.1	18	0.00	0	T	NM_199002	Intron	42410774	42410774	+1	no_errors	ENST00000337665	ensembl	human	known	69_37n	splice_site	17	25.00	6	SNP	0.991	C
ARL6	84100	genome.wustl.edu	37	3	97506865	97506865	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr3:97506865C>A	ENST00000463745.1	+	6	858	c.381C>A	c.(379-381)ttC>ttA	p.F127L	ARL6_ENST00000496713.1_3'UTR|ARL6_ENST00000335979.2_Missense_Mutation_p.F127L|ARL6_ENST00000394206.1_Missense_Mutation_p.F127L	NM_001278293.1	NP_001265222.1	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	127					cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|melanosome transport (GO:0032402)|protein polymerization (GO:0051258)|protein targeting to membrane (GO:0006612)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	axonemal microtubule (GO:0005879)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane coat (GO:0030117)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)			large_intestine(1)|lung(4)	5		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		CAATCTTATTCTTTGCAAATA	0.333																																						dbGAP											0													78.0	80.0	79.0					3																	97506865		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC024239	CCDS2928.1	3q11.2	2014-05-09			ENSG00000113966	ENSG00000113966		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	13210	protein-coding gene	gene with protein product		608845		BBS3		15258860, 15314642, 21282186	Standard	NM_032146		Approved	RP55	uc003drv.3	Q9H0F7	OTTHUMG00000159189	ENST00000463745.1:c.381C>A	3.37:g.97506865C>A	ENSP00000419619:p.Phe127Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA93|D3DN31	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.F127L	ENST00000463745.1	37	c.381	CCDS2928.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.30|18.30	3.593322|3.593322	0.66219|0.66219	.|.	.|.	ENSG00000113966|ENSG00000113966	ENST00000463745;ENST00000335979;ENST00000394206|ENST00000476753	T;T;T|.	0.61158|.	0.13;0.13;0.13|.	5.49|5.49	4.6|4.6	0.57074|0.57074	Small GTP-binding protein domain (1);|.	0.049710|.	0.85682|.	D|.	0.000000|.	T|T	0.56906|0.56906	0.2017|0.2017	L|L	0.41710|0.41710	1.295|1.295	0.58432|0.58432	D|D	0.999996|0.999996	P|.	0.52692|.	0.955|.	P|.	0.47981|.	0.563|.	T|T	0.51028|0.51028	-0.8757|-0.8757	10|5	0.59425|.	D|.	0.04|.	.|.	12.0448|12.0448	0.53473|0.53473	0.0:0.9189:0.0:0.0811|0.0:0.9189:0.0:0.0811	.|.	127|.	Q9H0F7|.	ARL6_HUMAN|.	L|Y	127|22	ENSP00000419619:F127L;ENSP00000337722:F127L;ENSP00000377756:F127L|.	ENSP00000337722:F127L|.	F|S	+|+	3|2	2|0	ARL6|ARL6	98989555|98989555	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.086000|1.086000	0.30853|0.30853	2.733000|2.733000	0.93635|0.93635	0.655000|0.655000	0.94253|0.94253	TTC|TCT	ARL6	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,tigrfam_Small_GTP-bd_dom	ENSG00000113966		0.333	ARL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6	HGNC	protein_coding	OTTHUMT00000353756.1	365	0.00	0	C	NM_032146		97506865	97506865	+1	no_errors	ENST00000335979	ensembl	human	known	69_37n	missense	98	16.24	19	SNP	1.000	A
BMPR2	659	genome.wustl.edu	37	2	203242213	203242213	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr2:203242213C>T	ENST00000374580.4	+	1	555	c.16C>T	c.(16-18)Cag>Tag	p.Q6*	BMPR2_ENST00000374574.2_Nonsense_Mutation_p.Q6*|RP11-686O6.2_ENST00000607928.1_lincRNA	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	6					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						TTCCTCGCTGCAGCGGCCCTG	0.642																																						dbGAP											0			GRCh37	CD041563	BMPR2	D							63.0	69.0	67.0					2																	203242213		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.16C>T	2.37:g.203242213C>T	ENSP00000363708:p.Gln6*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q6*	ENST00000374580.4	37	c.16	CCDS33361.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.240785	0.95240	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	.	.	.	5.4	5.4	0.78164	.	1.793460	0.02759	N	0.118349	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	15.8811	0.79205	0.0:1.0:0.0:0.0	.	.	.	.	X	6	.	ENSP00000363702:Q6X	Q	+	1	0	BMPR2	202950458	0.944000	0.32072	0.067000	0.19924	0.609000	0.37215	4.370000	0.59517	2.532000	0.85374	0.563000	0.77884	CAG	BMPR2	-	NULL	ENSG00000204217		0.642	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1	49	0.00	0	C	NM_001204		203242213	203242213	+1	no_errors	ENST00000374580	ensembl	human	known	69_37n	nonsense	58	30.12	25	SNP	0.233	T
ARMC9	80210	genome.wustl.edu	37	2	232156119	232156119	+	Silent	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr2:232156119C>T	ENST00000349938.4	+	18	1874	c.1680C>T	c.(1678-1680)atC>atT	p.I560I	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	560						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CTGAAATGATCCGCCAGATAG	0.393																																						dbGAP											0													147.0	140.0	142.0					2																	232156119		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1680C>T	2.37:g.232156119C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Silent	SNP	superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.I560	ENST00000349938.4	37	c.1680	CCDS2484.1	2																																																																																			ARMC9	-	superfamily_ARM-type_fold	ENSG00000135931		0.393	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC9	HGNC	protein_coding	OTTHUMT00000256966.3	156	0.00	0	C	NM_025139		232156119	232156119	+1	no_errors	ENST00000349938	ensembl	human	known	69_37n	silent	81	18.18	18	SNP	1.000	T
BTN3A1	11119	genome.wustl.edu	37	6	26412970	26412970	+	Intron	SNP	A	A	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr6:26412970A>G	ENST00000289361.6	+	10	1386				BTN3A1_ENST00000414912.2_Intron|BTN3A1_ENST00000425234.2_3'UTR|BTN3A1_ENST00000476549.2_Silent_p.K352K	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1						activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						ACTTTGTTAAATAAATTGGAT	0.373																																						dbGAP											0													115.0	94.0	100.0					6																	26412970		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1019-427A>G	6.37:g.26412970A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Silent	SNP	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.K352	ENST00000289361.6	37	c.1056	CCDS4608.1	6																																																																																			BTN3A1	-	NULL	ENSG00000026950		0.373	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN3A1	HGNC	protein_coding	OTTHUMT00000040112.3	452	0.00	0	A			26412970	26412970	+1	no_errors	ENST00000476549	ensembl	human	known	69_37n	silent	211	12.45	30	SNP	0.000	G
CARS2	79587	genome.wustl.edu	37	13	111319757	111319759	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	ATG	ATG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr13:111319757_111319759delATG	ENST00000257347.4	-	8	910_912	c.847_849delCAT	c.(847-849)catdel	p.H283del	CARS2_ENST00000535398.1_5'UTR	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)	283					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	TTTCGTTTTCATGATGTGGAAAA	0.374																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.847_849delCAT	13.37:g.111319760_111319762delATG	ENSP00000257347:p.His283del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NI84|Q96IV4	In_Frame_Del	DEL	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,superfamily_tRNAsynth_1a_anticodon-bd,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-synt	p.H283in_frame_del	ENST00000257347.4	37	c.849_847	CCDS9514.1	13																																																																																			CARS2	-	pfam_Cys-tRNA/MSH_ligase,pfam_aa-tRNA-synth_Ia,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-synt	ENSG00000134905		0.374	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARS2	HGNC	protein_coding	OTTHUMT00000045772.3	304	0.00	0	ATG	NM_024537		111319757	111319759	-1	no_errors	ENST00000257347	ensembl	human	known	69_37n	in_frame_del	91	10.58	11	DEL	0.835:1.000:1.000	-
CCDC144CP	348254	genome.wustl.edu	37	17	18528551	18528551	+	IGR	SNP	G	G	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr17:18528551G>A								CCDC144B (18847 upstream) : TBC1D28 (9767 downstream)																							GCTGGGGCTGGTCTAAGGCGC	0.652																																						dbGAP											0													50.0	59.0	56.0					17																	18528551		2203	4298	6501	-	-	-	SO:0001628	intergenic_variant	0																															17.37:g.18528551G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		17																																																																																			CCDC144B	-	-	ENSG00000154874	0	0.652					CCDC144B	HGNC			27	0.00	0	G			18528551	18528551	-1	no_errors	ENST00000450277	ensembl	human	known	69_37n	rna	33	32.65	16	SNP	0.059	A
CEP63	80254	genome.wustl.edu	37	3	134268924	134268924	+	Missense_Mutation	SNP	A	A	G	rs564972913		TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr3:134268924A>G	ENST00000337090.3	+	11	1375	c.1202A>G	c.(1201-1203)cAg>cGg	p.Q401R	CEP63_ENST00000332047.5_Missense_Mutation_p.Q355R|CEP63_ENST00000513612.2_Missense_Mutation_p.Q401R|CEP63_ENST00000606977.1_Missense_Mutation_p.Q401R|CEP63_ENST00000354446.3_Missense_Mutation_p.Q355R|CEP63_ENST00000383229.3_Missense_Mutation_p.Q401R			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	401					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CAGATTTTACAGGGTGAACAA	0.343																																						dbGAP											0													62.0	64.0	63.0					3																	134268924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1202A>G	3.37:g.134268924A>G	ENSP00000336524:p.Gln401Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	NULL	p.Q401R	ENST00000337090.3	37	c.1202	CCDS3086.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.97|14.97	2.693522|2.693522	0.48202|0.48202	.|.	.|.	ENSG00000182923|ENSG00000182923	ENST00000332047;ENST00000354446;ENST00000337090;ENST00000383229;ENST00000513612;ENST00000514678|ENST00000504929	T;T;T;T;T;T|.	0.34472|.	1.4;1.81;2.13;1.43;2.13;1.36|.	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	0.303110|.	0.30809|.	N|.	0.008837|.	T|T	0.66346|0.66346	0.2780|0.2780	L|L	0.58810|0.58810	1.83|1.83	0.34697|0.34697	D|D	0.726389|0.726389	D;P;P;B|.	0.61697|.	0.99;0.459;0.616;0.112|.	P;B;B;B|.	0.60236|.	0.871;0.175;0.263;0.066|.	T|T	0.74272|0.74272	-0.3719|-0.3719	10|5	0.35671|.	T|.	0.21|.	-7.4679|-7.4679	15.4777|15.4777	0.75497|0.75497	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	401;401;355;355|.	Q96MT8;Q96MT8-2;Q96MT8-4;Q96MT8-3|.	CEP63_HUMAN;.;.;.|.	R|G	355;355;401;401;401;74|90	ENSP00000328382:Q355R;ENSP00000346432:Q355R;ENSP00000336524:Q401R;ENSP00000372716:Q401R;ENSP00000426129:Q401R;ENSP00000427526:Q74R|.	ENSP00000328382:Q355R|.	Q|R	+|+	2|1	0|2	CEP63|CEP63	135751614|135751614	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.898000|0.898000	0.52572|0.52572	3.908000|3.908000	0.56355|0.56355	2.243000|2.243000	0.73865|0.73865	0.528000|0.528000	0.53228|0.53228	CAG|AGG	CEP63	-	NULL	ENSG00000182923		0.343	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP63	HGNC	protein_coding	OTTHUMT00000470139.1	302	0.00	0	A	NM_025180		134268924	134268924	+1	no_errors	ENST00000337090	ensembl	human	known	69_37n	missense	83	21.70	23	SNP	1.000	G
CNGB1	1258	genome.wustl.edu	37	16	57965655	57965655	+	Silent	SNP	G	G	T	rs75406397	byFrequency	TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr16:57965655G>T	ENST00000251102.8	-	17	1560	c.1500C>A	c.(1498-1500)acC>acA	p.T500T	CNGB1_ENST00000564654.1_5'Flank|CNGB1_ENST00000564448.1_Silent_p.T494T	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	500					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						GGACTATAAGGGTGTCTGATT	0.527																																					Colon(156;1293 1853 16336 28962 38659)	dbGAP											0													88.0	97.0	94.0					16																	57965655		1982	4183	6165	-	-	-	SO:0001819	synonymous_variant	0			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.1500C>A	16.37:g.57965655G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.T500	ENST00000251102.8	37	c.1500	CCDS42169.1	16																																																																																			CNGB1	-	NULL	ENSG00000070729		0.527	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	HGNC	protein_coding	OTTHUMT00000337167.2	140	0.00	0	G	NM_001297		57965655	57965655	-1	no_errors	ENST00000251102	ensembl	human	known	69_37n	silent	172	17.70	37	SNP	0.998	T
CSPP1	79848	genome.wustl.edu	37	8	68024243	68024243	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr8:68024243A>G	ENST00000262210.5	+	9	1188	c.1157A>G	c.(1156-1158)gAg>gGg	p.E386G	CSPP1_ENST00000412460.1_Missense_Mutation_p.E92G	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	421					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AGAAGGAAAGAGAAATACAGA	0.343																																						dbGAP											0													141.0	139.0	140.0					8																	68024243		1861	4102	5963	-	-	-	SO:0001583	missense	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.1157A>G	8.37:g.68024243A>G	ENSP00000262210:p.Glu386Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	NULL	p.E386G	ENST00000262210.5	37	c.1157	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	A	22.4	4.278872	0.80692	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.42131	0.98;1.0;1.0	5.35	4.12	0.48240	.	0.000000	0.64402	D	0.000014	T	0.58481	0.2125	M	0.61703	1.905	0.40179	D	0.977279	D;D;D;D	0.89917	1.0;0.999;0.998;0.998	D;D;D;D	0.83275	0.983;0.996;0.98;0.99	T	0.62978	-0.6739	10	0.87932	D	0	-15.1486	10.3069	0.43685	0.8523:0.0:0.0:0.1477	.	92;386;421;421	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5;F8W7C3	.;.;CSPP1_HUMAN;.	G	386;421;92;92	ENSP00000262210:E386G;ENSP00000415782:E92G;ENSP00000430092:E92G	ENSP00000262210:E386G	E	+	2	0	CSPP1	68186797	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.692000	0.54727	2.033000	0.60031	0.402000	0.26972	GAG	CSPP1	-	NULL	ENSG00000104218		0.343	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	395	0.00	0	A	NM_024790		68024243	68024243	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	missense	203	20.39	52	SNP	1.000	G
DDX26B	203522	genome.wustl.edu	37	X	134713802	134713802	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chrX:134713802G>C	ENST00000370752.4	+	15	2432	c.2098G>C	c.(2098-2100)Gag>Cag	p.E700Q	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	700										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					TGCTCCATCAGAGCTTATAAA	0.443																																						dbGAP											0													73.0	67.0	70.0					X																	134713802		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.2098G>C	X.37:g.134713802G>C	ENSP00000359788:p.Glu700Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	pfscan_VWF_A	p.E700Q	ENST00000370752.4	37	c.2098	CCDS35401.1	X	.	.	.	.	.	.	.	.	.	.	G	2.388	-0.340486	0.05243	.	.	ENSG00000165359	ENST00000370752	T	0.31769	1.48	5.67	3.71	0.42584	.	0.973098	0.08536	N	0.931357	T	0.27900	0.0687	L	0.52759	1.655	0.09310	N	1	B;B	0.19331	0.003;0.035	B;B	0.18871	0.007;0.023	T	0.29427	-1.0012	10	0.17832	T	0.49	-0.3533	9.0812	0.36554	0.0907:0.143:0.7664:0.0	.	700;700	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	Q	700	ENSP00000359788:E700Q	ENSP00000359788:E700Q	E	+	1	0	DDX26B	134541468	0.874000	0.30092	0.047000	0.18901	0.284000	0.27059	3.180000	0.50895	1.185000	0.42971	0.600000	0.82982	GAG	DDX26B	-	NULL	ENSG00000165359		0.443	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX26B	HGNC	protein_coding	OTTHUMT00000058420.1	157	0.00	0	G	NM_182540		134713802	134713802	+1	no_errors	ENST00000370752	ensembl	human	known	69_37n	missense	76	20.83	20	SNP	0.008	C
DHPS	1725	genome.wustl.edu	37	19	12788192	12788192	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr19:12788192T>G	ENST00000210060.7	-	6	832	c.697A>C	c.(697-699)Agt>Cgt	p.S233R	DHPS_ENST00000594424.1_Missense_Mutation_p.S191R|DHPS_ENST00000599481.1_5'Flank|DHPS_ENST00000351660.5_Missense_Mutation_p.S233R	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	233					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)			central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						AGTGCGGGACTAAACACAGGG	0.557																																						dbGAP											0													70.0	60.0	63.0					19																	12788192		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.697A>C	19.37:g.12788192T>G	ENSP00000210060:p.Ser233Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Missense_Mutation	SNP	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	p.S233R	ENST00000210060.7	37	c.697	CCDS12276.1	19	.	.	.	.	.	.	.	.	.	.	T	18.56	3.650311	0.67472	.	.	ENSG00000095059	ENST00000210060;ENST00000351660	T;T	0.47528	0.84;0.84	5.64	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.71668	0.3367	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	1.0;0.983;1.0	D;D;D	0.97110	1.0;0.981;0.999	T	0.75328	-0.3356	10	0.87932	D	0	-32.8329	9.847	0.41032	0.0:0.0814:0.0:0.9185	.	233;233;233	Q5J8M5;P49366-2;P49366	.;.;DHYS_HUMAN	R	233	ENSP00000210060:S233R;ENSP00000221303:S233R	ENSP00000210060:S233R	S	-	1	0	DHPS	12649192	1.000000	0.71417	0.985000	0.45067	0.496000	0.33645	7.649000	0.83500	0.963000	0.38082	0.460000	0.39030	AGT	DHPS	-	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	ENSG00000095059		0.557	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHPS	HGNC	protein_coding	OTTHUMT00000462708.1	50	0.00	0	T	NM_001930		12788192	12788192	-1	no_errors	ENST00000210060	ensembl	human	known	69_37n	missense	81	18.18	18	SNP	1.000	G
EIF3I	8668	genome.wustl.edu	37	1	32694340	32694340	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:32694340A>G	ENST00000373586.1	+	8	724	c.652A>G	c.(652-654)Aca>Gca	p.T218A	MTMR9LP_ENST00000441044.1_RNA|EIF3I_ENST00000471486.1_3'UTR	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I											breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				TTTTGACTCCACAACTCTTGA	0.557																																					Colon(102;1138 2140 2180 17876)	dbGAP											0													259.0	283.0	275.0					1																	32694340		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364	ENST00000373586.1:c.652A>G	1.37:g.32694340A>G	ENSP00000362688:p.Thr218Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T218A	ENST00000373586.1	37	c.652	CCDS357.1	1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.363403	0.24684	.	.	ENSG00000084623	ENST00000373586	T	0.80824	-1.42	4.3	4.3	0.51218	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.144560	0.64402	D	0.000010	T	0.68924	0.3054	L	0.28740	0.885	0.42114	D	0.991393	B	0.02656	0.0	B	0.04013	0.001	T	0.63431	-0.6639	10	0.15952	T	0.53	-25.3078	13.7434	0.62862	1.0:0.0:0.0:0.0	.	218	Q13347	EIF3I_HUMAN	A	218	ENSP00000362688:T218A	ENSP00000362688:T218A	T	+	1	0	EIF3I	32466927	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.796000	0.69080	1.724000	0.51502	0.374000	0.22700	ACA	EIF3I	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000084623		0.557	EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3I	HGNC	protein_coding	OTTHUMT00000019282.2	95	0.00	0	A	NM_003757		32694340	32694340	+1	no_errors	ENST00000373586	ensembl	human	known	69_37n	missense	117	17.48	25	SNP	1.000	G
EPHA6	285220	genome.wustl.edu	37	3	97356897	97356897	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr3:97356897G>T	ENST00000514100.1	+	11	1173	c.931G>T	c.(931-933)Gat>Tat	p.D311Y	EPHA6_ENST00000442602.2_3'UTR|EPHA6_ENST00000502694.1_Missense_Mutation_p.D311Y|EPHA6_ENST00000389672.5_Missense_Mutation_p.D919Y	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	825						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AGTGCTGGAAGATGATCCAGA	0.363																																						dbGAP											0													86.0	84.0	85.0					3																	97356897		1877	4124	6001	-	-	-	SO:0001583	missense	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.931G>T	3.37:g.97356897G>T	ENSP00000421711:p.Asp311Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RAL5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D919Y	ENST00000514100.1	37	c.2755		3	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897590	0.91962	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694	D;D;D	0.83250	-1.7;-1.7;-1.7	5.8	5.8	0.92144	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.88310	0.6402	L	0.38838	1.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.88831	0.3305	9	0.87932	D	0	.	20.0567	0.97653	0.0:0.0:1.0:0.0	.	824;311;311	Q9UF33;Q9UF33-2;D6RAL5	EPHA6_HUMAN;.;.	Y	919;311;311	ENSP00000374323:D919Y;ENSP00000421711:D311Y;ENSP00000423950:D311Y	ENSP00000374323:D919Y	D	+	1	0	EPHA6	98839587	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.771000	0.98977	2.752000	0.94435	0.650000	0.86243	GAT	EPHA6	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000080224		0.363	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000359997.1	221	0.00	0	G	NM_001080448		97356897	97356897	+1	no_errors	ENST00000389672	ensembl	human	known	69_37n	missense	143	11.18	18	SNP	1.000	T
GALNT5	11227	genome.wustl.edu	37	2	158152231	158152231	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr2:158152231C>A	ENST00000259056.4	+	4	2283	c.1798C>A	c.(1798-1800)Cct>Act	p.P600T		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	600	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TTGGTTGGAACCTCTTCTGGA	0.358																																						dbGAP											0													260.0	242.0	248.0					2																	158152231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1798C>A	2.37:g.158152231C>A	ENSP00000259056:p.Pro600Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.P600T	ENST00000259056.4	37	c.1798	CCDS2203.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.110458	0.94292	.	.	ENSG00000136542	ENST00000259056	T	0.61510	0.1	5.63	5.63	0.86233	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.78991	0.4371	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80641	-0.1292	10	0.87932	D	0	.	19.6351	0.95728	0.0:1.0:0.0:0.0	.	600	Q7Z7M9	GALT5_HUMAN	T	600	ENSP00000259056:P600T	ENSP00000259056:P600T	P	+	1	0	GALNT5	157860477	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.647000	0.83462	2.805000	0.96524	0.655000	0.94253	CCT	GALNT5	-	pfam_Glyco_trans_2	ENSG00000136542		0.358	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT5	HGNC	protein_coding	OTTHUMT00000254925.2	730	0.14	1	C	NM_014568		158152231	158152231	+1	no_errors	ENST00000259056	ensembl	human	known	69_37n	missense	380	19.83	94	SNP	1.000	A
HIVEP3	59269	genome.wustl.edu	37	1	41976178	41976178	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:41976178C>T	ENST00000372583.1	-	9	8050	c.7165G>A	c.(7165-7167)Ggg>Agg	p.G2389R	HIVEP3_ENST00000247584.5_Missense_Mutation_p.G2389R|HIVEP3_ENST00000429157.2_Missense_Mutation_p.G2388R|HIVEP3_ENST00000372584.1_Missense_Mutation_p.G2388R|HIVEP3_ENST00000460604.1_5'UTR	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2389					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTGGGCTCCCCACTTCCTGAG	0.652																																						dbGAP											0													34.0	33.0	33.0					1																	41976178		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.7165G>A	1.37:g.41976178C>T	ENSP00000361664:p.Gly2389Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G2389R	ENST00000372583.1	37	c.7165	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986701	0.53934	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.06142	3.35;3.34;3.34;3.35	5.26	2.37	0.29283	.	0.952493	0.08633	N	0.916754	T	0.05318	0.0141	N	0.24115	0.695	0.28620	N	0.908215	B;B	0.14012	0.009;0.005	B;B	0.12156	0.007;0.003	T	0.36212	-0.9757	10	0.72032	D	0.01	-5.3013	6.2374	0.20770	0.0:0.6815:0.1527:0.1658	.	2388;2389	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	R	2388;2389;2389;2388	ENSP00000361665:G2388R;ENSP00000361664:G2389R;ENSP00000247584:G2389R;ENSP00000410828:G2388R	ENSP00000247584:G2389R	G	-	1	0	HIVEP3	41748765	0.453000	0.25721	0.957000	0.39632	0.647000	0.38526	0.330000	0.19715	0.363000	0.24346	-0.315000	0.08773	GGG	HIVEP3	-	NULL	ENSG00000127124		0.652	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	24	0.00	0	C	NM_024503		41976178	41976178	-1	no_errors	ENST00000247584	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	0.893	T
IGSF9B	22997	genome.wustl.edu	37	11	133807856	133807856	+	Splice_Site	SNP	G	G	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:133807856G>T	ENST00000321016.8	-	4	640	c.410C>A	c.(409-411)gCc>gAc	p.A137D	IGSF9B_ENST00000533871.2_Splice_Site_p.A137D			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	137					homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GGTGGGAGGGGCTGCAAAGGA	0.577																																						dbGAP											0													47.0	54.0	51.0					11																	133807856		2165	4268	6433	-	-	-	SO:0001630	splice_region_variant	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.410-1C>A	11.37:g.133807856G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G5EA26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A137D	ENST00000321016.8	37	c.410		11	.	.	.	.	.	.	.	.	.	.	G	35	5.415721	0.96092	.	.	ENSG00000080854	ENST00000321016;ENST00000527648;ENST00000533160	T;T;T	0.27402	1.67;1.67;1.67	5.6	5.6	0.85130	Immunoglobulin-like fold (1);	.	.	.	.	T	0.49949	0.1587	M	0.72118	2.19	0.80722	D	1	P	0.51933	0.949	P	0.52823	0.71	T	0.52071	-0.8624	9	0.72032	D	0.01	.	19.6195	0.95650	0.0:0.0:1.0:0.0	.	137	Q9UPX0	TUTLB_HUMAN	D	137;137;127	ENSP00000317980:A137D;ENSP00000436576:A137D;ENSP00000434026:A127D	ENSP00000317980:A137D	A	-	2	0	IGSF9B	133313066	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.827000	0.99397	2.633000	0.89246	0.561000	0.74099	GCC	IGSF9B	-	NULL	ENSG00000080854		0.577	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		57	0.00	0	G	XM_290502	Missense_Mutation	133807856	133807856	-1	no_errors	ENST00000321016	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	1.000	T
ITGA8	8516	genome.wustl.edu	37	10	15573048	15573048	+	Splice_Site	SNP	C	C	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr10:15573048C>A	ENST00000378076.3	-	28	3336		c.e28+1			NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8						brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AAGATACTCACTACTATGCTT	0.348																																						dbGAP											0													81.0	82.0	81.0					10																	15573048		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2982+1G>T	10.37:g.15573048C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ31|Q5VX94	Splice_Site	SNP	-	e28+1	ENST00000378076.3	37	c.2982+1	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160864	0.78226	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2915	0.94102	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA8	15613054	0.998000	0.40836	0.967000	0.41034	0.912000	0.54170	4.784000	0.62411	2.651000	0.90000	0.643000	0.83706	.	ITGA8	-	-	ENSG00000077943		0.348	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	277	0.00	0	C	NM_003638	Intron	15573048	15573048	-1	no_errors	ENST00000378076	ensembl	human	known	69_37n	splice_site	64	20.00	16	SNP	0.996	A
ITGAX	3687	genome.wustl.edu	37	16	31373963	31373963	+	Silent	SNP	G	G	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr16:31373963G>T	ENST00000268296.4	+	12	1369	c.1248G>T	c.(1246-1248)ggG>ggT	p.G416G	ITGAX_ENST00000562522.1_Silent_p.G416G	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	416					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TCTGGAAAGGGGTGCAGAGCC	0.667																																						dbGAP											0													20.0	21.0	21.0					16																	31373963		2197	4298	6495	-	-	-	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1248G>T	16.37:g.31373963G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.G416	ENST00000268296.4	37	c.1248	CCDS10711.1	16																																																																																			ITGAX	-	smart_Int_alpha_beta-p	ENSG00000140678		0.667	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	27	0.00	0	G	NM_000887		31373963	31373963	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	silent	45	29.69	19	SNP	0.154	T
ITGAD	3681	genome.wustl.edu	37	16	31425771	31425771	+	Splice_Site	SNP	G	G	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr16:31425771G>C	ENST00000389202.2	+	17	2045		c.e17-1			NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D						activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTGCACTTCAGGTGACATCCA	0.448																																						dbGAP											0													142.0	153.0	149.0					16																	31425771		2197	4300	6497	-	-	-	SO:0001630	splice_region_variant	0			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1997-1G>C	16.37:g.31425771G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15575|Q15576	Splice_Site	SNP	-	e17-1	ENST00000389202.2	37	c.1997-1	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	G	7.935	0.741469	0.15642	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4049	0.60906	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGAD	31333272	1.000000	0.71417	0.188000	0.23233	0.019000	0.09904	4.633000	0.61318	2.243000	0.73865	0.603000	0.83216	.	ITGAD	-	-	ENSG00000156886		0.448	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	HGNC	protein_coding	OTTHUMT00000432836.1	181	0.00	0	G	NM_005353	Intron	31425771	31425771	+1	no_errors	ENST00000389202	ensembl	human	known	69_37n	splice_site	130	21.21	35	SNP	0.961	C
KIAA0907	22889	genome.wustl.edu	37	1	155903461	155903461	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:155903461T>C	ENST00000368321.3	-	2	241	c.218A>G	c.(217-219)aAa>aGa	p.K73R	KIAA0907_ENST00000368319.3_Missense_Mutation_p.K73R|KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368320.3_Missense_Mutation_p.K73R	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	73							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			CAGCTTCCCTTTTGCCATGAG	0.517																																						dbGAP											0													51.0	49.0	49.0					1																	155903461		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.218A>G	1.37:g.155903461T>C	ENSP00000357304:p.Lys73Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	NULL	p.K73R	ENST00000368321.3	37	c.218	CCDS30885.1	1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.876179	0.91664	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	.	.	.	5.52	5.52	0.82312	.	0.051440	0.85682	D	0.000000	T	0.57873	0.2083	L	0.46885	1.475	0.58432	D	0.999994	D;D;D;D;B;P	0.61697	0.974;0.959;0.974;0.99;0.221;0.93	P;P;P;P;B;B	0.59825	0.74;0.637;0.74;0.864;0.084;0.289	T	0.57516	-0.7798	9	0.39692	T	0.17	-10.1754	15.4695	0.75429	0.0:0.0:0.0:1.0	.	73;73;73;73;73;73	D3DVA4;Q7Z7F0-4;A8K1I7;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;.;.;K0907_HUMAN	R	73	.	ENSP00000357302:K73R	K	-	2	0	KIAA0907	154170085	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.279000	0.78599	2.320000	0.78422	0.528000	0.53228	AAA	KIAA0907	-	NULL	ENSG00000132680		0.517	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0907	HGNC	protein_coding	OTTHUMT00000039583.1	93	0.00	0	T	NM_014949		155903461	155903461	-1	no_errors	ENST00000368321	ensembl	human	known	69_37n	missense	99	10.00	11	SNP	1.000	C
LAMB4	22798	genome.wustl.edu	37	7	107746436	107746436	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr7:107746436C>G	ENST00000388781.3	-	8	779	c.696G>C	c.(694-696)aaG>aaC	p.K232N	LAMB4_ENST00000414450.2_Missense_Mutation_p.K232N|LAMB4_ENST00000418464.1_Missense_Mutation_p.K232N|LAMB4_ENST00000205386.4_Missense_Mutation_p.K232N|LAMB4_ENST00000388780.3_Missense_Mutation_p.K232N	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	232	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GGGTGTGGAGCTTGGTAAAGT	0.418																																						dbGAP											0													104.0	96.0	99.0					7																	107746436		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.696G>C	7.37:g.107746436C>G	ENSP00000373433:p.Lys232Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.K232N	ENST00000388781.3	37	c.696	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	16.58	3.163210	0.57476	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	4.72	-0.229	0.13094	Laminin, N-terminal (3);	0.124068	0.35555	N	0.003121	D	0.85890	0.5802	M	0.85197	2.74	0.48395	D	0.99964	D	0.71674	0.998	D	0.69824	0.966	D	0.84270	0.0488	10	0.87932	D	0	.	9.4251	0.38574	0.0:0.4154:0.0:0.5846	.	232	A4D0S4	LAMB4_HUMAN	N	232	ENSP00000205386:K232N;ENSP00000373433:K232N;ENSP00000373432:K232N;ENSP00000402353:K232N;ENSP00000402265:K232N	ENSP00000205386:K232N	K	-	3	2	LAMB4	107533672	0.099000	0.21834	0.993000	0.49108	0.987000	0.75469	-0.199000	0.09491	-0.194000	0.10399	-0.302000	0.09304	AAG	LAMB4	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000091128		0.418	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	221	0.00	0	C	XM_209857		107746436	107746436	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	missense	161	18.27	36	SNP	0.970	G
LILRA5	353514	genome.wustl.edu	37	19	54822884	54822884	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr19:54822884A>G	ENST00000301219.3	-	5	631	c.512T>C	c.(511-513)tTc>tCc	p.F171S	AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000346508.3_Missense_Mutation_p.F159S|LILRA5_ENST00000446712.3_Missense_Mutation_p.F159S|LILRA5_ENST00000432233.3_Missense_Mutation_p.F171S	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	171	Ig-like C2-type 2.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGTCAGAATGAACCTGTCGAA	0.592																																						dbGAP											0													64.0	63.0	63.0					19																	54822884		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.512T>C	19.37:g.54822884A>G	ENSP00000301219:p.Phe171Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHI3	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2	p.F171S	ENST00000301219.3	37	c.512	CCDS12888.1	19	.	.	.	.	.	.	.	.	.	.	A	14.54	2.565177	0.45694	.	.	ENSG00000187116	ENST00000301219;ENST00000346508;ENST00000446712;ENST00000432233	T;T;T;T	0.00940	5.52;5.52;5.52;5.52	3.14	0.777	0.18538	Immunoglobulin-like fold (1);	0.453650	0.16716	U	0.202442	T	0.06142	0.0159	H	0.96048	3.76	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.87578	0.998;0.975;0.998;0.985	T	0.21965	-1.0230	10	0.72032	D	0.01	.	1.9274	0.03320	0.5691:0.0:0.1619:0.269	.	159;171;159;171	A6NI73-4;A6NI73-3;A6NI73-2;A6NI73	.;.;.;LIRA5_HUMAN	S	171;159;159;171	ENSP00000301219:F171S;ENSP00000302948:F159S;ENSP00000389499:F159S;ENSP00000404236:F171S	ENSP00000301219:F171S	F	-	2	0	LILRA5	59514696	0.000000	0.05858	0.002000	0.10522	0.220000	0.24768	0.380000	0.20602	1.214000	0.43395	0.172000	0.16884	TTC	LILRA5	-	smart_Ig_sub	ENSG00000187116		0.592	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA5	HGNC	protein_coding	OTTHUMT00000140231.1	55	0.00	0	A	NM_181985		54822884	54822884	-1	no_errors	ENST00000301219	ensembl	human	known	69_37n	missense	78	14.29	13	SNP	0.000	G
LRP2	4036	genome.wustl.edu	37	2	170011097	170011097	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr2:170011097C>G	ENST00000263816.3	-	66	12453	c.12168G>C	c.(12166-12168)ttG>ttC	p.L4056F		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4056					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAGGCAGTAGCAACAAAGGAG	0.353																																						dbGAP											0													73.0	72.0	72.0					2																	170011097		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12168G>C	2.37:g.170011097C>G	ENSP00000263816:p.Leu4056Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L4056F	ENST00000263816.3	37	c.12168	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401980	0.42613	.	.	ENSG00000081479	ENST00000263816	D	0.94232	-3.38	5.7	0.0863	0.14445	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.072222	0.56097	N	0.000029	D	0.89438	0.6715	M	0.74467	2.265	0.80722	D	1	B	0.19331	0.035	B	0.17433	0.018	T	0.80412	-0.1393	10	0.62326	D	0.03	.	1.9073	0.03280	0.1228:0.3594:0.2454:0.2723	.	4056	P98164	LRP2_HUMAN	F	4056	ENSP00000263816:L4056F	ENSP00000263816:L4056F	L	-	3	2	LRP2	169719343	0.995000	0.38212	0.932000	0.37286	0.943000	0.58893	0.364000	0.20325	-0.007000	0.14345	0.655000	0.94253	TTG	LRP2	-	superfamily_Growth_fac_rcpt	ENSG00000081479		0.353	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	149	0.00	0	C	NM_004525		170011097	170011097	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	103	22.56	30	SNP	0.997	G
LRRIQ1	84125	genome.wustl.edu	37	12	85449848	85449849	+	Missense_Mutation	DNP	TA	TA	AG			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T|A	T|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr12:85449848_85449849TA>AG	ENST00000393217.2	+	8	1338_1339	c.1277_1278TA>AG	c.(1276-1278)cTA>cAG	p.L426Q		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	426										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GCCAAAAATCTAGTGGATGAAA	0.302																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	Exception_encountered	12.37:g.85449848_85449849delinsAG	ENSP00000376910:p.Leu426Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P4|Q9BS17|Q9HA36	Missense_Mutation|Silent	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.L426Q|p.L426	ENST00000393217.2	37	c.1277|c.1278	CCDS41816.1	12																																																																																			LRRIQ1	-	NULL	ENSG00000133640		0.302	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	244	0.00	0	T|A	NM_032165		85449848|85449849	85449848|85449849	+1	no_errors	ENST00000393217	ensembl	human	known	69_37n	missense|silent	31|32	24.39|23.81	10	SNP	0.000	A|G
MAML2	84441	genome.wustl.edu	37	11	95825407	95825407	+	Silent	SNP	C	C	T	rs61901862		TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:95825407C>T	ENST00000524717.1	-	2	3072	c.1788G>A	c.(1786-1788)caG>caA	p.Q596Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	596					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q596Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgtt	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																	dbGAP		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	1	Substitution - coding silent(1)	kidney(1)											28.0	35.0	33.0					11																	95825407		2119	4148	6267	-	-	-	SO:0001819	synonymous_variant	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1788G>A	11.37:g.95825407C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q596	ENST00000524717.1	37	c.1788	CCDS44714.1	11																																																																																			MAML2	-	NULL	ENSG00000184384		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1	69	0.00	0	C			95825407	95825407	-1	no_errors	ENST00000440572	ensembl	human	known	69_37n	silent	192	13.51	30	SNP	0.003	T
METTL14	57721	genome.wustl.edu	37	4	119609080	119609080	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr4:119609080G>C	ENST00000388822.5	+	2	236	c.69G>C	c.(67-69)ttG>ttC	p.L23F	METTL14_ENST00000506780.1_5'UTR			Q9HCE5	MET14_HUMAN	methyltransferase like 14	23					mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						TTTCTCAGTTGGGAGCTGAAA	0.378																																						dbGAP											0													95.0	93.0	93.0					4																	119609080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.69G>C	4.37:g.119609080G>C	ENSP00000373474:p.Leu23Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIG1|Q969V2	Missense_Mutation	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.L23F	ENST00000388822.5	37	c.69	CCDS34053.1	4	.	.	.	.	.	.	.	.	.	.	g	15.60	2.882498	0.51908	.	.	ENSG00000145388	ENST00000388822;ENST00000508801	.	.	.	5.5	5.5	0.81552	.	0.074213	0.53938	D	0.000048	T	0.74854	0.3771	L	0.60455	1.87	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	T	0.74067	-0.3784	9	0.48119	T	0.1	-12.4706	14.9978	0.71446	0.0704:0.0:0.9296:0.0	.	23	Q9HCE5	MTL14_HUMAN	F	23;73	.	ENSP00000373474:L23F	L	+	3	2	METTL14	119828528	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	2.363000	0.44178	2.762000	0.94881	0.643000	0.83706	TTG	METTL14	-	NULL	ENSG00000145388		0.378	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL14	HGNC	protein_coding	OTTHUMT00000364034.3	297	0.00	0	G	NM_020961		119609080	119609080	+1	no_errors	ENST00000388822	ensembl	human	known	69_37n	missense	178	18.35	40	SNP	1.000	C
MUC5B	727897	genome.wustl.edu	37	11	1264014	1264014	+	Silent	SNP	G	G	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:1264014G>C	ENST00000529681.1	+	31	5962	c.5904G>C	c.(5902-5904)ctG>ctC	p.L1968L	MUC5B_ENST00000447027.1_Silent_p.L1971L|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1968	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TTCCAGCACTGAGAAGCACAG	0.627																																						dbGAP											0													148.0	203.0	185.0					11																	1264014		2169	4256	6425	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5904G>C	11.37:g.1264014G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.L1971	ENST00000529681.1	37	c.5913	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.627	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	261	0.00	0	G	XM_001126093		1264014	1264014	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	599	19.49	145	SNP	0.000	C
NECAB1	64168	genome.wustl.edu	37	8	91937819	91937819	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr8:91937819G>T	ENST00000417640.2	+	7	888	c.551G>T	c.(550-552)aGc>aTc	p.S184I		NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	184						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			AAACGATCAAGCCGCCGAGTC	0.458																																						dbGAP											0													63.0	72.0	69.0					8																	91937819		2004	4159	6163	-	-	-	SO:0001583	missense	0			AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.551G>T	8.37:g.91937819G>T	ENSP00000387380:p.Ser184Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUS7|Q96AZ7|Q9HBW8	Missense_Mutation	SNP	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S184I	ENST00000417640.2	37	c.551	CCDS47889.1	8	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591459	0.46214	.	.	ENSG00000123119	ENST00000417640	T	0.18338	2.22	5.3	3.24	0.37175	.	0.211721	0.56097	D	0.000034	T	0.09992	0.0245	N	0.24115	0.695	0.80722	D	1	B	0.28128	0.201	B	0.26969	0.075	T	0.12967	-1.0527	10	0.54805	T	0.06	-8.6822	5.092	0.14713	0.2886:0.1786:0.5328:0.0	.	184	Q8N987	NECA1_HUMAN	I	184	ENSP00000387380:S184I	ENSP00000387380:S184I	S	+	2	0	NECAB1	92006995	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	1.624000	0.37018	1.236000	0.43740	0.561000	0.74099	AGC	NECAB1	-	NULL	ENSG00000123119		0.458	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB1	HGNC	protein_coding	OTTHUMT00000376728.1	124	0.00	0	G	NM_022351		91937819	91937819	+1	no_errors	ENST00000417640	ensembl	human	known	69_37n	missense	220	11.65	29	SNP	0.997	T
NECAP2	55707	genome.wustl.edu	37	1	16770220	16770220	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:16770220G>T	ENST00000337132.5	+	2	276	c.186G>T	c.(184-186)agG>agT	p.R62S	NECAP2_ENST00000443980.2_Missense_Mutation_p.R62S|NECAP2_ENST00000406746.1_Missense_Mutation_p.R62S|NECAP2_ENST00000457722.2_Missense_Mutation_p.R36S|NECAP2_ENST00000504551.2_Intron	NM_001145278.1|NM_018090.4	NP_001138750.1|NP_060560.1	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2	62					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TGGAGGACAGGACGTCAGGTA	0.622																																						dbGAP											0													61.0	59.0	60.0					1																	16770220		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021938	CCDS173.1, CCDS44066.1, CCDS44067.1	1p36.13	2008-02-05			ENSG00000157191	ENSG00000157191			25528	protein-coding gene	gene with protein product		611624				14555962, 15494011	Standard	NM_001145277		Approved	FLJ10420	uc001ayq.3	Q9NVZ3	OTTHUMG00000002313	ENST00000337132.5:c.186G>T	1.37:g.16770220G>T	ENSP00000338746:p.Arg62Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DY19|E9PGQ8|Q5VSU4|Q5VSU5|Q9H7L1|Q9H8L1	Missense_Mutation	SNP	pfam_NECAP-1	p.R62S	ENST00000337132.5	37	c.186	CCDS173.1	1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255884	0.59321	.	.	ENSG00000157191	ENST00000337132;ENST00000457722;ENST00000406746;ENST00000263498;ENST00000443980;ENST00000492095	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.86	3.59	0.41128	.	0.312207	0.38837	N	0.001549	T	0.22126	0.0533	N	0.10916	0.065	0.41004	D	0.984959	B;B;B	0.21225	0.053;0.053;0.013	B;B;B	0.28916	0.096;0.062;0.043	T	0.06734	-1.0810	10	0.24483	T	0.36	-9.6498	6.3287	0.21259	0.1818:0.1566:0.6615:0.0	.	36;62;62	Q9NVZ3-4;Q9NVZ3-2;Q9NVZ3	.;.;NECP2_HUMAN	S	62;36;62;62;62;62	ENSP00000338746:R62S;ENSP00000407091:R36S;ENSP00000383925:R62S;ENSP00000391942:R62S;ENSP00000427620:R62S	ENSP00000263498:R62S	R	+	3	2	NECAP2	16642807	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.194000	0.42668	1.416000	0.47057	0.563000	0.77884	AGG	NECAP2	-	pfam_NECAP-1	ENSG00000157191		0.622	NECAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAP2	HGNC	protein_coding	OTTHUMT00000006680.2	50	0.00	0	G	NM_018090		16770220	16770220	+1	no_errors	ENST00000443980	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	0.990	T
NEDD9	4739	genome.wustl.edu	37	6	11190312	11190312	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr6:11190312T>A	ENST00000379446.5	-	5	1956	c.1790A>T	c.(1789-1791)cAg>cTg	p.Q597L	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Missense_Mutation_p.Q597L	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	597					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GTTGTGGGCCTGGGCCTTGTG	0.592																																						dbGAP											0													80.0	71.0	74.0					6																	11190312		2203	4300	6503	-	-	-	SO:0001583	missense	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.1790A>T	6.37:g.11190312T>A	ENSP00000368759:p.Gln597Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.Q597L	ENST00000379446.5	37	c.1790	CCDS4520.1	6	.	.	.	.	.	.	.	.	.	.	T	12.72	2.021469	0.35701	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.42900	0.96;1.09	5.61	3.06	0.35304	.	0.873800	0.10518	N	0.665281	T	0.14527	0.0351	N	0.08118	0	0.29199	N	0.875358	B;P;B	0.40660	0.12;0.726;0.134	B;B;B	0.43575	0.138;0.424;0.047	T	0.11767	-1.0574	10	0.48119	T	0.1	-12.751	12.346	0.55122	0.0:0.0:0.2828:0.7172	.	597;597;597	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	L	597	ENSP00000368759:Q597L;ENSP00000422871:Q597L	ENSP00000368759:Q597L	Q	-	2	0	NEDD9	11298298	0.803000	0.28956	0.714000	0.30535	0.801000	0.45260	1.176000	0.31957	0.937000	0.37394	0.477000	0.44152	CAG	NEDD9	-	NULL	ENSG00000111859		0.592	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	37	0.00	0	T	NM_006403		11190312	11190312	-1	no_errors	ENST00000379446	ensembl	human	known	69_37n	missense	63	22.22	18	SNP	0.133	A
NUP88	4927	genome.wustl.edu	37	17	5289552	5289552	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr17:5289552C>G	ENST00000573584.1	-	17	2709	c.2200G>C	c.(2200-2202)Gat>Cat	p.D734H	NUP88_ENST00000573169.1_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	734					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						TTGCGGATATCATTGATTTGC	0.363																																						dbGAP											0													264.0	240.0	248.0					17																	5289552		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.2200G>C	17.37:g.5289552C>G	ENSP00000458954:p.Asp734His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTM2|Q9BWE5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup88	p.D734H	ENST00000573584.1	37	c.2200	CCDS11070.1	17	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988665	0.74589	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	4.94	4.94	0.65067	.	0.105124	0.64402	D	0.000007	T	0.68403	0.2997	L	0.57536	1.79	0.53688	D	0.999975	D;D	0.67145	0.996;0.995	D;D	0.66196	0.942;0.924	T	0.67917	-0.5546	9	0.49607	T	0.09	-14.977	11.1883	0.48671	0.0:0.9166:0.0:0.0834	.	619;734	B4DP20;Q99567	.;NUP88_HUMAN	H	734;619	.	ENSP00000225696:D734H	D	-	1	0	NUP88	5230276	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	4.782000	0.62396	2.733000	0.93635	0.655000	0.94253	GAT	NUP88	-	pfam_Nucleoporin_Nup88	ENSG00000108559		0.363	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP88	HGNC	protein_coding	OTTHUMT00000216918.3	537	0.00	0	C	NM_002532		5289552	5289552	-1	no_errors	ENST00000573584	ensembl	human	known	69_37n	missense	270	22.41	78	SNP	1.000	G
OR4A5	81318	genome.wustl.edu	37	11	51411671	51411671	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:51411671G>C	ENST00000319760.6	-	1	777	c.725C>G	c.(724-726)aCc>aGc	p.T242S		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				GACAACAACGGTACTGCCGGA	0.398																																						dbGAP											0													62.0	60.0	61.0					11																	51411671		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.725C>G	11.37:g.51411671G>C	ENSP00000367664:p.Thr242Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF84	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T242S	ENST00000319760.6	37	c.725	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	7.182	0.589787	0.13812	.	.	ENSG00000221840	ENST00000319760	T	0.38240	1.15	2.2	-2.71	0.05986	GPCR, rhodopsin-like superfamily (1);	0.150925	0.31145	N	0.008168	T	0.45034	0.1322	M	0.73753	2.245	0.09310	N	1	P	0.42357	0.777	P	0.53185	0.72	T	0.45556	-0.9253	10	0.87932	D	0	.	7.4073	0.26998	0.5268:0.0:0.4732:0.0	.	242	Q8NH83	OR4A5_HUMAN	S	242	ENSP00000367664:T242S	ENSP00000367664:T242S	T	-	2	0	OR4A5	51268247	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.773000	0.26661	-0.701000	0.05063	0.162000	0.16502	ACC	OR4A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221840		0.398	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	119	0.00	0	G	NM_001005272		51411671	51411671	-1	no_errors	ENST00000319760	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	0.001	C
OR5L2	26338	genome.wustl.edu	37	11	55594925	55594925	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:55594925T>G	ENST00000378397.1	+	1	231	c.231T>G	c.(229-231)atT>atG	p.I77M		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				CCTCAATAATTGTGCCAAAGA	0.463										HNSCC(27;0.073)																												dbGAP											0													215.0	200.0	205.0					11																	55594925		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.231T>G	11.37:g.55594925T>G	ENSP00000367650:p.Ile77Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF66|Q96RB2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I77M	ENST00000378397.1	37	c.231	CCDS31511.1	11	.	.	.	.	.	.	.	.	.	.	.	13.13	2.145290	0.37825	.	.	ENSG00000205030	ENST00000378397	T	0.01145	5.27	5.13	-2.37	0.06643	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000095	T	0.05044	0.0135	M	0.84948	2.725	0.09310	N	1	D	0.56968	0.978	P	0.61940	0.896	T	0.01337	-1.1381	10	0.87932	D	0	-21.4814	11.5268	0.50584	0.0:0.4998:0.0:0.5002	.	77	Q8NGL0	OR5L2_HUMAN	M	77	ENSP00000367650:I77M	ENSP00000367650:I77M	I	+	3	3	OR5L2	55351501	0.000000	0.05858	0.586000	0.28679	0.489000	0.33432	-1.896000	0.01605	-0.344000	0.08338	-0.333000	0.08304	ATT	OR5L2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000205030		0.463	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	365	0.00	0	T	NM_001004739		55594925	55594925	+1	no_errors	ENST00000378397	ensembl	human	known	69_37n	missense	383	16.92	78	SNP	0.044	G
OXGR1	27199	genome.wustl.edu	37	13	97639673	97639673	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr13:97639673T>C	ENST00000298440.1	-	4	584	c.341A>G	c.(340-342)cAt>cGt	p.H114R	OXGR1_ENST00000543457.1_Missense_Mutation_p.H114R	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	114					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			CAGGTTGAAATGGAAGCTGAA	0.453																																						dbGAP											0													80.0	69.0	72.0					13																	97639673		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.341A>G	13.37:g.97639673T>C	ENSP00000298440:p.His114Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5A7|Q86TL1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.H114R	ENST00000298440.1	37	c.341	CCDS9482.1	13	.	.	.	.	.	.	.	.	.	.	T	21.6	4.179275	0.78564	.	.	ENSG00000165621	ENST00000298440;ENST00000543457	T;T	0.71698	-0.59;-0.59	5.56	5.56	0.83823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.80160	0.4572	L	0.53671	1.685	0.43250	D	0.995172	D	0.67145	0.996	D	0.65323	0.934	T	0.81927	-0.0709	10	0.66056	D	0.02	.	15.727	0.77770	0.0:0.0:0.0:1.0	.	114	Q96P68	OXGR1_HUMAN	R	114	ENSP00000298440:H114R;ENSP00000438800:H114R	ENSP00000298440:H114R	H	-	2	0	OXGR1	96437674	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	8.040000	0.89188	2.118000	0.64928	0.533000	0.62120	CAT	OXGR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	ENSG00000165621		0.453	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXGR1	HGNC	protein_coding	OTTHUMT00000045521.3	77	0.00	0	T	NM_080818		97639673	97639673	-1	no_errors	ENST00000298440	ensembl	human	known	69_37n	missense	112	22.76	33	SNP	1.000	C
PARP8	79668	genome.wustl.edu	37	5	50055554	50055554	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr5:50055554A>T	ENST00000281631.5	+	4	420	c.262A>T	c.(262-264)Aga>Tga	p.R88*	PARP8_ENST00000514067.2_Nonsense_Mutation_p.R88*|PARP8_ENST00000514342.2_5'UTR|PARP8_ENST00000503750.2_Nonsense_Mutation_p.R88*|PARP8_ENST00000511363.2_Intron|PARP8_ENST00000505697.2_Nonsense_Mutation_p.R88*|PARP8_ENST00000505554.1_Nonsense_Mutation_p.R67*	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	88						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				AATTTTTCATAGAATAGCAAC	0.259																																						dbGAP											0													58.0	65.0	62.0					5																	50055554		2198	4276	6474	-	-	-	SO:0001587	stop_gained	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.262A>T	5.37:g.50055554A>T	ENSP00000281631:p.Arg88*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KRB7|Q6DHZ1|Q9H754	Nonsense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.R88*	ENST00000281631.5	37	c.262	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524955	0.85600	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000281631;ENST00000514067;ENST00000503046;ENST00000505554	.	.	.	5.31	4.34	0.51931	.	0.146179	0.43260	D	0.000587	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.2296	10.1909	0.43026	0.6019:0.3981:0.0:0.0	.	.	.	.	X	88;88;88;88;88;67	.	.	R	+	1	2	PARP8	50091311	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.240000	0.43088	1.156000	0.42514	0.533000	0.62120	AGA	PARP8	-	NULL	ENSG00000151883		0.259	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	412	0.00	0	A	NM_024615		50055554	50055554	+1	no_errors	ENST00000281631	ensembl	human	known	69_37n	nonsense	126	11.27	16	SNP	1.000	T
PDE2A	5138	genome.wustl.edu	37	11	72300269	72300269	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:72300269C>G	ENST00000334456.5	-	12	1134	c.889G>C	c.(889-891)Ggc>Cgc	p.G297R	PDE2A_ENST00000544570.1_Missense_Mutation_p.G290R|PDE2A_ENST00000444035.2_Missense_Mutation_p.G288R|PDE2A_ENST00000376450.3_Intron|PDE2A_ENST00000418754.2_Missense_Mutation_p.G182R|PDE2A_ENST00000540345.1_Missense_Mutation_p.G288R|RP11-169D4.2_ENST00000545254.1_RNA	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	297	GAF 1.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	ACCACCTGGCCCAGGCATCCT	0.597																																						dbGAP											0													71.0	55.0	61.0					11																	72300269		2200	4293	6493	-	-	-	SO:0001583	missense	0			U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.889G>C	11.37:g.72300269C>G	ENSP00000334910:p.Gly297Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.G297R	ENST00000334456.5	37	c.889	CCDS8216.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.5|23.5	4.427306|4.427306	0.83667|0.83667	.|.	.|.	ENSG00000186642|ENSG00000186642	ENST00000538299|ENST00000334456;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000475807	.|T;T;T;T;T;T	.|0.76839	.|-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	5.46|5.46	4.55|4.55	0.56014|0.56014	.|GAF (2);	1.042410|1.042410	0.07613|0.07613	N|N	0.925782|0.925782	D|D	0.87585|0.87585	0.6214|0.6214	M|M	0.72118|0.72118	2.19|2.19	0.48901|0.48901	D|D	0.999725|0.999725	.|D;D;D;D;D	.|0.89917	.|0.991;0.982;1.0;0.987;0.992	.|P;P;D;P;P	.|0.79108	.|0.787;0.673;0.992;0.69;0.744	T|T	0.79902|0.79902	-0.1607|-0.1607	6|10	.|0.87932	.|D	.|0	.|.	11.2976|11.2976	0.49288|0.49288	0.0:0.9143:0.0:0.0857|0.0:0.9143:0.0:0.0857	.|.	.|182;297;288;290;297	.|E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646	.|.;PDE2A_HUMAN;.;.;.	A|R	58|297;288;366;290;182;288;121	.|ENSP00000334910:G297R;ENSP00000411657:G288R;ENSP00000442256:G290R;ENSP00000410310:G182R;ENSP00000446399:G288R;ENSP00000439077:G121R	.|ENSP00000334910:G297R	G|G	-|-	2|1	0|0	PDE2A|PDE2A	71977917|71977917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.545000|4.545000	0.60698|0.60698	1.304000|1.304000	0.44892|0.44892	0.491000|0.491000	0.48974|0.48974	GGG|GGC	PDE2A	-	pfam_GAF,smart_GAF	ENSG00000186642		0.597	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE2A	HGNC	protein_coding	OTTHUMT00000219839.2	43	0.00	0	C	NM_002599		72300269	72300269	-1	no_errors	ENST00000334456	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	1.000	G
PEAK1	79834	genome.wustl.edu	37	15	77406585	77406585	+	Silent	SNP	G	G	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr15:77406585G>A	ENST00000560626.2	-	7	5629	c.5154C>T	c.(5152-5154)agC>agT	p.S1718S	PEAK1_ENST00000312493.4_Silent_p.S1718S			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1718					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AGTCCTCAAGGCTGATTCCAC	0.478																																						dbGAP											0													114.0	115.0	115.0					15																	77406585		2010	4182	6192	-	-	-	SO:0001819	synonymous_variant	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.5154C>T	15.37:g.77406585G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.S1718	ENST00000560626.2	37	c.5154	CCDS42062.1	15																																																																																			PEAK1	-	NULL	ENSG00000173517		0.478	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Clone_based_vega_gene	protein_coding	OTTHUMT00000419483.3	96	0.00	0	G			77406585	77406585	-1	no_errors	ENST00000312493	ensembl	human	known	69_37n	silent	130	13.33	20	SNP	1.000	A
PEAR1	375033	genome.wustl.edu	37	1	156883814	156883814	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:156883814T>A	ENST00000338302.3	+	23	3109	c.2884T>A	c.(2884-2886)Tgg>Agg	p.W962R	PEAR1_ENST00000292357.7_Missense_Mutation_p.W962R			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	962	Pro-rich.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCCTCAGTTCTGGGACAGCCA	0.677																																						dbGAP											0													17.0	23.0	21.0					1																	156883814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2884T>A	1.37:g.156883814T>A	ENSP00000344465:p.Trp962Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEK2	Missense_Mutation	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.W962R	ENST00000338302.3	37	c.2884	CCDS30892.1	1	.	.	.	.	.	.	.	.	.	.	T	4.038	0.004657	0.07866	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.87650	-2.28;-2.28	5.6	2.45	0.29901	.	1.259530	0.05754	N	0.603638	T	0.44623	0.1302	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46816	-0.9164	10	0.26408	T	0.33	.	5.276	0.15649	0.0:0.6479:0.1686:0.1835	.	962	Q5VY43	PEAR1_HUMAN	R	962	ENSP00000344465:W962R;ENSP00000292357:W962R	ENSP00000292357:W962R	W	+	1	0	PEAR1	155150438	0.000000	0.05858	0.054000	0.19295	0.202000	0.24057	-0.602000	0.05680	1.356000	0.45884	-0.177000	0.13119	TGG	PEAR1	-	NULL	ENSG00000187800		0.677	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEAR1	HGNC	protein_coding	OTTHUMT00000098937.2	19	0.00	0	T	NM_001080471		156883814	156883814	+1	no_errors	ENST00000292357	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	0.084	A
PHKB	5257	genome.wustl.edu	37	16	47531346	47531346	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr16:47531346C>T	ENST00000323584.5	+	2	137	c.113C>T	c.(112-114)cCa>cTa	p.P38L	PHKB_ENST00000566044.1_Missense_Mutation_p.P31L|PHKB_ENST00000455779.1_Missense_Mutation_p.P31L|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000299167.8_Missense_Mutation_p.P38L	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	38					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				ATTAATCTTCCAAGACCTGAT	0.333																																						dbGAP											0													73.0	74.0	74.0					16																	47531346		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.113C>T	16.37:g.47531346C>T	ENSP00000313504:p.Pro38Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4T5	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.P38L	ENST00000323584.5	37	c.113	CCDS10729.1	16	.	.	.	.	.	.	.	.	.	.	C	14.06	2.421465	0.42918	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D;D	0.90385	-2.6;-2.66;-2.65	5.9	1.63	0.23807	.	0.159522	0.44285	N	0.000480	T	0.77425	0.4128	N	0.08118	0	0.52501	D	0.99995	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.08055	0.001;0.002;0.003	T	0.65998	-0.6032	10	0.38643	T	0.18	-2.5969	7.7436	0.28856	0.0:0.6872:0.1176:0.1952	.	31;38;31	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	L	31;31;38	ENSP00000299167:P31L;ENSP00000414345:P31L;ENSP00000313504:P38L	ENSP00000299167:P31L	P	+	2	0	PHKB	46088847	0.983000	0.35010	0.996000	0.52242	0.997000	0.91878	1.253000	0.32886	0.416000	0.25844	0.591000	0.81541	CCA	PHKB	-	NULL	ENSG00000102893		0.333	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	HGNC	protein_coding	OTTHUMT00000430413.1	403	0.00	0	C			47531346	47531346	+1	no_errors	ENST00000299167	ensembl	human	known	69_37n	missense	96	25.00	32	SNP	0.992	T
PLEKHS1	79949	genome.wustl.edu	37	10	115540387	115540387	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr10:115540387C>G	ENST00000354462.3	+	6	602	c.444C>G	c.(442-444)atC>atG	p.I148M	PLEKHS1_ENST00000369312.4_Missense_Mutation_p.I316M|PLEKHS1_ENST00000361048.1_3'UTR|PLEKHS1_ENST00000369309.1_Missense_Mutation_p.I232M			Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	412																	TCGGCAGGATCCCAAATTCAG	0.413																																						dbGAP											0													106.0	100.0	102.0					10																	115540387		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000354462.3:c.444C>G	10.37:g.115540387C>G	ENSP00000346451:p.Ile148Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	NULL	p.I316M	ENST00000354462.3	37	c.948		10	.	.	.	.	.	.	.	.	.	.	C	15.69	2.909024	0.52439	.	.	ENSG00000148735	ENST00000369312;ENST00000369309;ENST00000354462	T;T;T	0.33654	1.4;1.4;1.4	5.49	2.61	0.31194	.	.	.	.	.	T	0.53061	0.1773	M	0.62723	1.935	0.25712	N	0.985478	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.36939	-0.9727	9	0.66056	D	0.02	.	7.9892	0.30231	0.0:0.741:0.0:0.259	.	412;398	Q5SXH7;Q5SXH7-2	CJ081_HUMAN;.	M	316;232;148	ENSP00000358318:I316M;ENSP00000358315:I232M;ENSP00000346451:I148M	ENSP00000346451:I148M	I	+	3	3	C10orf81	115530377	0.963000	0.33076	0.999000	0.59377	0.673000	0.39480	0.242000	0.18087	0.366000	0.24427	0.655000	0.94253	ATC	PLEKHS1	-	NULL	ENSG00000148735		0.413	PLEKHS1-002	KNOWN	basic	protein_coding	PLEKHS1	HGNC	protein_coding	OTTHUMT00000050431.2	218	0.46	1	C	NM_024889		115540387	115540387	+1	no_errors	ENST00000369312	ensembl	human	known	69_37n	missense	107	15.08	19	SNP	1.000	G
PRR23B	389151	genome.wustl.edu	37	3	138738845	138738845	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr3:138738845C>T	ENST00000329447.5	-	1	923	c.659G>A	c.(658-660)cGc>cAc	p.R220H	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	220	Pro-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTCCAGAAGGCGGAATTCCAG	0.662																																						dbGAP											0													38.0	41.0	40.0					3																	138738845		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.659G>A	3.37:g.138738845C>T	ENSP00000328768:p.Arg220His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNV9	Missense_Mutation	SNP	pfam_UPF0572	p.R220H	ENST00000329447.5	37	c.659	CCDS33868.1	3	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.378975	0.01204	.	.	ENSG00000184814	ENST00000329447	.	.	.	3.5	-3.74	0.04385	.	0.994069	0.08158	N	0.988912	T	0.05318	0.0141	N	0.00146	-1.995	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41070	-0.9529	9	0.02654	T	1	.	9.2352	0.37461	0.0:0.549:0.0:0.451	.	220	Q6ZRT6	PR23B_HUMAN	H	220	.	ENSP00000328768:R220H	R	-	2	0	PRR23B	140221535	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.256000	0.18351	-0.707000	0.05022	-1.155000	0.01812	CGC	PRR23B	-	pfam_UPF0572	ENSG00000184814		0.662	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23B	HGNC	protein_coding	OTTHUMT00000361501.1	49	0.00	0	C	NM_001013650		138738845	138738845	-1	no_errors	ENST00000329447	ensembl	human	known	69_37n	missense	76	23.00	23	SNP	0.000	T
PLS1	5357	genome.wustl.edu	37	3	142403210	142403210	+	Silent	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr3:142403210C>T	ENST00000337777.3	+	8	1074	c.861C>T	c.(859-861)acC>acT	p.T287T	PLS1_ENST00000457734.2_Silent_p.T287T|PLS1_ENST00000497002.1_Silent_p.T287T	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	287	Actin-binding 1.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GATGGCATACCATCAGCAACT	0.403																																						dbGAP											0													80.0	73.0	76.0					3																	142403210		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.861C>T	3.37:g.142403210C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Q1|D3DNG3|Q8NEG6	Silent	SNP	pfam_CH-domain,pfam_EF-hand,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.T287	ENST00000337777.3	37	c.861	CCDS3125.1	3																																																																																			PLS1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000120756		0.403	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLS1	HGNC	protein_coding	OTTHUMT00000354435.1	122	0.00	0	C	NM_002670		142403210	142403210	+1	no_errors	ENST00000337777	ensembl	human	known	69_37n	silent	112	12.50	16	SNP	0.905	T
PSMA5	5686	genome.wustl.edu	37	1	109952632	109952632	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:109952632A>C	ENST00000271308.4	-	8	586	c.566T>G	c.(565-567)aTg>aGg	p.M189R	PSMA5_ENST00000490870.1_5'UTR|PSMA5_ENST00000538610.1_Missense_Mutation_p.M131R	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	189					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		TTTCAAAGTCATAGACTTGAA	0.358																																						dbGAP											0													182.0	182.0	182.0					1																	109952632		2203	4300	6503	-	-	-	SO:0001583	missense	0			X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.566T>G	1.37:g.109952632A>C	ENSP00000271308:p.Met189Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.M189R	ENST00000271308.4	37	c.566	CCDS799.1	1	.	.	.	.	.	.	.	.	.	.	a	24.7	4.556324	0.86231	.	.	ENSG00000143106	ENST00000538610;ENST00000271308	T;T	0.26518	1.73;1.73	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.61350	0.2340	H	0.98068	4.14	0.80722	D	1	D	0.59357	0.985	D	0.72338	0.977	T	0.77297	-0.2640	10	0.87932	D	0	-10.5836	15.0492	0.71854	1.0:0.0:0.0:0.0	.	189	P28066	PSA5_HUMAN	R	131;189	ENSP00000440618:M131R;ENSP00000271308:M189R	ENSP00000271308:M189R	M	-	2	0	PSMA5	109754155	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.287000	0.95975	2.189000	0.69895	0.456000	0.33151	ATG	PSMA5	-	pfam_Proteasome_sua/b	ENSG00000143106		0.358	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA5	HGNC	protein_coding	OTTHUMT00000033192.2	434	0.23	1	A	NM_002790		109952632	109952632	-1	no_errors	ENST00000271308	ensembl	human	known	69_37n	missense	180	21.40	49	SNP	1.000	C
PTGIS	5740	genome.wustl.edu	37	20	48124493	48124493	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr20:48124493T>A	ENST00000244043.4	-	10	1496	c.1467A>T	c.(1465-1467)gaA>gaT	p.E489D	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	489					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GCACGTCGTGTTCCGGCTGCA	0.627																																						dbGAP											0													106.0	71.0	83.0					20																	48124493		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1467A>T	20.37:g.48124493T>A	ENSP00000244043:p.Glu489Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.E489D	ENST00000244043.4	37	c.1467	CCDS13419.1	20	.	.	.	.	.	.	.	.	.	.	T	2.812	-0.246662	0.05867	.	.	ENSG00000124212	ENST00000244043	T	0.69175	-0.38	4.76	-2.78	0.05859	.	0.252231	0.37219	N	0.002183	T	0.44561	0.1299	N	0.24115	0.695	0.20489	N	0.999897	B	0.15930	0.015	B	0.20955	0.032	T	0.33777	-0.9855	10	0.13108	T	0.6	-4.1897	11.5273	0.50586	0.0:0.5107:0.0:0.4893	.	489	Q16647	PTGIS_HUMAN	D	489	ENSP00000244043:E489D	ENSP00000244043:E489D	E	-	3	2	PTGIS	47557900	0.000000	0.05858	0.035000	0.18076	0.100000	0.18952	-0.798000	0.04565	-0.358000	0.08162	-0.464000	0.05259	GAA	PTGIS	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000124212		0.627	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIS	HGNC	protein_coding	OTTHUMT00000080496.2	10	0.00	0	T			48124493	48124493	-1	no_errors	ENST00000244043	ensembl	human	known	69_37n	missense	44	21.43	12	SNP	0.056	A
PTPN14	5784	genome.wustl.edu	37	1	214557148	214557148	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:214557148G>C	ENST00000366956.5	-	13	2244	c.2050C>G	c.(2050-2052)Cac>Gac	p.H684D	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	684					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GGGACCTCGTGGCTGCCTGAC	0.647																																					Colon(92;557 1424 24372 34121 40073)	dbGAP											0													53.0	53.0	53.0					1																	214557148		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2050C>G	1.37:g.214557148G>C	ENSP00000355923:p.His684Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSI0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.H684D	ENST00000366956.5	37	c.2050	CCDS1514.1	1	.	.	.	.	.	.	.	.	.	.	G	1.699	-0.502096	0.04261	.	.	ENSG00000152104	ENST00000366956	T	0.66638	-0.22	4.36	4.36	0.52297	.	0.306271	0.31519	N	0.007519	T	0.57636	0.2067	L	0.44542	1.39	0.80722	D	1	B	0.18610	0.029	B	0.14023	0.01	T	0.54603	-0.8269	10	0.13108	T	0.6	.	16.9018	0.86116	0.0:0.0:1.0:0.0	.	684	Q15678	PTN14_HUMAN	D	684	ENSP00000355923:H684D	ENSP00000355923:H684D	H	-	1	0	PTPN14	212623771	0.941000	0.31946	0.957000	0.39632	0.251000	0.25915	3.345000	0.52182	1.999000	0.58509	0.563000	0.77884	CAC	PTPN14	-	pirsf_Tyr_Pase_non-rcpt_typ-14/21	ENSG00000152104		0.647	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	18	0.00	0	G	NM_005401		214557148	214557148	-1	no_errors	ENST00000366956	ensembl	human	known	69_37n	missense	62	19.48	15	SNP	0.989	C
RIMBP2	23504	genome.wustl.edu	37	12	130927134	130927134	+	Missense_Mutation	SNP	G	G	A	rs549158714		TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr12:130927134G>A	ENST00000261655.4	-	8	875	c.712C>T	c.(712-714)Cgg>Tgg	p.R238W	RIMBP2_ENST00000535703.1_Missense_Mutation_p.R146W|RIMBP2_ENST00000536002.1_Missense_Mutation_p.R146W	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	238					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CTTGCCAACCGCGACTCGTTG	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		18516	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													130.0	129.0	129.0					12																	130927134		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.712C>T	12.37:g.130927134G>A	ENSP00000261655:p.Arg238Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.R238W	ENST00000261655.4	37	c.712	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885658	0.51908	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.30448	1.53;1.53;1.53	4.53	3.61	0.41365	Src homology-3 domain (1);	0.538961	0.20115	N	0.098937	T	0.52837	0.1759	M	0.68317	2.08	0.42057	D	0.991146	D;D	0.89917	0.998;1.0	D;D	0.83275	0.928;0.996	T	0.55611	-0.8114	10	0.66056	D	0.02	-24.1815	13.5684	0.61832	0.0:0.0:0.8432:0.1568	.	146;238	O15034-2;O15034	.;RIMB2_HUMAN	W	238;146;146;146	ENSP00000261655:R238W;ENSP00000440347:R146W;ENSP00000439159:R146W	ENSP00000261655:R238W	R	-	1	2	RIMBP2	129493087	1.000000	0.71417	0.020000	0.16555	0.317000	0.28152	5.216000	0.65246	0.840000	0.34995	0.561000	0.74099	CGG	RIMBP2	-	superfamily_SH3_domain	ENSG00000060709		0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	66	0.00	0	G	NM_015347		130927134	130927134	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	missense	93	22.50	27	SNP	0.780	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037843	10037843	+	RNA	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chrY:10037843C>T	ENST00000515896.1	+	0	80									RNA, 5.8S ribosomal pseudogene 6																		AATTGCAGGACACATTGATCA	0.512																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037843C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.512	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		32	0.00	0	C			10037843	10037843	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	8	38.46	5	SNP	1.000	T
RSPO2	340419	genome.wustl.edu	37	8	109001415	109001415	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr8:109001415C>A	ENST00000276659.5	-	3	772	c.152G>T	c.(151-153)gGg>gTg	p.G51V	RSPO2_ENST00000517781.1_Intron|RSPO2_ENST00000517939.1_5'UTR|RSPO2_ENST00000378439.2_Intron	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	51					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			TCGGCTACACCCATTGTCCTT	0.408																																						dbGAP											0													108.0	90.0	96.0					8																	109001415		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.152G>T	8.37:g.109001415C>A	ENSP00000276659:p.Gly51Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	superfamily_Growth_fac_rcpt,superfamily_Thrombospondin_1_rpt,smart_Furin_repeat,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G51V	ENST00000276659.5	37	c.152	CCDS6307.1	8	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491282	0.84962	.	.	ENSG00000147655	ENST00000276659;ENST00000521956;ENST00000520026;ENST00000522333	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	4.92	4.92	0.64577	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.85323	0.5670	N	0.20610	0.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86395	0.1738	10	0.45353	T	0.12	-0.265	18.4941	0.90858	0.0:1.0:0.0:0.0	.	51	Q6UXX9	RSPO2_HUMAN	V	51;51;23;51	ENSP00000276659:G51V;ENSP00000430010:G51V;ENSP00000429159:G23V;ENSP00000430973:G51V	ENSP00000276659:G51V	G	-	2	0	RSPO2	109070591	1.000000	0.71417	0.984000	0.44739	0.960000	0.62799	7.323000	0.79105	2.446000	0.82766	0.557000	0.71058	GGG	RSPO2	-	superfamily_Growth_fac_rcpt,smart_Furin_repeat	ENSG00000147655		0.408	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO2	HGNC	protein_coding	OTTHUMT00000380830.1	130	0.76	1	C	NM_178565		109001415	109001415	-1	no_errors	ENST00000276659	ensembl	human	known	69_37n	missense	132	13.16	20	SNP	1.000	A
RTN4RL2	349667	genome.wustl.edu	37	11	57235332	57235332	+	Silent	SNP	C	C	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:57235332C>T	ENST00000533205.1	+	2	291	c.282C>T	c.(280-282)ctC>ctT	p.L94L	RTN4RL2_ENST00000395120.2_Silent_p.L94L|RTN4RL2_ENST00000335099.3_Silent_p.L94L					reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CCAACAACCTCTCCACCATCT	0.632																																						dbGAP											0													169.0	146.0	154.0					11																	57235332		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000533205.1:c.282C>T	11.37:g.57235332C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L94	ENST00000533205.1	37	c.282		11																																																																																			RTN4RL2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000186907		0.632	RTN4RL2-003	PUTATIVE	basic|exp_conf	protein_coding	RTN4RL2	HGNC	protein_coding	OTTHUMT00000392538.1	39	0.00	0	C	NM_178570		57235332	57235332	+1	no_errors	ENST00000335099	ensembl	human	known	69_37n	silent	128	19.50	31	SNP	1.000	T
SELPLG	6404	genome.wustl.edu	37	12	109017672	109017674	+	In_Frame_Del	DEL	GCA	GCA	-	rs63748999|rs558357966|rs372173288|rs201851784|rs540144714	byFrequency	TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr12:109017672_109017674delGCA	ENST00000550948.1	-	2	634_636	c.410_412delTGC	c.(409-414)gtgccc>gcc	p.137_138VP>A	SELPLG_ENST00000388962.3_Intron|SELPLG_ENST00000228463.6_In_Frame_Del_p.153_154VP>A			Q14242	SELPL_HUMAN	selectin P ligand	137	12 X 10 AA tandem repeats.		Missing (in short form; not an alternative splicing; dbSNP:rs63748999). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7505206}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						GCCTCCGTGGGCACTGGTTGAGT	0.616																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.410_412delTGC	12.37:g.109017672_109017674delGCA	ENSP00000447752:p.Val137_Pro138delinsAla	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	In_Frame_Del	DEL	NULL	p.VP137in_frame_delA	ENST00000550948.1	37	c.412_410	CCDS31895.2	12																																																																																			SELPLG	-	NULL	ENSG00000110876		0.616	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELPLG	HGNC	protein_coding	OTTHUMT00000403904.1	66	0.00	0	GCA			109017672	109017674	-1	no_errors	ENST00000550948	ensembl	human	known	69_37n	in_frame_del	213	12.20	50	DEL	0.000:0.000:0.000	-
SLC45A3	85414	genome.wustl.edu	37	1	205628387	205628387	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:205628387C>G	ENST00000367145.3	-	5	1932	c.1637G>C	c.(1636-1638)aGc>aCc	p.S546T	SLC45A3_ENST00000460934.1_5'UTR	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	546					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GGCCAAGTCGCTCTTGTCAAA	0.562			T	"""ETV1, ETV5, ELK4, ERG"""	prostate						OREG0014161	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	0													62.0	63.0	63.0					1																	205628387		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.1637G>C	1.37:g.205628387C>G	ENSP00000356113:p.Ser546Thr	Somatic	2153	WXS	Illumina GAIIx	Phase_IV	A8K2U9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S546T	ENST00000367145.3	37	c.1637	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249484	0.39797	.	.	ENSG00000158715	ENST00000367145	T	0.44881	0.91	5.66	2.65	0.31530	.	0.337163	0.37809	N	0.001932	T	0.24236	0.0587	N	0.14661	0.345	0.22342	N	0.999185	B	0.17038	0.02	B	0.15870	0.014	T	0.16453	-1.0402	10	0.49607	T	0.09	-8.75	8.8328	0.35093	0.0:0.7366:0.0:0.2634	.	546	Q96JT2	S45A3_HUMAN	T	546	ENSP00000356113:S546T	ENSP00000356113:S546T	S	-	2	0	SLC45A3	203895010	0.833000	0.29383	0.764000	0.31436	0.909000	0.53808	1.478000	0.35442	0.264000	0.21851	0.591000	0.81541	AGC	SLC45A3	-	NULL	ENSG00000158715		0.562	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	HGNC	protein_coding	OTTHUMT00000090619.1	15	0.00	0	C	NM_033102		205628387	205628387	-1	no_errors	ENST00000367145	ensembl	human	known	69_37n	missense	36	41.94	26	SNP	0.826	G
SIPA1L2	57568	genome.wustl.edu	37	1	232650538	232650538	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:232650538T>C	ENST00000366630.1	-	2	906	c.548A>G	c.(547-549)aAc>aGc	p.N183S	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.N183S			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	183					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				AGCCCCGGTGTTGGGGTTGAC	0.483																																						dbGAP											0													121.0	118.0	119.0					1																	232650538		1943	4136	6079	-	-	-	SO:0001583	missense	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.548A>G	1.37:g.232650538T>C	ENSP00000355589:p.Asn183Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.N183S	ENST00000366630.1	37	c.548	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	T	9.801	1.180564	0.21787	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.39787	1.06;1.06	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.31389	0.0795	L	0.31207	0.915	0.58432	D	0.999996	B	0.24823	0.112	B	0.24394	0.053	T	0.09143	-1.0688	10	0.15066	T	0.55	-48.4546	15.2209	0.73310	0.0:0.0:0.0:1.0	.	183	Q9P2F8	SI1L2_HUMAN	S	183	ENSP00000355589:N183S;ENSP00000262861:N183S	ENSP00000262861:N183S	N	-	2	0	SIPA1L2	230717161	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.868000	0.87116	2.187000	0.69744	0.528000	0.53228	AAC	SIPA1L2	-	NULL	ENSG00000116991		0.483	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	141	0.70	1	T	XM_045839		232650538	232650538	-1	no_errors	ENST00000262861	ensembl	human	known	69_37n	missense	182	14.55	31	SNP	1.000	C
SPEG	10290	genome.wustl.edu	37	2	220333886	220333886	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr2:220333886T>A	ENST00000312358.7	+	13	3632	c.3500T>A	c.(3499-3501)cTg>cAg	p.L1167Q	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1167					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGCTCGAAGCTGGAGAAGATG	0.657																																						dbGAP											0													35.0	41.0	39.0					2																	220333886		2163	4267	6430	-	-	-	SO:0001583	missense	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3500T>A	2.37:g.220333886T>A	ENSP00000311684:p.Leu1167Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L1167Q	ENST00000312358.7	37	c.3500	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	T	17.51	3.406679	0.62399	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.68903	-0.36	4.77	4.77	0.60923	.	0.000000	0.32852	N	0.005572	T	0.69922	0.3165	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.75190	-0.3405	10	0.87932	D	0	.	14.4658	0.67482	0.0:0.0:0.0:1.0	.	1167	Q15772	SPEG_HUMAN	Q	1167	ENSP00000311684:L1167Q	ENSP00000265327:L1167Q	L	+	2	0	SPEG	220042130	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.934000	0.70138	2.015000	0.59207	0.533000	0.62120	CTG	SPEG	-	NULL	ENSG00000072195		0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	13	0.00	0	T	NM_005876		220333886	220333886	+1	no_errors	ENST00000312358	ensembl	human	novel	69_37n	missense	23	34.29	12	SNP	1.000	A
SPG20	23111	genome.wustl.edu	37	13	36886528	36886528	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr13:36886528A>G	ENST00000451493.1	-	7	1787	c.1570T>C	c.(1570-1572)Tct>Cct	p.S524P	SPG20_ENST00000438666.2_Missense_Mutation_p.S524P|SPG20_ENST00000355182.4_Missense_Mutation_p.S524P|SPG20_ENST00000494062.2_Missense_Mutation_p.S524P	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	524					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		TTTTTAAGAGATTCTGGAACA	0.398																																						dbGAP											0													149.0	145.0	146.0					13																	36886528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1570T>C	13.37:g.36886528A>G	ENSP00000414147:p.Ser524Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.S524P	ENST00000451493.1	37	c.1570	CCDS9356.1	13	.	.	.	.	.	.	.	.	.	.	A	21.1	4.098267	0.76870	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.90444	-2.67;-2.67;-2.67	5.86	1.93	0.25924	Senescence/spartin-associated (1);	0.000000	0.85682	D	0.000000	D	0.94706	0.8292	M	0.80616	2.505	0.47994	D	0.999563	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93958	0.7238	10	0.62326	D	0.03	-15.3948	13.8401	0.63432	0.6388:0.3612:0.0:0.0	.	524;524	A8K6Q9;Q8N0X7	.;SPG20_HUMAN	P	524	ENSP00000406061:S524P;ENSP00000347314:S524P;ENSP00000414147:S524P	ENSP00000347314:S524P	S	-	1	0	SPG20	35784528	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	4.549000	0.60726	0.163000	0.19507	-0.299000	0.09455	TCT	SPG20	-	pfam_Senescence/spartin	ENSG00000133104		0.398	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	416	0.00	0	A			36886528	36886528	-1	no_errors	ENST00000355182	ensembl	human	known	69_37n	missense	102	27.66	39	SNP	1.000	G
SSPO	23145	genome.wustl.edu	37	7	149500337	149500337	+	RNA	SNP	T	T	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr7:149500337T>G	ENST00000378016.2	+	0	7863							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCGTGTGTATGTGAGTGCCG	0.652																																						dbGAP											0													45.0	55.0	52.0					7																	149500337		2156	4261	6417	-	-	-			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149500337T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.652	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		22	0.00	0	T			149500337	149500337	+1	no_errors	ENST00000378016	ensembl	human	known	69_37n	rna	51	15.00	9	SNP	0.108	G
SYT17	51760	genome.wustl.edu	37	16	19278387	19278387	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr16:19278387G>T	ENST00000355377.2	+	8	1812	c.1414G>T	c.(1414-1416)Gag>Tag	p.E472*	SYT17_ENST00000562034.1_Nonsense_Mutation_p.E411*|SYT17_ENST00000568433.1_Nonsense_Mutation_p.E166*|SYT17_ENST00000562711.2_Nonsense_Mutation_p.E468*	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	472					exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						TGCCTCCCTGGAGGTGACCTG	0.527																																						dbGAP											0													37.0	30.0	32.0					16																	19278387		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.1414G>T	16.37:g.19278387G>T	ENSP00000347538:p.Glu472*	Somatic		WXS	Illumina GAIIx	Phase_IV	O43330|Q9NZ18	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.E472*	ENST00000355377.2	37	c.1414	CCDS10575.1	16	.	.	.	.	.	.	.	.	.	.	G	58	32.628663	0.99980	.	.	ENSG00000103528	ENST00000355377	.	.	.	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.51767	D	0.999934	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.5662	0.91118	0.0:0.0:1.0:0.0	.	.	.	.	X	472	.	ENSP00000347538:E472X	E	+	1	0	SYT17	19185888	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.735000	0.84939	2.351000	0.79841	0.655000	0.94253	GAG	SYT17	-	NULL	ENSG00000103528		0.527	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT17	HGNC	protein_coding	OTTHUMT00000254286.2	15	0.00	0	G	NM_016524		19278387	19278387	+1	no_errors	ENST00000355377	ensembl	human	known	69_37n	nonsense	43	15.69	8	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y220C	ENST00000269305.4	37	c.659	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	179	0.56	1	T	NM_000546		7578190	7578190	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	104	33.33	52	SNP	0.998	C
TMUB2	79089	genome.wustl.edu	37	17	42265092	42265092	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr17:42265092C>G	ENST00000587989.1	+	2	169	c.16C>G	c.(16-18)Ctt>Gtt	p.L6V	TMUB2_ENST00000446571.3_5'UTR|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|TMUB2_ENST00000357984.3_Intron|TMUB2_ENST00000587172.1_5'Flank|TMUB2_ENST00000589785.1_Intron|ASB16-AS1_ENST00000592897.1_RNA|TMUB2_ENST00000590235.1_Intron|TMUB2_ENST00000538716.2_Missense_Mutation_p.L6V|TMUB2_ENST00000319511.6_5'UTR|ASB16-AS1_ENST00000585457.1_RNA|TMUB2_ENST00000592825.1_5'UTR|TMUB2_ENST00000589184.1_5'UTR|TMUB2_ENST00000589856.1_5'UTR			Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain containing 2	6						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(3)	8		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		ttcacgtcatcttcaaaacaa	0.388																																						dbGAP											0													176.0	173.0	174.0					17																	42265092		1020	2137	3157	-	-	-	SO:0001583	missense	0				CCDS11479.1, CCDS54134.1	17q21	2006-06-27				ENSG00000168591			28459	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_177441		Approved	MGC3123	uc002ifo.3	Q71RG4		ENST00000587989.1:c.16C>G	17.37:g.42265092C>G	ENSP00000466971:p.Leu6Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU81|Q8NDI2|Q9BPZ5|Q9HAG3	Missense_Mutation	SNP	pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.L6V	ENST00000587989.1	37	c.16	CCDS54134.1	17	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621596	0.46736	.	.	ENSG00000168591	ENST00000538716	T	0.49139	0.79	4.36	4.36	0.52297	.	.	.	.	.	T	0.25494	0.0620	N	0.08118	0	0.80722	D	1	P	0.34522	0.455	B	0.29440	0.102	T	0.09751	-1.0660	9	0.30854	T	0.27	.	12.711	0.57089	0.0:1.0:0.0:0.0	.	6	Q71RG4	TMUB2_HUMAN	V	6	ENSP00000444565:L6V	ENSP00000444565:L6V	L	+	1	0	TMUB2	39620618	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.969000	0.49232	2.714000	0.92807	0.561000	0.74099	CTT	TMUB2	-	NULL	ENSG00000168591		0.388	TMUB2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMUB2	HGNC	protein_coding	OTTHUMT00000457711.1	455	0.00	0	C	NM_177441		42265092	42265092	+1	no_errors	ENST00000538716	ensembl	human	known	69_37n	missense	142	29.21	59	SNP	0.999	G
TRIM49B	283116	genome.wustl.edu	37	11	49053370	49053370	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr11:49053370G>A	ENST00000332682.7	+	2	247	c.219G>A	c.(217-219)atG>atA	p.M73I		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	73						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						TCAAGAAGATGGCTTCTCTTG	0.453																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.219G>A	11.37:g.49053370G>A	ENSP00000330216:p.Met73Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.M73I	ENST00000332682.7	37	c.219	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	G	9.107	1.005633	0.19199	.	.	ENSG00000182053	ENST00000332682	T	0.80214	-1.35	0.49	0.49	0.16861	.	.	.	.	.	T	0.56411	0.1983	N	0.08118	0	0.22639	N	0.998903	.	.	.	.	.	.	T	0.43360	-0.9396	7	0.11794	T	0.64	.	6.783	0.23657	2.0E-4:0.0:0.9998:0.0	.	.	.	.	I	73	ENSP00000330216:M73I	ENSP00000330216:M73I	M	+	3	0	AC084851.1	49009946	0.001000	0.12720	0.015000	0.15790	0.041000	0.13682	-1.425000	0.02446	0.513000	0.28278	0.184000	0.17185	ATG	TRIM49B	-	NULL	ENSG00000182053		0.453	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		350	0.00	0	G			49053370	49053370	+1	no_errors	ENST00000332682	ensembl	human	known	69_37n	missense	157	19.49	38	SNP	0.855	A
UAP1	6675	genome.wustl.edu	37	1	162557384	162557384	+	Missense_Mutation	SNP	C	C	G	rs140592976		TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr1:162557384C>G	ENST00000367925.1	+	5	986	c.954C>G	c.(952-954)gaC>gaG	p.D318E	UAP1_ENST00000367924.1_Missense_Mutation_p.D318E|UAP1_ENST00000367926.4_Missense_Mutation_p.D318E|UAP1_ENST00000271469.3_Missense_Mutation_p.D318E			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	318					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)			breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			GAAGCTCAGACGGACGACTGC	0.473																																						dbGAP											0													158.0	160.0	159.0					1																	162557384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.954C>G	1.37:g.162557384C>G	ENSP00000356902:p.Asp318Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	Missense_Mutation	SNP	pfam_UDPGP_trans	p.D318E	ENST00000367925.1	37	c.954		1	.	.	.	.	.	.	.	.	.	.	T	19.27	3.795275	0.70452	.	.	ENSG00000117143	ENST00000367926;ENST00000271469;ENST00000367925;ENST00000367924	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	5.23	0.209	0.15226	.	0.092012	0.64402	D	0.000001	T	0.07458	0.0188	M	0.63843	1.955	0.58432	D	0.999992	B	0.27823	0.19	B	0.28139	0.086	T	0.10200	-1.0640	9	0.56958	D	0.05	-25.4566	9.9388	0.41567	0.0:0.3596:0.0:0.6404	.	318	Q16222-2	.	E	318	ENSP00000356903:D318E;ENSP00000271469:D318E;ENSP00000356902:D318E;ENSP00000356901:D318E	ENSP00000271469:D318E	D	+	3	2	UAP1	160824008	0.809000	0.29036	0.983000	0.44433	0.994000	0.84299	-0.133000	0.10451	-0.387000	0.07809	-0.332000	0.08345	GAC	UAP1	-	pfam_UDPGP_trans	ENSG00000117143		0.473	UAP1-002	KNOWN	basic	protein_coding	UAP1	HGNC	protein_coding	OTTHUMT00000083203.1	160	0.00	0	C	NM_003115		162557384	162557384	+1	no_errors	ENST00000271469	ensembl	human	known	69_37n	missense	130	10.96	16	SNP	0.996	G
ZNF169	169841	genome.wustl.edu	37	9	97063282	97063282	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr9:97063282C>A	ENST00000395395.2	+	5	1532	c.1442C>A	c.(1441-1443)aCa>aAa	p.T481K	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				AGGACACACACAGGGGAGAAG	0.572																																						dbGAP											0													82.0	71.0	75.0					9																	97063282		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.1442C>A	9.37:g.97063282C>A	ENSP00000378792:p.Thr481Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T481K	ENST00000395395.2	37	c.1442	CCDS6709.2	9	.	.	.	.	.	.	.	.	.	.	C	8.879	0.951126	0.18431	.	.	ENSG00000175787	ENST00000395395;ENST00000340911	T	0.24538	1.85	2.83	-0.146	0.13432	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27832	0.0685	M	0.79123	2.44	0.53688	D	0.999977	P	0.35628	0.513	B	0.38712	0.28	T	0.10706	-1.0618	9	0.72032	D	0.01	.	4.4101	0.11429	0.0:0.5698:0.19:0.2402	.	481	Q14929	ZN169_HUMAN	K	481;290	ENSP00000378792:T481K	ENSP00000340711:T290K	T	+	2	0	ZNF169	96103103	0.543000	0.26434	0.119000	0.21687	0.376000	0.30014	1.092000	0.30927	-0.027000	0.13873	-0.199000	0.12753	ACA	ZNF169	-	pfscan_Znf_C2H2	ENSG00000175787		0.572	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	HGNC	protein_coding	OTTHUMT00000253714.1	70	0.00	0	C	NM_194320		97063282	97063282	+1	no_errors	ENST00000395395	ensembl	human	known	69_37n	missense	85	14.00	14	SNP	0.687	A
ZNF37A	7587	genome.wustl.edu	37	10	38407207	38407207	+	Silent	SNP	A	A	G			TCGA-AR-A0U1-01A-11D-A10Y-09	TCGA-AR-A0U1-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	265ceec6-e9a8-499e-adf6-0c18c598532e	30329e31-a2b2-4c2e-8291-f775e3c9fa14	g.chr10:38407207A>G	ENST00000361085.5	+	7	1473	c.1128A>G	c.(1126-1128)acA>acG	p.T376T	ZNF37A_ENST00000351773.3_Silent_p.T376T	NM_001178101.1|NM_003421.2	NP_001171572.1|NP_003412.1	P17032	ZN37A_HUMAN	zinc finger protein 37A	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|prostate(1)	28						ATCAGAAAACACACACAGGGG	0.413																																						dbGAP											0													71.0	73.0	72.0					10																	38407207		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X69115	CCDS31183.1	10p11.2	2013-01-08	2006-05-11		ENSG00000075407	ENSG00000075407		"""Zinc fingers, C2H2-type"", ""-"""	13102	protein-coding gene	gene with protein product			"""zinc finger protein 37a (KOX 21)"""			2014798, 8464732	Standard	NM_001178101		Approved	KOX21, ZNF37	uc001izl.3	P17032	OTTHUMG00000017990	ENST00000361085.5:c.1128A>G	10.37:g.38407207A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRQ3|D3DRZ3|Q96B88	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T376	ENST00000361085.5	37	c.1128	CCDS31183.1	10																																																																																			ZNF37A	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000075407		0.413	ZNF37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF37A	HGNC	protein_coding	OTTHUMT00000047624.2	205	0.00	0	A	NM_003421		38407207	38407207	+1	no_errors	ENST00000351773	ensembl	human	known	69_37n	silent	97	22.40	28	SNP	0.975	G
