#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACACB	32	genome.wustl.edu	37	12	109675151	109675151	+	Missense_Mutation	SNP	G	G	A	rs527660684		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr12:109675151G>A	ENST00000338432.7	+	34	4747	c.4628G>A	c.(4627-4629)cGc>cAc	p.R1543H	ACACB_ENST00000543201.1_Missense_Mutation_p.R209H|ACACB_ENST00000377854.5_Missense_Mutation_p.R1473H|ACACB_ENST00000377848.3_Missense_Mutation_p.R1543H			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1543					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.R1543H(1)|p.R209H(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TTCTTCATCCGCGCCATCATC	0.547																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)											144.0	103.0	117.0					12																	109675151		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.4628G>A	12.37:g.109675151G>A	ENSP00000341044:p.Arg1543His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.R1543H	ENST00000338432.7	37	c.4628	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.138584	0.94560	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	4.76	4.76	0.60689	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.81331	0.4800	M	0.77313	2.365	0.80722	D	1	P	0.51791	0.948	P	0.48982	0.597	D	0.85088	0.0950	10	0.87932	D	0	.	18.6559	0.91453	0.0:0.0:1.0:0.0	.	1543	O00763	ACACB_HUMAN	H	1543;1543;1473;774;209	ENSP00000341044:R1543H;ENSP00000367079:R1543H;ENSP00000367085:R1473H;ENSP00000444075:R209H	ENSP00000341044:R1543H	R	+	2	0	ACACB	108159534	1.000000	0.71417	0.994000	0.49952	0.948000	0.59901	9.798000	0.99111	2.590000	0.87494	0.561000	0.74099	CGC	ACACB	-	pfam_AcCoA_COase_cen	ENSG00000076555		0.547	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	227	0.44	1	G	NM_001093		109675151	109675151	+1	no_errors	ENST00000338432	ensembl	human	known	69_37n	missense	129	42.48	96	SNP	1.000	A
ACAD10	80724	genome.wustl.edu	37	12	112186223	112186223	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr12:112186223C>A	ENST00000313698.4	+	17	2743	c.2588C>A	c.(2587-2589)aCc>aAc	p.T863N	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000455480.2_Missense_Mutation_p.T894N|ACAD10_ENST00000392636.2_Missense_Mutation_p.T465N	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	863						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						CCCATGGATACCCCAGGGATA	0.562																																						dbGAP											0													88.0	88.0	88.0					12																	112186223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2588C>A	12.37:g.112186223C>A	ENSP00000325137:p.Thr863Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Dehalogen-like_hydro,superfamily_AcylCoA_DH/oxidase,superfamily_Kinase-like_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_HAD-like_dom,prints_Haloacid_DH/epoxide_hydro,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA_v3	p.T894N	ENST00000313698.4	37	c.2681	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859013	0.71834	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000455480;ENST00000313698	D;D;D	0.99060	-5.38;-5.38;-5.38	5.87	2.98	0.34508	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.617785	0.15303	N	0.269537	D	0.99070	0.9681	M	0.85462	2.755	0.33642	D	0.607358	D;P;D	0.63046	0.991;0.868;0.992	D;P;P	0.62955	0.909;0.497;0.688	D	0.99828	1.1052	10	0.56958	D	0.05	.	10.678	0.45797	0.0:0.6846:0.2463:0.0691	.	894;863;863	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	N	465;863;894;863	ENSP00000376411:T465N;ENSP00000389813:T894N;ENSP00000325137:T863N	ENSP00000325137:T863N	T	+	2	0	ACAD10	110670606	0.491000	0.26019	0.635000	0.29338	0.942000	0.58702	1.747000	0.38298	0.792000	0.33850	-0.175000	0.13238	ACC	ACAD10	-	superfamily_AcylCoA_DH/oxidase	ENSG00000111271		0.562	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	HGNC	protein_coding	OTTHUMT00000368307.1	162	0.61	1	C	NM_025247		112186223	112186223	+1	no_errors	ENST00000455480	ensembl	human	known	69_37n	missense	103	36.97	61	SNP	0.970	A
ACOT4	122970	genome.wustl.edu	37	14	74058810	74058810	+	Silent	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr14:74058810C>T	ENST00000326303.4	+	1	401	c.147C>T	c.(145-147)caC>caT	p.H49H		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	49					acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TCCGGGCCCACGCGCGCTACT	0.771																																						dbGAP											0													4.0	4.0	4.0					14																	74058810		1672	3397	5069	-	-	-	SO:0001819	synonymous_variant	0			BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.147C>T	14.37:g.74058810C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Silent	SNP	pfam_BAAT_C,pfam_Thio_Ohase/aa_AcTrfase,pirsf_Acyl-CoA_thioEstase_long-chain	p.H49	ENST00000326303.4	37	c.147	CCDS9817.1	14																																																																																			ACOT4	-	pfam_Thio_Ohase/aa_AcTrfase,pirsf_Acyl-CoA_thioEstase_long-chain	ENSG00000177465		0.771	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT4	HGNC	protein_coding	OTTHUMT00000404298.2	13	0.00	0	C	NM_152331		74058810	74058810	+1	no_errors	ENST00000326303	ensembl	human	known	69_37n	silent	5	54.55	6	SNP	0.999	T
ADAMDEC1	27299	genome.wustl.edu	37	8	24257811	24257811	+	Silent	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr8:24257811G>A	ENST00000256412.4	+	11	1360	c.1140G>A	c.(1138-1140)ctG>ctA	p.L380L	ADAMDEC1_ENST00000522298.1_Silent_p.L301L|RP11-624C23.1_ENST00000523578.1_RNA|ADAMDEC1_ENST00000538205.1_Silent_p.L301L|RP11-624C23.1_ENST00000519689.1_RNA	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	380	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		ATCAGTATCTGAGGTGAGACC	0.378																																					Ovarian(147;687 1849 3699 25981 31337)	dbGAP											0													129.0	106.0	114.0					8																	24257811		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.1140G>A	8.37:g.24257811G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZAK5	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.L380	ENST00000256412.4	37	c.1140	CCDS6044.1	8																																																																																			ADAMDEC1	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000134028		0.378	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMDEC1	HGNC	protein_coding	OTTHUMT00000215149.2	174	0.00	0	G	NM_014479		24257811	24257811	+1	no_errors	ENST00000256412	ensembl	human	known	69_37n	silent	109	39.89	73	SNP	1.000	A
ADRA1A	148	genome.wustl.edu	37	8	26721870	26721870	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr8:26721870C>T	ENST00000519229.1	-	1	623	c.617G>A	c.(616-618)cGc>cAc	p.R206H	ADRA1A_ENST00000276393.4_Missense_Mutation_p.R206H|ADRA1A_ENST00000380587.1_Missense_Mutation_p.R206H|ADRA1A_ENST00000380572.3_Missense_Mutation_p.R206H|ADRA1A_ENST00000380586.1_Missense_Mutation_p.R206H|ADRA1A_ENST00000380582.3_Missense_Mutation_p.R206H|ADRA1A_ENST00000358857.5_Missense_Mutation_p.R206H|ADRA1A_ENST00000354550.4_Missense_Mutation_p.R206H|ADRA1A_ENST00000380573.3_Missense_Mutation_p.R206H|ADRA1A_ENST00000380581.2_Missense_Mutation_p.R206H			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	276					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CACGTAGACGCGGCAGTACAT	0.612																																						dbGAP											0													30.0	29.0	29.0					8																	26721870		2203	4300	6503	-	-	-	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.617G>A	8.37:g.26721870C>T	ENSP00000430793:p.Arg206His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPY0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adrene_rcpt_A1Cs,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.R206H	ENST00000519229.1	37	c.617		8	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898578	0.91962	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.36	5.36	0.76844	GPCR, rhodopsin-like superfamily (1);	0.059436	0.64402	D	0.000002	T	0.67776	0.2929	M	0.79343	2.45	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.996;0.993;0.998;0.997;0.999;0.999	T	0.71272	-0.4642	10	0.87932	D	0	.	19.053	0.93053	0.0:1.0:0.0:0.0	.	206;206;206;206;206;206	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	H	206	ENSP00000369960:R206H;ENSP00000369961:R206H;ENSP00000369956:R206H;ENSP00000369955:R206H;ENSP00000430793:R206H;ENSP00000346557:R206H;ENSP00000276393:R206H;ENSP00000369947:R206H;ENSP00000369946:R206H;ENSP00000351725:R206H	ENSP00000276393:R206H	R	-	2	0	ADRA1A	26777787	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.776000	0.85560	2.649000	0.89929	0.563000	0.77884	CGC	ADRA1A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	ENSG00000120907		0.612	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	63	0.00	0	C	NM_033303		26721870	26721870	-1	no_errors	ENST00000380586	ensembl	human	known	69_37n	missense	47	38.16	29	SNP	1.000	T
AK9	221264	genome.wustl.edu	37	6	109850252	109850252	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:109850252C>T	ENST00000424296.2	-	29	3671	c.3595G>A	c.(3595-3597)Gct>Act	p.A1199T	AK9_ENST00000355283.1_Missense_Mutation_p.A278T|AK9_ENST00000341338.6_Missense_Mutation_p.A278T	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1199	Adenylate kinase 2.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										ATAAGTTCAGCCCTTCTTTTA	0.338																																						dbGAP											0													90.0	88.0	88.0					6																	109850252		2201	4300	6501	-	-	-	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3595G>A	6.37:g.109850252C>T	ENSP00000410186:p.Ala1199Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.A1199T	ENST00000424296.2	37	c.3595	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063723	0.76187	.	.	ENSG00000155085	ENST00000424296;ENST00000355283;ENST00000341338	T;T;T	0.66099	-0.19;-0.11;-0.19	3.99	3.99	0.46301	ATPase, AAA+ type, core (1);	0.187051	0.45126	D	0.000399	T	0.59224	0.2178	L	0.31926	0.97	0.33788	D	0.625101	P;D	0.89917	0.936;1.0	P;D	0.77557	0.512;0.99	T	0.59994	-0.7349	9	.	.	.	.	14.4809	0.67582	0.0:1.0:0.0:0.0	.	278;1199	Q5TCS8-5;Q5TCS8	.;AKD1_HUMAN	T	1199;278;278	ENSP00000410186:A1199T;ENSP00000347431:A278T;ENSP00000344637:A278T	.	A	-	1	0	AKD1	109956945	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	2.685000	0.46959	2.069000	0.61940	0.655000	0.94253	GCT	AKD1	-	smart_AAA+_ATPase	ENSG00000155085		0.338	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		349	0.00	0	C	NM_001145128		109850252	109850252	-1	no_errors	ENST00000424296	ensembl	human	known	69_37n	missense	283	23.10	85	SNP	1.000	T
AMBRA1	55626	genome.wustl.edu	37	11	46419289	46419289	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr11:46419289G>T	ENST00000458649.2	-	18	4026	c.3608C>A	c.(3607-3609)aCc>aAc	p.T1203N	AMBRA1_ENST00000314845.3_Missense_Mutation_p.T1113N|AMBRA1_ENST00000298834.3_Missense_Mutation_p.T1143N|AMBRA1_ENST00000528950.1_Missense_Mutation_p.T1174N|AMBRA1_ENST00000534300.1_Missense_Mutation_p.T1143N|AMBRA1_ENST00000426438.1_Missense_Mutation_p.T1174N|AMBRA1_ENST00000533727.1_Missense_Mutation_p.T1084N			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1203					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GGGTGAGGAGGTGTGGGCGGC	0.667																																						dbGAP											0													84.0	69.0	74.0					11																	46419289		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3608C>A	11.37:g.46419289G>T	ENSP00000415327:p.Thr1203Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T1203N	ENST00000458649.2	37	c.3608		11	.	.	.	.	.	.	.	.	.	.	G	3.284	-0.146326	0.06627	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.70631	-0.34;-0.5;-0.09;-0.22;-0.09;-0.2;-0.22	5.16	4.22	0.49857	.	0.518086	0.19939	N	0.102682	T	0.53642	0.1809	N	0.08118	0	0.09310	N	1	B;B;P;B;B;B	0.37955	0.012;0.009;0.612;0.009;0.145;0.009	B;B;B;B;B;B	0.37451	0.007;0.022;0.25;0.022;0.054;0.022	T	0.56050	-0.8043	10	0.51188	T	0.08	.	16.8479	0.85986	0.0:0.1874:0.8126:0.0	.	1203;1174;1143;1084;1206;1113	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	N	1113;1084;1143;1174;1143;1203;161;1174	ENSP00000318313:T1113N;ENSP00000433372:T1084N;ENSP00000431926:T1143N;ENSP00000410899:T1174N;ENSP00000298834:T1143N;ENSP00000415327:T1203N;ENSP00000433945:T1174N	ENSP00000298834:T1143N	T	-	2	0	AMBRA1	46375865	0.439000	0.25610	0.190000	0.23270	0.089000	0.18198	1.495000	0.35627	2.679000	0.91253	0.655000	0.94253	ACC	AMBRA1	-	NULL	ENSG00000110497		0.667	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	206	0.00	0	G	NM_017749		46419289	46419289	-1	no_errors	ENST00000458649	ensembl	human	known	69_37n	missense	119	49.79	119	SNP	0.001	T
ARHGAP22	58504	genome.wustl.edu	37	10	49701493	49701493	+	Intron	SNP	C	C	T	rs182668382		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr10:49701493C>T	ENST00000249601.4	-	4	619				ARHGAP22_ENST00000374172.1_Intron|ARHGAP22_ENST00000374170.1_Intron|ARHGAP22_ENST00000435790.2_Intron|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.R14H|ARHGAP22_ENST00000417912.2_Intron	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCTGGGCATACGCCTGCTCCT	0.612													C|||	0	0.0	0.0	0.0	5008	,	,		21038	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.323-13686G>A	10.37:g.49701493C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R14H	ENST00000249601.4	37	c.41	CCDS7227.1	10	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	2.877	-0.232579	0.05983	.	.	ENSG00000128805	ENST00000417247	T	0.14391	2.51	3.21	-5.29	0.02747	.	.	.	.	.	T	0.08179	0.0204	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32613	-0.9900	8	0.44086	T	0.13	.	6.2376	0.20772	0.1445:0.2225:0.0:0.633	.	14	Q7Z5H3-3	.	H	14	ENSP00000410054:R14H	ENSP00000410054:R14H	R	-	2	0	ARHGAP22	49371499	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.183000	0.00568	-1.437000	0.01967	-0.312000	0.09012	CGT	ARHGAP22	-	pfscan_Pleckstrin_homology	ENSG00000128805		0.612	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGAP22	HGNC	protein_coding	OTTHUMT00000358767.1	15	0.00	0	C	NM_021226		49701493	49701493	-1	no_errors	ENST00000417247	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.000	T
ASXL2	55252	genome.wustl.edu	37	2	25994378	25994378	+	Silent	SNP	T	T	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:25994378T>C	ENST00000435504.4	-	6	728	c.435A>G	c.(433-435)ccA>ccG	p.P145P	ASXL2_ENST00000404843.1_5'UTR|ASXL2_ENST00000497092.1_5'UTR|ASXL2_ENST00000336112.4_Silent_p.P117P|ASXL2_ENST00000272341.4_5'UTR			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	145	Ser-rich.				adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGTGGGTGATGGGCAGCCTG	0.438																																						dbGAP											0													174.0	170.0	172.0					2																	25994378		2027	4184	6211	-	-	-	SO:0001819	synonymous_variant	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.435A>G	2.37:g.25994378T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Silent	SNP	superfamily_Znf_FYVE_PHD	p.P145	ENST00000435504.4	37	c.435		2																																																																																			ASXL2	-	NULL	ENSG00000143970		0.438	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	532	0.00	0	T	NM_018263		25994378	25994378	-1	no_errors	ENST00000435504	ensembl	human	known	69_37n	silent	244	51.00	254	SNP	0.816	C
ASXL3	80816	genome.wustl.edu	37	18	31314340	31314340	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr18:31314340C>T	ENST00000269197.5	+	10	1043	c.1043C>T	c.(1042-1044)cCt>cTt	p.P348L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AAAACAGAACCTTGGAAAGAA	0.318																																						dbGAP											0													54.0	54.0	54.0					18																	31314340		1794	4061	5855	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1043C>T	18.37:g.31314340C>T	ENSP00000269197:p.Pro348Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.P348L	ENST00000269197.5	37	c.1043	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633870	0.47049	.	.	ENSG00000141431	ENST00000269197	T	0.16743	2.32	5.71	5.71	0.89125	.	0.081250	0.52532	D	0.000062	T	0.10465	0.0256	N	0.05330	-0.07	0.49299	D	0.999772	B	0.25809	0.135	B	0.30029	0.11	T	0.28138	-1.0053	10	0.31617	T	0.26	.	13.1041	0.59237	0.0:0.9269:0.0:0.0731	.	348	Q9C0F0	ASXL3_HUMAN	L	348	ENSP00000269197:P348L	ENSP00000269197:P348L	P	+	2	0	ASXL3	29568338	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.874000	0.39568	2.699000	0.92147	0.460000	0.39030	CCT	ASXL3	-	NULL	ENSG00000141431		0.318	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	172	0.00	0	C			31314340	31314340	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	117	34.27	61	SNP	1.000	T
BANP	54971	genome.wustl.edu	37	16	88098920	88098920	+	Silent	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr16:88098920C>T	ENST00000393207.1	+	12	1547	c.1326C>T	c.(1324-1326)ttC>ttT	p.F442F	BANP_ENST00000355163.5_Silent_p.F420F|BANP_ENST00000393208.2_Silent_p.F414F|BANP_ENST00000538234.1_Intron|BANP_ENST00000479780.2_Intron|BANP_ENST00000286122.7_Silent_p.F442F|BANP_ENST00000355022.4_Intron	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	442					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		catccgtcttcaaagccagca	0.572																																						dbGAP											0													34.0	38.0	37.0					16																	88098920		1904	4126	6030	-	-	-	SO:0001819	synonymous_variant	0			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.1326C>T	16.37:g.88098920C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Silent	SNP	pfam_BEN_domain	p.F442	ENST00000393207.1	37	c.1326	CCDS54054.1	16																																																																																			BANP	-	NULL	ENSG00000172530		0.572	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	86	0.00	0	C	NM_017869		88098920	88098920	+1	no_errors	ENST00000286122	ensembl	human	known	69_37n	silent	51	13.56	8	SNP	0.029	T
BCAN	63827	genome.wustl.edu	37	1	156622540	156622540	+	Missense_Mutation	SNP	G	G	T	rs150190291	byFrequency	TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:156622540G>T	ENST00000329117.5	+	8	2134	c.1798G>T	c.(1798-1800)Gcc>Tcc	p.A600S	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.A600S	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	600					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGCCACACGGGCCCCTGAGGG	0.647																																						dbGAP											0													25.0	29.0	28.0					1																	156622540		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1798G>T	1.37:g.156622540G>T	ENSP00000331210:p.Ala600Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like	p.A600S	ENST00000329117.5	37	c.1798	CCDS1149.1	1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.642016	0.29157	.	.	ENSG00000132692	ENST00000329117;ENST00000361588	T;T	0.14391	2.51;3.19	4.29	0.881	0.19166	.	0.270895	0.20565	N	0.089829	T	0.01800	0.0057	N	0.24115	0.695	0.09310	N	0.999998	B;B	0.32245	0.361;0.287	B;B	0.30495	0.075;0.116	T	0.42378	-0.9455	10	0.22109	T	0.4	-5.0541	1.0664	0.01611	0.1565:0.2266:0.3862:0.2307	.	600;600	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	S	600	ENSP00000331210:A600S;ENSP00000354925:A600S	ENSP00000331210:A600S	A	+	1	0	BCAN	154889164	0.699000	0.27786	0.691000	0.30163	0.957000	0.61999	0.778000	0.26732	0.386000	0.24997	0.455000	0.32223	GCC	BCAN	-	NULL	ENSG00000132692		0.647	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	HGNC	protein_coding	OTTHUMT00000081844.2	53	0.00	0	G	NM_021948		156622540	156622540	+1	no_errors	ENST00000329117	ensembl	human	known	69_37n	missense	76	18.28	17	SNP	0.264	T
C6orf52	347744	genome.wustl.edu	37	6	10671667	10671667	+	3'UTR	SNP	G	G	A	rs41271785	byFrequency	TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:10671667G>A	ENST00000426700.2	-	0	480				C6orf52_ENST00000259983.3_3'UTR|C6orf52_ENST00000379586.1_3'UTR|C6orf52_ENST00000467832.2_5'UTR|C6orf52_ENST00000503680.1_3'UTR|C6orf52_ENST00000460742.2_3'UTR			Q5T4I8	CF052_HUMAN	chromosome 6 open reading frame 52											endometrium(1)|prostate(1)	2						TGATAATTGCGGAGTTTAATG	0.448													G|||	47	0.00938498	0.0	0.0187	5008	,	,		19228	0.001		0.0278	False		,,,				2504	0.0051					dbGAP											0													110.0	100.0	103.0					6																	10671667		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC016820	CCDS47371.1	6p24.2	2009-09-22	2007-06-07	2007-06-07	ENSG00000137434	ENSG00000137434			20881	protein-coding gene	gene with protein product						12477932	Standard	NM_001145020		Approved		uc011dij.2	Q5T4I8	OTTHUMG00000014240	ENST00000426700.2:c.*22C>T	6.37:g.10671667G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4I7|Q96AS6	RNA	SNP	-	NULL	ENST00000426700.2	37	NULL	CCDS47371.1	6																																																																																			C6orf52	-	-	ENSG00000137434		0.448	C6orf52-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C6orf52	HGNC	protein_coding	OTTHUMT00000039825.2	192	0.00	0	G	NM_001145020		10671667	10671667	-1	no_errors	ENST00000467832	ensembl	human	known	69_37n	rna	111	45.59	93	SNP	0.000	A
C6orf132	647024	genome.wustl.edu	37	6	42074796	42074796	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:42074796C>G	ENST00000341865.4	-	4	853	c.854G>C	c.(853-855)gGg>gCg	p.G285A		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	285										breast(1)	1						CAGGGCGCTCCCCTTTGGCTC	0.617																																						dbGAP											0													13.0	17.0	16.0					6																	42074796		691	1591	2282	-	-	-	SO:0001583	missense	0				CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.854G>C	6.37:g.42074796C>G	ENSP00000341368:p.Gly285Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI05	Missense_Mutation	SNP	NULL	p.G285A	ENST00000341865.4	37	c.854	CCDS47428.1	6	.	.	.	.	.	.	.	.	.	.	C	0.171	-1.071507	0.01918	.	.	ENSG00000188112	ENST00000341865	T	0.40225	1.04	2.93	2.93	0.34026	.	.	.	.	.	T	0.11623	0.0283	N	0.14661	0.345	0.36164	D	0.848329	.	.	.	.	.	.	T	0.05241	-1.0897	7	0.09590	T	0.72	.	9.9874	0.41849	0.0:1.0:0.0:0.0	.	.	.	.	A	285	ENSP00000341368:G285A	ENSP00000341368:G285A	G	-	2	0	C6orf132	42182774	0.100000	0.21855	0.220000	0.23810	0.575000	0.36095	1.138000	0.31491	1.580000	0.49851	0.585000	0.79938	GGG	C6orf132	-	NULL	ENSG00000188112		0.617	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C6orf132	HGNC	protein_coding	OTTHUMT00000040548.2	66	0.00	0	C	NM_001164446		42074796	42074796	-1	no_errors	ENST00000341865	ensembl	human	putative	69_37n	missense	51	28.17	20	SNP	0.128	G
SUGCT	79783	genome.wustl.edu	37	7	40723677	40723677	+	Intron	SNP	G	G	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr7:40723677G>C	ENST00000335693.4	+	13	1133				C7orf10_ENST00000309930.5_Missense_Mutation_p.S378T|C7orf10_ENST00000401647.2_Intron	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN							metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						ggcttccaaagcctgctgcat	0.488																																						dbGAP											0													126.0	131.0	129.0					7																	40723677		2107	4242	6349	-	-	-	SO:0001627	intron_variant	0																														ENST00000335693.4:c.1111-65356G>C	7.37:g.40723677G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Missense_Mutation	SNP	pfam_CoA-Trfase_fam_III,superfamily_CoA-Trfase_III_dom	p.S378T	ENST00000335693.4	37	c.1133	CCDS55105.1	7	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.128022	0.00342	.	.	ENSG00000175600	ENST00000309930	T	0.42131	0.98	2.4	0.343	0.16001	.	446.762000	0.00166	U	0.000000	T	0.23370	0.0565	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.09377	0.004	T	0.10520	-1.0626	9	0.13108	T	0.6	.	4.4351	0.11547	0.3777:0.0:0.6223:0.0	.	341	Q9HAC7-2	.	T	378	ENSP00000312054:S378T	ENSP00000312054:S378T	S	+	2	0	C7orf10	40690202	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	0.220000	0.17660	0.066000	0.16515	0.643000	0.83706	AGC	C7orf10	-	superfamily_CoA-Trfase_III_dom	ENSG00000175600		0.488	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C7orf10	HGNC	protein_coding	OTTHUMT00000338388.1	353	0.00	0	G			40723677	40723677	+1	no_errors	ENST00000309930	ensembl	human	known	69_37n	missense	316	20.00	79	SNP	0.000	C
CCP110	9738	genome.wustl.edu	37	16	19556209	19556209	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr16:19556209G>C	ENST00000381396.5	+	9	2822	c.2575G>C	c.(2575-2577)Gtg>Ctg	p.V859L	CCP110_ENST00000396212.2_Missense_Mutation_p.V859L|CCP110_ENST00000396208.2_Missense_Mutation_p.V859L	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	859					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						TCAGGAAAGAGTGTTAGCTCA	0.338																																						dbGAP											0													107.0	108.0	107.0					16																	19556209		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.2575G>C	16.37:g.19556209G>C	ENSP00000370803:p.Val859Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	NULL	p.V859L	ENST00000381396.5	37	c.2575	CCDS55992.1	16	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500975	0.85176	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.17528	2.27;2.32;2.27	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.29882	0.0747	N	0.26092	0.79	0.54753	D	0.999985	D;D	0.61080	0.989;0.989	D;D	0.69654	0.942;0.965	T	0.01961	-1.1239	10	0.30078	T	0.28	-13.4471	19.364	0.94454	0.0:0.0:1.0:0.0	.	859;859	O43303;O43303-2	CP110_HUMAN;.	L	859	ENSP00000379515:V859L;ENSP00000370803:V859L;ENSP00000379511:V859L	ENSP00000370803:V859L	V	+	1	0	CCP110	19463710	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.578000	0.82498	2.547000	0.85894	0.655000	0.94253	GTG	CCP110	-	NULL	ENSG00000103540		0.338	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCP110	HGNC	protein_coding	OTTHUMT00000254284.2	288	0.00	0	G	NM_014711		19556209	19556209	+1	no_errors	ENST00000381396	ensembl	human	known	69_37n	missense	167	32.93	82	SNP	1.000	C
CDH6	1004	genome.wustl.edu	37	5	31267600	31267600	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr5:31267600T>G	ENST00000265071.2	+	2	285	c.20T>G	c.(19-21)tTc>tGc	p.F7C	RP11-152K4.2_ENST00000523584.1_RNA|CDH6_ENST00000514738.1_5'UTR	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	7					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TACCGCTACTTCTTGCTGCTC	0.537																																						dbGAP											0													93.0	85.0	87.0					5																	31267600		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.20T>G	5.37:g.31267600T>G	ENSP00000265071:p.Phe7Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5H5|Q9BWS0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F7C	ENST00000265071.2	37	c.20	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	T	19.76	3.887126	0.72410	.	.	ENSG00000113361	ENST00000265071	T	0.57907	0.37	5.73	5.73	0.89815	.	0.107611	0.64402	D	0.000004	T	0.52917	0.1764	N	0.24115	0.695	0.43047	D	0.994642	P;D	0.54397	0.938;0.966	B;P	0.53062	0.428;0.717	T	0.59402	-0.7461	10	0.87932	D	0	.	16.026	0.80545	0.0:0.0:0.0:1.0	.	7;7	P55285;P55285-2	CADH6_HUMAN;.	C	7	ENSP00000265071:F7C	ENSP00000265071:F7C	F	+	2	0	CDH6	31303357	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.065000	0.57513	2.191000	0.70037	0.533000	0.62120	TTC	CDH6	-	NULL	ENSG00000113361		0.537	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	82	0.00	0	T	NM_004932		31267600	31267600	+1	no_errors	ENST00000265071	ensembl	human	known	69_37n	missense	30	48.28	28	SNP	1.000	G
CFHR1	3078	genome.wustl.edu	37	1	196800996	196800996	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:196800996A>G	ENST00000320493.5	+	6	948	c.860A>G	c.(859-861)aAg>aGg	p.K287R	CFHR2_ENST00000367421.3_Intron|CFHR1_ENST00000367424.4_Missense_Mutation_p.K228R	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	287	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						GCCAAACAGAAGCTTTATTTG	0.368																																						dbGAP											0													121.0	143.0	136.0					1																	196800996		1891	4135	6026	-	-	-	SO:0001583	missense	0			M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.860A>G	1.37:g.196800996A>G	ENSP00000314299:p.Lys287Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K465|Q3B774|Q9UJ17	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.K287R	ENST00000320493.5	37	c.860	CCDS1386.1	1	.	.	.	.	.	.	.	.	.	.	.	10.42	1.345346	0.24426	.	.	ENSG00000244414	ENST00000367424;ENST00000320493	D;D	0.84442	-1.85;-1.85	2.77	1.63	0.23807	Complement control module (1);Sushi/SCR/CCP (3);	.	.	.	.	D	0.87014	0.6072	L	0.48174	1.505	0.09310	N	0.999999	D;D	0.71674	0.998;0.981	D;P	0.83275	0.996;0.894	T	0.74097	-0.3775	9	0.51188	T	0.08	.	4.668	0.12675	0.8452:0.0:0.1548:0.0	.	287;1188	Q03591;A8K5T0	FHR1_HUMAN;.	R	228;287	ENSP00000356394:K228R;ENSP00000314299:K287R	ENSP00000314299:K287R	K	+	2	0	CFHR1	195067619	0.145000	0.22656	0.002000	0.10522	0.000000	0.00434	1.179000	0.31993	0.463000	0.27118	-0.472000	0.04984	AAG	CFHR1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP	ENSG00000244414		0.368	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR1	HGNC	protein_coding	OTTHUMT00000088251.2	580	0.00	0	A	NM_002113		196800996	196800996	+1	no_errors	ENST00000320493	ensembl	human	known	69_37n	missense	306	51.27	322	SNP	0.003	G
CLDN23	137075	genome.wustl.edu	37	8	8560424	8560424	+	Silent	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr8:8560424G>T	ENST00000519106.1	+	1	977	c.516G>T	c.(514-516)ctG>ctT	p.L172L		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	172					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		TCCTGCTGCTGGGCGGCTTCT	0.746																																						dbGAP											0													8.0	9.0	9.0					8																	8560424		2112	4176	6288	-	-	-	SO:0001819	synonymous_variant	0			AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.516G>T	8.37:g.8560424G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AJ3	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.L172	ENST00000519106.1	37	c.516	CCDS55195.1	8																																																																																			CLDN23	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000253958		0.746	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN23	HGNC	protein_coding	OTTHUMT00000374721.1	11	0.00	0	G	NM_194284		8560424	8560424	+1	no_errors	ENST00000519106	ensembl	human	known	69_37n	silent	5	58.33	7	SNP	1.000	T
CNOT10	25904	genome.wustl.edu	37	3	32754743	32754744	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr3:32754743_32754744insT	ENST00000328834.5	+	5	771_772	c.455_456insT	c.(454-459)tgttttfs	p.CF152fs	CNOT10_ENST00000538368.1_Intron|CNOT10_ENST00000331889.6_Frame_Shift_Ins_p.CF152fs|CNOT10_ENST00000454516.2_Frame_Shift_Ins_p.CF212fs	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	152					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						CAAGCAGTGTGTTTTTTGCTTG	0.361																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.461dupT	3.37:g.32754749_32754749dupT	ENSP00000330060:p.Cys152fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Frame_Shift_Ins	INS	pfam_TPR-1,smart_TPR_repeat	p.L214fs	ENST00000328834.5	37	c.635_636	CCDS2655.1	3																																																																																			CNOT10	-	NULL	ENSG00000182973		0.361	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT10	HGNC	protein_coding	OTTHUMT00000253248.2	375	0.00	0	-	NM_015442		32754743	32754744	+1	no_errors	ENST00000454516	ensembl	human	known	69_37n	frame_shift_ins	111	75.00	333	INS	1.000:1.000	T
CNTN6	27255	genome.wustl.edu	37	3	1320096	1320096	+	Splice_Site	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr3:1320096G>T	ENST00000446702.2	+	5	985		c.e5-1		CNTN6_ENST00000350110.2_Splice_Site|CNTN6_ENST00000539053.1_Splice_Site			Q9UQ52	CNTN6_HUMAN	contactin 6						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TGTTTTCCAAGATATTGAAGA	0.338																																						dbGAP											0													67.0	69.0	69.0					3																	1320096		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.359-1G>T	3.37:g.1320096G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM2	Splice_Site	SNP	-	e4-1	ENST00000446702.2	37	c.359-1	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176718	0.78564	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5697	0.76323	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTN6	1295096	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.117000	0.89575	2.476000	0.83614	0.650000	0.86243	.	CNTN6	-	-	ENSG00000134115		0.338	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	155	0.00	0	G	NM_014461	Intron	1320096	1320096	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	splice_site	69	44.35	55	SNP	1.000	T
COL6A5	256076	genome.wustl.edu	37	3	130187808	130187808	+	Silent	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr3:130187808C>T	ENST00000432398.2	+	38	7454	c.6960C>T	c.(6958-6960)taC>taT	p.Y2320Y	COL6A5_ENST00000265379.6_Silent_p.Y2320Y	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2320	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TGCTTGATTACTTTCACATTG	0.448																																						dbGAP											0													83.0	82.0	82.0					3																	130187808		2043	4175	6218	-	-	-	SO:0001819	synonymous_variant	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6960C>T	3.37:g.130187808C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.L572F	ENST00000432398.2	37	c.1714		3	.	.	.	.	.	.	.	.	.	.	C	0.417	-0.910109	0.02434	.	.	ENSG00000172752	ENST00000512836	.	.	.	5.34	2.57	0.30868	.	.	.	.	.	T	0.56016	0.1957	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48927	-0.8991	4	.	.	.	.	7.8835	0.29635	0.0:0.7366:0.0:0.2634	.	.	.	.	F	572	.	.	L	+	1	0	COL6A5	131670498	0.951000	0.32395	0.988000	0.46212	0.265000	0.26407	-0.140000	0.10342	0.634000	0.30469	0.650000	0.86243	CTT	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.448	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		285	0.35	1	C	NM_153264		130187808	130187808	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000512836	ensembl	human	putative	69_37n	missense	50	70.93	122	SNP	0.999	T
CXorf23	256643	genome.wustl.edu	37	X	19971133	19971133	+	Silent	SNP	T	T	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chrX:19971133T>C	ENST00000379682.4	-	6	1635	c.1602A>G	c.(1600-1602)aaA>aaG	p.K534K	CXorf23_ENST00000379687.3_Silent_p.K534K|CXorf23_ENST00000356980.3_Silent_p.K534K			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	534						mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						TCACAGCTTGTTTACTCTGAA	0.343																																						dbGAP											0													75.0	72.0	73.0					X																	19971133		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.1602A>G	X.37:g.19971133T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Missense_Mutation	SNP	NULL	p.T143A	ENST00000379682.4	37	c.427		X	.	.	.	.	.	.	.	.	.	.	T	3.093	-0.186495	0.06340	.	.	ENSG00000173681	ENST00000340625	.	.	.	5.71	1.87	0.25490	.	.	.	.	.	T	0.51550	0.1681	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37686	-0.9695	4	.	.	.	.	4.8455	0.13512	0.1391:0.1416:0.0:0.7193	.	.	.	.	A	143	.	.	T	-	1	0	CXorf23	19881054	0.999000	0.42202	0.974000	0.42286	0.551000	0.35334	0.834000	0.27518	0.297000	0.22615	0.486000	0.48141	ACA	CXorf23	-	NULL	ENSG00000173681		0.343	CXorf23-006	NOVEL	basic	protein_coding	CXorf23	HGNC	protein_coding	OTTHUMT00000055991.2	237	0.00	0	T	NM_198279		19971133	19971133	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000340625	ensembl	human	known	69_37n	missense	176	40.14	118	SNP	0.999	C
CYP4F11	57834	genome.wustl.edu	37	19	16038292	16038292	+	Splice_Site	SNP	A	A	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:16038292A>T	ENST00000402119.4	-	3	771	c.345T>A	c.(343-345)gcT>gcA	p.A115A	CYP4F11_ENST00000248041.8_Splice_Site_p.A115A|CYP4F11_ENST00000326742.8_Splice_Site_p.A115A|CYP4F11_ENST00000591841.1_5'UTR	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GTGCGACAGCAGCTGACATGA	0.532																																						dbGAP											0													139.0	135.0	136.0					19																	16038292		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.344-1T>A	19.37:g.16038292A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.A115	ENST00000402119.4	37	c.345	CCDS12337.1	19																																																																																			CYP4F11	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000171903		0.532	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	151	0.00	0	A	NM_021187	Silent	16038292	16038292	-1	no_errors	ENST00000248041	ensembl	human	known	69_37n	silent	89	46.78	80	SNP	0.613	T
DKKL1	27120	genome.wustl.edu	37	19	49869131	49869131	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:49869131G>T	ENST00000221498.2	+	4	811	c.406G>T	c.(406-408)Ggt>Tgt	p.G136C	DKKL1_ENST00000594268.1_Intron|AC010524.2_ENST00000599433.1_RNA	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	136					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		GAGCTTCGAGGGTGATTTGAA	0.507																																						dbGAP											0													98.0	91.0	94.0					19																	49869131		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.406G>T	19.37:g.49869131G>T	ENSP00000221498:p.Gly136Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G136C	ENST00000221498.2	37	c.406	CCDS12762.1	19	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632749	0.47049	.	.	ENSG00000104901	ENST00000221498	T	0.14266	2.52	4.5	1.18	0.20946	.	1.118380	0.06731	N	0.776600	T	0.23688	0.0573	L	0.51422	1.61	0.09310	N	1	D	0.59767	0.986	P	0.55999	0.789	T	0.19386	-1.0307	10	0.87932	D	0	0.0325	6.5317	0.22330	0.3059:0.0:0.6941:0.0	.	136	Q9UK85	DKKL1_HUMAN	C	136	ENSP00000221498:G136C	ENSP00000221498:G136C	G	+	1	0	DKKL1	54560943	0.004000	0.15560	0.041000	0.18516	0.035000	0.12851	0.687000	0.25407	0.261000	0.21753	0.561000	0.74099	GGT	DKKL1	-	NULL	ENSG00000104901		0.507	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKKL1	HGNC	protein_coding	OTTHUMT00000465454.2	206	0.00	0	G	NM_014419		49869131	49869131	+1	no_errors	ENST00000221498	ensembl	human	known	69_37n	missense	137	36.57	79	SNP	0.031	T
PGS1	9489	genome.wustl.edu	37	17	76423090	76423090	+	IGR	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr17:76423090C>A	ENST00000262764.6	+	0	2201				DNAH17_ENST00000389840.5_Missense_Mutation_p.V4253F|DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000585328.1_Missense_Mutation_p.V4225F	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			TGAAAGGCGACTACCACGTAG	0.532																																					Esophageal Squamous(45;182 1126 10685 43198)	dbGAP											0													66.0	50.0	55.0					17																	76423090		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8			17.37:g.76423090C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.V4253F	ENST00000262764.6	37	c.12757	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030343	0.93575	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.10960	2.82	4.99	4.99	0.66335	.	0.000000	0.49305	D	0.000155	T	0.38161	0.1030	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.28618	-1.0038	10	0.49607	T	0.09	.	18.2745	0.90078	0.0:1.0:0.0:0.0	.	4225	E7EUM8	.	F	4225;4253	ENSP00000374490:V4253F	ENSP00000300671:V4225F	V	-	1	0	DNAH17	73934685	1.000000	0.71417	0.791000	0.31998	0.950000	0.60333	7.718000	0.84743	2.319000	0.78375	0.655000	0.94253	GTC	DNAH17	-	pfam_Dynein_heavy	ENSG00000187775		0.532	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000437301.1	126	0.00	0	C	NM_024419		76423090	76423090	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	84	26.32	30	SNP	1.000	A
DPCR1	135656	genome.wustl.edu	37	6	30919364	30919364	+	Silent	SNP	T	T	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:30919364T>C	ENST00000462446.1	+	2	3151	c.3123T>C	c.(3121-3123)ccT>ccC	p.P1041P	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	0						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CAGCAAAGCCTACAGAACACG	0.493																																						dbGAP											0													193.0	170.0	177.0					6																	30919364		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3123T>C	6.37:g.30919364T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZC0|Q658M7|Q8WYN2	Silent	SNP	NULL	p.P1041	ENST00000462446.1	37	c.3123	CCDS4692.2	6																																																																																			DPCR1	-	NULL	ENSG00000168631		0.493	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	HGNC	protein_coding	OTTHUMT00000076173.3	675	0.00	0	T	NM_080870		30919364	30919364	+1	no_errors	ENST00000462446	ensembl	human	novel	69_37n	silent	632	14.09	104	SNP	0.001	C
ENAH	55740	genome.wustl.edu	37	1	225742665	225742665	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:225742665T>C	ENST00000366844.3	-	3	743	c.292A>G	c.(292-294)Aat>Gat	p.N98D	ENAH_ENST00000284563.6_Missense_Mutation_p.N98D|ENAH_ENST00000391874.2_5'UTR|ENAH_ENST00000366843.2_Missense_Mutation_p.N98D	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	98	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)			NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		GCGAAGACATTGGCATCCTCT	0.438																																						dbGAP											0													194.0	162.0	173.0					1																	225742665		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.292A>G	1.37:g.225742665T>C	ENSP00000355809:p.Asn98Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Missense_Mutation	SNP	pfam_EVH1,pfam_VASP_tetra,smart_EVH1,pfscan_EVH1	p.N98D	ENST00000366844.3	37	c.292	CCDS31041.1	1	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508065	0.64410	.	.	ENSG00000154380	ENST00000366844;ENST00000366843;ENST00000284563;ENST00000538194	D;D;D	0.98550	-4.99;-4.99;-4.99	5.4	5.4	0.78164	EVH1 (3);Pleckstrin homology-type (1);Ran binding protein 1 (1);	0.045584	0.85682	D	0.000000	D	0.95526	0.8546	N	0.00972	-1.085	0.80722	D	1	D;D	0.64830	0.993;0.994	P;D	0.65443	0.893;0.935	D	0.96028	0.9014	10	0.29301	T	0.29	-14.2493	15.7312	0.77807	0.0:0.0:0.0:1.0	.	98;98	Q8N8S7-2;Q8N8S7	.;ENAH_HUMAN	D	98;98;98;97	ENSP00000355809:N98D;ENSP00000355808:N98D;ENSP00000284563:N98D	ENSP00000284563:N98D	N	-	1	0	ENAH	223809288	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.993000	0.88291	2.165000	0.68154	0.533000	0.62120	AAT	ENAH	-	pfam_EVH1,smart_EVH1,pfscan_EVH1	ENSG00000154380		0.438	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENAH	HGNC	protein_coding	OTTHUMT00000357426.2	294	0.00	0	T	NM_018212		225742665	225742665	-1	no_errors	ENST00000366844	ensembl	human	known	69_37n	missense	188	43.88	147	SNP	1.000	C
FAM193B	54540	genome.wustl.edu	37	5	176964948	176964948	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr5:176964948delG	ENST00000514747.1	-	3	662	c.614delC	c.(613-615)tcgfs	p.S205fs	FAM193B_ENST00000508298.1_Intron|FAM193B_ENST00000329540.5_5'UTR|FAM193B_ENST00000443375.2_Frame_Shift_Del_p.S92fs	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	205	Ser-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						CCAGAGGCCCGAGAGCTTATG	0.607																																						dbGAP											0													29.0	32.0	31.0					5																	176964948		2016	4168	6184	-	-	-	SO:0001589	frameshift_variant	0				CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.614delC	5.37:g.176964948delG	ENSP00000422131:p.Ser205fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PET5|Q9NW00	Frame_Shift_Del	DEL	NULL	p.S92fs	ENST00000514747.1	37	c.275	CCDS54954.1	5																																																																																			FAM193B	-	NULL	ENSG00000146067		0.607	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM193B	HGNC	protein_coding	OTTHUMT00000373121.1	154	0.00	0	G	NM_019057		176964948	176964948	-1	no_errors	ENST00000443375	ensembl	human	known	69_37n	frame_shift_del	31	59.18	58	DEL	1.000	-
FAM207A	85395	genome.wustl.edu	37	21	46380034	46380034	+	Silent	SNP	T	T	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr21:46380034T>C	ENST00000291634.6	+	3	351	c.303T>C	c.(301-303)gtT>gtC	p.V101V	FAM207A_ENST00000397826.3_Silent_p.V86V|FAM207A_ENST00000479127.1_3'UTR	NM_058190.2	NP_478070.1	Q9NSI2	F207A_HUMAN	family with sequence similarity 207, member A	101																	CCAAGACCGTTTTGCCCAAGA	0.582																																						dbGAP											0													120.0	95.0	103.0					21																	46380034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13718.1	21q22.3	2011-08-15	2011-08-15	2011-08-15	ENSG00000160256	ENSG00000160256			15811	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 70"""	C21orf70			Standard	NM_058190		Approved	PRED56	uc002zgl.3	Q9NSI2	OTTHUMG00000090293	ENST00000291634.6:c.303T>C	21.37:g.46380034T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.V101	ENST00000291634.6	37	c.303	CCDS13718.1	21																																																																																			FAM207A	-	NULL	ENSG00000160256		0.582	FAM207A-002	KNOWN	basic|CCDS	protein_coding	FAM207A	HGNC	protein_coding	OTTHUMT00000206639.1	177	0.00	0	T	NM_058190		46380034	46380034	+1	no_errors	ENST00000291634	ensembl	human	known	69_37n	silent	158	22.17	45	SNP	0.001	C
FAM210A	125228	genome.wustl.edu	37	18	13681832	13681832	+	Missense_Mutation	SNP	C	C	G	rs116967198		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr18:13681832C>G	ENST00000322247.3	-	3	632	c.245G>C	c.(244-246)cGc>cCc	p.R82P	FAM210A_ENST00000402563.1_Missense_Mutation_p.R82P|FAM210A_ENST00000588475.1_5'UTR	NM_001098801.1	NP_001092271.1	Q96ND0	F210A_HUMAN	family with sequence similarity 210, member A	82			R -> H (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.			integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R82H(2)									TTGCTTATGGCGAAGGACTCC	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											189.0	188.0	188.0					18																	13681832		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055618	CCDS11866.1	18p11.21	2011-11-24	2011-11-24	2011-11-24	ENSG00000177150	ENSG00000177150			28346	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 19"""	C18orf19		14702039	Standard	NM_152352		Approved	MGC24180, HsT2329	uc010dli.3	Q96ND0	OTTHUMG00000131719	ENST00000322247.3:c.245G>C	18.37:g.13681832C>G	ENSP00000323635:p.Arg82Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUJ4	Missense_Mutation	SNP	pfam_DUF1279	p.R82P	ENST00000322247.3	37	c.245	CCDS11866.1	18	.	.	.	.	.	.	.	.	.	.	C	1.687	-0.504981	0.04261	.	.	ENSG00000177150	ENST00000322247;ENST00000402563	T;T	0.23348	1.91;1.91	5.13	-7.96	0.01144	.	0.757107	0.12561	N	0.458135	T	0.11922	0.0290	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14924	-1.0455	10	0.29301	T	0.29	2.5955	8.5394	0.33384	0.0:0.2722:0.2747:0.4531	.	82	Q96ND0	CR019_HUMAN	P	82	ENSP00000323635:R82P;ENSP00000386115:R82P	ENSP00000323635:R82P	R	-	2	0	C18orf19	13671832	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.056000	0.03489	-1.859000	0.01156	-0.880000	0.02959	CGC	FAM210A	-	NULL	ENSG00000177150		0.493	FAM210A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM210A	HGNC	protein_coding	OTTHUMT00000254637.1	448	0.00	0	C	NM_152352		13681832	13681832	-1	no_errors	ENST00000322247	ensembl	human	known	69_37n	missense	298	41.91	215	SNP	0.000	G
MROH2B	133558	genome.wustl.edu	37	5	41048471	41048471	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr5:41048471C>G	ENST00000399564.4	-	16	2089	c.1639G>C	c.(1639-1641)Gac>Cac	p.D547H	MROH2B_ENST00000506092.2_Missense_Mutation_p.D102H	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	547																	TTCCATAGGTCTACCAATTTT	0.468																																						dbGAP											0													146.0	138.0	140.0					5																	41048471		1891	4117	6008	-	-	-	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1639G>C	5.37:g.41048471C>G	ENSP00000382476:p.Asp547His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D547H	ENST00000399564.4	37	c.1639	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698812	0.68501	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.08546	3.08;3.08	4.87	3.93	0.45458	Armadillo-type fold (1);	0.487586	0.19185	N	0.120565	T	0.13200	0.0320	L	0.52573	1.65	0.28707	N	0.90373	P	0.40794	0.729	P	0.48166	0.569	T	0.02901	-1.1096	10	0.54805	T	0.06	.	8.1584	0.31183	0.0:0.8794:0.0:0.1206	.	547	Q7Z745	HTRB2_HUMAN	H	102;251;547	ENSP00000441504:D102H;ENSP00000382476:D547H	ENSP00000296803:D251H	D	-	1	0	HEATR7B2	41084228	0.103000	0.21917	0.933000	0.37362	0.977000	0.68977	0.688000	0.25422	1.272000	0.44329	0.655000	0.94253	GAC	HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.468	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	348	0.00	0	C	NM_173489		41048471	41048471	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	missense	146	46.55	128	SNP	0.952	G
ING1	3621	genome.wustl.edu	37	13	111371953	111371953	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr13:111371953G>T	ENST00000375774.3	+	2	1405	c.943G>T	c.(943-945)Gcc>Tcc	p.A315S	ING1_ENST00000338450.7_Missense_Mutation_p.A128S|ING1_ENST00000375775.3_Missense_Mutation_p.A103S|ING1_ENST00000333219.7_Missense_Mutation_p.A172S	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	315					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CGACGACGGCGCCTCGGGCAC	0.652																																						dbGAP											0													67.0	51.0	57.0					13																	111371953		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.943G>T	13.37:g.111371953G>T	ENSP00000364929:p.Ala315Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.A315S	ENST00000375774.3	37	c.943	CCDS9517.1	13	.	.	.	.	.	.	.	.	.	.	G	0.057	-1.233963	0.01505	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.26	1.44	0.22558	.	0.586646	0.18632	N	0.135547	T	0.16471	0.0396	N	0.08118	0	0.24552	N	0.994014	B;B;B	0.19935	0.04;0.001;0.001	B;B;B	0.14578	0.011;0.001;0.008	T	0.26052	-1.0114	10	0.09084	T	0.74	-19.3825	5.0233	0.14372	0.7134:0.0:0.152:0.1346	.	315;172;128	Q9UK53;Q5T9H0;Q9UK53-4	ING1_HUMAN;.;.	S	128;172;103;315	ENSP00000345202:A128S;ENSP00000328436:A172S;ENSP00000364930:A103S;ENSP00000364929:A315S	ENSP00000328436:A172S	A	+	1	0	ING1	110169954	0.997000	0.39634	0.168000	0.22838	0.047000	0.14425	1.555000	0.36277	0.014000	0.14944	-0.339000	0.08088	GCC	ING1	-	NULL	ENSG00000153487		0.652	ING1-004	KNOWN	basic|CCDS	protein_coding	ING1	HGNC	protein_coding	OTTHUMT00000045770.2	48	0.00	0	G	NM_005537		111371953	111371953	+1	no_errors	ENST00000375774	ensembl	human	known	69_37n	missense	10	76.74	33	SNP	0.976	T
INPP5D	3635	genome.wustl.edu	37	2	233925287	233925287	+	Silent	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:233925287C>T	ENST00000359570.5	+	1	99	c.99C>T	c.(97-99)agC>agT	p.S33S	INPP5D_ENST00000538935.1_Silent_p.S33S			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	33	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TGCGTGCCAGCGAGTCCATCT	0.637																																					NSCLC(82;1215 1426 16163 20348 41018)	dbGAP											0													42.0	48.0	46.0					2																	233925287		2092	4215	6307	-	-	-	SO:0001819	synonymous_variant	0			U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.99C>T	2.37:g.233925287C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Silent	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,prints_SH2,pfscan_SH2	p.S33	ENST00000359570.5	37	c.99		2																																																																																			INPP5D	-	pfam_SH2,smart_SH2,prints_SH2,pfscan_SH2	ENSG00000168918		0.637	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	HGNC	protein_coding		42	0.00	0	C	NM_001017915		233925287	233925287	+1	no_errors	ENST00000359570	ensembl	human	known	69_37n	silent	33	45.00	27	SNP	0.991	T
ITPR2	3709	genome.wustl.edu	37	12	26580852	26580852	+	Silent	SNP	T	T	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr12:26580852T>G	ENST00000381340.3	-	49	7355	c.6939A>C	c.(6937-6939)gcA>gcC	p.A2313A		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2313					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTACATTAGCTGCACCAAGAA	0.323																																						dbGAP											0													89.0	79.0	82.0					12																	26580852		1814	4081	5895	-	-	-	SO:0001819	synonymous_variant	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6939A>C	12.37:g.26580852T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O94773	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.A2313	ENST00000381340.3	37	c.6939	CCDS41764.1	12																																																																																			ITPR2	-	NULL	ENSG00000123104		0.323	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	198	0.00	0	T	NM_002223		26580852	26580852	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	silent	645	12.96	96	SNP	1.000	G
KCNH1	3756	genome.wustl.edu	37	1	210857058	210857058	+	Silent	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:210857058C>A	ENST00000271751.4	-	11	2562	c.2535G>T	c.(2533-2535)ggG>ggT	p.G845G	KCNH1_ENST00000367007.4_Silent_p.G818G			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	845					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CCTCACTCTTCCCGCAAGCAT	0.607																																						dbGAP											0													76.0	78.0	77.0					1																	210857058		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2535G>T	1.37:g.210857058C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ26|O76035|Q14CL3	Silent	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.G845	ENST00000271751.4	37	c.2535	CCDS1496.1	1																																																																																			KCNH1	-	NULL	ENSG00000143473		0.607	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	88	0.00	0	C	NM_002238		210857058	210857058	-1	no_errors	ENST00000271751	ensembl	human	known	69_37n	silent	78	15.96	15	SNP	0.033	A
KHSRP	8570	genome.wustl.edu	37	19	6415313	6415314	+	Splice_Site	INS	-	-	TG			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:6415313_6415314insTG	ENST00000398148.3	-	19	2059		c.e19-1		MIR3940_ENST00000579148.1_RNA|CTB-180A7.8_ENST00000398173.3_lincRNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						GCCACTTGCGCTGTGGGTGGAC	0.644																																					Colon(55;593 1006 2067 9135 22980)	dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1967-1->CA	19.37:g.6415316_6415317dupTG		Somatic		WXS	Illumina GAIIx	Phase_IV	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Splice_Site	INS	-	e19-1	ENST00000398148.3	37	c.1967-2_1967-1	CCDS45936.1	19																																																																																			KHSRP	-	-	ENSG00000088247		0.644	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHSRP	HGNC	protein_coding	OTTHUMT00000453305.1	33	0.00	0	-		Intron	6415313	6415314	-1	no_errors	ENST00000398148	ensembl	human	known	69_37n	splice_site_ins	33	31.25	15	INS	0.989:0.952	TG
KIAA1324L	222223	genome.wustl.edu	37	7	86522367	86522367	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr7:86522367G>T	ENST00000450689.2	-	20	2920	c.2735C>A	c.(2734-2736)tCt>tAt	p.S912Y	KIAA1324L_ENST00000416314.1_Missense_Mutation_p.S745Y|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.S672Y|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.S841Y	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	912						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					CTCAGGCAAAGAAATTCCTTT	0.408																																						dbGAP											0													110.0	121.0	117.0					7																	86522367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2735C>A	7.37:g.86522367G>T	ENSP00000413445:p.Ser912Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt	p.S912Y	ENST00000450689.2	37	c.2735	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.02|19.02	3.745300|3.745300	0.69418|0.69418	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	.|T;T;T;T	.|0.19806	.|2.38;2.13;2.12;2.13	6.02|6.02	5.13|5.13	0.70059|0.70059	.|.	.|0.332013	.|0.37219	.|N	.|0.002194	T|T	0.30479|0.30479	0.0766|0.0766	L|L	0.52573|0.52573	1.65|1.65	0.54753|0.54753	D|D	0.999986|0.999986	.|P;B;B	.|0.40909	.|0.732;0.402;0.402	.|P;B;B	.|0.48030	.|0.564;0.23;0.23	T|T	0.01259|0.01259	-1.1403|-1.1403	5|10	.|0.72032	.|D	.|0.01	.|.	14.6872|14.6872	0.69057|0.69057	0.0701:0.0:0.9299:0.0|0.0701:0.0:0.9299:0.0	.|.	.|912;672;745	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	L|Y	872|912;672;841;745	.|ENSP00000413445:S912Y;ENSP00000297222:S672Y;ENSP00000397377:S841Y;ENSP00000402390:S745Y	.|ENSP00000297222:S672Y	F|S	-|-	3|2	2|0	KIAA1324L|KIAA1324L	86360303|86360303	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.662000|5.662000	0.68032|0.68032	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	TTC|TCT	KIAA1324L	-	NULL	ENSG00000164659		0.408	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	160	0.00	0	G	NM_152748		86522367	86522367	-1	no_errors	ENST00000450689	ensembl	human	known	69_37n	missense	95	47.51	86	SNP	1.000	T
L1CAM	3897	genome.wustl.edu	37	X	153130155	153130155	+	Silent	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chrX:153130155G>T	ENST00000370060.1	-	24	3240	c.3051C>A	c.(3049-3051)atC>atA	p.I1017I	L1CAM_ENST00000538883.1_Silent_p.I1019I|L1CAM_ENST00000543994.1_Silent_p.I1019I|L1CAM_ENST00000361981.3_Silent_p.I1012I|L1CAM_ENST00000370055.1_Silent_p.I1012I|L1CAM_ENST00000370057.3_Silent_p.I1017I|L1CAM_ENST00000361699.4_Silent_p.I1017I	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1017	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAAAATCTGAGATCCCTGGGG	0.607																																						dbGAP											0													93.0	93.0	93.0					X																	153130155		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3051C>A	X.37:g.153130155G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I1019	ENST00000370060.1	37	c.3057	CCDS14733.1	X																																																																																			L1CAM	-	NULL	ENSG00000198910		0.607	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	132	0.00	0	G	NM_024003		153130155	153130155	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	silent	93	26.77	34	SNP	0.000	T
LRP2	4036	genome.wustl.edu	37	2	170063595	170063595	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:170063595C>A	ENST00000263816.3	-	39	6920	c.6635G>T	c.(6634-6636)aGa>aTa	p.R2212I		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2212					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AATCTTTGGTCTCTGCCCATA	0.493																																						dbGAP											0													178.0	162.0	167.0					2																	170063595		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6635G>T	2.37:g.170063595C>A	ENSP00000263816:p.Arg2212Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.R2212I	ENST00000263816.3	37	c.6635	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	9.357	1.066952	0.20067	.	.	ENSG00000081479	ENST00000263816	D	0.96651	-4.08	5.98	1.04	0.20106	Six-bladed beta-propeller, TolB-like (1);	0.443905	0.28376	N	0.015578	D	0.89491	0.6730	N	0.17764	0.52	0.58432	D	0.999999	B	0.33583	0.418	B	0.30401	0.115	T	0.81072	-0.1098	10	0.21540	T	0.41	.	9.2535	0.37568	0.0:0.3657:0.0:0.6343	.	2212	P98164	LRP2_HUMAN	I	2212	ENSP00000263816:R2212I	ENSP00000263816:R2212I	R	-	2	0	LRP2	169771841	0.982000	0.34865	0.786000	0.31890	0.731000	0.41821	0.355000	0.20163	-0.049000	0.13379	-0.312000	0.09012	AGA	LRP2	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.493	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	188	0.00	0	C	NM_004525		170063595	170063595	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	109	35.29	60	SNP	0.695	A
MDGA1	266727	genome.wustl.edu	37	6	37614094	37614094	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:37614094G>T	ENST00000434837.3	-	11	3282	c.2104C>A	c.(2104-2106)Cag>Aag	p.Q702K	MDGA1_ENST00000510077.1_5'UTR|MDGA1_ENST00000297153.7_Missense_Mutation_p.Q705K|MDGA1_ENST00000505425.1_Missense_Mutation_p.Q702K	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	702	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TCCAGCAGCTGCCCCTTCTCC	0.602																																						dbGAP											0													57.0	63.0	61.0					6																	37614094		2131	4234	6365	-	-	-	SO:0001583	missense	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2104C>A	6.37:g.37614094G>T	ENSP00000402584:p.Gln702Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHG0|Q8NBE3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like	p.Q705K	ENST00000434837.3	37	c.2113	CCDS47417.1	6	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493866	0.64186	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.53206	0.63;0.78;0.65	5.68	5.68	0.88126	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.157328	0.29995	N	0.010675	T	0.21145	0.0509	N	0.22421	0.69	0.32865	D	0.50851	B	0.25105	0.118	B	0.21360	0.034	T	0.04915	-1.0918	10	0.23302	T	0.38	.	18.7862	0.91955	0.0:0.0:1.0:0.0	.	702	Q8NFP4	MDGA1_HUMAN	K	702;705;702	ENSP00000402584:Q702K;ENSP00000297153:Q705K;ENSP00000422042:Q702K	ENSP00000297153:Q705K	Q	-	1	0	MDGA1	37722072	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.635000	0.61332	2.677000	0.91161	0.563000	0.77884	CAG	MDGA1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000112139		0.602	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	122	0.00	0	G			37614094	37614094	-1	no_errors	ENST00000297153	ensembl	human	known	69_37n	missense	99	35.06	54	SNP	1.000	T
MEF2B	100271849	genome.wustl.edu	37	19	19258546	19258546	+	Silent	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:19258546G>A	ENST00000602424.2	-	6	1080	c.354C>T	c.(352-354)ggC>ggT	p.G118G	MEF2B_ENST00000410050.1_Silent_p.G118G|MEF2BNB-MEF2B_ENST00000602276.1_5'UTR|MEF2BNB-MEF2B_ENST00000444486.3_Silent_p.G118G|MEF2B_ENST00000409224.1_Silent_p.G121G|MEF2BNB-MEF2B_ENST00000514819.3_Silent_p.G135G|MEF2B_ENST00000162023.5_Silent_p.G118G|MEF2B_ENST00000424583.2_Silent_p.G118G|MEF2B_ENST00000409447.2_Silent_p.G118G	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	118					muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			CACCCCCTTCGCCTGCCAGCC	0.622																																						dbGAP											0													64.0	65.0	65.0					19																	19258546		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.354C>T	19.37:g.19258546G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Silent	SNP	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.G118	ENST00000602424.2	37	c.354	CCDS12394.1	19																																																																																			MEF2B	-	NULL	ENSG00000213999		0.622	MEF2B-202	KNOWN	basic|CCDS	protein_coding	MEF2B	HGNC	protein_coding		83	0.00	0	G	NM_005919		19258546	19258546	-1	no_errors	ENST00000162023	ensembl	human	known	69_37n	silent	55	26.61	29	SNP	0.321	A
MRPL20	55052	genome.wustl.edu	37	1	1337585	1337585	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:1337585G>A	ENST00000344843.7	-	4	423	c.328C>T	c.(328-330)Cca>Tca	p.P110S	MRPL20_ENST00000493287.1_5'UTR|CCNL2_ENST00000400809.3_5'Flank|CCNL2_ENST00000408918.4_5'Flank	NM_017971.3	NP_060441.2	Q9BYC9	RM20_HUMAN	mitochondrial ribosomal protein L20	110					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AAAGTCTTTGGCTCGTAGATG	0.507																																						dbGAP											0													94.0	88.0	90.0					1																	1337585		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB049644	CCDS26.1	1p36.3-p36.2	2012-09-13			ENSG00000242485	ENSG00000242485		"""Mitochondrial ribosomal proteins / large subunits"""	14478	protein-coding gene	gene with protein product		611833					Standard	NM_017971		Approved	FLJ10024	uc001afo.4	Q9BYC9	OTTHUMG00000002916	ENST00000344843.7:c.328C>T	1.37:g.1337585G>A	ENSP00000341082:p.Pro110Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE41|B7Z746	Missense_Mutation	SNP	pfam_Ribosomal_L20,prints_Ribosomal_L20,tigrfam_Ribosomal_L20	p.P110S	ENST00000344843.7	37	c.328	CCDS26.1	1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339270	0.60963	.	.	ENSG00000242485	ENST00000344843	.	.	.	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.79953	0.4535	M	0.81179	2.53	0.80722	D	1	D	0.71674	0.998	D	0.75020	0.985	T	0.82999	-0.0178	9	0.62326	D	0.03	-5.9581	16.905	0.86124	0.0:0.0:1.0:0.0	.	110	Q9BYC9	RM20_HUMAN	S	110	.	ENSP00000341082:P110S	P	-	1	0	MRPL20	1327448	1.000000	0.71417	1.000000	0.80357	0.213000	0.24496	8.086000	0.89520	2.231000	0.72958	0.467000	0.42956	CCA	MRPL20	-	pfam_Ribosomal_L20,tigrfam_Ribosomal_L20	ENSG00000242485		0.507	MRPL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL20	HGNC	protein_coding	OTTHUMT00000008139.1	109	0.00	0	G	NM_017971		1337585	1337585	-1	no_errors	ENST00000344843	ensembl	human	known	69_37n	missense	206	21.59	57	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9070668	9070668	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:9070668G>T	ENST00000397910.4	-	3	16981	c.16778C>A	c.(16777-16779)aCt>aAt	p.T5593N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5595	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTTGAATGAGTCCCTCCCTG	0.522																																						dbGAP											0													149.0	138.0	142.0					19																	9070668		1983	4162	6145	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16778C>A	19.37:g.9070668G>T	ENSP00000381008:p.Thr5593Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T5593N	ENST00000397910.4	37	c.16778	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	2.428	-0.331473	0.05314	.	.	ENSG00000181143	ENST00000397910	T	0.28069	1.63	1.45	-1.18	0.09617	.	.	.	.	.	T	0.14787	0.0357	L	0.27053	0.805	.	.	.	P	0.39809	0.689	B	0.32022	0.139	T	0.15896	-1.0421	8	0.87932	D	0	.	2.4679	0.04557	0.2545:0.3179:0.4276:0.0	.	5593	B5ME49	.	N	5593	ENSP00000381008:T5593N	ENSP00000381008:T5593N	T	-	2	0	MUC16	8931668	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.089000	0.11180	-0.255000	0.09486	0.299000	0.19835	ACT	MUC16	-	NULL	ENSG00000181143		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	363	0.00	0	G	NM_024690		9070668	9070668	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	212	43.35	163	SNP	0.000	T
ACAA1	30	genome.wustl.edu	37	3	38180431	38180431	+	5'Flank	SNP	A	A	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr3:38180431A>T	ENST00000333167.8	-	0	0				ACAA1_ENST00000450296.1_5'Flank|MYD88_ENST00000396334.3_Silent_p.G93G|MYD88_ENST00000495303.1_Silent_p.G93G|MYD88_ENST00000443433.2_Silent_p.G93G|ACAA1_ENST00000301810.7_5'Flank|ACAA1_ENST00000544624.1_5'Flank|ACAA1_ENST00000444607.2_5'Flank|MYD88_ENST00000424893.1_Silent_p.G93G|MYD88_ENST00000417037.2_Silent_p.G93G	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		CCTGGCAGGGACGCCCTGGCG	0.662																																						dbGAP											0													39.0	46.0	44.0					3																	38180431		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		3.37:g.38180431A>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E935|Q96CA6	Silent	SNP	pfam_TIR_dom,pfam_Death,superfamily_DEATH-like,superfamily_TIR_dom,smart_Death,smart_TIR_dom,pirsf_Myelin_different_resp_MyD88,pfscan_Death,pfscan_TIR_dom	p.G93	ENST00000333167.8	37	c.279	CCDS2673.1	3																																																																																			MYD88	-	pfam_Death,superfamily_DEATH-like,smart_Death,pirsf_Myelin_different_resp_MyD88,pfscan_Death	ENSG00000172936		0.662	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYD88	HGNC	protein_coding	OTTHUMT00000342980.1	35	0.00	0	A	NM_001607		38180431	38180431	+1	no_errors	ENST00000417037	ensembl	human	known	69_37n	silent	14	27.27	6	SNP	0.801	T
MYH14	79784	genome.wustl.edu	37	19	50713890	50713890	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:50713890C>T	ENST00000596571.1	+	1	268	c.268C>T	c.(268-270)Cga>Tga	p.R90*	MYH14_ENST00000262269.8_Nonsense_Mutation_p.R90*|MYH14_ENST00000598205.1_Nonsense_Mutation_p.R90*|MYH14_ENST00000376970.2_Nonsense_Mutation_p.R90*|MYH14_ENST00000440075.2_Nonsense_Mutation_p.R90*|MYH14_ENST00000425460.1_Nonsense_Mutation_p.R90*|MYH14_ENST00000601313.1_Nonsense_Mutation_p.R90*			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	90					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GAGGCGGCTGCGACTGCCGCG	0.701																																						dbGAP											0													8.0	13.0	11.0					19																	50713890		2145	4219	6364	-	-	-	SO:0001587	stop_gained	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.268C>T	19.37:g.50713890C>T	ENSP00000472819:p.Arg90*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R90*	ENST00000596571.1	37	c.268	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521560	0.85600	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	.	.	.	4.38	3.34	0.38264	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	5.6338	0.17526	0.1972:0.7027:0.0:0.1	.	.	.	.	X	90	.	ENSP00000262269:R90X	R	+	1	2	MYH14	55405702	0.000000	0.05858	1.000000	0.80357	0.143000	0.21401	-0.827000	0.04424	1.190000	0.43042	-0.277000	0.10078	CGA	MYH14	-	pfam_Myosin_N	ENSG00000105357		0.701	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	22	0.00	0	C	NM_024729		50713890	50713890	+1	no_errors	ENST00000262269	ensembl	human	known	69_37n	nonsense	10	47.37	9	SNP	1.000	T
MYH7B	57644	genome.wustl.edu	37	20	33577724	33577724	+	Splice_Site	SNP	T	T	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr20:33577724T>C	ENST00000262873.7	+	18	1985		c.e18+2		MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta							membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GCAGGCGTGGTAGGTGCTTGC	0.642																																						dbGAP											0													40.0	44.0	43.0					20																	33577724		2097	4230	6327	-	-	-	SO:0001630	splice_region_variant	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1893+2T>C	20.37:g.33577724T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Splice_Site	SNP	-	e18+2	ENST00000262873.7	37	c.1893+2	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	T	17.83	3.485289	0.63962	.	.	ENSG00000078814	ENST00000262873	.	.	.	4.17	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6784	0.62469	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYH7B	33041385	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.818000	0.86416	1.881000	0.54492	0.459000	0.35465	.	MYH7B	-	-	ENSG00000078814		0.642	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	85	0.00	0	T	NM_020884	Intron	33577724	33577724	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	splice_site	57	40.00	38	SNP	1.000	C
NBAS	51594	genome.wustl.edu	37	2	15432702	15432702	+	Silent	SNP	T	T	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:15432702T>A	ENST00000281513.5	-	41	5011	c.4986A>T	c.(4984-4986)gcA>gcT	p.A1662A	NBAS_ENST00000441750.1_Silent_p.A1542A	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1662					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ACTGGTCATCTGCAGTAAACC	0.463																																						dbGAP											0													84.0	76.0	78.0					2																	15432702		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.4986A>T	2.37:g.15432702T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39	p.Q710L	ENST00000281513.5	37	c.2129	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	T	10.18	1.279759	0.23392	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.84	-11.7	0.00046	.	.	.	.	.	T	0.30479	0.0766	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43261	-0.9402	4	.	.	.	.	1.2526	0.01985	0.4042:0.2633:0.1608:0.1716	.	.	.	.	L	710	.	.	Q	-	2	0	NBAS	15350153	0.000000	0.05858	0.001000	0.08648	0.946000	0.59487	-2.972000	0.00667	-3.155000	0.00229	-0.376000	0.06991	CAG	NBAS	-	NULL	ENSG00000151779		0.463	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	186	0.00	0	T	NM_015909		15432702	15432702	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000442506	ensembl	human	novel	69_37n	missense	53	89.90	472	SNP	0.000	A
NDUFS2	4720	genome.wustl.edu	37	1	161179917	161179917	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:161179917T>G	ENST00000367993.3	+	8	1167	c.719T>G	c.(718-720)cTt>cGt	p.L240R	NDUFS2_ENST00000392179.4_Missense_Mutation_p.L240R|NDUFS2_ENST00000476409.2_Missense_Mutation_p.L142R|NDUFS2_ENST00000465923.1_3'UTR	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	240					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	CCCCTTGGGCTTATGGATGAC	0.498											OREG0013941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													119.0	113.0	115.0					1																	161179917		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.719T>G	1.37:g.161179917T>G	ENSP00000356972:p.Leu240Arg	Somatic	1814	WXS	Illumina GAIIx	Phase_IV	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Missense_Mutation	SNP	pfam_NADH_Q_OxRdtase_suD,tigrfam_NADH_DH_1_suD	p.L240R	ENST00000367993.3	37	c.719	CCDS1224.1	1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.379526	0.82682	.	.	ENSG00000158864	ENST00000367993;ENST00000392179;ENST00000476409;ENST00000546154	D;D;D	0.87179	-2.22;-2.22;-2.22	5.29	5.29	0.74685	NADH-quinone oxidoreductase, subunit D (1);	0.067662	0.64402	D	0.000019	D	0.94188	0.8135	M	0.93720	3.45	0.54753	D	0.999987	D;D;D	0.71674	0.994;0.998;0.998	D;D;D	0.73708	0.972;0.981;0.981	D	0.95614	0.8675	9	0.87932	D	0	.	14.3399	0.66619	0.0:0.0:0.0:1.0	.	189;240;240	B7Z792;Q53HG2;O75306	.;.;NDUS2_HUMAN	R	240;240;142;31	ENSP00000356972:L240R;ENSP00000376018:L240R;ENSP00000446447:L142R	ENSP00000356972:L240R	L	+	2	0	NDUFS2	159446541	1.000000	0.71417	0.937000	0.37676	0.955000	0.61496	7.218000	0.77991	2.213000	0.71641	0.533000	0.62120	CTT	NDUFS2	-	pfam_NADH_Q_OxRdtase_suD,tigrfam_NADH_DH_1_suD	ENSG00000158864		0.498	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NDUFS2	HGNC	protein_coding	OTTHUMT00000083015.1	210	0.00	0	T	NM_004550		161179917	161179917	+1	no_errors	ENST00000367993	ensembl	human	known	69_37n	missense	163	44.93	133	SNP	0.998	G
NEB	4703	genome.wustl.edu	37	2	152507244	152507244	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:152507244G>T	ENST00000172853.10	-	53	7218	c.7071C>A	c.(7069-7071)ttC>ttA	p.F2357L	NEB_ENST00000427231.2_Missense_Mutation_p.F2357L|NEB_ENST00000604864.1_Missense_Mutation_p.F2357L|NEB_ENST00000603639.1_Missense_Mutation_p.F2357L|NEB_ENST00000409198.1_Missense_Mutation_p.F2357L|NEB_ENST00000397345.3_Missense_Mutation_p.F2357L			P20929	NEBU_HUMAN	nebulin	2357					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTGGGCTGGAGAACTTAGTTT	0.458																																						dbGAP											0													286.0	288.0	287.0					2																	152507244		2015	4172	6187	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7071C>A	2.37:g.152507244G>T	ENSP00000172853:p.Phe2357Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.F2357L	ENST00000172853.10	37	c.7071		2	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469313	0.26423	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.47	3.66	0.41972	.	0.263566	0.36972	N	0.002308	T	0.39682	0.1087	M	0.83384	2.64	0.09310	N	0.999997	B	0.25809	0.135	B	0.31390	0.129	T	0.31971	-0.9924	10	0.15066	T	0.55	.	9.6586	0.39941	0.2752:0.0:0.7248:0.0	.	2357	P20929	NEBU_HUMAN	L	2357	ENSP00000386259:F2357L;ENSP00000380505:F2357L;ENSP00000416578:F2357L;ENSP00000172853:F2357L	ENSP00000172853:F2357L	F	-	3	2	NEB	152215490	0.635000	0.27199	0.175000	0.22980	0.350000	0.29205	0.449000	0.21744	1.331000	0.45412	0.650000	0.86243	TTC	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.458	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		315	0.32	1	G	NM_004543		152507244	152507244	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	171	42.03	124	SNP	0.042	T
NR0B2	8431	genome.wustl.edu	37	1	27240275	27240275	+	Missense_Mutation	SNP	G	G	C	rs540387719	byFrequency	TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:27240275G>C	ENST00000254227.3	-	1	182	c.157C>G	c.(157-159)Cat>Gat	p.H53D		NM_021969.2	NP_068804.1	Q15466	NR0B2_HUMAN	nuclear receptor subfamily 0, group B, member 2	53					cholesterol metabolic process (GO:0008203)|gene expression (GO:0010467)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(3)	5		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		CAGGTGCGATGAGGTGCACAT	0.642																																						dbGAP											0													27.0	30.0	29.0					1																	27240275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044316	CCDS291.1	1p36.1	2013-01-16			ENSG00000131910	ENSG00000131910		"""Nuclear hormone receptors"""	7961	protein-coding gene	gene with protein product		604630				9603951	Standard	NM_021969		Approved	SHP	uc001bnf.3	Q15466	OTTHUMG00000004231	ENST00000254227.3:c.157C>G	1.37:g.27240275G>C	ENSP00000254227:p.His53Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	F1D8P5|Q5QP36	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	p.H53D	ENST00000254227.3	37	c.157	CCDS291.1	1	.	.	.	.	.	.	.	.	.	.	G	9.590	1.125886	0.20959	.	.	ENSG00000131910	ENST00000254227	D	0.83837	-1.77	5.15	2.21	0.28008	Nuclear hormone receptor, ligand-binding (2);	0.591057	0.20099	N	0.099265	T	0.75613	0.3873	M	0.61703	1.905	0.09310	N	1	B	0.20164	0.042	B	0.18871	0.023	T	0.56631	-0.7947	10	0.11794	T	0.64	-22.5029	7.9257	0.29872	0.0742:0.0:0.6439:0.2819	.	53	Q15466	NR0B2_HUMAN	D	53	ENSP00000254227:H53D	ENSP00000254227:H53D	H	-	1	0	NR0B2	27112862	0.071000	0.21146	0.080000	0.20451	0.934000	0.57294	1.035000	0.30216	0.179000	0.19938	-0.254000	0.11334	CAT	NR0B2	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000131910		0.642	NR0B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR0B2	HGNC	protein_coding	OTTHUMT00000012185.1	14	0.00	0	G			27240275	27240275	-1	no_errors	ENST00000254227	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	0.000	C
NSUN3	63899	genome.wustl.edu	37	3	93845211	93845211	+	Missense_Mutation	SNP	C	C	G	rs150153749		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr3:93845211C>G	ENST00000314622.4	+	6	1111	c.900C>G	c.(898-900)caC>caG	p.H300Q		NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	300							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						CTTGCTCCCACGACTTCACAT	0.443																																						dbGAP											0													90.0	82.0	85.0					3																	93845211		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.900C>G	3.37:g.93845211C>G	ENSP00000318986:p.His300Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PG41|Q8IXG9|Q9H6M2	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.H300Q	ENST00000314622.4	37	c.900	CCDS2927.1	3	.	.	.	.	.	.	.	.	.	.	C	0.028	-1.351133	0.01256	.	.	ENSG00000178694	ENST00000314622	T	0.09445	2.98	5.9	-4.49	0.03504	.	0.852758	0.11013	N	0.609224	T	0.03053	0.0090	N	0.04043	-0.29	0.19775	N	0.999952	B	0.02656	0.0	B	0.01281	0.0	T	0.42816	-0.9429	10	0.20046	T	0.44	-0.6022	1.8832	0.03232	0.1695:0.2289:0.3723:0.2294	.	300	Q9H649	NSUN3_HUMAN	Q	300	ENSP00000318986:H300Q	ENSP00000318986:H300Q	H	+	3	2	NSUN3	95327901	0.522000	0.26266	0.528000	0.27938	0.010000	0.07245	0.043000	0.13971	-0.311000	0.08754	-0.275000	0.10095	CAC	NSUN3	-	NULL	ENSG00000178694		0.443	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN3	HGNC	protein_coding	OTTHUMT00000352934.1	161	0.00	0	C	NM_022072		93845211	93845211	+1	no_errors	ENST00000314622	ensembl	human	known	69_37n	missense	28	65.85	54	SNP	0.688	G
OPRM1	4988	genome.wustl.edu	37	6	154412347	154412347	+	Missense_Mutation	SNP	G	G	C	rs187512719		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:154412347G>C	ENST00000330432.7	+	3	1141	c.904G>C	c.(904-906)Gtc>Ctc	p.V302L	OPRM1_ENST00000435918.2_Missense_Mutation_p.V302L|OPRM1_ENST00000428397.2_Missense_Mutation_p.V302L|OPRM1_ENST00000522236.1_Missense_Mutation_p.V202L|OPRM1_ENST00000414028.2_Missense_Mutation_p.V302L|OPRM1_ENST00000452687.2_Missense_Mutation_p.V302L|OPRM1_ENST00000337049.4_Missense_Mutation_p.V302L|OPRM1_ENST00000518759.1_Missense_Mutation_p.V221L|OPRM1_ENST00000524163.1_Missense_Mutation_p.V302L|OPRM1_ENST00000419506.2_Missense_Mutation_p.V302L|OPRM1_ENST00000434900.2_Missense_Mutation_p.V395L|OPRM1_ENST00000520708.1_Missense_Mutation_p.V202L|OPRM1_ENST00000360422.4_Missense_Mutation_p.V302L|OPRM1_ENST00000522555.1_Missense_Mutation_p.V202L|OPRM1_ENST00000229768.5_Missense_Mutation_p.V302L	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	302					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TCACATTTACGTCATCATTAA	0.483																																						dbGAP											0													157.0	171.0	166.0					6																	154412347		2200	4299	6499	-	-	-	SO:0001583	missense	0			L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.904G>C	6.37:g.154412347G>C	ENSP00000328264:p.Val302Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Mu_opioid_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Somatstn_rcpt,prints_Neuropept_W_rcpt,prints_P2_purnocptor,prints_NPY_rcpt	p.V395L	ENST00000330432.7	37	c.1183	CCDS55070.1	6	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508154	0.64410	.	.	ENSG00000112038	ENST00000434900;ENST00000520708;ENST00000518759;ENST00000330432;ENST00000360422;ENST00000428397;ENST00000452687;ENST00000229768;ENST00000419506;ENST00000524163;ENST00000414028;ENST00000435918;ENST00000337049;ENST00000522555;ENST00000522236	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3	5.86	5.86	0.93980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.40956	0.1138	L	0.27944	0.81	0.54753	D	0.999988	D;D;D;D;D;P;P;D;D;P;D;D	0.76494	0.999;0.99;0.99;0.999;0.995;0.946;0.86;0.995;0.992;0.872;0.995;0.971	D;P;P;D;D;P;P;D;P;P;D;P	0.87578	0.998;0.828;0.828;0.998;0.938;0.837;0.746;0.938;0.892;0.467;0.938;0.749	T	0.10989	-1.0606	10	0.33940	T	0.23	.	20.1837	0.98210	0.0:0.0:1.0:0.0	.	302;302;302;302;395;221;202;302;302;302;302;302	P35372-4;P35372-8;P35372-11;P35372-9;P35372-10;B8Q1L9;Q6UPP1;P35372-5;P35372;P35372-7;P35372-3;P35372-2	.;.;.;.;.;.;.;.;OPRM_HUMAN;.;.;.	L	395;202;221;302;302;302;302;302;302;302;302;302;302;202;202	ENSP00000394624:V395L;ENSP00000430876:V202L;ENSP00000430260:V221L;ENSP00000328264:V302L;ENSP00000353598:V302L;ENSP00000411903:V302L;ENSP00000410497:V302L;ENSP00000229768:V302L;ENSP00000403549:V302L;ENSP00000430097:V302L;ENSP00000399359:V302L;ENSP00000413752:V302L;ENSP00000338381:V302L;ENSP00000429719:V202L;ENSP00000429373:V202L	ENSP00000229768:V302L	V	+	1	0	OPRM1	154454040	1.000000	0.71417	0.984000	0.44739	0.891000	0.51852	6.722000	0.74735	2.774000	0.95407	0.650000	0.86243	GTC	OPRM1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Neuropept_W_rcpt,prints_P2_purnocptor	ENSG00000112038		0.483	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPRM1	HGNC	protein_coding	OTTHUMT00000042786.2	335	0.00	0	G	NM_000914		154412347	154412347	+1	no_errors	ENST00000434900	ensembl	human	known	69_37n	missense	391	28.65	157	SNP	1.000	C
OR4C15	81309	genome.wustl.edu	37	11	55321983	55321983	+	Silent	SNP	G	G	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr11:55321983G>C	ENST00000314644.2	+	1	201	c.201G>C	c.(199-201)ctG>ctC	p.L67L		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TTGTCCTCCTGGGACTTTCAC	0.383										HNSCC(20;0.049)																												dbGAP											0													126.0	132.0	130.0					11																	55321983		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.201G>C	11.37:g.55321983G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFE2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L67	ENST00000314644.2	37	c.201	CCDS31501.1	11																																																																																			OR4C15	-	NULL	ENSG00000181939		0.383	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	191	0.00	0	G	NM_001001920		55321983	55321983	+1	no_errors	ENST00000314644	ensembl	human	known	69_37n	silent	113	42.71	85	SNP	0.679	C
OSBPL1A	114876	genome.wustl.edu	37	18	21745043	21745043	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr18:21745043C>G	ENST00000319481.3	-	27	2942	c.2736G>C	c.(2734-2736)gaG>gaC	p.E912D	OSBPL1A_ENST00000399443.3_Missense_Mutation_p.E399D|OSBPL1A_ENST00000357041.4_Missense_Mutation_p.E530D|RP11-799B12.4_ENST00000583267.1_lincRNA	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	912					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TCTTCCAGTCCTCTTCTGACT	0.512																																						dbGAP											0													264.0	238.0	247.0					18																	21745043		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2736G>C	18.37:g.21745043C>G	ENSP00000320291:p.Glu912Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pleckstrin_homology,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,prints_Ankyrin_rpt	p.E912D	ENST00000319481.3	37	c.2736	CCDS11884.1	18	.	.	.	.	.	.	.	.	.	.	C	12.77	2.038963	0.35989	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.31769	1.48;1.48;1.48	5.62	3.59	0.41128	.	0.049359	0.85682	D	0.000000	T	0.25791	0.0628	L	0.56199	1.76	0.80722	D	1	B	0.33171	0.4	B	0.30251	0.113	T	0.02893	-1.1097	10	0.30078	T	0.28	-24.3903	9.463	0.38796	0.0:0.6782:0.0:0.3218	.	912	Q9BXW6	OSBL1_HUMAN	D	912;399;530	ENSP00000320291:E912D;ENSP00000382372:E399D;ENSP00000349545:E530D	ENSP00000320291:E912D	E	-	3	2	OSBPL1A	19999041	0.858000	0.29795	1.000000	0.80357	0.973000	0.67179	-0.027000	0.12371	0.539000	0.28788	0.491000	0.48974	GAG	OSBPL1A	-	pfam_Oxysterol-bd	ENSG00000141447		0.512	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL1A	HGNC	protein_coding	OTTHUMT00000254902.1	649	0.00	0	C	NM_080597		21745043	21745043	-1	no_errors	ENST00000319481	ensembl	human	known	69_37n	missense	549	18.18	122	SNP	0.998	G
PCDHA9	9752	genome.wustl.edu	37	5	140230439	140230439	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr5:140230439G>A	ENST00000532602.1	+	1	3392	c.2359G>A	c.(2359-2361)Gga>Aga	p.G787R	PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.G787R|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	787	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGCGAACGGGAGAACCCTC	0.463																																					Melanoma(55;1800 1972 14909)	dbGAP											0													63.0	67.0	66.0					5																	140230439		2197	4269	6466	-	-	-	SO:0001583	missense	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2359G>A	5.37:g.140230439G>A	ENSP00000436042:p.Gly787Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O15053|Q2M3S5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G787R	ENST00000532602.1	37	c.2359	CCDS54920.1	5	.	.	.	.	.	.	.	.	.	.	G	6.866	0.529232	0.13127	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.10763	2.84;2.84	4.6	-0.574	0.11738	.	.	.	.	.	T	0.04452	0.0122	N	0.08118	0	0.09310	N	1	B;B	0.24368	0.0;0.102	B;B	0.18561	0.002;0.022	T	0.42310	-0.9459	9	0.30078	T	0.28	.	4.7243	0.12933	0.3244:0.0:0.5336:0.142	.	787;787	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	R	787	ENSP00000436042:G787R;ENSP00000367362:G787R	ENSP00000367362:G787R	G	+	1	0	PCDHA9	140210623	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.271000	0.18626	-0.392000	0.07751	0.491000	0.48974	GGA	PCDHA9	-	NULL	ENSG00000204961		0.463	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	119	0.00	0	G	NM_031857		140230439	140230439	+1	no_errors	ENST00000532602	ensembl	human	known	69_37n	missense	14	77.42	48	SNP	0.000	A
ZIM2	23619	genome.wustl.edu	37	19	57286770	57286770	+	Silent	SNP	T	T	C	rs150347938		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:57286770T>C	ENST00000391708.3	-	12	1412	c.870A>G	c.(868-870)agA>agG	p.R290R	AC006115.3_ENST00000595954.1_RNA|AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000593711.1_Silent_p.R290R|ZIM2_ENST00000221722.5_Silent_p.R290R|AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000601070.1_Silent_p.R290R|ZIM2_ENST00000599935.1_Silent_p.R290R	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GATTAGAGCTTCTCTCAAATT	0.468																																						dbGAP											0													129.0	124.0	126.0					19																	57286770		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.870A>G	19.37:g.57286770T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3K1	Silent	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R290	ENST00000391708.3	37	c.870	CCDS33123.1	19																																																																																			PEG3	-	NULL	ENSG00000198300		0.468	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416094.2	300	0.33	1	T			57286770	57286770	-1	no_errors	ENST00000221722	ensembl	human	known	69_37n	silent	211	32.15	100	SNP	0.000	C
PLXNA2	5362	genome.wustl.edu	37	1	208216496	208216496	+	Silent	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:208216496G>T	ENST00000367033.3	-	21	4684	c.3927C>A	c.(3925-3927)cgC>cgA	p.R1309R		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1309					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGATTCCTGAGCGGTCCAGGT	0.582																																						dbGAP											0													95.0	90.0	91.0					1																	208216496		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3927C>A	1.37:g.208216496G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.R1309	ENST00000367033.3	37	c.3927	CCDS31013.1	1																																																																																			PLXNA2	-	NULL	ENSG00000076356		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	164	0.00	0	G	NM_025179		208216496	208216496	-1	no_errors	ENST00000367033	ensembl	human	known	69_37n	silent	107	37.79	65	SNP	1.000	T
PPEF1	5475	genome.wustl.edu	37	X	18822127	18822127	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chrX:18822127C>A	ENST00000361511.4	+	14	1677	c.1183C>A	c.(1183-1185)Cag>Aag	p.Q395K	PPEF1_ENST00000544635.1_Missense_Mutation_p.Q330K|PPEF1_ENST00000349874.5_Intron|PPEF1_ENST00000543630.1_Intron|PPEF1_ENST00000359763.6_Missense_Mutation_p.Q342K	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	395	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					TAATAAATACCAGTTGAAGAT	0.428																																						dbGAP											0													121.0	113.0	116.0					X																	18822127		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1183C>A	X.37:g.18822127C>A	ENSP00000354871:p.Gln395Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_EF-hand,pfam_PPP_dom,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_HAND_2,pfscan_IQ_motif_EF-hand-BS,prints_Ser/Thr-sp_prot-phosphatase	p.Q395K	ENST00000361511.4	37	c.1183	CCDS14188.1	X	.	.	.	.	.	.	.	.	.	.	C	8.870	0.948987	0.18356	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000544635	T;T;T	0.04809	3.55;3.55;3.55	5.4	4.52	0.55395	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.991702	0.08196	N	0.983027	T	0.03695	0.0105	N	0.16233	0.39	0.09310	N	1	B;B	0.32573	0.376;0.228	B;B	0.33960	0.173;0.053	T	0.40440	-0.9563	10	0.21014	T	0.42	-0.0407	6.1919	0.20528	0.3517:0.447:0.2013:0.0	.	395;367	O14829;O14829-3	PPE1_HUMAN;.	K	395;342;330	ENSP00000354871:Q395K;ENSP00000352806:Q342K;ENSP00000441289:Q330K	ENSP00000352806:Q342K	Q	+	1	0	PPEF1	18732048	0.245000	0.23899	0.266000	0.24541	0.827000	0.46813	1.623000	0.37008	2.248000	0.74166	0.594000	0.82650	CAG	PPEF1	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr-Pase_EF-hand_contain,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000086717		0.428	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF1	HGNC	protein_coding	OTTHUMT00000055953.3	447	0.00	0	C	NM_006240		18822127	18822127	+1	no_errors	ENST00000361511	ensembl	human	known	69_37n	missense	251	39.42	164	SNP	0.034	A
POU3F4	5456	genome.wustl.edu	37	X	82763506	82763506	+	Silent	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chrX:82763506G>T	ENST00000373200.2	+	1	238	c.174G>T	c.(172-174)gtG>gtT	p.V58V	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	58					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						ATCACTGGGTGACCAGTCTGA	0.627																																						dbGAP											0													27.0	22.0	24.0					X																	82763506		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.174G>T	X.37:g.82763506G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC71|Q5H9G9|Q99410	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pirsf_Transcription_factor_POU,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.V58	ENST00000373200.2	37	c.174	CCDS14450.1	X																																																																																			POU3F4	-	pirsf_Transcription_factor_POU	ENSG00000196767		0.627	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F4	HGNC	protein_coding	OTTHUMT00000057368.2	46	0.00	0	G	NM_000307		82763506	82763506	+1	no_errors	ENST00000373200	ensembl	human	known	69_37n	silent	27	32.50	13	SNP	1.000	T
PRKCE	5581	genome.wustl.edu	37	2	46234725	46234725	+	Silent	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:46234725G>A	ENST00000306156.3	+	9	1515	c.1188G>A	c.(1186-1188)cgG>cgA	p.R396R	PRKCE_ENST00000394874.1_Silent_p.R119R	NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	396					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	GCGAAGTCCGGCAAGGCCAGG	0.587																																						dbGAP											0													45.0	49.0	48.0					2																	46234725		1857	3840	5697	-	-	-	SO:0001819	synonymous_variant	0				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.1188G>A	2.37:g.46234725G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.R396	ENST00000306156.3	37	c.1188	CCDS1824.1	2																																																																																			PRKCE	-	superfamily_Kinase-like_dom,pirsf_Prot_kin_PKC_delta	ENSG00000171132		0.587	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	HGNC	protein_coding	OTTHUMT00000250751.2	79	0.00	0	G			46234725	46234725	+1	no_errors	ENST00000306156	ensembl	human	known	69_37n	silent	46	20.69	12	SNP	1.000	A
PSG7	5676	genome.wustl.edu	37	19	43433600	43433600	+	RNA	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr19:43433600G>T	ENST00000406070.2	-	0	799				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TCACGGAGGAGATTCAGGGTG	0.527																																						dbGAP											0													193.0	210.0	204.0					19																	43433600		2201	4294	6495	-	-	-			0					19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43433600G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15232	Missense_Mutation	SNP	NULL	p.L235I	ENST00000406070.2	37	c.703		19																																																																																			PSG7	-	NULL	ENSG00000221878		0.527	PSG7-001	KNOWN	basic	polymorphic_pseudogene	PSG7	HGNC	polymorphic_pseudogene	OTTHUMT00000321431.2	304	0.00	0	G	NM_001206650		43433600	43433600	-1	pseudogene	ENST00000406070	ensembl	human	known	69_37n	missense	168	43.29	129	SNP	0.509	T
PTPRO	5800	genome.wustl.edu	37	12	15673153	15673153	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr12:15673153C>A	ENST00000281171.4	+	10	2128	c.1798C>A	c.(1798-1800)Cca>Aca	p.P600T	PTPRO_ENST00000348962.2_Missense_Mutation_p.P600T	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	600	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TAATCTGCTGCCAGCATGGTA	0.438																																						dbGAP											0													123.0	117.0	119.0					12																	15673153		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1798C>A	12.37:g.15673153C>A	ENSP00000281171:p.Pro600Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P600T	ENST00000281171.4	37	c.1798	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	C	23.6	4.437484	0.83885	.	.	ENSG00000151490	ENST00000281171;ENST00000348962	T;T	0.60672	0.17;0.17	5.34	5.34	0.76211	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.49916	D	0.000128	T	0.66703	0.2816	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.96	T	0.69431	-0.5147	10	0.87932	D	0	.	17.4057	0.87473	0.0:1.0:0.0:0.0	.	600;600	Q16827-2;Q16827	.;PTPRO_HUMAN	T	600	ENSP00000281171:P600T;ENSP00000343434:P600T	ENSP00000281171:P600T	P	+	1	0	PTPRO	15564420	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.978000	0.76147	2.776000	0.95493	0.655000	0.94253	CCA	PTPRO	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000151490		0.438	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	143	0.00	0	C			15673153	15673153	+1	no_errors	ENST00000281171	ensembl	human	known	69_37n	missense	21	72.37	55	SNP	1.000	A
PUS10	150962	genome.wustl.edu	37	2	61175203	61175203	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:61175203G>C	ENST00000316752.6	-	16	1687	c.1426C>G	c.(1426-1428)Ctc>Gtc	p.L476V	PUS10_ENST00000407787.1_Missense_Mutation_p.L476V	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	476					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			TTCAAGTGGAGGCGGAAGTGG	0.542																																						dbGAP											0													159.0	160.0	160.0					2																	61175203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.1426C>G	2.37:g.61175203G>C	ENSP00000326003:p.Leu476Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPJ5|Q96MI8	Missense_Mutation	SNP	superfamily_PsdUridine_synth_cat_dom	p.L476V	ENST00000316752.6	37	c.1426	CCDS1865.1	2	.	.	.	.	.	.	.	.	.	.	G	16.39	3.108676	0.56291	.	.	ENSG00000162927	ENST00000316752;ENST00000407787	D;D	0.90385	-2.66;-2.66	5.86	5.86	0.93980	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93831	0.8027	L	0.55834	1.745	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.62955	0.909;0.909	D	0.92282	0.5834	10	0.41790	T	0.15	-3.5332	20.5632	0.99335	0.0:0.0:1.0:0.0	.	476;476	A8K6R4;Q3MIT2	.;PUS10_HUMAN	V	476	ENSP00000326003:L476V;ENSP00000386074:L476V	ENSP00000326003:L476V	L	-	1	0	PUS10	61028707	1.000000	0.71417	0.996000	0.52242	0.034000	0.12701	7.499000	0.81566	2.937000	0.99478	0.650000	0.86243	CTC	PUS10	-	superfamily_PsdUridine_synth_cat_dom	ENSG00000162927		0.542	PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PUS10	HGNC	protein_coding	OTTHUMT00000251582.2	219	0.45	1	G	NM_144709		61175203	61175203	-1	no_errors	ENST00000316752	ensembl	human	known	69_37n	missense	143	39.66	94	SNP	1.000	C
FRMD4A	55691	genome.wustl.edu	37	10	13769842	13769842	+	Intron	SNP	A	A	G	rs12572591	byFrequency	TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr10:13769842A>G	ENST00000357447.2	-	12	1128				FRMD4A_ENST00000358621.4_Intron|FRMD4A_ENST00000342409.2_Intron|RP11-353M9.1_ENST00000449462.1_RNA|RNA5SP301_ENST00000362537.1_RNA|FRMD4A_ENST00000378503.1_Intron	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A						establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						gtctgatttcagaagctaagc	0.438													G|||	3405	0.679912	0.5734	0.7752	5008	,	,		22863	0.631		0.7922	False		,,,				2504	0.6912					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.759+10001T>C	10.37:g.13769842A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	RNA	SNP	-	NULL	ENST00000357447.2	37	NULL	CCDS7101.1	10																																																																																			RNA5SP301	-	-	ENSG00000199407		0.438	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNA5SP301	HGNC	protein_coding	OTTHUMT00000046889.1	11	0.00	0	A	NM_018027		13769842	13769842	+1	no_errors	ENST00000362537	ensembl	human	known	69_37n	rna	3	70.00	7	SNP	0.000	G
RNF182	221687	genome.wustl.edu	37	6	13977498	13977498	+	Missense_Mutation	SNP	A	A	C	rs574090276		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:13977498A>C	ENST00000488300.1	+	3	671	c.148A>C	c.(148-150)Aag>Cag	p.K50Q	RNF182_ENST00000537388.1_Missense_Mutation_p.K50Q|RNF182_ENST00000544682.1_Missense_Mutation_p.K50Q|RNF182_ENST00000537663.1_Missense_Mutation_p.K50Q	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	50					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			ATGCCTCTACAAGATCATAGA	0.473																																						dbGAP											0													168.0	158.0	162.0					6																	13977498		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.148A>C	6.37:g.13977498A>C	ENSP00000420465:p.Lys50Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDG2|Q8NBG3	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.K50Q	ENST00000488300.1	37	c.148	CCDS4531.1	6	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463356	0.84425	.	.	ENSG00000180537	ENST00000488763;ENST00000537663;ENST00000488300;ENST00000544682;ENST00000420478;ENST00000423553;ENST00000537388	D;D;D;D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	5.52	5.52	0.82312	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.097518	0.64402	N	0.000002	D	0.90923	0.7147	L	0.37630	1.12	0.51767	D	0.999937	D	0.64830	0.994	P	0.55260	0.772	D	0.90068	0.4161	10	0.30078	T	0.28	-27.5255	15.6281	0.76878	1.0:0.0:0.0:0.0	.	50	Q8N6D2	RN182_HUMAN	Q	50	ENSP00000417500:K50Q;ENSP00000443228:K50Q;ENSP00000420465:K50Q;ENSP00000442021:K50Q;ENSP00000419329:K50Q;ENSP00000418717:K50Q;ENSP00000441271:K50Q	ENSP00000419329:K50Q	K	+	1	0	RNF182	14085477	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.935000	0.75886	2.101000	0.63845	0.460000	0.39030	AAG	RNF182	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000180537		0.473	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF182	HGNC	protein_coding	OTTHUMT00000039911.2	242	0.00	0	A	NM_152737		13977498	13977498	+1	no_errors	ENST00000488300	ensembl	human	known	69_37n	missense	279	25.99	98	SNP	1.000	C
RPS6KA4	8986	genome.wustl.edu	37	11	64137029	64137029	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr11:64137029G>A	ENST00000334205.4	+	13	1605	c.1540G>A	c.(1540-1542)Gtg>Atg	p.V514M	MIR1237_ENST00000408346.1_RNA|RPS6KA4_ENST00000294261.4_Intron|RPS6KA4_ENST00000528057.1_Missense_Mutation_p.V507M	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	514	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						GCGCAGCCTCGTGTCGGCCGT	0.711																																						dbGAP											0													26.0	21.0	23.0					11																	64137029		2190	4293	6483	-	-	-	SO:0001583	missense	0			AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.1540G>A	11.37:g.64137029G>A	ENSP00000333896:p.Val514Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	p.V514M	ENST00000334205.4	37	c.1540	CCDS8073.1	11	.	.	.	.	.	.	.	.	.	.	g	25.0	4.591270	0.86851	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000530504	T;T;T	0.42513	0.97;0.97;0.97	4.52	4.52	0.55395	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.138162	0.47455	D	0.000234	T	0.59514	0.2199	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.99	T	0.63717	-0.6574	10	0.87932	D	0	.	14.7121	0.69241	0.0:0.0:1.0:0.0	.	507;514;508	E9PJN1;O75676;O75676-2	.;KS6A4_HUMAN;.	M	507;514;492	ENSP00000435580:V507M;ENSP00000333896:V514M;ENSP00000432945:V492M	ENSP00000333896:V514M	V	+	1	0	RPS6KA4	63893605	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.252000	0.78309	2.060000	0.61445	0.484000	0.47621	GTG	RPS6KA4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000162302		0.711	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA4	HGNC	protein_coding	OTTHUMT00000106246.2	13	0.00	0	G	NM_003942		64137029	64137029	+1	no_errors	ENST00000334205	ensembl	human	known	69_37n	missense	4	63.64	7	SNP	1.000	A
SCN10A	6336	genome.wustl.edu	37	3	38768529	38768529	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr3:38768529G>T	ENST00000449082.2	-	16	2654	c.2655C>A	c.(2653-2655)ttC>ttA	p.F885L		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	885					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GCAGGGCGATGAACAGGTTAA	0.557																																						dbGAP											0													85.0	82.0	83.0					3																	38768529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.2655C>A	3.37:g.38768529G>T	ENSP00000390600:p.Phe885Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.F885L	ENST00000449082.2	37	c.2655	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024366	0.75390	.	.	ENSG00000185313	ENST00000449082	D	0.98221	-4.8	5.06	2.33	0.28932	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98504	0.9501	M	0.81341	2.54	0.43279	D	0.99524	D	0.76494	0.999	D	0.81914	0.995	D	0.98036	1.0379	10	0.87932	D	0	.	8.3113	0.32073	0.3012:0.0:0.6988:0.0	.	885	Q9Y5Y9	SCNAA_HUMAN	L	885	ENSP00000390600:F885L	ENSP00000390600:F885L	F	-	3	2	SCN10A	38743533	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	4.011000	0.57124	0.331000	0.23511	0.561000	0.74099	TTC	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.557	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	134	0.00	0	G	NM_006514		38768529	38768529	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	13	84.34	70	SNP	1.000	T
SCN4A	6329	genome.wustl.edu	37	17	62034711	62034711	+	Silent	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr17:62034711G>A	ENST00000435607.1	-	13	2263	c.2187C>T	c.(2185-2187)tgC>tgT	p.C729C	SCN4A_ENST00000578147.1_Silent_p.C729C	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	729					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTGCACACGCACTCCTTGT	0.582																																						dbGAP											0													101.0	108.0	106.0					17																	62034711		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2187C>T	17.37:g.62034711G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.C729	ENST00000435607.1	37	c.2187	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.582	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		184	0.00	0	G	NM_000334		62034711	62034711	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	116	46.30	100	SNP	0.981	A
SIRT5	23408	genome.wustl.edu	37	6	13599264	13599264	+	Splice_Site	SNP	G	G	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:13599264G>C	ENST00000606117.1	+	8	914	c.618G>C	c.(616-618)cgG>cgC	p.R206R	SIRT5_ENST00000359782.3_Splice_Site_p.G188G|SIRT5_ENST00000397350.2_Splice_Site_p.R98R|SIRT5_ENST00000379262.4_Splice_Site_p.R206R	NM_012241.4	NP_036373.1			sirtuin 5											breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	11	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)			ATTCTTCCAGGTGTGAAGAGG	0.597																																						dbGAP											0													109.0	103.0	105.0					6																	13599264		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF083110	CCDS4526.1, CCDS4527.1, CCDS54966.1, CCDS56398.1	6p23	2010-08-05	2010-06-25		ENSG00000124523	ENSG00000124523			14933	protein-coding gene	gene with protein product		604483	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 5"", ""sirtuin (silent mating type information regulation 2 homolog) 5 (S. cerevisiae)"""			10381378	Standard	NM_012241		Approved		uc003nay.3	Q9NXA8	OTTHUMG00000014278	ENST00000606117.1:c.618-1G>C	6.37:g.13599264G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_NAD-dep_deAcase_sirtuin,pfscan_NAD-dep_deAcase_sirtuin	p.R206	ENST00000606117.1	37	c.618	CCDS4526.1	6																																																																																			SIRT5	-	pfam_NAD-dep_deAcase_sirtuin,pfscan_NAD-dep_deAcase_sirtuin	ENSG00000124523		0.597	SIRT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT5	HGNC	protein_coding	OTTHUMT00000039908.2	105	0.00	0	G		Silent	13599264	13599264	+1	no_errors	ENST00000379250	ensembl	human	known	69_37n	silent	117	28.22	46	SNP	1.000	C
SLC27A4	10999	genome.wustl.edu	37	9	131105549	131105549	+	Silent	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr9:131105549C>A	ENST00000300456.4	+	2	255	c.138C>A	c.(136-138)atC>atA	p.I46I	SLC27A4_ENST00000372870.1_Missense_Mutation_p.Q74K	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	46					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						GGGTCTTCATCAAGACCATCA	0.582																																					Pancreas(107;1554 2241 10946 12953)	dbGAP											0													98.0	84.0	89.0					9																	131105549		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.138C>A	9.37:g.131105549C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F7|O95186|Q96G53	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.Q74K	ENST00000300456.4	37	c.220	CCDS6899.1	9	.	.	.	.	.	.	.	.	.	.	C	2.875	-0.233040	0.05983	.	.	ENSG00000167114	ENST00000372870	D	0.81821	-1.54	5.4	4.48	0.54585	.	.	.	.	.	T	0.61324	0.2338	.	.	.	0.80722	D	1	B	0.13145	0.007	B	0.01281	0.0	T	0.57106	-0.7868	8	0.02654	T	1	-2.8198	13.949	0.64104	0.0:0.8078:0.1922:0.0	.	74	Q96G53	.	K	74	ENSP00000361961:Q74K	ENSP00000361961:Q74K	Q	+	1	0	SLC27A4	130145370	0.999000	0.42202	0.973000	0.42090	0.361000	0.29550	0.920000	0.28705	2.522000	0.85027	0.467000	0.42956	CAA	SLC27A4	-	NULL	ENSG00000167114		0.582	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2	163	0.00	0	C			131105549	131105549	+1	no_errors	ENST00000372870	ensembl	human	known	69_37n	missense	23	77.23	78	SNP	0.968	A
SLC47A1	55244	genome.wustl.edu	37	17	19452969	19452969	+	Silent	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr17:19452969G>A	ENST00000270570.4	+	5	563	c.477G>A	c.(475-477)acG>acA	p.T159T	SLC47A1_ENST00000436810.2_Silent_p.T136T|SLC47A1_ENST00000457293.1_Silent_p.T159T|SLC47A1_ENST00000575023.1_Silent_p.T159T|SLC47A1_ENST00000395585.1_Silent_p.T159T|SLC47A1_ENST00000571335.1_Missense_Mutation_p.R11Q|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000542886.1_Silent_p.T159T	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	159					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)	p.T159T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	CCTATGTCACGATCTTCATTC	0.448																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											196.0	173.0	181.0					17																	19452969		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.477G>A	17.37:g.19452969G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	pfam_MATE	p.R11Q	ENST00000270570.4	37	c.32	CCDS11209.1	17																																																																																			SLC47A1	-	NULL	ENSG00000142494		0.448	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC47A1	HGNC	protein_coding	OTTHUMT00000132250.1	361	0.00	0	G	NM_018242		19452969	19452969	+1	no_errors	ENST00000571335	ensembl	human	novel	69_37n	missense	57	69.68	131	SNP	0.913	A
SND1	27044	genome.wustl.edu	37	7	127731927	127731927	+	Silent	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr7:127731927C>T	ENST00000354725.3	+	23	2855	c.2661C>T	c.(2659-2661)agC>agT	p.S887S		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	887					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						CAGCCAAGAGCGCCAGGGTGA	0.562																																						dbGAP											0													171.0	171.0	171.0					7																	127731927		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2661C>T	7.37:g.127731927C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13122|Q96AG0	Silent	SNP	pfam_Staphylococcal_nuclease,pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Staphylococcal_nuclease,smart_Tudor,pirsf_Silence_cplx_Nase-comp_TudorSN,pfscan_Tudor,pfscan_Staphylococcal_nuclease	p.S887	ENST00000354725.3	37	c.2661	CCDS34747.1	7																																																																																			SND1	-	pfam_Staphylococcal_nuclease,superfamily_Staphylococal_nuclease_OB-fold,pirsf_Silence_cplx_Nase-comp_TudorSN	ENSG00000197157		0.562	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SND1	HGNC	protein_coding	OTTHUMT00000349148.1	458	0.00	0	C	NM_014390		127731927	127731927	+1	no_errors	ENST00000354725	ensembl	human	known	69_37n	silent	250	47.17	225	SNP	0.884	T
SOX12	6666	genome.wustl.edu	37	20	307342	307342	+	Silent	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr20:307342G>T	ENST00000342665.2	+	1	1104	c.774G>T	c.(772-774)ctG>ctT	p.L258L	RP5-1103G7.4_ENST00000414676.1_RNA|RP5-1103G7.4_ENST00000442637.1_RNA|SOX12_ENST00000544632.1_Silent_p.L258L	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12	258					cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TGTCCAGGCTGCCCCCTGGCC	0.701																																						dbGAP											0													17.0	18.0	17.0					20																	307342		2179	4275	6454	-	-	-	SO:0001819	synonymous_variant	0			U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623	ENST00000342665.2:c.774G>T	20.37:g.307342G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5D038|Q9NUD4	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pirsf_SOX-12/11/4a,pfscan_HMG_superfamily	p.L258	ENST00000342665.2	37	c.774	CCDS12995.1	20																																																																																			SOX12	-	pirsf_SOX-12/11/4a	ENSG00000177732		0.701	SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX12	HGNC	protein_coding	OTTHUMT00000077435.2	8	0.00	0	G	NM_006943		307342	307342	+1	no_errors	ENST00000342665	ensembl	human	known	69_37n	silent	5	50.00	5	SNP	0.997	T
SVOP	55530	genome.wustl.edu	37	12	109372367	109372367	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr12:109372367G>T	ENST00000299134.5	-	1	72	c.73C>A	c.(73-75)Ctg>Atg	p.L25M		NM_018711.2	NP_061181.1	Q8N4V2	SVOP_HUMAN	SV2 related protein homolog (rat)	0						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	ion transmembrane transporter activity (GO:0015075)			breast(2)|lung(4)	6						AGCCAAGCCAGTGAGAACAGA	0.522																																						dbGAP											0													59.0	60.0	60.0					12																	109372367		692	1591	2283	-	-	-	SO:0001583	missense	0			BC033587	CCDS73520.1	12q24.11	2011-07-12				ENSG00000166111			25417	protein-coding gene	gene with protein product		611699					Standard	NM_018711		Approved	DKFZp761H039	uc010sxh.1	Q8N4V2		ENST00000299134.5:c.73C>A	12.37:g.109372367G>T	ENSP00000299134:p.Leu25Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPW5	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L25M	ENST00000299134.5	37	c.73		12	.	.	.	.	.	.	.	.	.	.	-	16.15	3.040567	0.55003	.	.	ENSG00000166111	ENST00000299134;ENST00000546618	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	T	0.80132	0.4567	M	0.86953	2.85	.	.	.	.	.	.	.	.	.	T	0.83322	-0.0017	4	.	.	.	.	16.3142	0.82909	0.0:0.0:1.0:0.0	.	.	.	.	M	25	.	.	L	-	1	2	SVOP	.	1.000000	0.71417	0.946000	0.38457	0.960000	0.62799	8.704000	0.91351	2.441000	0.82636	0.563000	0.77884	CTG	SVOP	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000166111		0.522	SVOP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic	protein_coding	SVOP	HGNC	protein_coding	OTTHUMT00000403982.1	84	0.00	0	G	NM_018711		109372367	109372367	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000299134	ensembl	human	known	69_37n	missense	69	45.24	57	SNP	0.999	T
SYNE1	23345	genome.wustl.edu	37	6	152639373	152639373	+	Missense_Mutation	SNP	C	C	A	rs374092886		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:152639373C>A	ENST00000367255.5	-	86	17016	c.16415G>T	c.(16414-16416)tGt>tTt	p.C5472F	SYNE1_ENST00000356820.4_5'UTR|SYNE1_ENST00000265368.4_Missense_Mutation_p.C5472F|SYNE1_ENST00000423061.1_Missense_Mutation_p.C5401F|SYNE1_ENST00000448038.1_Missense_Mutation_p.C5401F|SYNE1_ENST00000341594.5_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5472					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTTGAATTACAGCCATCTAA	0.408										HNSCC(10;0.0054)																												dbGAP											0													110.0	100.0	103.0					6																	152639373		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16415G>T	6.37:g.152639373C>A	ENSP00000356224:p.Cys5472Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.C5472F	ENST00000367255.5	37	c.16415	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445451	0.43429	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.55234	0.62;0.62;0.53;0.62	5.76	3.99	0.46301	.	0.166790	0.43416	D	0.000567	T	0.43545	0.1252	M	0.66939	2.045	0.80722	D	1	P;P;P;P	0.47762	0.9;0.839;0.839;0.9	P;B;B;P	0.50136	0.632;0.309;0.309;0.61	T	0.38499	-0.9658	10	0.18710	T	0.47	.	12.6415	0.56712	0.0:0.8652:0.0:0.1348	.	5472;5472;5472;5401	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	F	5472;5401;5472;5401	ENSP00000356224:C5472F;ENSP00000396024:C5401F;ENSP00000265368:C5472F;ENSP00000390975:C5401F	ENSP00000265368:C5472F	C	-	2	0	SYNE1	152681066	1.000000	0.71417	0.397000	0.26308	0.901000	0.52897	3.231000	0.51294	0.791000	0.33826	0.655000	0.94253	TGT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.408	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	327	0.00	0	C	NM_182961		152639373	152639373	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	328	29.46	137	SNP	0.999	A
SYNE1	23345	genome.wustl.edu	37	6	152716678	152716678	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:152716678A>T	ENST00000367255.5	-	51	8286	c.7685T>A	c.(7684-7686)aTg>aAg	p.M2562K	SYNE1_ENST00000265368.4_Missense_Mutation_p.M2562K|SYNE1_ENST00000423061.1_Missense_Mutation_p.M2569K|SYNE1_ENST00000448038.1_Missense_Mutation_p.M2569K|SYNE1_ENST00000341594.5_Missense_Mutation_p.M2601K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2562					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCCAAAAACATTTCAACTTT	0.398										HNSCC(10;0.0054)																												dbGAP											0													167.0	161.0	163.0					6																	152716678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.7685T>A	6.37:g.152716678A>T	ENSP00000356224:p.Met2562Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.M2562K	ENST00000367255.5	37	c.7685	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	11.07	1.530638	0.27387	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	5.56	5.56	0.83823	.	0.075768	0.56097	D	0.000029	T	0.05593	0.0147	N	0.22421	0.69	0.80722	D	1	B;B;B;B	0.15473	0.013;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.001;0.001;0.002	T	0.29761	-1.0001	10	0.05959	T	0.93	.	5.0424	0.14465	0.6523:0.0:0.0796:0.2681	.	2545;2562;2562;2569	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	2562;2569;2562;2569;2601	ENSP00000356224:M2562K;ENSP00000396024:M2569K;ENSP00000265368:M2562K;ENSP00000390975:M2569K;ENSP00000341887:M2601K	ENSP00000265368:M2562K	M	-	2	0	SYNE1	152758371	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.369000	0.44231	2.101000	0.63845	0.533000	0.62120	ATG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.398	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	462	0.00	0	A	NM_182961		152716678	152716678	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	557	18.21	124	SNP	1.000	T
TIPIN	54962	genome.wustl.edu	37	15	66644500	66644500	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr15:66644500A>G	ENST00000261881.4	-	3	264	c.179T>C	c.(178-180)gTt>gCt	p.V60A	TIPIN_ENST00000367709.4_5'UTR	NM_017858.2	NP_060328	Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein	60					cell cycle phase transition (GO:0044770)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|regulation of nuclear cell cycle DNA replication (GO:0033262)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	7						ATTTCTTTTAACTGTTCTCTT	0.313																																						dbGAP											0													76.0	70.0	72.0					15																	66644500		2201	4299	6500	-	-	-	SO:0001583	missense	0			BK001386	CCDS10215.1	15q22.31	2012-03-02	2006-08-08		ENSG00000075131	ENSG00000075131			30750	protein-coding gene	gene with protein product	"""CSM3 homolog (S. cerevisiae)"""	610716				12875843, 17102137	Standard	NM_017858		Approved	FLJ20516	uc002apr.2	Q9BVW5	OTTHUMG00000133188	ENST00000261881.4:c.179T>C	15.37:g.66644500A>G	ENSP00000261881:p.Val60Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2CW64|Q9NWZ6	Missense_Mutation	SNP	pfam_Swi3	p.V60A	ENST00000261881.4	37	c.179	CCDS10215.1	15	.	.	.	.	.	.	.	.	.	.	A	14.93	2.681322	0.47991	.	.	ENSG00000075131	ENST00000261881	T	0.15372	2.43	5.1	3.96	0.45880	.	0.059729	0.64402	D	0.000004	T	0.12774	0.0310	L	0.39898	1.24	0.80722	D	1	B	0.32653	0.379	B	0.26517	0.07	T	0.07233	-1.0783	10	0.40728	T	0.16	-19.0579	10.0883	0.42432	0.9172:0.0:0.0828:0.0	.	60	Q9BVW5	TIPIN_HUMAN	A	60	ENSP00000261881:V60A	ENSP00000261881:V60A	V	-	2	0	TIPIN	64431554	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.271000	0.58902	1.907000	0.55213	0.374000	0.22700	GTT	TIPIN	-	NULL	ENSG00000075131		0.313	TIPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIPIN	HGNC	protein_coding	OTTHUMT00000256897.2	251	0.00	0	A	NM_017858		66644500	66644500	-1	no_errors	ENST00000261881	ensembl	human	known	69_37n	missense	46	71.07	113	SNP	1.000	G
TLL1	7092	genome.wustl.edu	37	4	166913988	166913988	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr4:166913988C>T	ENST00000061240.2	+	3	960	c.313C>T	c.(313-315)Cga>Tga	p.R105*	TLL1_ENST00000513213.1_Nonsense_Mutation_p.R105*|TLL1_ENST00000507499.1_Nonsense_Mutation_p.R105*	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	105					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GTCAAAGAAGCGAGGGGCCCT	0.348																																						dbGAP											0													123.0	122.0	123.0					4																	166913988		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.313C>T	4.37:g.166913988C>T	ENSP00000061240:p.Arg105*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMU2|Q96AN3|Q9NQS4	Nonsense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.R105*	ENST00000061240.2	37	c.313	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	C	40	8.308999	0.98752	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213;ENST00000506144	.	.	.	5.52	4.59	0.56863	.	0.460849	0.21410	U	0.074984	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5925	0.61967	0.2695:0.7305:0.0:0.0	.	.	.	.	X	105;105;105;5	.	ENSP00000061240:R105X	R	+	1	2	TLL1	167133438	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	2.118000	0.41949	2.599000	0.87857	0.563000	0.77884	CGA	TLL1	-	pirsf_BMP_1/tolloid-like	ENSG00000038295		0.348	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	456	0.00	0	C			166913988	166913988	+1	no_errors	ENST00000061240	ensembl	human	known	69_37n	nonsense	58	75.62	183	SNP	1.000	T
TLL2	7093	genome.wustl.edu	37	10	98146742	98146742	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr10:98146742T>C	ENST00000357947.3	-	14	2045	c.1820A>G	c.(1819-1821)tAc>tGc	p.Y607C		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	607	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GGCCAGCTCGTAGCCAGGGTC	0.582																																						dbGAP											0													124.0	101.0	109.0					10																	98146742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1820A>G	10.37:g.98146742T>C	ENSP00000350630:p.Tyr607Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.Y607C	ENST00000357947.3	37	c.1820	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449470	0.63178	.	.	ENSG00000095587	ENST00000357947	D	0.98028	-4.67	4.43	3.2	0.36748	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.181394	0.26507	N	0.023993	D	0.98767	0.9585	H	0.95470	3.675	0.50813	D	0.999894	D	0.71674	0.998	D	0.67900	0.954	D	0.98693	1.0697	10	0.87932	D	0	.	8.6296	0.33911	0.2672:0.0:0.0:0.7327	.	607	Q9Y6L7	TLL2_HUMAN	C	607	ENSP00000350630:Y607C	ENSP00000350630:Y607C	Y	-	2	0	TLL2	98136732	1.000000	0.71417	0.969000	0.41365	0.871000	0.50021	3.889000	0.56212	1.991000	0.58162	0.402000	0.26972	TAC	TLL2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_EG-like_dom	ENSG00000095587		0.582	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	103	0.00	0	T			98146742	98146742	-1	no_errors	ENST00000357947	ensembl	human	known	69_37n	missense	19	64.15	34	SNP	0.987	C
TM2D2	83877	genome.wustl.edu	37	8	38852949	38852951	+	Intron	DEL	ATC	ATC	-	rs74196658	byFrequency	TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	ATC	ATC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr8:38852949_38852951delATC	ENST00000456397.2	-	2	321				ADAM9_ENST00000487273.2_5'Flank|TM2D2_ENST00000397070.2_In_Frame_Del_p.M24del|ADAM9_ENST00000466936.1_5'Flank|TM2D2_ENST00000412303.1_In_Frame_Del_p.M24del|TM2D2_ENST00000522434.1_Intron|TM2D2_ENST00000456845.2_In_Frame_Del_p.M24del|ADAM9_ENST00000481513.1_5'Flank	NM_078473.2	NP_510882.1	Q9BX73	TM2D2_HUMAN	TM2 domain containing 2							integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		all_lung(54;0.00338)|Lung NSC(58;0.0133)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			TAAGATCATGATCATCATCATAC	0.414																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF353991	CCDS6111.1, CCDS43733.1	8p11.23	2005-08-09				ENSG00000169490			24127	protein-coding gene	gene with protein product		610081				11278849	Standard	XM_005273657		Approved	BLP1	uc003xmk.3	Q9BX73		ENST00000456397.2:c.228-25GAT>-	8.37:g.38852955_38852957delATC		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK4|D3DSX8|Q8N0X9	In_Frame_Del	DEL	pfam_TM2	p.M24in_frame_del	ENST00000456397.2	37	c.74_72	CCDS6111.1	8																																																																																			TM2D2	-	NULL	ENSG00000169490		0.414	TM2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM2D2	HGNC	protein_coding	OTTHUMT00000377280.1	331	0.00	0	ATC	NM_031940		38852949	38852951	-1	no_errors	ENST00000397070	ensembl	human	known	69_37n	in_frame_del	232	34.28	121	DEL	0.000:0.000:0.000	-
TMEM132C	92293	genome.wustl.edu	37	12	129178526	129178526	+	Silent	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr12:129178526C>T	ENST00000435159.2	+	6	1602	c.1602C>T	c.(1600-1602)gaC>gaT	p.D534D	TMEM132C_ENST00000315208.8_Silent_p.D150D|TMEM132C_ENST00000537538.1_5'UTR	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	534						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						AGGTCTCTGACACGGAGCTCA	0.577																																						dbGAP											0													29.0	29.0	29.0					12																	129178526		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1602C>T	12.37:g.129178526C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX8	Silent	SNP	NULL	p.D534	ENST00000435159.2	37	c.1602		12																																																																																			TMEM132C	-	NULL	ENSG00000181234		0.577	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		75	0.00	0	C	XM_044062		129178526	129178526	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	silent	48	35.14	26	SNP	1.000	T
TNRC6A	27327	genome.wustl.edu	37	16	24801817	24801817	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr16:24801817C>A	ENST00000395799.3	+	6	1983	c.1854C>A	c.(1852-1854)aaC>aaA	p.N618K	TNRC6A_ENST00000315183.7_Missense_Mutation_p.N618K	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	618	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TTGAGTGGAACAAACTGCCTA	0.468																																						dbGAP											0													100.0	91.0	94.0					16																	24801817		2197	4300	6497	-	-	-	SO:0001583	missense	0			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1854C>A	16.37:g.24801817C>A	ENSP00000379144:p.Asn618Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.N618K	ENST00000395799.3	37	c.1854	CCDS10624.2	16	.	.	.	.	.	.	.	.	.	.	C	8.196	0.797063	0.16327	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.11277	2.79;2.8	5.54	4.5	0.54988	.	0.443384	0.27064	N	0.021102	T	0.11707	0.0285	L	0.47716	1.5	0.80722	D	1	B;B;B	0.24258	0.05;0.069;0.1	B;B;B	0.24701	0.049;0.055;0.036	T	0.03795	-1.1003	10	0.48119	T	0.1	0.9504	12.2735	0.54721	0.0:0.8507:0.0:0.1493	.	365;618;618	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	K	618	ENSP00000326900:N618K;ENSP00000379144:N618K	ENSP00000326900:N618K	N	+	3	2	TNRC6A	24709318	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	1.285000	0.33261	2.607000	0.88179	0.462000	0.41574	AAC	TNRC6A	-	NULL	ENSG00000090905		0.468	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1	227	0.44	1	C	NM_020847		24801817	24801817	+1	no_errors	ENST00000395799	ensembl	human	known	69_37n	missense	120	43.66	93	SNP	0.995	A
TP53	7157	genome.wustl.edu	37	17	7579364	7579365	+	Frame_Shift_Del	DEL	CC	CC	-	rs587782461|rs587783063		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr17:7579364_7579365delCC	ENST00000269305.4	-	4	511_512	c.322_323delGG	c.(322-324)ggtfs	p.G108fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.G108fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.G108fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.G108fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.G108fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.G108fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	108	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		G -> D (in a sporadic cancer; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q100fs*37(3)|p.G59fs*23(3)|p.G108_F109delGF(2)|p.G108del(2)|p.V73fs*9(1)|p.G108fs*41(1)|p.G105_T125del21(1)|p.?_?ins?(1)|p.G108S(1)|p.Y107fs*44(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.G108D(1)|p.G108fs*15(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)|p.Y103fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGACGGAAACCGTAGCTGCCC	0.619		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Deletion - Frameshift(14)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(2)|Substitution - Missense(2)|Insertion - Frameshift(1)|Insertion - In frame(1)	breast(7)|upper_aerodigestive_tract(5)|bone(4)|large_intestine(3)|ovary(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|lung(2)|liver(2)|stomach(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.322_323delGG	17.37:g.7579364_7579365delCC	ENSP00000269305:p.Gly108fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G108fs	ENST00000269305.4	37	c.323_322	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.619	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	57	0.00	0	CC	NM_000546		7579364	7579365	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	8	68.75	22	DEL	0.910:0.925	-
UGT1A10	54575	genome.wustl.edu	37	2	234545725	234545725	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr2:234545725C>T	ENST00000344644.5	+	1	626	c.557C>T	c.(556-558)cCt>cTt	p.P186L	UGT1A10_ENST00000373445.1_Missense_Mutation_p.P186L|UGT1A1_ENST00000373450.4_Intron	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	186					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	TGCCCTGCTCCTCTTTCCTAT	0.463																																						dbGAP											0													168.0	170.0	169.0					2																	234545725		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.557C>T	2.37:g.234545725C>T	ENSP00000343838:p.Pro186Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00474|Q6NT91|Q7Z6H8	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.P186L	ENST00000344644.5	37	c.557	CCDS33403.1	2	.	.	.	.	.	.	.	.	.	.	C	14.08	2.430149	0.43122	.	.	ENSG00000242515	ENST00000344644;ENST00000373445	T;T	0.64991	-0.13;-0.13	3.52	3.52	0.40303	.	.	.	.	.	T	0.74839	0.3769	M	0.93420	3.415	0.43632	D	0.996026	B;B	0.23806	0.051;0.091	B;B	0.33690	0.12;0.168	T	0.80415	-0.1392	9	0.66056	D	0.02	.	15.6441	0.77033	0.0:1.0:0.0:0.0	.	186;186	Q9HAW8;Q7Z6H8	UD110_HUMAN;.	L	186	ENSP00000343838:P186L;ENSP00000362544:P186L	ENSP00000343838:P186L	P	+	2	0	UGT1A10	234210464	0.633000	0.27181	0.028000	0.17463	0.092000	0.18411	4.732000	0.62029	1.997000	0.58415	0.405000	0.27470	CCT	UGT1A10	-	pfam_UDP_glucos_trans	ENSG00000242515		0.463	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A10	HGNC	protein_coding	OTTHUMT00000130986.1	496	0.00	0	C	NM_019075		234545725	234545725	+1	no_errors	ENST00000344644	ensembl	human	known	69_37n	missense	321	41.85	231	SNP	0.720	T
UGT2B15	7366	genome.wustl.edu	37	4	69536304	69536304	+	Silent	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr4:69536304C>A	ENST00000338206.5	-	1	42	c.33G>T	c.(31-33)ctG>ctT	p.L11L		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	11					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	TGAGCTGTATCAGCAGAAAGA	0.413																																						dbGAP											0													235.0	246.0	242.0					4																	69536304		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.33G>T	4.37:g.69536304C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L11	ENST00000338206.5	37	c.33	CCDS3524.1	4																																																																																			UGT2B15	-	NULL	ENSG00000196620		0.413	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	208	0.48	1	C	NM_001076		69536304	69536304	-1	no_errors	ENST00000338206	ensembl	human	known	69_37n	silent	34	70.43	81	SNP	0.997	A
UNC93B1	81622	genome.wustl.edu	37	11	67766699	67766699	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr11:67766699C>A	ENST00000227471.2	-	5	710	c.631G>T	c.(631-633)Ggc>Tgc	p.G211C	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	211					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											GCGTGGGAGCCCCGCGGAGGC	0.602																																						dbGAP											0													61.0	70.0	67.0					11																	67766699		2030	4179	6209	-	-	-	SO:0001583	missense	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.631G>T	11.37:g.67766699C>A	ENSP00000227471:p.Gly211Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.G211C	ENST00000227471.2	37	c.631		11	.	.	.	.	.	.	.	.	.	.	.	21.9	4.216803	0.79352	.	.	ENSG00000110057	ENST00000227471;ENST00000528423	T;T	0.07908	3.15;3.15	4.18	4.18	0.49190	.	0.108253	0.64402	D	0.000006	T	0.21674	0.0522	.	.	.	0.49389	D	0.999787	D	0.69078	0.997	P	0.56865	0.808	T	0.01010	-1.1482	9	0.52906	T	0.07	-2.3883	15.5951	0.76572	0.0:1.0:0.0:0.0	.	211	Q9H1C4	UN93B_HUMAN	C	211;140	ENSP00000227471:G211C;ENSP00000437195:G140C	ENSP00000227471:G211C	G	-	1	0	UNC93B1	67523275	1.000000	0.71417	0.998000	0.56505	0.721000	0.41392	6.710000	0.74670	2.316000	0.78162	0.561000	0.74099	GGC	UNC93B1	-	NULL	ENSG00000110057		0.602	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding		50	0.00	0	C	NM_030930		67766699	67766699	-1	no_errors	ENST00000227471	ensembl	human	known	69_37n	missense	54	19.40	13	SNP	1.000	A
USH2A	7399	genome.wustl.edu	37	1	216371845	216371845	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr1:216371845T>G	ENST00000307340.3	-	18	4279	c.3893A>C	c.(3892-3894)cAg>cCg	p.Q1298P	RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.Q1298P|USH2A_ENST00000366942.3_Missense_Mutation_p.Q1298P	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1298	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACCACTGCTCTGAAAAACTCG	0.378										HNSCC(13;0.011)																												dbGAP											0													117.0	112.0	114.0					1																	216371845		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3893A>C	1.37:g.216371845T>G	ENSP00000305941:p.Gln1298Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.Q1298P	ENST00000307340.3	37	c.3893	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	15.14	2.746108	0.49151	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.19806	2.63;2.62;2.12	5.81	3.41	0.39046	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.165225	0.28349	N	0.015672	T	0.23886	0.0578	L	0.46157	1.445	0.27133	N	0.961854	P;P	0.50819	0.709;0.939	B;P	0.49192	0.318;0.602	T	0.05257	-1.0896	10	0.35671	T	0.21	.	9.2468	0.37532	0.1223:0.0:0.1284:0.7493	.	1298;1298	O75445-2;O75445	.;USH2A_HUMAN	P	1298	ENSP00000305941:Q1298P;ENSP00000355910:Q1298P;ENSP00000355909:Q1298P	ENSP00000305941:Q1298P	Q	-	2	0	USH2A	214438468	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	1.196000	0.32198	0.416000	0.25844	0.528000	0.53228	CAG	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.378	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	260	0.38	1	T	NM_007123		216371845	216371845	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	193	41.03	135	SNP	1.000	G
VIPR2	7434	genome.wustl.edu	37	7	158902573	158902573	+	Silent	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr7:158902573C>T	ENST00000262178.2	-	3	374	c.189G>A	c.(187-189)cgG>cgA	p.R63R	VIPR2_ENST00000402066.1_Silent_p.R204R	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	63					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CATTGGCAGGCCGCCAGCACG	0.552																																					Pancreas(154;1876 1931 2329 17914 20079)	dbGAP											0													85.0	77.0	80.0					7																	158902573		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.189G>A	7.37:g.158902573C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Missense_Mutation	SNP	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_VIP_rcpt,prints_GPCR_2_VIP_rcpt_2	p.A59T	ENST00000262178.2	37	c.175	CCDS5950.1	7	.	.	.	.	.	.	.	.	.	.	C	9.383	1.073617	0.20147	.	.	ENSG00000106018	ENST00000418475	.	.	.	5.21	-0.0108	0.13995	.	.	.	.	.	T	0.50463	0.1617	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33266	-0.9875	4	.	.	.	.	5.0488	0.14497	0.0856:0.4567:0.3239:0.1339	.	.	.	.	T	59	.	.	A	-	1	0	VIPR2	158595334	0.924000	0.31332	0.913000	0.36048	0.786000	0.44442	0.090000	0.15025	-0.334000	0.08463	-0.218000	0.12543	GCC	VIPR2	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_VIP_rcpt_2	ENSG00000106018		0.552	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR2	HGNC	protein_coding	OTTHUMT00000322675.1	82	0.00	0	C	NM_003382		158902573	158902573	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418475	ensembl	human	putative	69_37n	missense	53	28.32	32	SNP	0.963	T
VNN2	8875	genome.wustl.edu	37	6	133078858	133078858	+	Missense_Mutation	SNP	G	G	C	rs375725220		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr6:133078858G>C	ENST00000326499.6	-	1	289	c.165C>G	c.(163-165)aaC>aaG	p.N55K	VNN2_ENST00000525289.1_Missense_Mutation_p.N55K|VNN2_ENST00000526192.1_5'UTR|VNN2_ENST00000525270.1_Missense_Mutation_p.N2K	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	55	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CTATATTCTCGTTCATGAGAT	0.433																																						dbGAP											0													131.0	127.0	129.0					6																	133078858		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.165C>G	6.37:g.133078858G>C	ENSP00000322276:p.Asn55Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	pirsf_Biotinidase_euk,pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.N55K	ENST00000326499.6	37	c.165	CCDS5161.1	6	.	.	.	.	.	.	.	.	.	.	g	9.476	1.097013	0.20552	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289;ENST00000524919;ENST00000530536;ENST00000532012	D;D;D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68;-2.68;-2.68	5.59	2.83	0.33086	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (3);	0.000000	0.85682	D	0.000000	T	0.78685	0.4322	L	0.46885	1.475	0.30450	N	0.775337	B;P	0.52577	0.351;0.954	B;P	0.55391	0.096;0.775	T	0.72398	-0.4306	10	0.05525	T	0.97	-8.1692	3.0174	0.06064	0.1994:0.1215:0.5533:0.1257	.	55;55	O95498-2;O95498	.;VNN2_HUMAN	K	55;2;55;55;2;55	ENSP00000322276:N55K;ENSP00000436822:N2K;ENSP00000436935:N55K;ENSP00000431451:N55K;ENSP00000434210:N2K;ENSP00000431680:N55K	ENSP00000322276:N55K	N	-	3	2	VNN2	133120551	1.000000	0.71417	0.998000	0.56505	0.088000	0.18126	0.658000	0.24979	0.394000	0.25230	-0.198000	0.12761	AAC	VNN2	-	pirsf_Biotinidase_euk,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	ENSG00000112303		0.433	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VNN2	HGNC	protein_coding	OTTHUMT00000042264.2	304	0.00	0	G			133078858	133078858	-1	no_errors	ENST00000326499	ensembl	human	known	69_37n	missense	201	40.06	135	SNP	1.000	C
WNK2	65268	genome.wustl.edu	37	9	96051807	96051807	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr9:96051807G>C	ENST00000297954.4	+	20	4882	c.4882G>C	c.(4882-4884)Gac>Cac	p.D1628H	WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000395477.2_Missense_Mutation_p.D1591H|WNK2_ENST00000427277.2_Missense_Mutation_p.D1203H|WNK2_ENST00000349097.3_Missense_Mutation_p.D1240H	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1628					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CCTGAGAGGGGACCAGCCCCG	0.692																																						dbGAP											0													13.0	16.0	15.0					9																	96051807		2193	4291	6484	-	-	-	SO:0001583	missense	0			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.4882G>C	9.37:g.96051807G>C	ENSP00000297954:p.Asp1628His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D1628H	ENST00000297954.4	37	c.4882		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.87|14.87	2.664050|2.664050	0.47572|0.47572	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277|ENST00000411624	T;T;T;T|T	0.27402|0.25749	1.67;1.67;1.67;1.67|1.78	4.13|4.13	3.23|3.23	0.37069|0.37069	.|.	0.925745|.	0.08979|.	N|.	0.866110|.	T|T	0.25269|0.25269	0.0614|0.0614	L|L	0.46157|0.46157	1.445|1.445	0.21933|0.21933	N|N	0.99947|0.99947	D;D;B;D;D|.	0.89917|.	0.998;1.0;0.049;1.0;1.0|.	D;D;B;D;D|.	0.87578|.	0.989;0.985;0.013;0.998;0.996|.	T|T	0.15954|0.15954	-1.0419|-1.0419	10|7	0.62326|0.30854	D|T	0.03|0.27	.|.	6.8902|6.8902	0.24224|0.24224	0.0976:0.1764:0.726:0.0|0.0976:0.1764:0.726:0.0	.|.	1591;1586;1194;1591;1628|.	Q9Y3S1-2;A6PVR3;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;.;WNK2_HUMAN|.	H|A	1628;1591;1240;1203|1194	ENSP00000297954:D1628H;ENSP00000378860:D1591H;ENSP00000297876:D1240H;ENSP00000411181:D1203H|ENSP00000414622:G1194A	ENSP00000297954:D1628H|ENSP00000414622:G1194A	D|G	+|+	1|2	0|0	WNK2|WNK2	95091628|95091628	0.998000|0.998000	0.40836|0.40836	0.416000|0.416000	0.26546|0.26546	0.967000|0.967000	0.64934|0.64934	2.271000|2.271000	0.43364|0.43364	0.717000|0.717000	0.32145|0.32145	0.561000|0.561000	0.74099|0.74099	GAC|GGA	WNK2	-	NULL	ENSG00000165238		0.692	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1	27	0.00	0	G	NM_006648		96051807	96051807	+1	no_errors	ENST00000297954	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	0.088	C
WNT10B	7480	genome.wustl.edu	37	12	49362067	49362067	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr12:49362067C>T	ENST00000301061.4	-	4	721	c.373G>A	c.(373-375)Gct>Act	p.A125T	WNT10B_ENST00000403957.1_Missense_Mutation_p.A125T|WNT10B_ENST00000407467.1_Missense_Mutation_p.A125T	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	125					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						ACCCCAGCAGCCAGCATGGAG	0.597																																						dbGAP											0													59.0	54.0	56.0					12																	49362067		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.373G>A	12.37:g.49362067C>T	ENSP00000301061:p.Ala125Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt10	p.A125T	ENST00000301061.4	37	c.373	CCDS8775.1	12	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515165	0.85389	.	.	ENSG00000169884	ENST00000301061;ENST00000407467;ENST00000403957	T;T;T	0.79141	-1.24;-1.24;-1.24	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.86539	0.5957	M	0.76938	2.355	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.75484	0.978;0.986	D	0.87381	0.2357	10	0.66056	D	0.02	.	11.0619	0.47953	0.0:0.9129:0.0:0.0871	.	125;125	Q4VAJ4;O00744	.;WN10B_HUMAN	T	125	ENSP00000301061:A125T;ENSP00000384691:A125T;ENSP00000385980:A125T	ENSP00000301061:A125T	A	-	1	0	WNT10B	47648334	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.943000	0.63554	2.504000	0.84457	0.491000	0.48974	GCT	WNT10B	-	pfam_Wnt,smart_Wnt,prints_Wnt	ENSG00000169884		0.597	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT10B	HGNC	protein_coding	OTTHUMT00000319864.1	133	0.00	0	C	NM_003394		49362067	49362067	-1	no_errors	ENST00000301061	ensembl	human	known	69_37n	missense	22	71.79	56	SNP	1.000	T
ZNF214	7761	genome.wustl.edu	37	11	7021508	7021508	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr11:7021508G>A	ENST00000278314.4	-	3	1721	c.1406C>T	c.(1405-1407)cCc>cTc	p.P469L	ZNF214_ENST00000531083.1_5'Flank|ZNF214_ENST00000536068.1_Missense_Mutation_p.P469L	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		ACAAGTATAGGGTTTCTCCCC	0.428																																					Ovarian(22;251 657 736 21522 46864)	dbGAP											0													100.0	105.0	103.0					11																	7021508		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1406C>T	11.37:g.7021508G>A	ENSP00000278314:p.Pro469Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Q1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P469L	ENST00000278314.4	37	c.1406	CCDS31418.1	11	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354578	0.82243	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.27557	1.66;1.66	4.05	4.05	0.47172	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.173219	0.28171	N	0.016331	T	0.56906	0.2017	M	0.81802	2.56	0.51012	D	0.999904	D	0.89917	1.0	D	0.85130	0.997	T	0.62863	-0.6764	10	0.72032	D	0.01	.	14.5016	0.67724	0.0:0.0:1.0:0.0	.	469	Q9UL59	ZN214_HUMAN	L	469	ENSP00000278314:P469L;ENSP00000445373:P469L	ENSP00000278314:P469L	P	-	2	0	ZNF214	6978084	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	6.208000	0.72165	2.536000	0.85505	0.561000	0.74099	CCC	ZNF214	-	pfscan_Znf_C2H2	ENSG00000149050		0.428	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF214	HGNC	protein_coding	OTTHUMT00000385349.1	311	0.00	0	G			7021508	7021508	-1	no_errors	ENST00000278314	ensembl	human	known	69_37n	missense	171	41.03	119	SNP	1.000	A
ZNF598	90850	genome.wustl.edu	37	16	2050140	2050140	+	Silent	SNP	C	C	A	rs549983056		TCGA-AR-A1AH-01A-11D-A12B-09	TCGA-AR-A1AH-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ff4a0f5a-9f30-4a2b-9915-62f2df5ad155	430fb469-2c87-469e-8d23-0473caeefab3	g.chr16:2050140C>A	ENST00000563630.1	-	9	1487	c.1245G>T	c.(1243-1245)ccG>ccT	p.P415P	ZNF598_ENST00000562103.1_Silent_p.P415P|AC005606.15_ENST00000567515.1_lincRNA|ZNF598_ENST00000431526.1_Silent_p.P470P			Q86UK7	ZN598_HUMAN	zinc finger protein 598	470							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GGATGGCGTACGGCAGCGCCA	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16393	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													20.0	24.0	23.0					16																	2050140		1931	4020	5951	-	-	-	SO:0001819	synonymous_variant	0			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.1245G>T	16.37:g.2050140C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Silent	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.P470	ENST00000563630.1	37	c.1410		16																																																																																			ZNF598	-	NULL	ENSG00000167962		0.682	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1	12	0.00	0	C	NM_178167		2050140	2050140	-1	no_errors	ENST00000431526	ensembl	human	known	69_37n	silent	7	56.25	9	SNP	0.000	A
