#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCY3	109	genome.wustl.edu	37	2	25047329	25047329	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr2:25047329C>T	ENST00000260600.5	-	16	3505	c.2654G>A	c.(2653-2655)cGa>cAa	p.R885Q	RP11-443B20.1_ENST00000606114.1_RNA|ADCY3_ENST00000405392.1_Missense_Mutation_p.R472Q	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	885					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GTTCCAGCGTCGCATCTCATA	0.542																																						dbGAP											0													177.0	145.0	156.0					2																	25047329		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2654G>A	2.37:g.25047329C>T	ENSP00000260600:p.Arg885Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R885Q	ENST00000260600.5	37	c.2654	CCDS1715.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.834894	0.97003	.	.	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879	T;T	0.71222	-0.55;-0.55	5.28	5.28	0.74379	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.000000	0.85682	D	0.000000	T	0.79569	0.4468	L	0.43152	1.355	0.58432	D	0.999996	D;D;P	0.89917	0.989;1.0;0.561	P;D;B	0.68192	0.77;0.956;0.05	T	0.79438	-0.1803	10	0.52906	T	0.07	.	18.71	0.91653	0.0:1.0:0.0:0.0	.	886;885;472	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	Q	885;472;860	ENSP00000260600:R885Q;ENSP00000384484:R472Q	ENSP00000260600:R885Q	R	-	2	0	ADCY3	24900833	0.999000	0.42202	0.994000	0.49952	0.996000	0.88848	3.954000	0.56708	2.746000	0.94184	0.655000	0.94253	CGA	ADCY3	-	smart_A/G_cyclase	ENSG00000138031		0.542	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	HGNC	protein_coding	OTTHUMT00000211574.2	172	0.00	0	C			25047329	25047329	-1	no_errors	ENST00000260600	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	1.000	T
ANAPC5	51433	genome.wustl.edu	37	12	121747576	121747576	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr12:121747576G>A	ENST00000261819.3	-	16	2105	c.1984C>T	c.(1984-1986)Cgt>Tgt	p.R662C	ANAPC5_ENST00000541887.1_Missense_Mutation_p.R649C|ANAPC5_ENST00000344395.4_Missense_Mutation_p.R550C|ANAPC5_ENST00000441917.2_Missense_Mutation_p.R550C|ANAPC5_ENST00000535482.1_Missense_Mutation_p.R328C|ANAPC5_ENST00000544314.1_5'UTR	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	662					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AACATGGCACGACCTTTGTCC	0.522																																						dbGAP											0													93.0	84.0	87.0					12																	121747576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.1984C>T	12.37:g.121747576G>A	ENSP00000261819:p.Arg662Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	SNP	smart_TPR_repeat	p.R662C	ENST00000261819.3	37	c.1984	CCDS9220.1	12	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467487	0.43839	.	.	ENSG00000089053	ENST00000441917;ENST00000541887;ENST00000261819;ENST00000535482;ENST00000544314;ENST00000344395	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.75	4.83	0.62350	Tetratricopeptide-like helical (1);	0.109437	0.64402	N	0.000006	T	0.63733	0.2536	N	0.21097	0.63	0.80722	D	1	B;B;B	0.17268	0.015;0.008;0.021	B;B;B	0.13407	0.009;0.002;0.004	T	0.59231	-0.7493	10	0.41790	T	0.15	.	9.63	0.39774	0.1824:0.0:0.8176:0.0	.	328;550;662	F5H0N1;E9PFB2;Q9UJX4	.;.;APC5_HUMAN	C	550;649;662;328;264;550	ENSP00000415061:R550C;ENSP00000439875:R649C;ENSP00000261819:R662C;ENSP00000438754:R328C;ENSP00000343787:R550C	ENSP00000261819:R662C	R	-	1	0	ANAPC5	120231959	1.000000	0.71417	0.987000	0.45799	0.981000	0.71138	2.559000	0.45888	1.363000	0.46019	0.555000	0.69702	CGT	ANAPC5	-	NULL	ENSG00000089053		0.522	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	HGNC	protein_coding	OTTHUMT00000402582.1	53	0.00	0	G			121747576	121747576	-1	no_errors	ENST00000261819	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.999	A
ANGEL2	90806	genome.wustl.edu	37	1	213174228	213174228	+	Silent	SNP	C	C	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr1:213174228C>A	ENST00000366962.3	-	6	1315	c.1161G>T	c.(1159-1161)cgG>cgT	p.R387R	ANGEL2_ENST00000544555.1_Silent_p.R218R|ANGEL2_ENST00000360506.2_Silent_p.R218R|ANGEL2_ENST00000540642.1_Silent_p.R261R|ANGEL2_ENST00000473303.1_5'UTR|ANGEL2_ENST00000535388.1_Intron	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	387										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TTCTTTGTCCCCGTGAAGACT	0.363																																						dbGAP											0													70.0	65.0	67.0					1																	213174228		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.1161G>T	1.37:g.213174228C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.R387	ENST00000366962.3	37	c.1161	CCDS1512.1	1																																																																																			ANGEL2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000174606		0.363	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	298	0.00	0	C	NM_144567		213174228	213174228	-1	no_errors	ENST00000366962	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	1.000	A
ANKRD17	26057	genome.wustl.edu	37	4	73957689	73957689	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr4:73957689G>A	ENST00000358602.4	-	29	5772	c.5656C>T	c.(5656-5658)Cct>Tct	p.P1886S	ANKRD17_ENST00000330838.6_Missense_Mutation_p.P1635S|ANKRD17_ENST00000509867.2_Missense_Mutation_p.P1773S	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1886					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGTGGAGGAGGATATGCTAAT	0.478																																						dbGAP											0													152.0	153.0	153.0					4																	73957689		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.5656C>T	4.37:g.73957689G>A	ENSP00000351416:p.Pro1886Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.P1886S	ENST00000358602.4	37	c.5656	CCDS34004.1	4	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431865	0.43122	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.65178	-0.14;-0.1;-0.13	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000005	T	0.55893	0.1949	N	0.25647	0.755	0.46336	D	0.998997	P;P;P;P	0.42908	0.793;0.793;0.689;0.689	B;B;B;B	0.42738	0.396;0.396;0.223;0.223	T	0.54801	-0.8239	10	0.35671	T	0.21	.	19.4978	0.95081	0.0:0.0:1.0:0.0	.	1885;1635;1886;1773	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	S	1886;1293;1635;1773;270	ENSP00000351416:P1886S;ENSP00000332265:P1635S;ENSP00000427151:P1773S	ENSP00000332265:P1635S	P	-	1	0	ANKRD17	74176553	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.047000	0.57383	2.617000	0.88574	0.467000	0.42956	CCT	ANKRD17	-	NULL	ENSG00000132466		0.478	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD17	HGNC	protein_coding	OTTHUMT00000362475.1	298	0.00	0	G	NM_032217		73957689	73957689	-1	no_errors	ENST00000358602	ensembl	human	known	69_37n	missense	61	11.59	8	SNP	1.000	A
ARID5B	84159	genome.wustl.edu	37	10	63662061	63662061	+	Silent	SNP	G	G	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr10:63662061G>C	ENST00000279873.7	+	2	575	c.165G>C	c.(163-165)gcG>gcC	p.A55A		NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	55					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TTTGCATAGCGGAGCTCCAGC	0.473																																						dbGAP											0													70.0	74.0	73.0					10																	63662061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.165G>C	10.37:g.63662061G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Silent	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.A55	ENST00000279873.7	37	c.165	CCDS31208.1	10																																																																																			ARID5B	-	NULL	ENSG00000150347		0.473	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5B	HGNC	protein_coding	OTTHUMT00000048233.1	201	0.00	0	G	XM_084482		63662061	63662061	+1	no_errors	ENST00000279873	ensembl	human	known	69_37n	silent	28	37.78	17	SNP	1.000	C
BRCA2	675	genome.wustl.edu	37	13	32921032	32921032	+	Splice_Site	SNP	C	C	T	rs80359632|rs397507890|rs431825347		TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr13:32921032C>T	ENST00000380152.3	+	13	7239	c.7006C>T	c.(7006-7008)Cgc>Tgc	p.R2336C	BRCA2_ENST00000544455.1_Splice_Site_p.R2336C			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2336			R -> H (in FANCD1; dbSNP:rs28897743). {ECO:0000269|PubMed:16825431, ECO:0000269|PubMed:17924331}.|R -> Q (in dbSNP:rs28897743).		brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGTACCCTTTCGGTAAGACAT	0.279			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													78.0	79.0	79.0					13																	32921032		2202	4293	6495	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7007+1C>T	13.37:g.32921032C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2,pfscan_BRCA2_repeat	p.R2336C	ENST00000380152.3	37	c.7006	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	C	3.953	-0.011934	0.07727	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.75704	-0.96;-0.96	5.03	-5.6	0.02497	.	0.901808	0.09597	N	0.780759	T	0.37865	0.1019	N	0.01742	-0.745	0.21290	N	0.999738	B	0.02656	0.0	B	0.01281	0.0	T	0.18085	-1.0348	10	0.38643	T	0.18	.	1.7491	0.02968	0.181:0.3815:0.1324:0.3051	.	2336	P51587	BRCA2_HUMAN	C	2336	ENSP00000369497:R2336C;ENSP00000439902:R2336C	ENSP00000369497:R2336C	R	+	1	0	BRCA2	31819032	0.064000	0.20934	0.162000	0.22713	0.356000	0.29392	-0.029000	0.12329	-0.633000	0.05545	-1.324000	0.01287	CGC	BRCA2	-	pirsf_DNA_recomb/repair_BRCA2	ENSG00000139618		0.279	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	461	0.00	0	C	NM_000059	Missense_Mutation	32921032	32921032	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	0.118	T
BRIX1	55299	genome.wustl.edu	37	5	34925371	34925371	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr5:34925371G>C	ENST00000336767.5	+	10	1196	c.833G>C	c.(832-834)aGa>aCa	p.R278T	BRIX1_ENST00000506023.1_3'UTR	NM_018321.3	NP_060791.3	Q8TDN6	BRX1_HUMAN	BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)	278					ribosome biogenesis (GO:0042254)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|lung(1)	4						GCAAAATACAGAGAGAAACAG	0.348																																						dbGAP											0													41.0	38.0	39.0					5																	34925371		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34143.1	5p13.2	2009-09-25	2009-09-25	2009-09-25	ENSG00000113460	ENSG00000113460			24170	protein-coding gene	gene with protein product			"""brix domain containing 2"""	BXDC2		12477932	Standard	NM_018321		Approved	BRIX, FLJ11100	uc003jja.3	Q8TDN6	OTTHUMG00000162021	ENST00000336767.5:c.833G>C	5.37:g.34925371G>C	ENSP00000338862:p.Arg278Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0P5|Q3ZTT4|Q8N453|Q96DH1	Missense_Mutation	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.R278T	ENST00000336767.5	37	c.833	CCDS34143.1	5	.	.	.	.	.	.	.	.	.	.	G	7.243	0.601726	0.13939	.	.	ENSG00000113460	ENST00000336767	T	0.45668	0.89	5.56	-5.97	0.02227	.	0.312793	0.38164	N	0.001785	T	0.29783	0.0744	L	0.41415	1.275	0.39584	D	0.969483	B	0.02656	0.0	B	0.06405	0.002	T	0.22906	-1.0203	10	0.13470	T	0.59	-4.2601	20.2971	0.98561	0.2096:0.0:0.7904:0.0	.	278	Q8TDN6	BRX1_HUMAN	T	278	ENSP00000338862:R278T	ENSP00000338862:R278T	R	+	2	0	BRIX1	34961128	0.072000	0.21174	0.836000	0.33094	0.985000	0.73830	-0.573000	0.05874	-1.149000	0.02843	-0.982000	0.02568	AGA	BRIX1	-	NULL	ENSG00000113460		0.348	BRIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIX1	HGNC	protein_coding	OTTHUMT00000366826.2	81	0.00	0	G	NM_018321		34925371	34925371	+1	no_errors	ENST00000336767	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	0.936	C
CCNB3	85417	genome.wustl.edu	37	X	50052008	50052008	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chrX:50052008delC	ENST00000376042.1	+	6	1137	c.839delC	c.(838-840)accfs	p.T280fs	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Frame_Shift_Del_p.T280fs|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	280					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					TCAATCCCCACCCATAAGTTA	0.413																																						dbGAP											0													70.0	63.0	65.0					X																	50052008		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.839delC	X.37:g.50052008delC	ENSP00000365210:p.Thr280fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Frame_Shift_Del	DEL	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.H281fs	ENST00000376042.1	37	c.839	CCDS14331.1	X																																																																																			CCNB3	-	NULL	ENSG00000147082		0.413	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	88	0.00	0	C			50052008	50052008	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.002	-
CDK19	23097	genome.wustl.edu	37	6	110948277	110948277	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr6:110948277C>T	ENST00000368911.3	-	7	897	c.718G>A	c.(718-720)Gat>Aat	p.D240N	CDK19_ENST00000413605.2_Missense_Mutation_p.D116N|CDK19_ENST00000323817.3_Missense_Mutation_p.D180N	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						GTTTTTATATCTTCCTGACGA	0.348																																						dbGAP											0													122.0	117.0	118.0					6																	110948277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.718G>A	6.37:g.110948277C>T	ENSP00000357907:p.Asp240Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D240N	ENST00000368911.3	37	c.718	CCDS5085.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.137576	0.94517	.	.	ENSG00000155111	ENST00000368911;ENST00000323817;ENST00000392576;ENST00000413605;ENST00000457688	T;T;T;T	0.66280	-0.13;-0.2;0.16;-0.15	5.02	5.02	0.67125	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63426	0.2510	N	0.25647	0.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.992	T	0.68093	-0.5500	10	0.54805	T	0.06	-3.2041	18.3329	0.90276	0.0:1.0:0.0:0.0	.	116;240	B4DUB1;Q9BWU1	.;CDK19_HUMAN	N	240;180;179;116;180	ENSP00000357907:D240N;ENSP00000317665:D180N;ENSP00000410604:D116N;ENSP00000415621:D180N	ENSP00000317665:D180N	D	-	1	0	CDK19	111054970	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.347000	0.79759	0.455000	0.32223	GAT	CDK19	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000155111		0.348	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK19	HGNC	protein_coding	OTTHUMT00000041804.1	407	0.00	0	C	NM_015076		110948277	110948277	-1	no_errors	ENST00000368911	ensembl	human	known	69_37n	missense	47	32.86	23	SNP	1.000	T
CDS1	1040	genome.wustl.edu	37	4	85525478	85525478	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr4:85525478G>C	ENST00000295887.5	+	2	623	c.200G>C	c.(199-201)aGa>aCa	p.R67T		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		TCCTCAGATAGAACCCCTGAG	0.358																																						dbGAP											0													100.0	100.0	100.0					4																	85525478		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.200G>C	4.37:g.85525478G>C	ENSP00000295887:p.Arg67Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_PC_trans,pirsf_PC_Trfase_euk	p.R67T	ENST00000295887.5	37	c.200	CCDS3608.1	4	.	.	.	.	.	.	.	.	.	.	G	11.32	1.602629	0.28534	.	.	ENSG00000163624	ENST00000295887	T	0.42900	0.96	5.55	5.55	0.83447	.	0.124010	0.64402	D	0.000001	T	0.25568	0.0622	N	0.08118	0	0.34438	D	0.699241	B	0.06786	0.001	B	0.08055	0.003	T	0.19160	-1.0314	10	0.15066	T	0.55	-19.0131	18.2792	0.90092	0.0:0.0:1.0:0.0	.	67	Q92903	CDS1_HUMAN	T	67	ENSP00000295887:R67T	ENSP00000295887:R67T	R	+	2	0	CDS1	85744502	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.342000	0.59341	2.624000	0.88883	0.563000	0.77884	AGA	CDS1	-	pirsf_PC_Trfase_euk	ENSG00000163624		0.358	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDS1	HGNC	protein_coding	OTTHUMT00000252817.2	367	0.00	0	G			85525478	85525478	+1	no_errors	ENST00000295887	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	C
CHD3	1107	genome.wustl.edu	37	17	7796726	7796726	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr17:7796726C>T	ENST00000330494.7	+	5	782	c.632C>T	c.(631-633)gCg>gTg	p.A211V	CHD3_ENST00000380358.4_Missense_Mutation_p.A270V|CHD3_ENST00000358181.4_Missense_Mutation_p.A211V	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	211	Poly-Ala.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				gctgtggcggcggcagcggca	0.617																																						dbGAP											0													21.0	21.0	21.0					17																	7796726		2202	4300	6502	-	-	-	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.632C>T	17.37:g.7796726C>T	ENSP00000332628:p.Ala211Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A211V	ENST00000330494.7	37	c.632	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755906	0.69648	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.90676	-2.71;-2.64;-2.65	4.82	4.82	0.62117	.	0.000000	0.39544	N	0.001324	D	0.94827	0.8329	M	0.72353	2.195	0.58432	D	0.99999	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.78314	0.991;0.98;0.986	D	0.94995	0.8138	10	0.59425	D	0.04	-15.8208	18.1079	0.89526	0.0:1.0:0.0:0.0	.	211;211;270	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	V	270;211;211	ENSP00000369716:A270V;ENSP00000350907:A211V;ENSP00000332628:A211V	ENSP00000332628:A211V	A	+	2	0	CHD3	7737451	1.000000	0.71417	0.909000	0.35828	0.987000	0.75469	4.483000	0.60264	2.509000	0.84616	0.555000	0.69702	GCG	CHD3	-	superfamily_HMG_superfamily	ENSG00000170004		0.617	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	54	0.00	0	C	NM_001005273		7796726	7796726	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	T
CMYA5	202333	genome.wustl.edu	37	5	79084809	79084809	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr5:79084809C>G	ENST00000446378.2	+	10	11602	c.11571C>G	c.(11569-11571)atC>atG	p.I3857M	CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3857	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TCTCTGGAATCAAAGGACTCC	0.358																																						dbGAP											0													118.0	113.0	115.0					5																	79084809		1838	4103	5941	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.11571C>G	5.37:g.79084809C>G	ENSP00000394770:p.Ile3857Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.I3857M	ENST00000446378.2	37	c.11571	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863405	0.51482	.	.	ENSG00000164309	ENST00000446378	T	0.53423	0.62	5.6	0.427	0.16489	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58438	0.2122	M	0.73962	2.25	0.45883	D	0.998733	D	0.89917	1.0	D	0.70227	0.968	T	0.56390	-0.7987	9	0.72032	D	0.01	.	1.9259	0.03317	0.1213:0.2614:0.1251:0.4922	.	3857	Q8N3K9	CMYA5_HUMAN	M	3857	ENSP00000394770:I3857M	ENSP00000394770:I3857M	I	+	3	3	CMYA5	79120565	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	0.730000	0.26043	-0.149000	0.11215	-0.157000	0.13467	ATC	CMYA5	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000164309		0.358	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	304	0.00	0	C	NM_153610		79084809	79084809	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.993	G
COL12A1	1303	genome.wustl.edu	37	6	75893090	75893090	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr6:75893090T>G	ENST00000322507.8	-	10	1876	c.1567A>C	c.(1567-1569)Atg>Ctg	p.M523L	COL12A1_ENST00000483888.2_Missense_Mutation_p.M523L|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.M523L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	523	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACATAAGTCATTGCTTTGCCA	0.378																																						dbGAP											0													150.0	146.0	147.0					6																	75893090		1886	4097	5983	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1567A>C	6.37:g.75893090T>G	ENSP00000325146:p.Met523Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.M523L	ENST00000322507.8	37	c.1567	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563449	0.45694	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.61274	0.12;0.12;0.12	5.56	5.56	0.83823	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.38852	0.1056	N	0.01761	-0.735	0.54753	D	0.99998	P;P	0.49696	0.927;0.927	D;D	0.66602	0.945;0.945	T	0.57653	-0.7774	10	0.28530	T	0.3	.	16.002	0.80301	0.0:0.0:0.0:1.0	.	523;523	D6RGG3;Q99715	.;COCA1_HUMAN	L	523	ENSP00000325146:M523L;ENSP00000412864:M523L;ENSP00000421216:M523L	ENSP00000325146:M523L	M	-	1	0	COL12A1	75949810	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.997000	0.88414	2.241000	0.73720	0.533000	0.62120	ATG	COL12A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000111799		0.378	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	199	0.00	0	T	NM_004370		75893090	75893090	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	G
COL1A2	1278	genome.wustl.edu	37	7	94056944	94056944	+	Silent	SNP	C	C	A	rs74315103|rs563540756		TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr7:94056944C>A	ENST00000297268.6	+	49	3744	c.3273C>A	c.(3271-3273)ccC>ccA	p.P1091P		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1091					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGCAGGGCCCCCCTGGTCCCC	0.532										HNSCC(75;0.22)																												dbGAP											0													72.0	80.0	78.0					7																	94056944		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3273C>A	7.37:g.94056944C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C,smart_Fib_collagen_C	p.P1091	ENST00000297268.6	37	c.3273	CCDS34682.1	7																																																																																			COL1A2	-	pfam_Collagen	ENSG00000164692		0.532	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	134	0.00	0	C	NM_000089		94056944	94056944	+1	no_errors	ENST00000297268	ensembl	human	known	69_37n	silent	29	25.64	10	SNP	0.998	A
CYP2A13	1553	genome.wustl.edu	37	19	41594877	41594877	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr19:41594877C>T	ENST00000330436.3	+	2	224	c.224C>T	c.(223-225)cCc>cTc	p.P75L		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	75					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CACTTGGGGCCCCGGCGGGTC	0.642																																						dbGAP											0													88.0	82.0	84.0					19																	41594877		2203	4300	6503	-	-	-	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.224C>T	19.37:g.41594877C>T	ENSP00000332679:p.Pro75Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.P75L	ENST00000330436.3	37	c.224	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	8.766	0.924666	0.18056	.	.	ENSG00000197838	ENST00000330436	T	0.69685	-0.42	3.49	1.2	0.21068	.	0.880911	0.09886	U	0.743079	T	0.57740	0.2074	L	0.48642	1.525	0.09310	N	1	B	0.25351	0.124	B	0.33295	0.161	T	0.47598	-0.9105	10	0.18710	T	0.47	.	6.9502	0.24540	0.1713:0.7298:0.0:0.099	.	75	Q16696	CP2AD_HUMAN	L	75	ENSP00000332679:P75L	ENSP00000332679:P75L	P	+	2	0	CYP2A13	46286717	0.000000	0.05858	0.024000	0.17045	0.203000	0.24098	-0.524000	0.06222	0.258000	0.21686	-0.497000	0.04613	CCC	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000197838		0.642	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	137	0.00	0	C	NM_000766		41594877	41594877	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	0.000	T
DMXL2	23312	genome.wustl.edu	37	15	51766785	51766785	+	Silent	SNP	C	C	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr15:51766785C>G	ENST00000251076.5	-	28	7253	c.6966G>C	c.(6964-6966)gtG>gtC	p.V2322V	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Silent_p.V2323V|DMXL2_ENST00000449909.3_Silent_p.V1686V	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2322						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TAAGTGAGCTCACACCTATAA	0.343																																						dbGAP											0													54.0	53.0	54.0					15																	51766785		2196	4293	6489	-	-	-	SO:0001819	synonymous_variant	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.6966G>C	15.37:g.51766785C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR3|B7ZMH3|F5GWF1|O94938	Nonstop_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.*448S	ENST00000251076.5	37	c.1343	CCDS10141.1	15																																																																																			DMXL2	-	NULL	ENSG00000104093		0.343	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	215	0.00	0	C	NM_015263		51766785	51766785	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000560891	ensembl	human	novel	69_37n	nonstop	21	30.00	9	SNP	1.000	G
DOCK11	139818	genome.wustl.edu	37	X	117679333	117679333	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chrX:117679333A>T	ENST00000276202.7	+	5	503	c.440A>T	c.(439-441)gAt>gTt	p.D147V	DOCK11_ENST00000276204.6_Missense_Mutation_p.D147V	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	147					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTTGAGATAGATGAAGACTGT	0.363																																						dbGAP											0													59.0	55.0	56.0					X																	117679333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.440A>T	X.37:g.117679333A>T	ENSP00000276202:p.Asp147Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D147V	ENST00000276202.7	37	c.440	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	A	21.3	4.127471	0.77549	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.48836	0.8;0.81	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.71091	0.3299	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76545	-0.2920	10	0.87932	D	0	-3.5335	13.1482	0.59474	1.0:0.0:0.0:0.0	.	147	Q5JSL3	DOC11_HUMAN	V	147	ENSP00000276204:D147V;ENSP00000276202:D147V	ENSP00000276202:D147V	D	+	2	0	DOCK11	117563361	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.847000	0.86896	1.745000	0.51790	0.417000	0.27973	GAT	DOCK11	-	NULL	ENSG00000147251		0.363	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	322	0.00	0	A	NM_144658		117679333	117679333	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	T
DUOX2	50506	genome.wustl.edu	37	15	45392973	45392973	+	Silent	SNP	C	C	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr15:45392973C>G	ENST00000603300.1	-	23	3187	c.2985G>C	c.(2983-2985)ctG>ctC	p.L995L	DUOX2_ENST00000389039.6_Silent_p.L995L	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	995	Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		ACCTCTTCTTCAGTCCAGGGC	0.577																																						dbGAP											0													97.0	104.0	101.0					15																	45392973		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.2985G>C	15.37:g.45392973C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.L995	ENST00000603300.1	37	c.2985	CCDS10117.1	15																																																																																			DUOX2	-	NULL	ENSG00000140279		0.577	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding		345	0.00	0	C	NM_014080		45392973	45392973	-1	no_errors	ENST00000389039	ensembl	human	known	69_37n	silent	37	36.21	21	SNP	0.931	G
DYNC1I1	1780	genome.wustl.edu	37	7	95668673	95668673	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr7:95668673C>A	ENST00000324972.6	+	14	1693	c.1500C>A	c.(1498-1500)gaC>gaA	p.D500E	DYNC1I1_ENST00000359388.4_Missense_Mutation_p.D463E|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.D483E|DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.D480E|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.D463E|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.D483E	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	500					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			GCCCAATCGACTTTTCTCACC	0.448																																						dbGAP											0													136.0	123.0	127.0					7																	95668673		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1500C>A	7.37:g.95668673C>A	ENSP00000320130:p.Asp500Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.D500E	ENST00000324972.6	37	c.1500	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	C	22.3	4.271560	0.80469	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.76968	-0.89;-0.85;-1.06;-0.85;-0.84;-0.89	4.27	1.34	0.21922	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82848	0.5126	M	0.65320	2	0.58432	D	0.999995	D;D;D;D;P	0.65815	0.995;0.994;0.994;0.995;0.928	D;D;D;D;P	0.67382	0.951;0.919;0.919;0.951;0.614	T	0.81586	-0.0865	10	0.87932	D	0	-0.0035	9.4026	0.38442	0.0:0.7478:0.0:0.2522	.	483;480;483;500;463	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	E	483;500;463;480;463;483	ENSP00000392337:D483E;ENSP00000320130:D500E;ENSP00000438377:D463E;ENSP00000398118:D480E;ENSP00000352348:D463E;ENSP00000412444:D483E	ENSP00000320130:D500E	D	+	3	2	DYNC1I1	95506609	0.998000	0.40836	0.998000	0.56505	0.986000	0.74619	0.623000	0.24447	0.285000	0.22329	0.557000	0.71058	GAC	DYNC1I1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000158560		0.448	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	HGNC	protein_coding	OTTHUMT00000333432.1	166	0.00	0	C	NM_004411		95668673	95668673	+1	no_errors	ENST00000324972	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	1.000	A
IGHV3-7	28452	genome.wustl.edu	37	14	106518523	106518523	+	RNA	SNP	C	C	A	rs369520613	byFrequency	TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr14:106518523C>A	ENST00000390598.2	-	0	306									immunoglobulin heavy variable 3-7																		CATAGTATTTCTCACTTCCAT	0.522																																						dbGAP											0													244.0	238.0	240.0					14																	106518523		1922	4123	6045	-	-	-			0			M99649		14q32.33	2012-02-08			ENSG00000211938	ENSG00000211938		"""Immunoglobulins / IGH locus"""	5620	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152271		14.37:g.106518523C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E76D	ENST00000390598.2	37	c.228		14																																																																																			IGHV3-7	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211938		0.522	IGHV3-7-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-7	HGNC	IG_V_gene	OTTHUMT00000325659.1	441	0.23	1	C	NG_001019		106518523	106518523	-1	no_stop_codon	ENST00000390598	ensembl	human	known	69_37n	missense	113	17.52	24	SNP	0.000	A
IGSF10	285313	genome.wustl.edu	37	3	151160895	151160895	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr3:151160895G>A	ENST00000282466.3	-	5	5839	c.5840C>T	c.(5839-5841)tCc>tTc	p.S1947F	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1947	Ig-like C2-type 6.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCTTTTCTGGGATGCAGCTTC	0.478																																						dbGAP											0													137.0	135.0	136.0					3																	151160895		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5840C>T	3.37:g.151160895G>A	ENSP00000282466:p.Ser1947Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S1947F	ENST00000282466.3	37	c.5840	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644138	0.47258	.	.	ENSG00000152580	ENST00000489791;ENST00000282466;ENST00000544042	T;T	0.68765	-0.35;-0.35	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000220	T	0.78780	0.4337	L	0.51853	1.615	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.78386	-0.2224	10	0.49607	T	0.09	.	19.1316	0.93410	0.0:0.0:1.0:0.0	.	1947	Q6WRI0	IGS10_HUMAN	F	15;1947;574	ENSP00000417627:S15F;ENSP00000282466:S1947F	ENSP00000282466:S1947F	S	-	2	0	IGSF10	152643585	1.000000	0.71417	0.833000	0.33012	0.049000	0.14656	6.535000	0.73838	2.545000	0.85829	0.591000	0.81541	TCC	IGSF10	-	pfam_Ig_I-set,pfscan_Ig-like	ENSG00000152580		0.478	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	274	0.00	0	G	NM_178822		151160895	151160895	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	missense	60	24.05	19	SNP	0.999	A
KCNN3	3782	genome.wustl.edu	37	1	154842243	154842243	+	Silent	SNP	A	A	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr1:154842243A>C	ENST00000271915.4	-	1	513	c.198T>G	c.(196-198)ctT>ctG	p.L66L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggag	0.701																																						dbGAP											0													6.0	4.0	5.0					1																	154842243		1926	3811	5737	-	-	-	SO:0001819	synonymous_variant	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.198T>G	1.37:g.154842243A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.L66	ENST00000271915.4	37	c.198	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	21	0.00	0	A	NM_002249		154842243	154842243	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent	22	21.43	6	SNP	0.000	C
LACTB2	51110	genome.wustl.edu	37	8	71581315	71581315	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr8:71581315C>G	ENST00000276590.4	-	1	77	c.41G>C	c.(40-42)cGa>cCa	p.R14P	XKR9_ENST00000408926.3_5'Flank|XKR9_ENST00000520030.1_5'Flank|LACTB2_ENST00000522447.1_Missense_Mutation_p.R14P	NM_016027.2	NP_057111.1	Q53H82	LACB2_HUMAN	lactamase, beta 2	14						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|prostate(1)	10	Breast(64;0.0716)		Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)			ACGCACGACTCGATTGGACAG	0.647											OREG0018822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													45.0	38.0	40.0					8																	71581315		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF151841	CCDS6208.1	8q13.3	2005-10-14			ENSG00000147592	ENSG00000147592			18512	protein-coding gene	gene with protein product							Standard	NM_016027		Approved	CGI-83	uc003xyp.3	Q53H82	OTTHUMG00000164430	ENST00000276590.4:c.41G>C	8.37:g.71581315C>G	ENSP00000276590:p.Arg14Pro	Somatic	1131	WXS	Illumina GAIIx	Phase_IV	A8K2D6|Q9Y392	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.R14P	ENST00000276590.4	37	c.41	CCDS6208.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.306614	0.95629	.	.	ENSG00000147592	ENST00000522447;ENST00000276590	T;T	0.44083	0.93;0.93	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.69797	0.3151	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.72704	-0.4213	10	0.30854	T	0.27	-27.3844	17.7342	0.88388	0.0:1.0:0.0:0.0	.	14	Q53H82	LACB2_HUMAN	P	14	ENSP00000428801:R14P;ENSP00000276590:R14P	ENSP00000276590:R14P	R	-	2	0	LACTB2	71743869	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	7.146000	0.77373	2.429000	0.82318	0.650000	0.86243	CGA	LACTB2	-	NULL	ENSG00000147592		0.647	LACTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LACTB2	HGNC	protein_coding	OTTHUMT00000378748.1	20	0.00	0	C	NM_016027		71581315	71581315	-1	no_errors	ENST00000276590	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	1.000	G
LCTL	197021	genome.wustl.edu	37	15	66853439	66853439	+	Splice_Site	DEL	C	C	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr15:66853439delC	ENST00000341509.5	-	6	741	c.610delG	c.(610-612)gca>ca	p.A204fs	LCTL_ENST00000563438.1_5'Flank|LCTL_ENST00000537670.1_Splice_Site_p.A31fs	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	204					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCTGCCATTGCCTATAGGGAC	0.582																																						dbGAP											0													66.0	66.0	66.0					15																	66853439		2201	4299	6500	-	-	-	SO:0001630	splice_region_variant	0			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.610-1G>-	15.37:g.66853439delC		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQY0	Frame_Shift_Del	DEL	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.A204fs	ENST00000341509.5	37	c.610	CCDS10220.1	15																																																																																			LCTL	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000188501		0.582	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCTL	HGNC	protein_coding	OTTHUMT00000256921.2	67	0.00	0	C	NM_207338	Frame_Shift_Del	66853439	66853439	-1	no_errors	ENST00000341509	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	1.000	-
LENG1	79165	genome.wustl.edu	37	19	54660722	54660722	+	Silent	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr19:54660722G>A	ENST00000222224.3	-	3	540	c.354C>T	c.(352-354)ggC>ggT	p.G118G		NM_024316.1	NP_077292.1	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1	118										breast(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	8	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTGCACTCTGGCCCAGGTATG	0.592																																						dbGAP											0													54.0	50.0	51.0					19																	54660722		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF211966	CCDS12881.1	19q13.4	2008-02-05			ENSG00000105617	ENSG00000105617			15502	protein-coding gene	gene with protein product						10941842	Standard	NM_024316		Approved		uc002qdm.3	Q96BZ8	OTTHUMG00000066486	ENST00000222224.3:c.354C>T	19.37:g.54660722G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HCU7	Silent	SNP	NULL	p.G118	ENST00000222224.3	37	c.354	CCDS12881.1	19																																																																																			LENG1	-	NULL	ENSG00000105617		0.592	LENG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG1	HGNC	protein_coding	OTTHUMT00000142159.1	80	0.00	0	G	NM_024316		54660722	54660722	-1	no_errors	ENST00000222224	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	1.000	A
LPCAT1	79888	genome.wustl.edu	37	5	1463930	1463930	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr5:1463930C>T	ENST00000283415.3	-	14	1573	c.1441G>A	c.(1441-1443)Gaa>Aaa	p.E481K	LPCAT1_ENST00000503252.1_5'UTR	NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	481	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		GGGTACATTTCTGCAAACCTG	0.527																																						dbGAP											0													125.0	121.0	122.0					5																	1463930		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.1441G>A	5.37:g.1463930C>T	ENSP00000283415:p.Glu481Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E481K	ENST00000283415.3	37	c.1441	CCDS3864.1	5	.	.	.	.	.	.	.	.	.	.	C	6.366	0.435681	0.12104	.	.	ENSG00000153395	ENST00000283415	T	0.78924	-1.22	4.29	3.41	0.39046	EF-hand-like domain (1);	0.384600	0.31134	N	0.008190	T	0.67401	0.2889	L	0.58669	1.825	0.37716	D	0.924757	B	0.14438	0.01	B	0.21151	0.033	T	0.58775	-0.7577	10	0.06236	T	0.91	-12.5831	8.6931	0.34278	0.0:0.8902:0.0:0.1098	.	481	Q8NF37	PCAT1_HUMAN	K	481	ENSP00000283415:E481K	ENSP00000283415:E481K	E	-	1	0	LPCAT1	1516930	0.377000	0.25106	0.028000	0.17463	0.020000	0.10135	1.376000	0.34306	1.933000	0.56026	0.561000	0.74099	GAA	LPCAT1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000153395		0.527	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	HGNC	protein_coding	OTTHUMT00000304032.1	198	0.00	0	C	NM_024830		1463930	1463930	-1	no_errors	ENST00000283415	ensembl	human	known	69_37n	missense	76	26.21	27	SNP	0.472	T
MC5R	4161	genome.wustl.edu	37	18	13826448	13826448	+	Silent	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr18:13826448G>A	ENST00000324750.3	+	1	906	c.684G>A	c.(682-684)gcG>gcA	p.A228A	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	228				ALPGASSARQRTSM -> LCPGPALRGRGPAW (in Ref. 1). {ECO:0000305}.	G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						CCAGCTCTGCGCGGCAGAGGA	0.617																																						dbGAP											0													210.0	180.0	190.0					18																	13826448		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.684G>A	18.37:g.13826448G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ34|Q502V1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Melancort_rcpt_5,prints_Melcrt_ACTH_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Melancort_rcpt	p.A228	ENST00000324750.3	37	c.684	CCDS11868.1	18																																																																																			MC5R	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Melancort_rcpt_5	ENSG00000176136		0.617	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC5R	HGNC	protein_coding	OTTHUMT00000254638.1	166	0.00	0	G	NM_005913		13826448	13826448	+1	no_errors	ENST00000324750	ensembl	human	known	69_37n	silent	61	17.57	13	SNP	0.998	A
MPP2	4355	genome.wustl.edu	37	17	41960570	41960570	+	Splice_Site	SNP	C	C	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr17:41960570C>A	ENST00000461854.1	-	5	461		c.e5+1		MPP2_ENST00000523501.1_Splice_Site|MPP2_ENST00000473246.1_Splice_Site|MPP2_ENST00000518766.1_Splice_Site|MPP2_ENST00000269095.4_Splice_Site|MPP2_ENST00000520305.1_Splice_Site|MPP2_ENST00000377184.3_Splice_Site|MPP2_ENST00000536246.1_Splice_Site			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)						nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		CAGCCAGGAACCTGGAAGTGG	0.662																																						dbGAP											0													20.0	21.0	20.0					17																	41960570		2199	4299	6498	-	-	-	SO:0001630	splice_region_variant	0				CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.375+1G>T	17.37:g.41960570C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Splice_Site	SNP	-	e4+1	ENST00000461854.1	37	c.375+1		17	.	.	.	.	.	.	.	.	.	.	C	20.8	4.047339	0.75846	.	.	ENSG00000108852	ENST00000377184;ENST00000269095;ENST00000461854;ENST00000523501;ENST00000536246;ENST00000518766;ENST00000523220;ENST00000520406;ENST00000523762;ENST00000523934;ENST00000520241;ENST00000521178	.	.	.	3.84	3.84	0.44239	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3463	0.60575	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MPP2	39316096	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.620000	0.83070	1.983000	0.57843	0.449000	0.29647	.	MPP2	-	-	ENSG00000108852		0.662	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	MPP2	HGNC	protein_coding	OTTHUMT00000258388.2	25	0.00	0	C	NM_005374	Intron	41960570	41960570	-1	no_errors	ENST00000461854	ensembl	human	known	69_37n	splice_site	13	27.78	5	SNP	1.000	A
MSR1	4481	genome.wustl.edu	37	8	16007748	16007748	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr8:16007748delC	ENST00000262101.5	-	7	1092	c.971delG	c.(970-972)ggafs	p.G324fs	MSR1_ENST00000536385.1_Frame_Shift_Del_p.G98fs|MSR1_ENST00000350896.3_Frame_Shift_Del_p.G324fs|MSR1_ENST00000445506.2_Frame_Shift_Del_p.G342fs|MSR1_ENST00000381998.4_Frame_Shift_Del_p.G324fs|MSR1_ENST00000355282.2_Frame_Shift_Del_p.G324fs			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	324	Collagen-like.				cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		ACCTGGCCTTCCGGCATATCC	0.338																																						dbGAP											0													34.0	34.0	34.0					8																	16007748		2203	4298	6501	-	-	-	SO:0001589	frameshift_variant	0			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.971delG	8.37:g.16007748delC	ENSP00000262101:p.Gly324fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSP3|O60505|P21759|Q45F10	Frame_Shift_Del	DEL	pfam_Srcr_rcpt,pfam_Macro_scav_rcpt,pfam_Collagen,superfamily_Srcr_rcpt-rel,superfamily_STAT_TF_coiled-coil,smart_Srcr_rcpt-rel,prints_Macro_scav_rcpt,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.G324fs	ENST00000262101.5	37	c.971	CCDS5995.1	8																																																																																			MSR1	-	pfam_Collagen	ENSG00000038945		0.338	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSR1	HGNC	protein_coding	OTTHUMT00000211627.2	58	0.00	0	C			16007748	16007748	-1	no_errors	ENST00000262101	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	0.784	-
CMC4	100272147	genome.wustl.edu	37	X	154290173	154290173	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chrX:154290173G>T	ENST00000369484.3	-	3	830	c.152C>A	c.(151-153)tCa>tAa	p.S51*	CMC4_ENST00000369479.1_Nonsense_Mutation_p.S51*	NM_001018024.2	NP_001018024.1	P56277	CMC4_HUMAN	C-x(9)-C motif containing 4	51					cell proliferation (GO:0008283)	mitochondrion (GO:0005739)											TTCAAATCCTGAACAGACGAC	0.418																																						dbGAP											0													157.0	135.0	143.0					X																	154290173		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS14764.1	Xq28	2013-10-18	2013-10-18	2012-10-15	ENSG00000182712	ENSG00000182712			35428	protein-coding gene	gene with protein product	"""mature T-cell proliferation 1, isoform p8"""		"""mature T-cell proliferation 1 neighbor"", ""C-x(9)-C motif containing 4 homolog (S. cerevisiae)"""	MTCP1, MTCP1NB		8361760, 9405159, 20922212	Standard	NM_001018024		Approved	P8MTCP1, p8	uc004fmy.3	P56277	OTTHUMG00000158504	ENST00000369484.3:c.152C>A	X.37:g.154290173G>T	ENSP00000358496:p.Ser51*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HYP9	Nonsense_Mutation	SNP	pfam_MTCP1,superfamily_MTCP1	p.S51*	ENST00000369484.3	37	c.152	CCDS14764.1	X	.	.	.	.	.	.	.	.	.	.	G	42	9.220398	0.99105	.	.	ENSG00000182712	ENST00000369484;ENST00000369479	.	.	.	5.41	5.41	0.78517	.	0.176252	0.21024	U	0.081457	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1342	15.0938	0.72217	0.0:0.0:1.0:0.0	.	.	.	.	X	51	.	ENSP00000358491:S51X	S	-	2	0	MTCP1NB	153943367	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	6.856000	0.75450	2.402000	0.81655	0.600000	0.82982	TCA	MTCP1NB	-	pfam_MTCP1,superfamily_MTCP1	ENSG00000182712		0.418	CMC4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	MTCP1NB	HGNC	protein_coding	OTTHUMT00000037822.2	408	0.24	1	G	NM_001018024.2		154290173	154290173	-1	no_errors	ENST00000369479	ensembl	human	known	69_37n	nonsense	51	19.05	12	SNP	1.000	T
MYH7	4625	genome.wustl.edu	37	14	23894170	23894170	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr14:23894170C>A	ENST00000355349.3	-	22	2649	c.2487G>T	c.(2485-2487)tgG>tgT	p.W829C		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	829					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		AGAGCTTCATCCAGGGCCAAT	0.552																																						dbGAP											0													84.0	83.0	83.0					14																	23894170		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2487G>T	14.37:g.23894170C>A	ENSP00000347507:p.Trp829Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.W829C	ENST00000355349.3	37	c.2487	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183270	0.78677	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.93547	-3.24	4.6	4.6	0.57074	.	.	.	.	.	D	0.98261	0.9424	H	0.98936	4.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99709	1.1006	9	0.87932	D	0	.	17.9586	0.89078	0.0:1.0:0.0:0.0	.	829	P12883	MYH7_HUMAN	C	829	ENSP00000347507:W829C	ENSP00000347507:W829C	W	-	3	0	MYH7	22964010	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.210000	0.77924	2.543000	0.85770	0.563000	0.77884	TGG	MYH7	-	NULL	ENSG00000092054		0.552	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	223	0.00	0	C	NM_000257		23894170	23894170	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	A
MYOM3	127294	genome.wustl.edu	37	1	24402671	24402671	+	Silent	SNP	G	G	A	rs528961807	byFrequency	TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr1:24402671G>A	ENST00000374434.3	-	21	2841	c.2679C>T	c.(2677-2679)ccC>ccT	p.P893P	MYOM3_ENST00000330966.7_Silent_p.P894P|RP11-293P20.4_ENST00000429191.1_RNA|MYOM3_ENST00000329601.7_Silent_p.P893P|RP11-293P20.2_ENST00000439239.2_RNA	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	893	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CCAGGAGCACGGGATCAGTGG	0.622																																						dbGAP											0													62.0	68.0	66.0					1																	24402671		1998	4165	6163	-	-	-	SO:0001819	synonymous_variant	0			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.2679C>T	1.37:g.24402671G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P894	ENST00000374434.3	37	c.2682	CCDS41281.1	1																																																																																			MYOM3	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000142661		0.622	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	HGNC	protein_coding	OTTHUMT00000008272.2	80	0.00	0	G	NM_152372		24402671	24402671	-1	no_errors	ENST00000330966	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	0.003	A
NEURL4	84461	genome.wustl.edu	37	17	7225003	7225003	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr17:7225003G>A	ENST00000399464.2	-	18	2990	c.2975C>T	c.(2974-2976)cCa>cTa	p.P992L	NEURL4_ENST00000570460.1_Missense_Mutation_p.P968L|NEURL4_ENST00000315614.7_Missense_Mutation_p.P990L|NEURL4_ENST00000574120.1_5'Flank|RP11-542C16.2_ENST00000575474.1_5'Flank	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	992	NHR 5. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGGCAGCCCTGGGCCACCACC	0.622																																						dbGAP											0													38.0	47.0	44.0					17																	7225003		2050	4178	6228	-	-	-	SO:0001583	missense	0				CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.2975C>T	17.37:g.7225003G>A	ENSP00000382390:p.Pro992Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GPI8|Q96IU9|Q9H0B0	Nonsense_Mutation	SNP	pfam_Neu_Z,superfamily_ConA-like_lec_gl,smart_Neu_Z,pfscan_Neu_Z	p.Q955*	ENST00000399464.2	37	c.2863	CCDS42251.1	17	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656610	0.67586	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.30182	1.54;1.55	5.52	4.56	0.56223	NEUZ (2);	0.069504	0.64402	D	0.000012	T	0.17323	0.0416	N	0.04880	-0.145	0.46521	D	0.999088	B;B	0.13145	0.007;0.004	B;B	0.12156	0.007;0.003	T	0.04090	-1.0978	10	0.54805	T	0.06	-4.6933	13.5235	0.61582	0.0767:0.0:0.9233:0.0	.	990;992	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	L	990;992	ENSP00000319826:P990L;ENSP00000382390:P992L	ENSP00000319826:P990L	P	-	2	0	NEURL4	7165727	1.000000	0.71417	0.746000	0.31095	0.932000	0.56968	4.774000	0.62339	1.475000	0.48197	0.655000	0.94253	CCA	NEURL4	-	smart_Neu_Z,pfscan_Neu_Z	ENSG00000215041		0.622	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEURL4	HGNC	protein_coding	OTTHUMT00000255434.2	34	0.00	0	G	NM_032442		7225003	7225003	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000571887	ensembl	human	novel	69_37n	nonsense	11	26.67	4	SNP	0.948	A
NLRP12	91662	genome.wustl.edu	37	19	54313970	54313970	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr19:54313970delC	ENST00000324134.6	-	3	1111	c.943delG	c.(943-945)gagfs	p.E316fs	NLRP12_ENST00000354278.3_Frame_Shift_Del_p.E316fs|NLRP12_ENST00000391772.1_Frame_Shift_Del_p.E316fs|NLRP12_ENST00000391775.3_Frame_Shift_Del_p.E316fs|NLRP12_ENST00000535162.1_Frame_Shift_Del_p.E316fs|NLRP12_ENST00000351894.4_Frame_Shift_Del_p.E316fs|NLRP12_ENST00000391773.1_Frame_Shift_Del_p.E316fs|NLRP12_ENST00000345770.5_Frame_Shift_Del_p.E316fs	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	316	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CGTTTCTCCTCCCAGCAGAGG	0.567																																						dbGAP											0													43.0	46.0	45.0					19																	54313970		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.943delG	19.37:g.54313970delC	ENSP00000319377:p.Glu316fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Frame_Shift_Del	DEL	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E315fs	ENST00000324134.6	37	c.943	CCDS12864.1	19																																																																																			NLRP12	-	pfscan_NACHT_NTPase	ENSG00000142405		0.567	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	52	0.00	0	C	NM_144687		54313970	54313970	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.995	-
OSR2	116039	genome.wustl.edu	37	8	99963751	99963751	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr8:99963751C>T	ENST00000297565.4	+	4	1257	c.761C>T	c.(760-762)tCt>tTt	p.S254F	OSR2_ENST00000457907.2_Missense_Mutation_p.S375F|OSR2_ENST00000522510.1_Missense_Mutation_p.S254F|OSR2_ENST00000435298.2_Intron	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	254					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			GAACAGGAATCTCCACACAAA	0.428																																						dbGAP											0													84.0	69.0	74.0					8																	99963751		692	1591	2283	-	-	-	SO:0001583	missense	0			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.761C>T	8.37:g.99963751C>T	ENSP00000297565:p.Ser254Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S375F	ENST00000297565.4	37	c.1124	CCDS47901.1	8	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128201	0.77549	.	.	ENSG00000164920	ENST00000297565;ENST00000522510;ENST00000457907	T;T;T	0.15139	2.45;2.45;2.45	5.5	5.5	0.81552	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.32071	0.0817	L	0.39326	1.205	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.61201	0.76;0.885	T	0.00252	-1.1876	9	.	.	.	-10.3146	19.6014	0.95563	0.0:1.0:0.0:0.0	.	375;254	B4E3B7;Q8N2R0	.;OSR2_HUMAN	F	254;254;375	ENSP00000297565:S254F;ENSP00000430780:S254F;ENSP00000414657:S375F	.	S	+	2	0	OSR2	100032927	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.482000	0.81143	2.854000	0.98071	0.655000	0.94253	TCT	OSR2	-	pfscan_Znf_C2H2	ENSG00000164920		0.428	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSR2	HGNC	protein_coding	OTTHUMT00000379505.1	98	0.00	0	C	NM_053001		99963751	99963751	+1	no_errors	ENST00000457907	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	1.000	T
PCDHGA1	56114	genome.wustl.edu	37	5	140711613	140711613	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr5:140711613G>T	ENST00000517417.1	+	1	1362	c.1362G>T	c.(1360-1362)caG>caT	p.Q454H	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.Q454H|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	454	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTCCATCAGGACTCCTACT	0.468																																						dbGAP											0													129.0	132.0	131.0					5																	140711613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1362G>T	5.37:g.140711613G>T	ENSP00000431083:p.Gln454His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M273|Q9Y5D6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q454H	ENST00000517417.1	37	c.1362	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	G	0.196	-1.048972	0.01981	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.01767	4.65;4.65	3.89	1.13	0.20643	Cadherin (3);Cadherin-like (1);	0.307705	0.23289	N	0.049806	T	0.01661	0.0053	L	0.48877	1.53	0.09310	N	1	B;B	0.16166	0.016;0.009	B;B	0.17433	0.018;0.012	T	0.50074	-0.8870	10	0.02654	T	1	.	9.1315	0.36848	0.2479:0.0:0.7521:0.0	.	454;454	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	H	454	ENSP00000431083:Q454H;ENSP00000367345:Q454H	ENSP00000367345:Q454H	Q	+	3	2	PCDHGA1	140691797	0.000000	0.05858	0.500000	0.27589	0.225000	0.24961	-0.295000	0.08298	0.111000	0.17947	-0.769000	0.03391	CAG	PCDHGA1	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000204956		0.468	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	344	0.00	0	G	NM_018912		140711613	140711613	+1	no_errors	ENST00000517417	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	0.001	T
PDGFB	5155	genome.wustl.edu	37	22	39626161	39626161	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr22:39626161delC	ENST00000331163.6	-	5	1316	c.529delG	c.(529-531)gcafs	p.A177fs	PDGFB_ENST00000381551.4_Frame_Shift_Del_p.A162fs	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	177					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)		COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					CACTTGCATGCCAGGTGGTCT	0.582			T	COL1A1	DFSP																																	dbGAP		Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	0													78.0	73.0	75.0					22																	39626161		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.529delG	22.37:g.39626161delC	ENSP00000330382:p.Ala177fs	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Frame_Shift_Del	DEL	pfam_PD_growth_factor,pfam_PDGF_N,smart_PD_growth_factor,pfscan_PD_growth_factor	p.A177fs	ENST00000331163.6	37	c.529	CCDS13987.1	22																																																																																			PDGFB	-	pfam_PD_growth_factor,smart_PD_growth_factor,pfscan_PD_growth_factor	ENSG00000100311		0.582	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFB	HGNC	protein_coding	OTTHUMT00000321043.1	45	0.00	0	C	NM_002608		39626161	39626161	-1	no_errors	ENST00000331163	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.995	-
PDRG1	81572	genome.wustl.edu	37	20	30534308	30534308	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr20:30534308C>G	ENST00000202017.4	-	4	440	c.310G>C	c.(310-312)Gag>Cag	p.E104Q		NM_030815.2	NP_110442.1	Q9NUG6	PDRG1_HUMAN	p53 and DNA-damage regulated 1	104					protein folding (GO:0006457)	cytoplasm (GO:0005737)|prefoldin complex (GO:0016272)				endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	8			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCTTGGGCCTCAAAAAGGCGG	0.483																																						dbGAP											0													152.0	138.0	143.0					20																	30534308		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031658	CCDS13194.1	20q11.21	2009-06-12	2009-06-12	2004-10-07	ENSG00000088356	ENSG00000088356			16119	protein-coding gene	gene with protein product		610789	"""chromosome 20 open reading frame 126"""	C20orf126		14562055	Standard	NM_030815		Approved	dJ310O13.3	uc002wxd.3	Q9NUG6	OTTHUMG00000032196	ENST00000202017.4:c.310G>C	20.37:g.30534308C>G	ENSP00000202017:p.Glu104Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R511|Q96GP3|Q9BUW8	Missense_Mutation	SNP	pfam_PFD_beta-like,superfamily_Prefoldin	p.E104Q	ENST00000202017.4	37	c.310	CCDS13194.1	20	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206107	0.79127	.	.	ENSG00000088356	ENST00000202017	T	0.48836	0.8	5.64	5.64	0.86602	Prefoldin beta-like (1);	0.000000	0.85682	D	0.000000	T	0.68348	0.2991	M	0.75447	2.3	0.58432	D	0.999992	D	0.76494	0.999	D	0.72075	0.976	T	0.70103	-0.4964	10	0.66056	D	0.02	-23.8116	15.5531	0.76170	0.0:1.0:0.0:0.0	.	104	Q9NUG6	PDRG1_HUMAN	Q	104	ENSP00000202017:E104Q	ENSP00000202017:E104Q	E	-	1	0	PDRG1	29997969	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.247000	0.65416	2.816000	0.96949	0.563000	0.77884	GAG	PDRG1	-	pfam_PFD_beta-like,superfamily_Prefoldin	ENSG00000088356		0.483	PDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDRG1	HGNC	protein_coding	OTTHUMT00000078593.2	283	0.00	0	C	NM_030815		30534308	30534308	-1	no_errors	ENST00000202017	ensembl	human	known	69_37n	missense	92	21.37	25	SNP	1.000	G
PDXDC1	23042	genome.wustl.edu	37	16	15112739	15112739	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr16:15112739C>T	ENST00000396410.4	+	12	1103	c.1006C>T	c.(1006-1008)Ctc>Ttc	p.L336F	PDXDC1_ENST00000455313.2_Missense_Mutation_p.L313F|PDXDC1_ENST00000563679.1_Missense_Mutation_p.L354F|PDXDC1_ENST00000325823.7_Missense_Mutation_p.L321F|RP11-680G24.5_ENST00000565178.1_RNA|PDXDC1_ENST00000535621.2_Missense_Mutation_p.L336F|PDXDC1_ENST00000450288.2_Missense_Mutation_p.L308F|PDXDC1_ENST00000447912.2_Missense_Mutation_p.L245F|PDXDC1_ENST00000569715.1_Missense_Mutation_p.L309F	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	336					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CACAGACAAACTCCGTGCCCT	0.418																																						dbGAP											0													138.0	135.0	136.0					16																	15112739		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1006C>T	16.37:g.15112739C>T	ENSP00000379691:p.Leu336Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.L336F	ENST00000396410.4	37	c.1006	CCDS32393.1	16	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633185	0.87660	.	.	ENSG00000179889	ENST00000325823;ENST00000447912;ENST00000535621;ENST00000396410;ENST00000450288;ENST00000537781;ENST00000455313	T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37	5.22	5.22	0.72569	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.983	D;D;D;D;D;P	0.79108	0.992;0.992;0.989;0.992;0.992;0.835	T	0.53436	-0.8439	10	0.33940	T	0.23	-4.2522	17.7462	0.88421	0.0:1.0:0.0:0.0	.	308;245;336;308;336;313	E7EPL4;E7EMH5;Q86XE2;B4DR55;Q6P996;Q6P996-2	.;.;.;.;PDXD1_HUMAN;.	F	321;245;336;336;308;42;313	ENSP00000322807:L321F;ENSP00000400310:L245F;ENSP00000437835:L336F;ENSP00000379691:L336F;ENSP00000391147:L308F;ENSP00000406703:L313F	ENSP00000322807:L321F	L	+	1	0	PDXDC1	15020240	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.865000	0.75500	2.426000	0.82243	0.478000	0.44815	CTC	PDXDC1	-	superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000179889		0.418	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXDC1	HGNC	protein_coding	OTTHUMT00000389065.2	1013	0.00	0	C	NM_015027		15112739	15112739	+1	no_errors	ENST00000396410	ensembl	human	known	69_37n	missense	208	14.40	35	SNP	1.000	T
PKDREJ	10343	genome.wustl.edu	37	22	46654720	46654720	+	Silent	SNP	A	A	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr22:46654720A>C	ENST00000253255.5	-	1	4499	c.4500T>G	c.(4498-4500)ccT>ccG	p.P1500P		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1500					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTTTAGATGCAGGTTTTGCAA	0.502																																						dbGAP											0													181.0	179.0	179.0					22																	46654720		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.4500T>G	22.37:g.46654720A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJY3|O95850	Silent	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_LipOase_LH2,pfscan_LipOase_LH2,pfscan_REJ-like,prints_PKD_2	p.P1500	ENST00000253255.5	37	c.4500	CCDS14073.1	22																																																																																			PKDREJ	-	NULL	ENSG00000130943		0.502	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	417	0.00	0	A	NM_006071		46654720	46654720	-1	no_errors	ENST00000253255	ensembl	human	known	69_37n	silent	80	32.20	38	SNP	0.000	C
HELZ2	85441	genome.wustl.edu	37	20	62193250	62193251	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr20:62193250_62193251insG	ENST00000467148.1	-	11	6685_6686	c.6616_6617insC	c.(6616-6618)cgtfs	p.R2206fs	HELZ2_ENST00000427522.2_Frame_Shift_Ins_p.R1637fs	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2206	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTTCTCCCCACGGGGGGGGCCT	0.649																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.6617dupC	20.37:g.62193258_62193258dupG	ENSP00000417401:p.Arg2206fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Frame_Shift_Ins	INS	pfam_RNase_II/R,smart_RNase_II/R	p.R2206fs	ENST00000467148.1	37	c.6617_6616	CCDS33508.1	20																																																																																			RP4-697K14.7	-	NULL	ENSG00000130589		0.649	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	9	0.00	0	-	NM_001037335		62193250	62193251	-1	no_errors	ENST00000467148	ensembl	human	known	69_37n	frame_shift_ins	2	50.00	2	INS	0.000:0.000	G
PRKD1	5587	genome.wustl.edu	37	14	30095732	30095732	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr14:30095732C>G	ENST00000331968.5	-	12	1985	c.1756G>C	c.(1756-1758)Gat>Cat	p.D586H	PRKD1_ENST00000415220.2_Missense_Mutation_p.D594H	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	586	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AGTACTTCATCAGGAAAAATC	0.308																																						dbGAP											0													54.0	57.0	56.0					14																	30095732		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1756G>C	14.37:g.30095732C>G	ENSP00000333568:p.Asp586His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL64|B2RAF6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.D586H	ENST00000331968.5	37	c.1756	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751184	0.89753	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	D;D	0.82711	-1.64;-1.64	5.46	5.46	0.80206	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86674	0.5989	L	0.31371	0.925	0.80722	D	1	D	0.54207	0.965	D	0.64410	0.925	D	0.87883	0.2679	10	0.87932	D	0	-19.7087	19.6697	0.95907	0.0:1.0:0.0:0.0	.	586	Q15139	KPCD1_HUMAN	H	586;594	ENSP00000333568:D586H;ENSP00000390535:D594H	ENSP00000333568:D586H	D	-	1	0	PRKD1	29165483	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.704000	0.84595	2.724000	0.93272	0.650000	0.86243	GAT	PRKD1	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000184304		0.308	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	185	0.00	0	C	NM_002742		30095732	30095732	-1	no_errors	ENST00000331968	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	G
PSMD7	5713	genome.wustl.edu	37	16	74334086	74334086	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr16:74334086G>A	ENST00000219313.4	+	2	288	c.148G>A	c.(148-150)Gta>Ata	p.V50I	PSMD7_ENST00000567958.1_Missense_Mutation_p.V50I|PSMD7_ENST00000568615.2_Missense_Mutation_p.V50I|PSMD7_ENST00000540379.1_5'UTR	NM_002811.4	NP_002802.2	P51665	PSMD7_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 7	50	MPN.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	15						AGTACTTGATGTATCGAACAG	0.373																																						dbGAP											0													130.0	107.0	115.0					16																	74334086		2198	4300	6498	-	-	-	SO:0001583	missense	0			D50063	CCDS10910.1	16q22.3	2010-10-15	2007-07-06		ENSG00000103035	ENSG00000103035		"""Proteasome (prosome, macropain) subunits"""	9565	protein-coding gene	gene with protein product	"""Mov34 homolog"""	157970	"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)"""			7755639	Standard	NM_002811		Approved	S12, P40, MOV34, Rpn8	uc002fcq.3	P51665	OTTHUMG00000137601	ENST00000219313.4:c.148G>A	16.37:g.74334086G>A	ENSP00000219313:p.Val50Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWS9|Q6PKI2|Q96E97	Missense_Mutation	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.V50I	ENST00000219313.4	37	c.148	CCDS10910.1	16	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356940	0.61293	.	.	ENSG00000103035	ENST00000219313	T	0.50548	0.74	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.41236	0.1150	N	0.20574	0.59	0.80722	D	1	B	0.15930	0.015	B	0.29862	0.108	T	0.17684	-1.0361	10	0.38643	T	0.18	-17.2056	19.8109	0.96545	0.0:0.0:1.0:0.0	.	50	P51665	PSD7_HUMAN	I	50	ENSP00000219313:V50I	ENSP00000219313:V50I	V	+	1	0	PSMD7	72891587	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.797000	0.99108	2.691000	0.91804	0.591000	0.81541	GTA	PSMD7	-	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	ENSG00000103035		0.373	PSMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD7	HGNC	protein_coding	OTTHUMT00000269010.2	325	0.00	0	G	NM_002811		74334086	74334086	+1	no_errors	ENST00000219313	ensembl	human	known	69_37n	missense	82	15.46	15	SNP	1.000	A
RAG1	5896	genome.wustl.edu	37	11	36597453	36597453	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr11:36597453G>A	ENST00000299440.5	+	2	2711	c.2599G>A	c.(2599-2601)Gat>Aat	p.D867N		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	867					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				AGAGACTGTGGATGCAGTTTG	0.488									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	dbGAP											0													124.0	119.0	121.0					11																	36597453		2202	4298	6500	-	-	-	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2599G>A	11.37:g.36597453G>A	ENSP00000299440:p.Asp867Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.D867N	ENST00000299440.5	37	c.2599	CCDS7902.1	11	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986925	0.35036	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.87650	-2.28;-2.28	5.94	5.94	0.96194	.	0.051705	0.85682	D	0.000000	D	0.85327	0.5671	L	0.42245	1.32	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.79676	-0.1704	10	0.87932	D	0	.	20.4384	0.99098	0.0:0.0:1.0:0.0	.	867	P15918	RAG1_HUMAN	N	867	ENSP00000434610:D867N;ENSP00000299440:D867N	ENSP00000299440:D867N	D	+	1	0	RAG1	36554029	1.000000	0.71417	0.223000	0.23860	0.184000	0.23303	7.628000	0.83189	2.831000	0.97527	0.644000	0.83932	GAT	RAG1	-	NULL	ENSG00000166349		0.488	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	HGNC	protein_coding	OTTHUMT00000389535.1	178	0.00	0	G	NM_000448		36597453	36597453	+1	no_errors	ENST00000299440	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	1.000	A
RAMP3	10268	genome.wustl.edu	37	7	45222967	45222967	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr7:45222967delG	ENST00000242249.4	+	3	441	c.403delG	c.(403-405)ggcfs	p.G135fs	RAMP3_ENST00000481345.1_Frame_Shift_Del_p.G135fs|RAMP3_ENST00000496212.1_Frame_Shift_Del_p.G135fs	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	135					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CGCCATGGCTGGCCTGGTGGT	0.617																																						dbGAP											0													118.0	110.0	113.0					7																	45222967		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.403delG	7.37:g.45222967delG	ENSP00000242249:p.Gly135fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z2Y1	Frame_Shift_Del	DEL	pfam_RAMP	p.G135fs	ENST00000242249.4	37	c.403	CCDS5503.1	7																																																																																			RAMP3	-	pfam_RAMP	ENSG00000122679		0.617	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAMP3	HGNC	protein_coding	OTTHUMT00000251343.1	33	0.00	0	G	NM_005856		45222967	45222967	+1	no_errors	ENST00000242249	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.034	-
RFX6	222546	genome.wustl.edu	37	6	117252535	117252535	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr6:117252535T>C	ENST00000332958.2	+	19	2669	c.2653T>C	c.(2653-2655)Tgt>Cgt	p.C885R		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	885					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CTCATCCCAATGTATGTATGG	0.408																																						dbGAP											0													158.0	153.0	155.0					6																	117252535		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2653T>C	6.37:g.117252535T>C	ENSP00000332208:p.Cys885Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.C885R	ENST00000332958.2	37	c.2653	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	T	20.1	3.934075	0.73442	.	.	ENSG00000185002	ENST00000332958	T	0.74315	-0.83	5.98	5.98	0.97165	.	0.104642	0.64402	D	0.000003	T	0.77003	0.4067	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.79727	-0.1682	10	0.56958	D	0.05	-20.1864	16.4696	0.84102	0.0:0.0:0.0:1.0	.	885	Q8HWS3	RFX6_HUMAN	R	885	ENSP00000332208:C885R	ENSP00000332208:C885R	C	+	1	0	RFX6	117359228	1.000000	0.71417	0.999000	0.59377	0.832000	0.47134	7.263000	0.78421	2.289000	0.77006	0.482000	0.46254	TGT	RFX6	-	NULL	ENSG00000185002		0.408	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	370	0.00	0	T	NM_173560		117252535	117252535	+1	no_errors	ENST00000332958	ensembl	human	known	69_37n	missense	67	12.99	10	SNP	1.000	C
RSPH10B2	728194	genome.wustl.edu	37	7	6820992	6820992	+	Missense_Mutation	SNP	A	A	G	rs201342603	byFrequency	TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr7:6820992A>G	ENST00000403107.1	+	14	2030	c.1643A>G	c.(1642-1644)tAc>tGc	p.Y548C	RSPH10B2_ENST00000404077.1_Missense_Mutation_p.Y548C|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000359718.3_3'UTR|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.Y548C|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.Y548C			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	548								p.Y548C(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						CGGACGCTCTACTCTATGAGT	0.408													A|||	7	0.00139776	0.0	0.0	5008	,	,		13482	0.004		0.002	False		,,,				2504	0.001					dbGAP											2	Substitution - Missense(2)	pancreas(2)											18.0	18.0	18.0					7																	6820992		1684	3667	5351	-	-	-	SO:0001583	missense	0				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.1643A>G	7.37:g.6820992A>G	ENSP00000384766:p.Tyr548Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.Y548C	ENST00000403107.1	37	c.1643	CCDS43552.1	7	80	0.03663003663003663	1	0.0020325203252032522	26	0.0718232044198895	7	0.012237762237762238	46	0.06068601583113457	A	6.491	0.458703	0.12342	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859;ENST00000540958	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	3.38	0.748	0.18376	.	0.455544	0.18532	N	0.138477	T	0.02727	0.0082	L	0.43701	1.375	0.09310	N	1	B;B	0.18461	0.028;0.013	B;B	0.13407	0.009;0.007	T	0.06499	-1.0823	10	0.45353	T	0.12	.	3.7397	0.08524	0.6939:0.0:0.1159:0.1902	.	407;548	B3KSE9;B2RC85	.;R10B2_HUMAN	C	548;548;548;548;407	ENSP00000384766:Y548C;ENSP00000386102:Y548C;ENSP00000297186:Y548C;ENSP00000416710:Y548C	ENSP00000297186:Y548C	Y	+	2	0	RSPH10B2	6787517	0.000000	0.05858	0.002000	0.10522	0.056000	0.15407	0.157000	0.16402	0.052000	0.16007	0.149000	0.16113	TAC	RSPH10B2	-	NULL	ENSG00000169402		0.408	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B2	HGNC	protein_coding	OTTHUMT00000324184.4	59	0.00	0	A	NM_001099697		6820992	6820992	+1	no_errors	ENST00000297186	ensembl	human	known	69_37n	missense	9	18.18	2	SNP	0.009	G
SLC7A3	84889	genome.wustl.edu	37	X	70147461	70147461	+	Frame_Shift_Del	DEL	G	G	-	rs371343602		TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chrX:70147461delG	ENST00000374299.3	-	7	1200	c.1056delC	c.(1054-1056)tccfs	p.S352fs	SLC7A3_ENST00000298085.4_Frame_Shift_Del_p.S352fs			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	352					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TGGGGAACATGGAGCCCAGGA	0.567																																						dbGAP											0													46.0	34.0	38.0					X																	70147461		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1056delC	X.37:g.70147461delG	ENSP00000363417:p.Ser352fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Frame_Shift_Del	DEL	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.M353fs	ENST00000374299.3	37	c.1056	CCDS14404.1	X																																																																																			SLC7A3	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	ENSG00000165349		0.567	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	HGNC	protein_coding	OTTHUMT00000057080.1	65	0.00	0	G	NM_032803		70147461	70147461	-1	no_errors	ENST00000298085	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.997	-
CTBS	1486	genome.wustl.edu	37	1	85018772	85018772	+	3'UTR	DEL	A	A	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr1:85018772delA	ENST00000370630.5	-	0	3116				CTBS_ENST00000477677.1_5'Flank	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-						chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)	p.I452fs*1(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		ACTGGCACAGAAAAAAAAAAT	0.239																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)								84,112,2696		6,0,72,9,94,1265	4.0	4.0	4.0			4.5	1.0	1		5	187,225,6094		21,3,142,14,194,2879	no	near-gene-3				27,3,214,23,288,4144	A1A1,A1A2,A1R,A2A2,A2R,RR		6.3326,6.7773,6.4695			85018772	271,337,8790	1533	3494	5027	-	-	-	SO:0001624	3_prime_UTR_variant	0			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.*1910T>-	1.37:g.85018772delA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX50	RNA	DEL	-	NULL	ENST00000370630.5	37	NULL	CCDS698.1	1																																																																																			SPATA1	-	-	ENSG00000122432		0.239	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA1	HGNC	protein_coding	OTTHUMT00000027457.2	71	0.00	0	A	NM_004388		85018772	85018772	+1	no_errors	ENST00000460286	ensembl	human	known	69_37n	rna	8	21.43	3	DEL	1.000	-
TAF7	6879	genome.wustl.edu	37	5	140699073	140699073	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr5:140699073C>G	ENST00000313368.5	-	1	1257	c.539G>C	c.(538-540)cGg>cCg	p.R180P		NM_005642.2	NP_005633.2	Q15545	TAF7_HUMAN	TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa	180					DNA-templated transcription, initiation (GO:0006352)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of histone acetylation (GO:0035067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermine transport (GO:0000296)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	histone acetyltransferase binding (GO:0035035)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|vitamin D receptor binding (GO:0042809)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATTTCCCACCGAGTACTAAC	0.438																																						dbGAP											0													109.0	109.0	109.0					5																	140699073		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF349038	CCDS4259.1	5q31	2008-02-05	2002-08-29	2001-12-07	ENSG00000178913	ENSG00000178913			11541	protein-coding gene	gene with protein product		600573	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, F, 55kD"""	TAF2F		7824954	Standard	NM_005642		Approved	TAFII55	uc003ljg.3	Q15545	OTTHUMG00000129628	ENST00000313368.5:c.539G>C	5.37:g.140699073C>G	ENSP00000312709:p.Arg180Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV9|Q13036	Missense_Mutation	SNP	pfam_TAFII55_prot_cons_reg	p.R180P	ENST00000313368.5	37	c.539	CCDS4259.1	5	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946296	0.73672	.	.	ENSG00000178913	ENST00000313368	T	0.25912	1.77	5.08	5.08	0.68730	.	0.055057	0.64402	D	0.000001	T	0.51686	0.1689	M	0.85542	2.76	0.58432	D	0.999999	D	0.71674	0.998	P	0.59056	0.851	T	0.58549	-0.7617	10	0.87932	D	0	-3.3019	16.3808	0.83460	0.0:1.0:0.0:0.0	.	180	Q15545	TAF7_HUMAN	P	180	ENSP00000312709:R180P	ENSP00000312709:R180P	R	-	2	0	TAF7	140679257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.809000	0.62591	2.826000	0.97356	0.655000	0.94253	CGG	TAF7	-	NULL	ENSG00000178913		0.438	TAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF7	HGNC	protein_coding	OTTHUMT00000251823.2	319	0.00	0	C	NM_005642		140699073	140699073	-1	no_errors	ENST00000313368	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	G
TAPT1	202018	genome.wustl.edu	37	4	16177795	16177795	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr4:16177795C>T	ENST00000405303.2	-	9	1137	c.1054G>A	c.(1054-1056)Gtg>Atg	p.V352M	TAPT1_ENST00000304584.8_Missense_Mutation_p.V133M|TAPT1_ENST00000399920.3_Missense_Mutation_p.V241M|RP11-452J21.2_ENST00000513586.1_RNA	NM_153365.2	NP_699196.2	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation 1	352					embryonic skeletal system development (GO:0048706)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|post-embryonic development (GO:0009791)	integral component of membrane (GO:0016021)	growth hormone-releasing hormone receptor activity (GO:0016520)			NS(1)|breast(2)|cervix(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	10						ACAATATCCACGGCAATTTCT	0.303																																						dbGAP											0													66.0	64.0	64.0					4																	16177795		1844	4089	5933	-	-	-	SO:0001583	missense	0			AK074494	CCDS47030.1	4p15.32	2014-01-28			ENSG00000169762	ENSG00000169762			26887	protein-coding gene	gene with protein product		612758				12477932	Standard	NM_153365		Approved	FLJ90013	uc010ied.1	Q6NXT6	OTTHUMG00000160177	ENST00000405303.2:c.1054G>A	4.37:g.16177795C>T	ENSP00000385347:p.Val352Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2S3|Q9NZK9	Missense_Mutation	SNP	pfam_Membrane_Tatp1/CMV_rcpt	p.V352M	ENST00000405303.2	37	c.1054	CCDS47030.1	4	.	.	.	.	.	.	.	.	.	.	C	29.4	5.005067	0.93287	.	.	ENSG00000169762	ENST00000405303;ENST00000542770;ENST00000399920;ENST00000304584	T;T	0.59502	0.26;0.36	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.81498	0.4835	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84052	0.0370	10	0.87932	D	0	-15.5648	20.0804	0.97772	0.0:1.0:0.0:0.0	.	352	Q6NXT6	TAPT1_HUMAN	M	352;352;241;133	ENSP00000385347:V352M;ENSP00000382803:V241M	ENSP00000305198:V133M	V	-	1	0	TAPT1	15786893	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.458000	0.80787	2.738000	0.93877	0.655000	0.94253	GTG	TAPT1	-	pfam_Membrane_Tatp1/CMV_rcpt	ENSG00000169762		0.303	TAPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAPT1	HGNC	protein_coding	OTTHUMT00000359568.1	380	0.00	0	C	NM_153365		16177795	16177795	-1	no_errors	ENST00000405303	ensembl	human	known	69_37n	missense	26	34.15	14	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577130	7577130	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr17:7577130A>T	ENST00000269305.4	-	8	997	c.808T>A	c.(808-810)Ttt>Att	p.F270I	TP53_ENST00000359597.4_Missense_Mutation_p.F270I|TP53_ENST00000420246.2_Missense_Mutation_p.F270I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.F270I|TP53_ENST00000445888.2_Missense_Mutation_p.F270I|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	270	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F270L(15)|p.0?(8)|p.F270V(7)|p.F270I(5)|p.S269_F270>I(2)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.S269fs*75(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.S269_F270insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCACCTCAAAGCTGTTCCGT	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Substitution - Missense(27)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(2)|Complex - deletion inframe(2)|Insertion - In frame(1)	stomach(8)|large_intestine(7)|breast(5)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|urinary_tract(2)|soft_tissue(1)|biliary_tract(1)|testis(1)|eye(1)|ovary(1)|liver(1)											58.0	51.0	53.0					17																	7577130		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.808T>A	17.37:g.7577130A>T	ENSP00000269305:p.Phe270Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F270I	ENST00000269305.4	37	c.808	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	32	5.156372	0.94686	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99588	0.9851	L	0.58101	1.795	0.58432	D	0.999999	D;B;D;D	0.89917	1.0;0.306;1.0;0.999	D;B;D;D	0.80764	0.994;0.197;0.993;0.994	D	0.97644	1.0150	10	0.87932	D	0	-25.5181	12.9367	0.58319	1.0:0.0:0.0:0.0	.	270;270;270;270	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	I	270;270;270;270;270;259;138	ENSP00000352610:F270I;ENSP00000269305:F270I;ENSP00000398846:F270I;ENSP00000391127:F270I;ENSP00000391478:F270I;ENSP00000425104:F138I	ENSP00000269305:F270I	F	-	1	0	TP53	7517855	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.060000	0.93907	2.154000	0.67381	0.379000	0.24179	TTT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	156	0.00	0	A	NM_000546		7577130	7577130	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	23	36.11	13	SNP	1.000	T
TRBV4-2	28616	genome.wustl.edu	37	7	142045705	142045705	+	RNA	SNP	G	G	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr7:142045705G>C	ENST00000390392.3	+	0	344									T cell receptor beta variable 4-2																		GAAAACAACAGTGTGCCAAGT	0.483																																						dbGAP											0													199.0	225.0	217.0					7																	142045705		2019	4206	6225	-	-	-			0			U07975		7q34	2012-02-07			ENSG00000211745	ENSG00000211745		"""T cell receptors / TRB locus"""	12216	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV42, TCRBV4S2, TCRBV7S3A2T			OTTHUMG00000158525		7.37:g.142045705G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S78T	ENST00000390392.3	37	c.233		7																																																																																			TRBV4-2	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211745		0.483	TRBV4-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV4-2	HGNC	TR_V_gene	OTTHUMT00000351231.1	334	0.00	0	G	NG_001333		142045705	142045705	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390392	ensembl	human	known	69_37n	missense	82	22.64	24	SNP	0.000	C
TRPM6	140803	genome.wustl.edu	37	9	77455078	77455078	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr9:77455078G>A	ENST00000360774.1	-	5	643	c.406C>T	c.(406-408)Ccc>Tcc	p.P136S	TRPM6_ENST00000376864.4_Missense_Mutation_p.P136S|TRPM6_ENST00000359047.2_Missense_Mutation_p.P136S|TRPM6_ENST00000376872.3_Missense_Mutation_p.P136S|TRPM6_ENST00000361255.3_Missense_Mutation_p.P131S|TRPM6_ENST00000449912.2_Missense_Mutation_p.P131S|TRPM6_ENST00000451710.3_Missense_Mutation_p.P136S|TRPM6_ENST00000376871.3_Missense_Mutation_p.P136S	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	136					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ACAAGCTTGGGCAGTTCCATT	0.388																																						dbGAP											0													118.0	112.0	114.0					9																	77455078		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.406C>T	9.37:g.77455078G>A	ENSP00000354006:p.Pro136Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P136S	ENST00000360774.1	37	c.406	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	30	5.057644	0.93846	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864;ENST00000359047	T;T;T;T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.53286	0.1787	M	0.90252	3.1	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.945;1.0;0.977	T	0.60667	-0.7218	10	0.87932	D	0	.	20.2019	0.98263	0.0:0.0:1.0:0.0	.	136;136;136;136;136;131	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q96LV9;Q9BX84;Q9BX84-3	.;.;.;.;TRPM6_HUMAN;.	S	136;136;136;136;131;131;135;136;136	ENSP00000354006:P136S;ENSP00000407341:P136S;ENSP00000366068:P136S;ENSP00000366067:P136S;ENSP00000396672:P131S;ENSP00000354962:P131S;ENSP00000366060:P136S;ENSP00000351942:P136S	ENSP00000351942:P136S	P	-	1	0	TRPM6	76644898	1.000000	0.71417	0.993000	0.49108	0.999000	0.98932	9.869000	0.99810	2.776000	0.95493	0.655000	0.94253	CCC	TRPM6	-	NULL	ENSG00000119121		0.388	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	332	0.00	0	G	NM_017662		77455078	77455078	-1	no_errors	ENST00000451710	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	1.000	A
GNPTG	84572	genome.wustl.edu	37	16	1400125	1400125	+	5'Flank	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr16:1400125C>T	ENST00000204679.4	+	0	0				TSR3_ENST00000007390.2_Missense_Mutation_p.E213K	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit						carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				TGCAGCACCTCCTCCGGGCTG	0.632																																						dbGAP											0													25.0	28.0	27.0					16																	1400125		2192	4298	6490	-	-	-	SO:0001631	upstream_gene_variant	0			BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835		16.37:g.1400125C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R556|Q6XYD7|Q96L13	Missense_Mutation	SNP	pfam_DUF367,pfam_RNaseL-inhib_metal-bd_dom	p.E213K	ENST00000204679.4	37	c.637	CCDS10436.1	16	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130785	0.56828	.	.	ENSG00000007520	ENST00000007390	.	.	.	5.03	2.96	0.34315	Domain of unknown function DUF367 (2);	0.199310	0.51477	D	0.000083	T	0.77824	0.4188	M	0.80746	2.51	0.58432	D	0.999999	D	0.63046	0.992	D	0.70487	0.969	T	0.79410	-0.1815	9	0.72032	D	0.01	-20.6021	12.8631	0.57924	0.0:0.6852:0.3148:0.0	.	213	Q9UJK0	TSR3_HUMAN	K	213	.	ENSP00000007390:E213K	E	-	1	0	C16orf42	1340126	0.940000	0.31905	0.755000	0.31263	0.019000	0.09904	2.419000	0.44671	0.457000	0.26962	0.491000	0.48974	GAG	TSR3	-	pfam_DUF367	ENSG00000007520		0.632	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR3	HGNC	protein_coding	OTTHUMT00000109058.2	47	0.00	0	C	NM_032520		1400125	1400125	-1	no_errors	ENST00000007390	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	1.000	T
TTC39B	158219	genome.wustl.edu	37	9	15210087	15210087	+	Splice_Site	DEL	T	T	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr9:15210087delT	ENST00000512701.2	-	6	726	c.690delA	c.(688-690)gaa>ga	p.E232fs	TTC39B_ENST00000355694.2_Splice_Site_p.E166fs|TTC39B_ENST00000380850.4_Splice_Site_p.E232fs|TTC39B_ENST00000297615.5_Splice_Site_p.E163fs|TTC39B_ENST00000507993.1_Splice_Site_p.E67fs|TTC39B_ENST00000507285.1_Splice_Site_p.E67fs|TTC39B_ENST00000541445.1_Splice_Site_p.E166fs			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	232										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						GACTTTTACCTTCACTCAGTT	0.303																																						dbGAP											0													56.0	60.0	59.0					9																	15210087		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.691+1A>-	9.37:g.15210087delT		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Frame_Shift_Del	DEL	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.E231fs	ENST00000512701.2	37	c.690	CCDS6477.2	9																																																																																			TTC39B	-	pfam_OMP_IML2_mit/TPR_39	ENSG00000155158		0.303	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	134	0.00	0	T	NM_152574	Frame_Shift_Del	15210087	15210087	-1	no_errors	ENST00000512701	ensembl	human	known	69_37n	frame_shift_del	8	20.00	2	DEL	1.000	-
UFL1	23376	genome.wustl.edu	37	6	97001226	97001226	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr6:97001226G>C	ENST00000369278.4	+	19	2298	c.2232G>C	c.(2230-2232)aaG>aaC	p.K744N		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	744					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										GTCAAAGTAAGAAGACTGGGC	0.373																																						dbGAP											0													107.0	100.0	103.0					6																	97001226		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.2232G>C	6.37:g.97001226G>C	ENSP00000358283:p.Lys744Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Missense_Mutation	SNP	pfam_E3_UFM1_ligase_1	p.K744N	ENST00000369278.4	37	c.2232	CCDS5034.1	6	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572926	0.28092	.	.	ENSG00000014123	ENST00000369278	T	0.45668	0.89	5.33	4.46	0.54185	.	0.263556	0.43579	D	0.000545	T	0.18383	0.0441	L	0.51422	1.61	0.41486	D	0.988199	P	0.44734	0.842	B	0.34536	0.185	T	0.03684	-1.1013	10	0.20046	T	0.44	-15.4006	14.3541	0.66724	0.0717:0.0:0.9283:0.0	.	744	O94874	UFL1_HUMAN	N	744	ENSP00000358283:K744N	ENSP00000358283:K744N	K	+	3	2	KIAA0776	97107947	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.975000	0.29449	1.391000	0.46566	0.650000	0.86243	AAG	UFL1	-	NULL	ENSG00000014123		0.373	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	511	0.00	0	G	NM_015323		97001226	97001226	+1	no_errors	ENST00000369278	ensembl	human	known	69_37n	missense	68	12.82	10	SNP	1.000	C
USP32	84669	genome.wustl.edu	37	17	58275782	58275782	+	Silent	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr17:58275782C>T	ENST00000300896.4	-	27	3467	c.3273G>A	c.(3271-3273)ctG>ctA	p.L1091L	USP32_ENST00000592339.1_Silent_p.L761L	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1091	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TCTGAGATGACAGGAAATACA	0.438																																						dbGAP											0													139.0	128.0	132.0					17																	58275782		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3273G>A	17.37:g.58275782C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5T3|Q9BX85|Q9Y591	Silent	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_EF_hand_Ca-bd,smart_Pept_C19_DUSP,pfscan_EF_HAND_2,pfscan_Peptidase_C19,prints_Recoverin	p.L1091	ENST00000300896.4	37	c.3273	CCDS32697.1	17																																																																																			USP32	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000170832		0.438	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	HGNC	protein_coding	OTTHUMT00000449235.2	418	0.00	0	C	NM_032582		58275782	58275782	-1	no_errors	ENST00000300896	ensembl	human	known	69_37n	silent	69	18.82	16	SNP	1.000	T
USP47	55031	genome.wustl.edu	37	11	11964198	11964198	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr11:11964198G>T	ENST00000399455.2	+	21	2810	c.2690G>T	c.(2689-2691)aGc>aTc	p.S897I	USP47_ENST00000339865.5_Missense_Mutation_p.S809I|USP47_ENST00000527733.1_Missense_Mutation_p.S877I|USP47_ENST00000539466.1_5'UTR	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	897					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		GGGGACAGCAGCAAAAGTACT	0.423																																						dbGAP											0													67.0	65.0	65.0					11																	11964198		1968	4140	6108	-	-	-	SO:0001583	missense	0			AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.2690G>T	11.37:g.11964198G>T	ENSP00000382382:p.Ser897Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.S897I	ENST00000399455.2	37	c.2690		11	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913021	0.52439	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455;ENST00000540365	T;T;T	0.04502	3.61;3.61;3.61	5.81	5.81	0.92471	.	0.136901	0.64402	D	0.000001	T	0.05410	0.0143	N	0.19112	0.55	0.80722	D	1	P;B;P	0.37864	0.61;0.38;0.514	B;B;B	0.38056	0.136;0.136;0.264	T	0.54016	-0.8356	10	0.31617	T	0.26	.	19.6863	0.95981	0.0:0.0:1.0:0.0	.	897;877;809	Q96K76;E9PM46;Q96K76-2	UBP47_HUMAN;.;.	I	809;877;897;94	ENSP00000339957:S809I;ENSP00000433146:S877I;ENSP00000382382:S897I	ENSP00000339957:S809I	S	+	2	0	USP47	11920774	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.259000	0.65485	2.746000	0.94184	0.591000	0.81541	AGC	USP47	-	NULL	ENSG00000170242		0.423	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	USP47	HGNC	protein_coding	OTTHUMT00000385853.2	125	0.00	0	G	NM_017944		11964198	11964198	+1	no_errors	ENST00000399455	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	T
ZDBF2	57683	genome.wustl.edu	37	2	207174888	207174888	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr2:207174888delC	ENST00000374423.3	+	5	6022	c.5636delC	c.(5635-5637)gctfs	p.A1879fs		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1879							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GTTACCTGGGCTGACTTGCAA	0.443																																						dbGAP											0													55.0	54.0	54.0					2																	207174888		1972	4155	6127	-	-	-	SO:0001589	frameshift_variant	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5636delC	2.37:g.207174888delC	ENSP00000363545:p.Ala1879fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNP7|Q6ZSN8	Frame_Shift_Del	DEL	pfam_Znf_DBF,smart_Znf_DBF	p.A1879fs	ENST00000374423.3	37	c.5636	CCDS46501.1	2																																																																																			ZDBF2	-	NULL	ENSG00000204186		0.443	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	161	0.00	0	C	NM_020923		207174888	207174888	+1	no_errors	ENST00000374423	ensembl	human	known	69_37n	frame_shift_del	27	20.00	7	DEL	0.000	-
ZNF330	27309	genome.wustl.edu	37	4	142151378	142151378	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr4:142151378T>A	ENST00000262990.4	+	7	705	c.477T>A	c.(475-477)ttT>ttA	p.F159L	ZNF330_ENST00000421169.2_Missense_Mutation_p.F99L	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	159						chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					ATGATCAATTTGAGCATCAAG	0.303																																						dbGAP											0													98.0	103.0	102.0					4																	142151378		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.477T>A	4.37:g.142151378T>A	ENSP00000262990:p.Phe159Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA3	Missense_Mutation	SNP	pfam_NOA36	p.F159L	ENST00000262990.4	37	c.477	CCDS3754.1	4	.	.	.	.	.	.	.	.	.	.	T	29.8	5.038238	0.93630	.	.	ENSG00000109445	ENST00000262990;ENST00000512809;ENST00000421169	T;T;T	0.39056	1.1;1.1;1.1	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.56187	0.1968	M	0.70595	2.14	0.80722	D	1	P;P	0.47034	0.889;0.798	P;B	0.51229	0.663;0.331	T	0.60332	-0.7284	10	0.66056	D	0.02	-6.1139	16.161	0.81712	0.0:0.0:0.0:1.0	.	99;159	E9PDK6;Q9Y3S2	.;ZN330_HUMAN	L	159;159;99	ENSP00000262990:F159L;ENSP00000422599:F159L;ENSP00000397397:F99L	ENSP00000262990:F159L	F	+	3	2	ZNF330	142370828	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.288000	0.72679	2.218000	0.71995	0.379000	0.24179	TTT	ZNF330	-	pfam_NOA36	ENSG00000109445		0.303	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF330	HGNC	protein_coding	OTTHUMT00000257271.2	483	0.00	0	T	NM_014487		142151378	142151378	+1	no_errors	ENST00000262990	ensembl	human	known	69_37n	missense	64	13.51	10	SNP	1.000	A
ZNF675	171392	genome.wustl.edu	37	19	23836780	23836780	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr19:23836780T>G	ENST00000359788.4	-	4	1123	c.955A>C	c.(955-957)Aag>Cag	p.K319Q	ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	319					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GTAAAAGCCTTGCCACATTCT	0.373																																						dbGAP											0													53.0	57.0	55.0					19																	23836780		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.955A>C	19.37:g.23836780T>G	ENSP00000352836:p.Lys319Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N211	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K319Q	ENST00000359788.4	37	c.955	CCDS32981.1	19	.	.	.	.	.	.	.	.	.	.	.	10.52	1.374472	0.24857	.	.	ENSG00000197372	ENST00000359788	T	0.35973	1.28	0.916	0.916	0.19373	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.55625	0.1932	M	0.81112	2.525	0.25077	N	0.99096	D	0.76494	0.999	D	0.71870	0.975	T	0.40924	-0.9537	9	0.72032	D	0.01	.	6.7351	0.23405	0.0:0.0:0.0:1.0	.	319	Q8TD23	ZN675_HUMAN	Q	319	ENSP00000352836:K319Q	ENSP00000352836:K319Q	K	-	1	0	ZNF675	23628620	0.798000	0.28890	0.159000	0.22649	0.160000	0.22226	2.091000	0.41691	0.257000	0.21650	0.254000	0.18369	AAG	ZNF675	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197372		0.373	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF675	HGNC	protein_coding	OTTHUMT00000466433.1	202	0.00	0	T	NM_138330		23836780	23836780	-1	no_errors	ENST00000359788	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.993	G
ZNF582	147948	genome.wustl.edu	37	19	56896091	56896091	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AI-01A-11D-A12Q-09	TCGA-AR-A1AI-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	842846ea-881c-4d79-88d2-fc1703c58350	e1aef6e6-ad91-48f0-8d2e-52c680cd81f8	g.chr19:56896091C>T	ENST00000301310.4	-	5	853	c.695G>A	c.(694-696)tGt>tAt	p.C232Y	AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Missense_Mutation_p.C232Y	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		GGCCTTTCCACATTCCTTACA	0.353																																					Ovarian(183;1887 2032 4349 30507 51343)	dbGAP											0													64.0	66.0	65.0					19																	56896091		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.695G>A	19.37:g.56896091C>T	ENSP00000301310:p.Cys232Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C232Y	ENST00000301310.4	37	c.695	CCDS33121.1	19	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924880	0.52759	.	.	ENSG00000018869	ENST00000301310	D	0.85861	-2.04	4.88	4.88	0.63580	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38548	N	0.001647	D	0.93697	0.7986	M	0.89840	3.065	0.47094	D	0.999316	D;P	0.89917	1.0;0.929	D;B	0.85130	0.997;0.366	D	0.94619	0.7811	10	0.72032	D	0.01	.	17.3131	0.87215	0.0:1.0:0.0:0.0	.	232;263	Q96NG8;B4DQZ9	ZN582_HUMAN;.	Y	232	ENSP00000301310:C232Y	ENSP00000301310:C232Y	C	-	2	0	ZNF582	61587903	1.000000	0.71417	0.598000	0.28837	0.073000	0.16967	7.154000	0.77437	2.679000	0.91253	0.655000	0.94253	TGT	ZNF582	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000018869		0.353	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	229	0.00	0	C	NM_144690		56896091	56896091	-1	no_errors	ENST00000301310	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	T
