#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD13D	338692	genome.wustl.edu	37	11	67066581	67066581	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr11:67066581G>A	ENST00000447274.2	+	7	1698	c.523G>A	c.(523-525)Ggc>Agc	p.G175S	ANKRD13D_ENST00000515828.1_5'Flank|ANKRD13D_ENST00000511455.2_Missense_Mutation_p.G262S|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.G175S|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.G175S			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	175						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			AACTGTTAGCGGCTACGAGGC	0.587																																						dbGAP											0													118.0	114.0	116.0					11																	67066581		2200	4295	6495	-	-	-	SO:0001583	missense	0			AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.523G>A	11.37:g.67066581G>A	ENSP00000402616:p.Gly175Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.G262S	ENST00000447274.2	37	c.784		11	.	.	.	.	.	.	.	.	.	.	G	34	5.308249	0.95629	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.06	5.06	0.68205	.	485.342000	0.00357	N	0.000021	T	0.75525	0.3861	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	T	0.58842	-0.7565	10	0.45353	T	0.12	-6.5181	18.5972	0.91232	0.0:0.0:1.0:0.0	.	262;175	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	S	175;262;175;175	ENSP00000402616:G175S;ENSP00000427130:G262S;ENSP00000310874:G175S;ENSP00000444404:G175S	ENSP00000310874:G175S	G	+	1	0	ANKRD13D	66823157	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.371000	0.97162	2.796000	0.96246	0.655000	0.94253	GGC	ANKRD13D	-	pfam_ANKRD13	ENSG00000172932		0.587	ANKRD13D-001	KNOWN	basic	protein_coding	ANKRD13D	HGNC	protein_coding	OTTHUMT00000371067.2	147	0.00	0	G	NM_207354		67066581	67066581	+1	no_errors	ENST00000511455	ensembl	human	known	69_37n	missense	183	35.34	100	SNP	1.000	A
AQP12A	375318	genome.wustl.edu	37	2	241633892	241633892	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr2:241633892C>A	ENST00000337801.4	+	3	683	c.614C>A	c.(613-615)gCc>gAc	p.A205D	AQP12A_ENST00000429564.1_Missense_Mutation_p.A217D	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	205						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GCCCTGGCCGCCTCTGTGACC	0.667																																						dbGAP											0													1.0	1.0	1.0					2																	241633892		81	505	586	-	-	-	SO:0001583	missense	0			AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.614C>A	2.37:g.241633892C>A	ENSP00000337144:p.Ala205Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.A217D	ENST00000337801.4	37	c.650		2	.	.	.	.	.	.	.	.	.	.	C	7.230	0.599108	0.13939	.	.	ENSG00000184945	ENST00000337801;ENST00000373309;ENST00000429564;ENST00000420599	D;D	0.85258	-1.96;-1.96	3.6	3.6	0.41247	Aquaporin-like (2);	0.569680	0.18826	N	0.130132	D	0.82586	0.5069	L	0.54323	1.7	0.22066	N	0.999389	P	0.38677	0.642	B	0.40329	0.326	T	0.74497	-0.3646	10	0.37606	T	0.19	-6.2665	13.1642	0.59560	0.0:1.0:0.0:0.0	.	205	Q8IXF9	AQ12A_HUMAN	D	205;143;217;190	ENSP00000337144:A205D;ENSP00000405899:A217D	ENSP00000337144:A205D	A	+	2	0	AQP12A	241282565	0.000000	0.05858	0.507000	0.27676	0.051000	0.14879	0.788000	0.26872	1.746000	0.51805	0.399000	0.26434	GCC	AQP12A	-	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12	ENSG00000184945		0.667	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	AQP12A	HGNC	protein_coding	OTTHUMT00000257185.2	8	0.00	0	C	NM_198998		241633892	241633892	+1	no_errors	ENST00000429564	ensembl	human	known	69_37n	missense	35	33.96	18	SNP	0.698	A
C14orf37	145407	genome.wustl.edu	37	14	58605863	58605863	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr14:58605863C>T	ENST00000267485.7	-	2	408	c.214G>A	c.(214-216)Gaa>Aaa	p.E72K	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	72						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						ATTGGATCTTCAGAGACCACC	0.453																																						dbGAP											0													214.0	211.0	212.0					14																	58605863		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.214G>A	14.37:g.58605863C>T	ENSP00000267485:p.Glu72Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	NULL	p.E72K	ENST00000267485.7	37	c.214	CCDS32089.1	14	.	.	.	.	.	.	.	.	.	.	C	19.01	3.743809	0.69418	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.35789	1.29	5.82	3.94	0.45596	.	0.415744	0.25047	N	0.033547	T	0.32376	0.0827	L	0.59436	1.845	0.09310	N	1	B;P;B;B	0.35793	0.047;0.521;0.047;0.047	B;B;B;B	0.33121	0.046;0.158;0.046;0.046	T	0.24440	-1.0160	10	0.62326	D	0.03	-0.7541	8.9846	0.35986	0.0:0.8195:0.0:0.1805	.	110;72;72;72	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	K	72;110	ENSP00000267485:E72K	ENSP00000267485:E72K	E	-	1	0	C14orf37	57675616	1.000000	0.71417	0.049000	0.19019	0.702000	0.40608	2.730000	0.47335	0.741000	0.32674	0.655000	0.94253	GAA	C14orf37	-	NULL	ENSG00000139971		0.453	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	HGNC	protein_coding	OTTHUMT00000412059.1	202	0.00	0	C	NM_001001872		58605863	58605863	-1	no_errors	ENST00000267485	ensembl	human	known	69_37n	missense	134	50.19	135	SNP	0.026	T
CFAP61	26074	genome.wustl.edu	37	20	20150064	20150064	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr20:20150064G>A	ENST00000245957.5	+	13	1421	c.1345G>A	c.(1345-1347)Gag>Aag	p.E449K	C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000451767.2_Missense_Mutation_p.E449K|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000377306.1_Missense_Mutation_p.E449K	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		449										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CTGCACCCTCGAGCAGGACCT	0.488																																						dbGAP											0													103.0	92.0	96.0					20																	20150064		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000245957.5:c.1345G>A	20.37:g.20150064G>A	ENSP00000245957:p.Glu449Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.E449K	ENST00000245957.5	37	c.1345	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	G	3.822	-0.037638	0.07497	.	.	ENSG00000089101	ENST00000343997;ENST00000339482;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000451767	T;T;T	0.10005	2.92;2.92;2.92	5.87	0.259	0.15583	.	1.027300	0.07708	N	0.941630	T	0.05181	0.0138	N	0.22421	0.69	0.18873	N	0.999986	P;B;B	0.44260	0.83;0.316;0.335	B;B;B	0.31495	0.131;0.08;0.09	T	0.29305	-1.0016	10	0.08179	T	0.78	.	9.1151	0.36753	0.145:0.5207:0.3344:0.0	.	449;429;449	Q8NHU2-3;F8W6K4;Q8NHU2	.;.;CT026_HUMAN	K	389;43;429;449;449;449	ENSP00000245957:E449K;ENSP00000366521:E449K;ENSP00000414537:E449K	ENSP00000245957:E449K	E	+	1	0	C20orf26	20098064	0.045000	0.20229	0.001000	0.08648	0.068000	0.16541	0.682000	0.25335	-0.068000	0.12953	-0.150000	0.13652	GAG	C20orf26	-	NULL	ENSG00000089101		0.488	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	150	0.00	0	G			20150064	20150064	+1	no_errors	ENST00000245957	ensembl	human	known	69_37n	missense	131	46.53	114	SNP	0.001	A
COL4A1	1282	genome.wustl.edu	37	13	110826988	110826988	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr13:110826988C>T	ENST00000375820.4	-	38	3428	c.3307G>A	c.(3307-3309)Ggg>Agg	p.G1103R		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1103	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCAACACTCCCGGGAGACCCT	0.522																																						dbGAP											0													73.0	85.0	81.0					13																	110826988		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3307G>A	13.37:g.110826988C>T	ENSP00000364979:p.Gly1103Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G1103R	ENST00000375820.4	37	c.3307	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	16.79	3.219530	0.58560	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.99353	-5.77	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.99715	0.9890	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97388	0.9987	10	0.87932	D	0	.	20.063	0.97692	0.0:1.0:0.0:0.0	.	1103	P02462	CO4A1_HUMAN	R	746;1103;752	ENSP00000364979:G1103R	ENSP00000364973:G746R	G	-	1	0	COL4A1	109624989	1.000000	0.71417	0.173000	0.22940	0.071000	0.16799	7.151000	0.77411	2.735000	0.93741	0.655000	0.94253	GGG	COL4A1	-	pfam_Collagen	ENSG00000187498		0.522	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	87	0.00	0	C			110826988	110826988	-1	no_errors	ENST00000375820	ensembl	human	known	69_37n	missense	104	34.18	54	SNP	1.000	T
CROCCP2	84809	genome.wustl.edu	37	1	16945358	16945358	+	lincRNA	SNP	G	G	C	rs945905	byFrequency	TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr1:16945358G>C	ENST00000412962.1	-	0	2161				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGTAGGAGAAGAGAGAGGAAG	0.567																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945358G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.567	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	9	0.00	0	G	NR_026752.1		16945358	16945358	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	34	17.07	7	SNP	0.110	C
DHX58	79132	genome.wustl.edu	37	17	40257115	40257115	+	Missense_Mutation	SNP	G	G	A	rs553858409		TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr17:40257115G>A	ENST00000251642.3	-	10	1544	c.1322C>T	c.(1321-1323)gCg>gTg	p.A441V		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	441	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCCCTCCTCCGCCACACTCGT	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		19619	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													63.0	56.0	58.0					17																	40257115		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.1322C>T	17.37:g.40257115G>A	ENSP00000251642:p.Ala441Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAM6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A441V	ENST00000251642.3	37	c.1322	CCDS11416.1	17	.	.	.	.	.	.	.	.	.	.	G	13.81	2.349370	0.41599	.	.	ENSG00000108771	ENST00000251642;ENST00000423748	T	0.76578	-1.03	5.01	3.0	0.34707	Helicase, C-terminal (3);	0.112824	0.64402	N	0.000014	T	0.73590	0.3606	M	0.72353	2.195	0.58432	D	0.999995	P;P	0.45348	0.856;0.769	B;B	0.39562	0.303;0.303	T	0.73927	-0.3828	10	0.59425	D	0.04	.	10.2748	0.43504	0.1635:0.0:0.8365:0.0	.	434;441	B7Z455;Q96C10	.;DHX58_HUMAN	V	441;404	ENSP00000251642:A441V	ENSP00000251642:A441V	A	-	2	0	DHX58	37510641	1.000000	0.71417	0.453000	0.27007	0.174000	0.22865	6.505000	0.73708	0.691000	0.31592	0.462000	0.41574	GCG	DHX58	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000108771		0.562	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX58	HGNC	protein_coding	OTTHUMT00000257396.1	39	0.00	0	G	NM_024119		40257115	40257115	-1	no_errors	ENST00000251642	ensembl	human	known	69_37n	missense	22	60.71	34	SNP	0.986	A
CSH1	1442	genome.wustl.edu	37	17	61972940	61972940	+	Missense_Mutation	SNP	G	G	A	rs368663907		TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr17:61972940G>A	ENST00000316193.8	-	4	490	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	CSH1_ENST00000453363.3_Intron|CSH1_ENST00000329882.8_Missense_Mutation_p.R117W	NM_001317.5	NP_001308.1	P0DML2	CSH1_HUMAN	chorionic somatomammotropin hormone 1 (placental lactogen)	117						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						CTGAGGAACCGCACGGGCTCC	0.597									Russell-Silver syndrome																													dbGAP											0													10.0	11.0	10.0					17																	61972940		2163	4260	6423	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	J00118	CCDS11649.1	17q22-q24	2008-07-18				ENSG00000136488			2440	protein-coding gene	gene with protein product	"""chorionic somatomammotropin A"", ""placental lactogen"", ""choriomammotropin"""	150200				6208192	Standard	NM_001317		Approved	hCS-A, CSA, PL, CSMT, FLJ75407	uc002jcs.2	P0DML2		ENST00000316193.8:c.349C>T	17.37:g.61972940G>A	ENSP00000316416:p.Arg117Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.R117W	ENST00000316193.8	37	c.349	CCDS11649.1	17	.	.	.	.	.	.	.	.	.	.	g	6.190	0.403314	0.11754	.	.	ENSG00000136488	ENST00000329882;ENST00000316193	D;D	0.89343	-2.5;-2.37	2.56	1.57	0.23409	.	0.307924	0.31760	N	0.007116	D	0.83631	0.5296	L	0.55213	1.73	0.80722	D	1	B;B;B	0.19331	0.035;0.009;0.008	B;B;B	0.13407	0.006;0.005;0.009	T	0.77672	-0.2500	10	0.72032	D	0.01	.	7.4494	0.27229	0.1415:0.0:0.8585:0.0	.	117;117;67	A6NFB4;Q6PF11;P78451	.;.;.	W	117	ENSP00000333268:R117W;ENSP00000316416:R117W	ENSP00000316416:R117W	R	-	1	2	CSH1	59326672	1.000000	0.71417	0.997000	0.53966	0.005000	0.04900	6.451000	0.73481	0.405000	0.25532	-0.671000	0.03813	CGG	CSH1	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	ENSG00000136488		0.597	CSH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSH1	HGNC	protein_coding	OTTHUMT00000416040.1	17	0.00	0	G	NM_001317		61972940	61972940	-1	no_errors	ENST00000316193	ensembl	human	known	69_37n	missense	28	40.43	19	SNP	1.000	A
DZIP3	9666	genome.wustl.edu	37	3	108335487	108335487	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr3:108335487C>G	ENST00000361582.3	+	5	588	c.358C>G	c.(358-360)Caa>Gaa	p.Q120E	DZIP3_ENST00000463306.1_Missense_Mutation_p.Q120E	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	120					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TAGGAACATTCAAGCTGGCAA	0.383																																						dbGAP											0													140.0	131.0	134.0					3																	108335487		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.358C>G	3.37:g.108335487C>G	ENSP00000355028:p.Gln120Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q120E	ENST00000361582.3	37	c.358	CCDS2952.1	3	.	.	.	.	.	.	.	.	.	.	C	9.467	1.094526	0.20471	.	.	ENSG00000198919	ENST00000393969;ENST00000361582;ENST00000486815;ENST00000479138;ENST00000463306	T;T	0.23950	1.88;1.88	4.74	4.74	0.60224	.	0.443464	0.18322	N	0.144773	T	0.35799	0.0944	L	0.29908	0.895	0.30269	N	0.792403	D	0.58620	0.983	D	0.63381	0.914	T	0.16571	-1.0398	10	0.62326	D	0.03	-10.3448	13.0876	0.59151	0.0:1.0:0.0:0.0	.	120	Q86Y13	DZIP3_HUMAN	E	120;120;36;120;120	ENSP00000355028:Q120E;ENSP00000419981:Q120E	ENSP00000355028:Q120E	Q	+	1	0	DZIP3	109818177	1.000000	0.71417	1.000000	0.80357	0.182000	0.23217	1.901000	0.39838	2.462000	0.83206	0.563000	0.77884	CAA	DZIP3	-	NULL	ENSG00000198919		0.383	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP3	HGNC	protein_coding	OTTHUMT00000353968.1	140	0.00	0	C	NM_014648		108335487	108335487	+1	no_errors	ENST00000361582	ensembl	human	known	69_37n	missense	108	37.21	64	SNP	1.000	G
FLG	2312	genome.wustl.edu	37	1	152285017	152285017	+	Missense_Mutation	SNP	C	C	T	rs545226612		TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr1:152285017C>T	ENST00000368799.1	-	3	2380	c.2345G>A	c.(2344-2346)cGg>cAg	p.R782Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	782	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R782Q(2)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCCCTGACCGGTCACGTGC	0.567									Ichthyosis				-|||	1	0.000199681	0.0	0.0	5008	,	,		20970	0.001		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	skin(2)											326.0	313.0	317.0					1																	152285017		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2345G>A	1.37:g.152285017C>T	ENSP00000357789:p.Arg782Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.R782Q	ENST00000368799.1	37	c.2345	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	-	7.439	0.640298	0.14386	.	.	ENSG00000143631	ENST00000368799	T	0.01685	4.69	3.04	-2.99	0.05497	.	.	.	.	.	T	0.00241	0.0007	N	0.05414	-0.055	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.41980	-0.9478	9	0.02654	T	1	.	7.4021	0.26971	0.0:0.3866:0.0:0.6134	.	782	P20930	FILA_HUMAN	Q	782	ENSP00000357789:R782Q	ENSP00000357789:R782Q	R	-	2	0	FLG	150551641	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.444000	0.06854	-0.986000	0.03498	-1.790000	0.00627	CGG	FLG	-	NULL	ENSG00000143631		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	237	0.00	0	C	NM_002016		152285017	152285017	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	292	44.96	241	SNP	0.000	T
GATA3	2625	genome.wustl.edu	37	10	8111433	8111434	+	Splice_Site	DEL	CA	CA	-	rs111853237		TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr10:8111433_8111434delCA	ENST00000346208.3	+	5	1376		c.e5-1		GATA3_ENST00000379328.3_Splice_Site|GATA3_ENST00000461472.1_Splice_Site			P23771	GATA3_HUMAN	GATA binding protein 3						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(7)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCCCCACTCTCAGTCTGCAGCC	0.48			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	7	Unknown(7)	breast(7)																																								-	-	-	SO:0001630	splice_region_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.922-1CA>-	10.37:g.8111433_8111434delCA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Splice_Site	DEL	-	e4-2	ENST00000346208.3	37	c.925-3_925-2	CCDS7083.1	10																																																																																			GATA3	-	-	ENSG00000107485		0.480	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	74	0	0	CA	NM_001002295	Intron	8111433	8111434	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	splice_site_del	176	22.12	50	DEL	1.000:1.000	-
GLYCTK	132158	genome.wustl.edu	37	3	52326415	52326415	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr3:52326415G>A	ENST00000436784.2	+	5	905	c.845G>A	c.(844-846)cGt>cAt	p.R282H	GLYCTK_ENST00000354773.4_Silent_p.T223T|GLYCTK_ENST00000473032.1_Intron|MIR135A1_ENST00000385191.1_RNA|GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000305690.8_Missense_Mutation_p.R282H|GLYCTK_ENST00000477382.1_Silent_p.T223T|GLYCTK_ENST00000471180.1_Missense_Mutation_p.R155H|GLYCTK_ENST00000461183.1_Missense_Mutation_p.R198H			Q8IVS8	GLCTK_HUMAN	glycerate kinase	282					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		GCCCTGCCACGTTCTGTGAAG	0.592																																						dbGAP											0													76.0	69.0	71.0					3																	52326415		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.845G>A	3.37:g.52326415G>A	ENSP00000389175:p.Arg282His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	pfam_MOFRL	p.R282H	ENST00000436784.2	37	c.845	CCDS2852.1	3	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390980	0.42410	.	.	ENSG00000168237	ENST00000461183;ENST00000305690;ENST00000471180;ENST00000436784;ENST00000411757	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.64	4.77	0.60923	.	0.321832	0.36932	N	0.002337	T	0.46814	0.1412	.	.	.	0.20196	N	0.999924	D;B	0.69078	0.997;0.329	P;B	0.55161	0.77;0.012	T	0.40869	-0.9540	9	0.44086	T	0.13	-3.9231	6.0493	0.19777	0.1994:0.0:0.6596:0.141	.	282;282	Q8IVS8-4;Q8IVS8	.;GLCTK_HUMAN	H	198;282;155;282;216	ENSP00000417264:R198H;ENSP00000301965:R282H;ENSP00000417526:R155H;ENSP00000389175:R282H	ENSP00000301965:R282H	R	+	2	0	GLYCTK	52301455	0.003000	0.15002	0.986000	0.45419	0.991000	0.79684	1.632000	0.37102	1.390000	0.46547	0.655000	0.94253	CGT	GLYCTK	-	NULL	ENSG00000168237		0.592	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYCTK	HGNC	protein_coding	OTTHUMT00000350835.1	47	0.00	0	G	NM_145262		52326415	52326415	+1	no_errors	ENST00000436784	ensembl	human	known	69_37n	missense	79	36.80	46	SNP	0.081	A
GPR128	84873	genome.wustl.edu	37	3	100378672	100378672	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr3:100378672A>G	ENST00000273352.3	+	14	2232	c.1964A>G	c.(1963-1965)aAc>aGc	p.N655S	GPR128_ENST00000475887.1_Missense_Mutation_p.N360S|GPR128_ENST00000481506.1_3'UTR	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	655					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						TGGAAGAATAACCAGAACCTG	0.438																																					Pancreas(87;185 1975 7223 18722)	dbGAP											0													142.0	132.0	135.0					3																	100378672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.1964A>G	3.37:g.100378672A>G	ENSP00000273352:p.Asn655Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14D94|Q86SQ2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.N655S	ENST00000273352.3	37	c.1964	CCDS2938.1	3	.	.	.	.	.	.	.	.	.	.	A	10.59	1.391897	0.25118	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.36157	1.27;1.27	5.48	4.32	0.51571	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000002	T	0.28200	0.0696	L	0.37507	1.11	0.35308	D	0.783651	B;B	0.20164	0.011;0.042	B;B	0.25140	0.023;0.058	T	0.26121	-1.0112	10	0.32370	T	0.25	.	9.3996	0.38424	0.9177:0.0:0.0823:0.0	.	360;655	E9PHI0;Q96K78	.;GP128_HUMAN	S	655;360	ENSP00000273352:N655S;ENSP00000419788:N360S	ENSP00000273352:N655S	N	+	2	0	GPR128	101861362	0.983000	0.35010	0.972000	0.41901	0.560000	0.35617	2.822000	0.48073	1.014000	0.39417	-0.400000	0.06385	AAC	GPR128	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000144820		0.438	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	HGNC	protein_coding	OTTHUMT00000353236.1	187	0.00	0	A			100378672	100378672	+1	no_errors	ENST00000273352	ensembl	human	known	69_37n	missense	192	39.05	123	SNP	0.894	G
NWD2	57495	genome.wustl.edu	37	4	37446793	37446793	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr4:37446793C>G	ENST00000309447.5	+	7	4031	c.3183C>G	c.(3181-3183)atC>atG	p.I1061M		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1061										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						CCACCTACATCAATGGATTTA	0.483																																						dbGAP											0													156.0	123.0	133.0					4																	37446793		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000309447.5:c.3183C>G	4.37:g.37446793C>G	ENSP00000309501:p.Ile1061Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRU1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.I1061M	ENST00000309447.5	37	c.3183	CCDS47040.1	4	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320584	0.41096	.	.	ENSG00000174145	ENST00000309447	T	0.71222	-0.55	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74756	0.3758	L	0.27053	0.805	0.48830	D	0.999711	D	0.71674	0.998	D	0.78314	0.991	T	0.72663	-0.4225	10	0.34782	T	0.22	.	14.8429	0.70237	0.1776:0.8223:0.0:0.0	.	1061	Q9ULI1	K1239_HUMAN	M	1061	ENSP00000309501:I1061M	ENSP00000309501:I1061M	I	+	3	3	KIAA1239	37123188	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	0.891000	0.28309	2.771000	0.95319	0.650000	0.86243	ATC	KIAA1239	-	superfamily_WD40_repeat_dom	ENSG00000174145		0.483	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	98	0.00	0	C			37446793	37446793	+1	no_errors	ENST00000309447	ensembl	human	known	69_37n	missense	200	31.27	91	SNP	1.000	G
KIAA1324L	222223	genome.wustl.edu	37	7	86537023	86537023	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr7:86537023G>A	ENST00000450689.2	-	18	2706	c.2521C>T	c.(2521-2523)Cct>Tct	p.P841S	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.P770S|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.P674S|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.P601S	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	841						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GATTTAGTAGGATTACACCTC	0.363																																						dbGAP											0													125.0	112.0	116.0					7																	86537023		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2521C>T	7.37:g.86537023G>A	ENSP00000413445:p.Pro841Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt	p.P841S	ENST00000450689.2	37	c.2521	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.943786|3.943786	0.73672|0.73672	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314|ENST00000423294	T;T;T;T|.	0.04083|.	3.71;3.71;3.71;3.71|.	6.11|6.11	6.11|6.11	0.99139|0.99139	Mannose-6-phosphate receptor, binding (1);|.	0.049190|.	0.85682|.	D|.	0.000000|.	T|T	0.79522|0.79522	0.4460|0.4460	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	D;D;P|.	0.67145|.	0.996;0.994;0.946|.	D;P;P|.	0.68039|.	0.955;0.844;0.67|.	T|T	0.79720|0.79720	-0.1685|-0.1685	10|5	0.54805|.	T|.	0.06|.	.|.	17.4671|17.4671	0.87635|0.87635	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	841;601;674|.	A8MWY0;A8MWY0-2;B4DJV3|.	K132L_HUMAN;.;.|.	S|F	841;601;770;674|801	ENSP00000413445:P841S;ENSP00000297222:P601S;ENSP00000397377:P770S;ENSP00000402390:P674S|.	ENSP00000297222:P601S|.	P|S	-|-	1|2	0|0	KIAA1324L|KIAA1324L	86374959|86374959	1.000000|1.000000	0.71417|0.71417	0.956000|0.956000	0.39512|0.39512	0.984000|0.984000	0.73092|0.73092	8.599000|8.599000	0.90856|0.90856	2.906000|2.906000	0.99361|0.99361	0.655000|0.655000	0.94253|0.94253	CCT|TCC	KIAA1324L	-	superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000164659		0.363	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	194	0.00	0	G	NM_152748		86537023	86537023	-1	no_errors	ENST00000450689	ensembl	human	known	69_37n	missense	176	31.52	81	SNP	1.000	A
MAP4K1	11184	genome.wustl.edu	37	19	39098654	39098654	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr19:39098654C>T	ENST00000591517.1	-	15	1113	c.1085G>A	c.(1084-1086)cGa>cAa	p.R362Q	MAP4K1_ENST00000589002.1_5'UTR|MAP4K1_ENST00000396857.2_Missense_Mutation_p.R362Q|MAP4K1_ENST00000589130.1_Missense_Mutation_p.R358Q|MAP4K1_ENST00000586296.1_Intron|MAP4K1_ENST00000423454.2_Missense_Mutation_p.R24Q	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	362					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTGAGGTCTCGAGGAGGCTG	0.652																																						dbGAP											0													26.0	29.0	28.0					19																	39098654		2003	4153	6156	-	-	-	SO:0001583	missense	0			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1085G>A	19.37:g.39098654C>T	ENSP00000465039:p.Arg362Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R362Q	ENST00000591517.1	37	c.1085	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	.	7.337	0.620192	0.14193	.	.	ENSG00000104814	ENST00000396857;ENST00000221409;ENST00000423454	T;T	0.72051	-0.62;2.93	3.55	-6.72	0.01755	Protein kinase-like domain (1);	7739.210000	0.00166	N	0.000007	T	0.40398	0.1115	N	0.08118	0	0.09310	N	1	B;B;B	0.32245	0.361;0.049;0.217	B;B;B	0.19391	0.025;0.024;0.011	T	0.35624	-0.9781	10	0.13853	T	0.58	.	5.6066	0.17383	0.0:0.2418:0.3195:0.4388	.	24;362;362	B4E087;Q92918-2;Q92918	.;.;M4K1_HUMAN	Q	362;362;24	ENSP00000380066:R362Q;ENSP00000396383:R24Q	ENSP00000221409:R362Q	R	-	2	0	MAP4K1	43790494	0.001000	0.12720	0.001000	0.08648	0.116000	0.19942	-0.896000	0.04114	-1.234000	0.02548	0.558000	0.71614	CGA	MAP4K1	-	superfamily_Kinase-like_dom	ENSG00000104814		0.652	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	HGNC	protein_coding	OTTHUMT00000453390.1	70	0.00	0	C	NM_001042600		39098654	39098654	-1	no_errors	ENST00000591517	ensembl	human	known	69_37n	missense	80	37.21	48	SNP	0.001	T
DDIT3	1649	genome.wustl.edu	37	12	57913024	57913024	+	Intron	SNP	G	G	C			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr12:57913024G>C	ENST00000346473.3	-	1	100				DDIT3_ENST00000552740.1_Intron|DDIT3_ENST00000551116.1_Intron|DDIT3_ENST00000547303.1_Intron|MIR616_ENST00000385293.1_RNA	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)		EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						gaagggttttgagtggaggaa	0.448			T	FUS	liposarcoma																																GBM(112;1383 1547 7626 23045 28770)	dbGAP		Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	0													54.0	53.0	53.0					12																	57913024		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.79+1176C>G	12.37:g.57913024G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	F8VS99	RNA	SNP	-	NULL	ENST00000346473.3	37	NULL	CCDS8943.1	12																																																																																			MIR616	-	-	ENSG00000208028		0.448	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR616	HGNC	protein_coding	OTTHUMT00000407137.1	90	0.00	0	G	NM_004083		57913024	57913024	-1	no_errors	ENST00000385293	ensembl	human	known	69_37n	rna	121	33.33	61	SNP	0.001	C
MMP14	4323	genome.wustl.edu	37	14	23314527	23314527	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr14:23314527G>A	ENST00000311852.6	+	9	1630	c.1369G>A	c.(1369-1371)Gaa>Aaa	p.E457K	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	457					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	CAAAGTCTGGGAAGGGATCCC	0.562																																						dbGAP											0													73.0	58.0	63.0					14																	23314527		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.1369G>A	14.37:g.23314527G>A	ENSP00000308208:p.Glu457Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.E457K	ENST00000311852.6	37	c.1369	CCDS9577.1	14	.	.	.	.	.	.	.	.	.	.	G	5.038	0.192721	0.09599	.	.	ENSG00000157227	ENST00000311852	T	0.02197	4.4	5.45	5.45	0.79879	Hemopexin/matrixin (2);	0.108055	0.64402	D	0.000005	T	0.02047	0.0064	N	0.20574	0.59	0.50039	D	0.999845	B	0.06786	0.001	B	0.08055	0.003	T	0.47787	-0.9090	10	0.06494	T	0.89	.	18.0472	0.89336	0.0:0.0:1.0:0.0	.	457	P50281	MMP14_HUMAN	K	457	ENSP00000308208:E457K	ENSP00000308208:E457K	E	+	1	0	MMP14	22384367	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.269000	0.43346	2.568000	0.86640	0.557000	0.71058	GAA	MMP14	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000157227		0.562	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP14	HGNC	protein_coding	OTTHUMT00000071660.3	52	0.00	0	G	NM_004995		23314527	23314527	+1	no_errors	ENST00000311852	ensembl	human	known	69_37n	missense	60	32.58	29	SNP	1.000	A
MPO	4353	genome.wustl.edu	37	17	56355208	56355208	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr17:56355208C>T	ENST00000225275.3	-	7	1360	c.1184G>A	c.(1183-1185)cGc>cAc	p.R395H	MPO_ENST00000578493.1_5'UTR|MPO_ENST00000340482.3_Missense_Mutation_p.R427H	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	395					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GCAGGGGATGCGCGCTGAGCG	0.617																																						dbGAP											0													58.0	59.0	59.0					17																	56355208		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1184G>A	17.37:g.56355208C>T	ENSP00000225275:p.Arg395His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R427H	ENST00000225275.3	37	c.1280	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347232	0.24426	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.73363	-0.74;-0.74	4.8	2.79	0.32731	.	1.422290	0.03913	N	0.282206	T	0.70815	0.3267	L	0.54323	1.7	0.09310	N	1	P	0.42409	0.779	B	0.38020	0.263	T	0.58059	-0.7703	10	0.49607	T	0.09	-2.9074	8.7721	0.34740	0.0:0.7347:0.0:0.2653	.	395	P05164	PERM_HUMAN	H	427;395	ENSP00000344419:R427H;ENSP00000225275:R395H	ENSP00000225275:R395H	R	-	2	0	MPO	53710207	0.000000	0.05858	0.354000	0.25760	0.416000	0.31233	0.490000	0.22403	0.620000	0.30215	0.561000	0.74099	CGC	MPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000005381		0.617	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	60	0.00	0	C			56355208	56355208	-1	no_errors	ENST00000340482	ensembl	human	known	69_37n	missense	81	34.65	44	SNP	0.005	T
MUC12	10071	genome.wustl.edu	37	7	100647276	100647276	+	Missense_Mutation	SNP	C	C	A	rs202226352	byFrequency	TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr7:100647276C>A	ENST00000379442.3	+	5	13861	c.13861C>A	c.(13861-13863)Cct>Act	p.P4621T	MUC12_ENST00000536621.1_Missense_Mutation_p.P4478T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4621	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AACACACTTCCCTGACAGCTC	0.542																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.13861C>A	7.37:g.100647276C>A	ENSP00000368755:p.Pro4621Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.P4621T	ENST00000379442.3	37	c.13861		7	.	.	.	.	.	.	.	.	.	.	C	0.646	-0.811242	0.02798	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.14893	2.48;2.47	0.917	-0.282	0.12878	.	.	.	.	.	T	0.06325	0.0163	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.35871	-0.9771	6	0.25751	T	0.34	.	1.6623	0.02794	0.3368:0.4106:0.0:0.2526	.	.	.	.	T	4621;4478	ENSP00000368755:P4621T;ENSP00000441929:P4478T	ENSP00000368755:P4621T	P	+	1	0	MUC12	100433996	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.639000	0.05446	-0.109000	0.12044	0.430000	0.28490	CCT	MUC12	-	NULL	ENSG00000205277		0.542	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	42	0.00	0	C	XM_379904		100647276	100647276	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	125	14.29	21	SNP	0.001	A
Unknown	0	genome.wustl.edu	37	3	195346587	195346587	+	IGR	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr3:195346587G>A								APOD (35511 upstream) : RP11-141C7.4 (20273 downstream)																							CCTGTCCACAGCCGGCACCAC	0.602																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															3.37:g.195346587G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A297T		37	c.889		3	.	.	.	.	.	.	.	.	.	.	.	8.167	0.790830	0.16258	.	.	ENSG00000176945	ENST00000381954	.	.	.	0.705	-0.563	0.11778	.	.	.	.	.	T	0.31231	0.0790	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28332	-1.0047	5	0.38643	T	0.18	.	4.3434	0.11120	0.0:0.4324:0.5676:0.0	.	.	.	.	T	297	.	ENSP00000371380:A297T	A	+	1	0	MUC20	196827876	0.001000	0.12720	0.007000	0.13788	0.254000	0.26022	0.355000	0.20163	-0.175000	0.10725	0.152000	0.16155	GCC	MUC20	-	NULL	ENSG00000176945	0	0.602					MUC20	HGNC			68	0.00	0	G			195346587	195346587	+1	no_errors	ENST00000381954	ensembl	human	known	69_37n	missense	132	24.14	42	SNP	0.009	A
TENM3	55714	genome.wustl.edu	37	4	183713590	183713590	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr4:183713590C>T	ENST00000511685.1	+	26	5888	c.5765C>T	c.(5764-5766)gCc>gTc	p.A1922V	TENM3_ENST00000406950.2_Missense_Mutation_p.A1922V			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1922					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GAAAGCAACGCCTCCATCATC	0.527																																						dbGAP											0													70.0	72.0	72.0					4																	183713590		2008	4163	6171	-	-	-	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5765C>T	4.37:g.183713590C>T	ENSP00000424226:p.Ala1922Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.A1922V	ENST00000511685.1	37	c.5765	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448273	0.84101	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.86956	-2.19;-2.19	5.04	5.04	0.67666	.	.	.	.	.	D	0.93539	0.7938	M	0.80028	2.48	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	D	0.93651	0.6973	9	0.54805	T	0.06	.	18.568	0.91124	0.0:1.0:0.0:0.0	.	1922	Q9P273	TEN3_HUMAN	V	1922	ENSP00000424226:A1922V;ENSP00000385276:A1922V	ENSP00000385276:A1922V	A	+	2	0	ODZ3	183950584	1.000000	0.71417	0.989000	0.46669	0.941000	0.58515	7.625000	0.83145	2.608000	0.88229	0.591000	0.81541	GCC	ODZ3	-	NULL	ENSG00000218336		0.527	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	23	0.00	0	C			183713590	183713590	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	missense	67	32.32	32	SNP	1.000	T
PDZD7	79955	genome.wustl.edu	37	10	102777873	102777873	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr10:102777873C>T	ENST00000370215.3	-	9	1730	c.1505G>A	c.(1504-1506)cGc>cAc	p.R502H		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	502						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		TATGTCCAGGCGAGGGTAAGT	0.572																																						dbGAP											0													127.0	114.0	118.0					10																	102777873		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1505G>A	10.37:g.102777873C>T	ENSP00000359234:p.Arg502His	Somatic		WXS	Illumina GAIIx	Phase_IV	D5FJ77|Q8N321	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R502H	ENST00000370215.3	37	c.1505	CCDS31269.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.015|0.015	-1.541132|-1.541132	0.00934|0.00934	.|.	.|.	ENSG00000186862|ENSG00000186862	ENST00000433616|ENST00000393462;ENST00000370215	.|T	.|0.11495	.|2.77	4.12|4.12	-4.89|-4.89	0.03103|0.03103	.|.	.|459.626000	.|0.00357	.|N	.|0.000027	T|T	0.07683|0.07683	0.0193|0.0193	N|N	0.12746|0.12746	0.255|0.255	0.09310|0.09310	N|N	1|1	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.28964|0.28964	-1.0027|-1.0027	5|10	.|0.36615	.|T	.|0.2	.|.	13.7279|13.7279	0.62769|0.62769	0.0:0.4957:0.0:0.5043|0.0:0.4957:0.0:0.5043	.|.	.|502;502	.|Q9H5P4;Q9H5P4-2	.|PDZD7_HUMAN;.	T|H	77|502	.|ENSP00000359234:R502H	.|ENSP00000359234:R502H	A|R	-|-	1|2	0|0	PDZD7|PDZD7	102767863|102767863	0.062000|0.062000	0.20869|0.20869	0.219000|0.219000	0.23793|0.23793	0.002000|0.002000	0.02628|0.02628	-0.375000|-0.375000	0.07475|0.07475	-1.378000|-1.378000	0.02120|0.02120	-2.110000|-2.110000	0.00354|0.00354	GCC|CGC	PDZD7	-	NULL	ENSG00000186862		0.572	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049883.1	115	0.00	0	C	NM_024895		102777873	102777873	-1	no_errors	ENST00000370215	ensembl	human	known	69_37n	missense	93	31.11	42	SNP	0.004	T
PRB2	653247	genome.wustl.edu	37	12	11546473	11546473	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr12:11546473G>A	ENST00000389362.4	-	3	574	c.539C>T	c.(538-540)cCa>cTa	p.P180L	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	180	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGTCCTTGTGGCTTTCCTGG	0.592																																						dbGAP											0													213.0	204.0	207.0					12																	11546473		2192	4291	6483	-	-	-	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.539C>T	12.37:g.11546473G>A	ENSP00000374013:p.Pro180Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.P180L	ENST00000389362.4	37	c.539	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	8.115	0.779753	0.16120	.	.	ENSG00000121335	ENST00000389362	T	0.05717	3.4	1.15	-2.31	0.06765	.	.	.	.	.	T	0.14442	0.0349	M	0.81341	2.54	0.32325	N	0.561913	D	0.65815	0.995	P	0.54889	0.763	T	0.18241	-1.0343	9	0.59425	D	0.04	.	5.6847	0.17797	0.0:0.0:0.5421:0.4578	.	180	P02812	PRB2_HUMAN	L	180	ENSP00000374013:P180L	ENSP00000374013:P180L	P	-	2	0	PRB2	11437740	0.002000	0.14202	0.006000	0.13384	0.389000	0.30415	-0.118000	0.10692	-0.549000	0.06191	0.109000	0.15622	CCA	PRB2	-	NULL	ENSG00000121335		0.592	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	338	0.00	0	G	NM_006248		11546473	11546473	-1	no_errors	ENST00000389362	ensembl	human	known	69_37n	missense	355	31.87	167	SNP	0.665	A
SAT1	6303	genome.wustl.edu	37	X	23803899	23803899	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chrX:23803899C>A	ENST00000379270.4	+	6	621	c.442C>A	c.(442-444)Ctg>Atg	p.L148M	RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000489394.1_3'UTR|SAT1_ENST00000379254.1_Missense_Mutation_p.L120M	NM_002970.2	NP_002961.1	Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						TGCTTCTGATCTGTCCAGTGA	0.463																																						dbGAP											0													92.0	80.0	84.0					X																	23803899		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379270.4:c.442C>A	X.37:g.23803899C>A	ENSP00000368572:p.Leu148Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.L148M	ENST00000379270.4	37	c.442	CCDS14207.1	X	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227238	0.58668	.	.	ENSG00000130066	ENST00000379270;ENST00000379254;ENST00000342463	T;T	0.45668	0.89;0.89	5.81	4.95	0.65309	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.187360	0.40469	N	0.001097	T	0.57227	0.2039	L	0.48935	1.535	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57353	-0.7826	10	0.51188	T	0.08	-2.5756	13.9843	0.64324	0.0:0.9255:0.0:0.0745	.	148	P21673	SAT1_HUMAN	M	148;120;176	ENSP00000368572:L148M;ENSP00000368556:L120M	ENSP00000343343:L176M	L	+	1	2	SAT1	23713820	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	4.683000	0.61679	1.206000	0.43276	0.594000	0.82650	CTG	SAT1	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000130066		0.463	SAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAT1	HGNC	protein_coding	OTTHUMT00000056056.1	125	0.00	0	C	NM_002970		23803899	23803899	+1	no_errors	ENST00000379270	ensembl	human	known	69_37n	missense	93	17.70	20	SNP	1.000	A
SCN7A	6332	genome.wustl.edu	37	2	167330310	167330310	+	Splice_Site	SNP	C	C	G			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr2:167330310C>G	ENST00000409855.1	-	4	568	c.442G>C	c.(442-444)Gag>Cag	p.E148Q		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	148					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	ataacatactctaataCTGGT	0.229																																						dbGAP											0													36.0	34.0	35.0					2																	167330310		1777	4024	5801	-	-	-	SO:0001630	splice_region_variant	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.443+1G>C	2.37:g.167330310C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.E148Q	ENST00000409855.1	37	c.442	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381000	0.42207	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.97976	-4.64;-4.64;-4.64	4.57	3.69	0.42338	Ion transport (1);	0.671051	0.13579	N	0.377501	D	0.93822	0.8024	L	0.31420	0.93	0.25662	N	0.985998	B	0.06786	0.001	B	0.10450	0.005	D	0.88054	0.2789	10	0.49607	T	0.09	.	5.9069	0.19006	0.0:0.5658:0.3109:0.1232	.	148	Q01118	SCN7A_HUMAN	Q	148	ENSP00000386796:E148Q;ENSP00000413699:E148Q;ENSP00000403846:E148Q	ENSP00000259060:E148Q	E	-	1	0	SCN7A	167038556	0.760000	0.28428	0.967000	0.41034	0.448000	0.32197	1.166000	0.31834	1.280000	0.44463	0.491000	0.48974	GAG	SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.229	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	68	0.00	0	C		Missense_Mutation	167330310	167330310	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	0.963	G
SLFN11	91607	genome.wustl.edu	37	17	33689955	33689955	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr17:33689955C>T	ENST00000394566.1	-	4	1144	c.872G>A	c.(871-873)cGc>cAc	p.R291H	SLFN11_ENST00000308377.4_Missense_Mutation_p.R291H	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	291					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGTTATCGGGCGTTGGGGTTG	0.423																																						dbGAP											0													196.0	195.0	195.0					17																	33689955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.872G>A	17.37:g.33689955C>T	ENSP00000378067:p.Arg291His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.R291H	ENST00000394566.1	37	c.872	CCDS11294.1	17	.	.	.	.	.	.	.	.	.	.	C	3.608	-0.080178	0.07141	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	T;T	0.59502	0.26;0.26	4.32	-5.42	0.02640	.	6.153270	0.00550	N	0.000256	T	0.33876	0.0878	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.22347	-1.0219	10	0.30078	T	0.28	.	7.3957	0.26936	0.0:0.1668:0.6041:0.2291	.	291	Q7Z7L1	SLN11_HUMAN	H	291	ENSP00000312402:R291H;ENSP00000378067:R291H	ENSP00000312402:R291H	R	-	2	0	SLFN11	30714068	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.079000	0.03410	-0.295000	0.08960	-0.219000	0.12488	CGC	SLFN11	-	pfam_ATPase_AAA-4	ENSG00000172716		0.423	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN11	HGNC	protein_coding	OTTHUMT00000256480.1	421	0.00	0	C	NM_152270		33689955	33689955	-1	no_errors	ENST00000308377	ensembl	human	known	69_37n	missense	218	52.60	243	SNP	0.000	T
SNX25	83891	genome.wustl.edu	37	4	186188240	186188240	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr4:186188240C>T	ENST00000504273.1	+	5	824	c.530C>T	c.(529-531)gCc>gTc	p.A177V	SNX25_ENST00000264694.8_Missense_Mutation_p.A177V			Q9H3E2	SNX25_HUMAN	sorting nexin 25	177					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TACACCTATGCCCCCTCTTAC	0.438																																						dbGAP											0													144.0	134.0	137.0					4																	186188240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.530C>T	4.37:g.186188240C>T	ENSP00000426255:p.Ala177Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Regulat_G_prot_signal,pfam_Phox,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal	p.A177V	ENST00000504273.1	37	c.530	CCDS34116.1	4	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984865	0.93044	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.14144	2.53;2.53	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.25306	0.0615	M	0.79926	2.475	0.80722	D	1	P	0.52316	0.952	P	0.44422	0.449	T	0.10177	-1.0641	10	0.39692	T	0.17	-13.1245	18.2534	0.90011	0.0:1.0:0.0:0.0	.	177	Q9H3E2	SNX25_HUMAN	V	177	ENSP00000426255:A177V;ENSP00000264694:A177V	ENSP00000264694:A177V	A	+	2	0	SNX25	186425234	1.000000	0.71417	0.882000	0.34594	0.785000	0.44390	7.308000	0.78929	2.541000	0.85698	0.655000	0.94253	GCC	SNX25	-	NULL	ENSG00000109762		0.438	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX25	HGNC	protein_coding	OTTHUMT00000360756.1	110	0.00	0	C	NM_031953		186188240	186188240	+1	no_errors	ENST00000264694	ensembl	human	known	69_37n	missense	94	31.39	43	SNP	1.000	T
TGFBR2	7048	genome.wustl.edu	37	3	30729932	30729932	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr3:30729932G>A	ENST00000295754.5	+	6	1835	c.1453G>A	c.(1453-1455)Gaa>Aaa	p.E485K	TGFBR2_ENST00000359013.4_Missense_Mutation_p.E510K	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	485	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.V484fs*28(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CCCCTGTGTCGAAAGCATGAA	0.498																																						dbGAP											1	Deletion - Frameshift(1)	pancreas(1)											127.0	119.0	121.0					3																	30729932		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1453G>A	3.37:g.30729932G>A	ENSP00000295754:p.Glu485Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt,pfscan_Prot_kinase_cat_dom	p.E510K	ENST00000295754.5	37	c.1528	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.713340	0.96830	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	T;T	0.65549	-0.16;-0.16	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045078	0.85682	D	0.000000	T	0.76919	0.4055	L	0.53671	1.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.78270	-0.2269	10	0.87932	D	0	.	19.4941	0.95064	0.0:0.0:1.0:0.0	.	485;510	P37173;D2JYI1	TGFR2_HUMAN;.	K	485;510;315	ENSP00000295754:E485K;ENSP00000351905:E510K	ENSP00000295754:E485K	E	+	1	0	TGFBR2	30704936	1.000000	0.71417	0.684000	0.30055	0.913000	0.54294	9.759000	0.98931	2.682000	0.91365	0.591000	0.81541	GAA	TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000163513		0.498	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	105	0.94	1	G			30729932	30729932	+1	no_errors	ENST00000359013	ensembl	human	known	69_37n	missense	127	36.18	72	SNP	1.000	A
TMPPE	643853	genome.wustl.edu	37	3	33135082	33135082	+	Silent	SNP	G	G	C			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr3:33135082G>C	ENST00000342462.4	-	2	796	c.606C>G	c.(604-606)gcC>gcG	p.A202A	GLB1_ENST00000399402.3_Intron|GLB1_ENST00000445488.2_Intron|TMPPE_ENST00000416695.2_Silent_p.A65A|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Intron	NM_001039770.2	NP_001034859.2	Q6ZT21	TMPPE_HUMAN	transmembrane protein with metallophosphoesterase domain	202						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|large_intestine(5)|lung(6)|prostate(1)	13						TGTTCATTGAGGCAGGCAGCT	0.572																																						dbGAP											0													100.0	94.0	96.0					3																	33135082		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK126979	CCDS33732.1, CCDS46786.1	3p22.3	2014-02-12	2009-02-24		ENSG00000188167	ENSG00000188167			33865	protein-coding gene	gene with protein product							Standard	NM_001039770		Approved	FLJ45032	uc003cfk.2	Q6ZT21	OTTHUMG00000155779	ENST00000342462.4:c.606C>G	3.37:g.33135082G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNG5|Q6ZRG1	Silent	SNP	pfam_Metallo_PEstase_dom	p.A202	ENST00000342462.4	37	c.606	CCDS33732.1	3																																																																																			TMPPE	-	NULL	ENSG00000188167		0.572	TMPPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPPE	HGNC	protein_coding	OTTHUMT00000341566.1	67	0.00	0	G	NM_001039770		33135082	33135082	-1	no_errors	ENST00000342462	ensembl	human	known	69_37n	silent	163	15.98	31	SNP	0.000	C
STX19	415117	genome.wustl.edu	37	3	93733513	93733513	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr3:93733513C>T	ENST00000315099.2	-	2	857	c.601G>A	c.(601-603)Gaa>Aaa	p.E201K	ARL13B_ENST00000303097.7_Intron|ARL13B_ENST00000486562.1_Intron|ARL13B_ENST00000539730.1_Intron|ARL13B_ENST00000394222.3_Intron|ARL13B_ENST00000471138.1_Intron|ARL13B_ENST00000535334.1_Intron	NM_001001850.2	NP_001001850.1	Q8N4C7	STX19_HUMAN	syntaxin 19	201					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(4)|prostate(1)	9						ATATTGATTTCTGTAAGTAAG	0.338																																						dbGAP											0													76.0	77.0	77.0					3																	93733513		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF461456	CCDS33793.1	3q11	2005-12-30			ENSG00000178750	ENSG00000178750			19300	protein-coding gene	gene with protein product							Standard	NM_001001850		Approved	MGC21382	uc003drh.1	Q8N4C7	OTTHUMG00000159013	ENST00000315099.2:c.601G>A	3.37:g.93733513C>T	ENSP00000320679:p.Glu201Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.E201K	ENST00000315099.2	37	c.601	CCDS33793.1	3	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751327	0.89753	.	.	ENSG00000178750	ENST00000315099	T	0.25085	1.82	4.86	4.86	0.63082	t-SNARE (1);	0.052169	0.85682	D	0.000000	T	0.43853	0.1266	M	0.70275	2.135	0.58432	D	0.999997	D	0.60575	0.988	P	0.52343	0.696	T	0.47586	-0.9106	10	0.72032	D	0.01	0.0093	18.9415	0.92607	0.0:1.0:0.0:0.0	.	201	Q8N4C7	STX19_HUMAN	K	201	ENSP00000320679:E201K	ENSP00000320679:E201K	E	-	1	0	STX19	95216203	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.445000	0.80570	2.651000	0.90000	0.650000	0.86243	GAA	STX19	-	superfamily_t-SNARE	ENSG00000178750		0.338	STX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX19	HGNC	protein_coding	OTTHUMT00000352909.1	147	0.00	0	C	NM_001001850		93733513	93733513	-1	no_errors	ENST00000315099	ensembl	human	known	69_37n	missense	158	33.89	81	SNP	1.000	T
TOX2	84969	genome.wustl.edu	37	20	42683009	42683009	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr20:42683009A>T	ENST00000358131.5	+	5	957	c.749A>T	c.(748-750)aAg>aTg	p.K250M	TOX2_ENST00000341197.4_Missense_Mutation_p.K241M|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000372999.1_Missense_Mutation_p.K199M|TOX2_ENST00000423191.2_Missense_Mutation_p.K199M	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	250	Poly-Lys.				female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			AAGAAAAAGAAGGACCCCAAT	0.537																																						dbGAP											0													39.0	40.0	40.0					20																	42683009		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.749A>T	20.37:g.42683009A>T	ENSP00000350849:p.Lys250Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.K241M	ENST00000358131.5	37	c.722	CCDS42875.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.7|26.7	4.765939|4.765939	0.90020|0.90020	.|.	.|.	ENSG00000124191|ENSG00000124191	ENST00000341197;ENST00000423191;ENST00000372999;ENST00000358131;ENST00000435864|ENST00000372992;ENST00000413823	T;T;T;T;T|.	0.53640|.	0.61;0.61;0.61;1.91;0.61|.	5.44|5.44	5.44|5.44	0.79542|0.79542	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (1);|.	0.145975|.	0.64402|.	D|.	0.000010|.	T|T	0.75451|0.75451	0.3851|0.3851	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;0.999;1.0;1.0|.	D;D;D;D;D|.	0.87578|.	0.997;0.998;0.994;0.997;0.996|.	T|T	0.78964|0.78964	-0.1996|-0.1996	10|6	0.87932|0.87932	D|D	0|0	.|.	14.6765|14.6765	0.68983|0.68983	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	119;241;199;250;199|.	B4DQV8;G3XAC7;A8K1J1;Q96NM4;E1P5X0|.	.;.;.;TOX2_HUMAN;.|.	M|W	241;199;199;250;119|7	ENSP00000344724:K241M;ENSP00000390278:K199M;ENSP00000362090:K199M;ENSP00000350849:K250M;ENSP00000396777:K119M|.	ENSP00000344724:K241M|ENSP00000362083:R7W	K|R	+|+	2|1	0|2	TOX2|TOX2	42116423|42116423	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.339000|9.339000	0.96797|0.96797	2.068000|2.068000	0.61886|0.61886	0.528000|0.528000	0.53228|0.53228	AAG|AGG	TOX2	-	superfamily_HMG_superfamily	ENSG00000124191		0.537	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2	49	0.00	0	A			42683009	42683009	+1	no_errors	ENST00000341197	ensembl	human	known	69_37n	missense	101	26.62	37	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	179	0.00	0	G	NM_000546		7578263	7578263	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	104	65.79	200	SNP	1.000	A
ZNF726	730087	genome.wustl.edu	37	19	24115276	24115276	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr19:24115276G>T	ENST00000594466.1	+	4	463	c.358G>T	c.(358-360)Gtg>Ttg	p.V120L	CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron|ZNF726_ENST00000334589.5_Intron|ZNF726_ENST00000322487.7_Missense_Mutation_p.V120L	NM_001244038.1	NP_001230967.1	A6NNF4	ZN726_HUMAN	zinc finger protein 726	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTGTAAAAGTGTGGATGAGTG	0.363																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000594466.1:c.358G>T	19.37:g.24115276G>T	ENSP00000471516:p.Val120Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	M0R0X8|Q86Y87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V120L	ENST00000594466.1	37	c.358	CCDS59372.1	19	.	.	.	.	.	.	.	.	.	.	g	6.687	0.495414	0.12762	.	.	ENSG00000213967	ENST00000322487	T	0.06218	3.33	1.25	-0.382	0.12481	.	.	.	.	.	T	0.02807	0.0084	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47923	-0.9079	6	0.12103	T	0.63	.	4.6466	0.12575	0.0:0.0:0.4319:0.5681	.	.	.	.	L	120	ENSP00000317125:V120L	ENSP00000317125:V120L	V	+	1	0	ZNF726	23907116	0.001000	0.12720	0.006000	0.13384	0.203000	0.24098	-0.292000	0.08332	0.658000	0.30925	0.205000	0.17691	GTG	ZNF726	-	NULL	ENSG00000213967		0.363	ZNF726-005	PUTATIVE	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF726	HGNC	protein_coding	OTTHUMT00000466443.1	236	0.42	1	G	XM_001715134		24115276	24115276	+1	no_errors	ENST00000322487	ensembl	human	known	69_37n	missense	100	10.71	12	SNP	0.007	T
URI1	8725	genome.wustl.edu	37	19	30505832	30505832	+	Silent	SNP	A	A	G			TCGA-AR-A1AP-01A-11D-A12Q-09	TCGA-AR-A1AP-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	597e37c9-f0c9-4839-800e-6e9519ec3add	db345a86-cbeb-4514-b490-b730372b90dc	g.chr19:30505832A>G	ENST00000542441.2	+	11	1761	c.1464A>G	c.(1462-1464)tcA>tcG	p.S488S	URI1_ENST00000360605.4_Intron|URI1_ENST00000392271.1_Silent_p.S412S|URI1_ENST00000312051.6_Silent_p.S448S			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	488					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										AATTTGTATCACCTTCCTTAA	0.403																																						dbGAP											0													126.0	132.0	130.0					19																	30505832		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1464A>G	19.37:g.30505832A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	pfam_Prefoldin_subunit,superfamily_Prefoldin	p.S488	ENST00000542441.2	37	c.1464	CCDS12420.1	19																																																																																			URI1	-	NULL	ENSG00000105176		0.403	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URI1	HGNC	protein_coding	OTTHUMT00000439756.1	144	0.00	0	A	NM_134447		30505832	30505832	+1	no_errors	ENST00000542441	ensembl	human	known	69_37n	silent	93	33.12	51	SNP	0.011	G
