#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AMOT	154796	genome.wustl.edu	37	X	112065720	112065720	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chrX:112065720G>T	ENST00000524145.1	-	2	709	c.635C>A	c.(634-636)aCa>aAa	p.T212K	AMOT_ENST00000371962.1_5'UTR|AMOT_ENST00000462114.1_5'Flank|AMOT_ENST00000304758.1_Intron|AMOT_ENST00000371959.3_Missense_Mutation_p.T212K|AMOT_ENST00000371958.1_5'UTR			Q4VCS5	AMOT_HUMAN	angiomotin	212					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						ACTGGAACTTGTGGGATTCTT	0.547																																						dbGAP											0													238.0	196.0	208.0					X																	112065720		692	1591	2283	-	-	-	SO:0001583	missense	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.635C>A	X.37:g.112065720G>T	ENSP00000429013:p.Thr212Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.T212K	ENST00000524145.1	37	c.635	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098327	0.37048	.	.	ENSG00000126016	ENST00000371959;ENST00000524145	T;T	0.13778	2.56;2.56	5.49	4.57	0.56435	.	0.146062	0.45361	D	0.000364	T	0.10723	0.0262	L	0.34521	1.04	0.34133	D	0.665501	B	0.29432	0.244	B	0.29785	0.107	T	0.17137	-1.0379	10	0.27785	T	0.31	-10.265	10.3233	0.43780	0.0:0.194:0.806:0.0	.	212	Q4VCS5	AMOT_HUMAN	K	212	ENSP00000361027:T212K;ENSP00000429013:T212K	ENSP00000361027:T212K	T	-	2	0	AMOT	111952376	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.756000	0.47549	2.299000	0.77371	0.600000	0.82982	ACA	AMOT	-	NULL	ENSG00000126016		0.547	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	659	0.30	2	G	NM_133265		112065720	112065720	-1	no_errors	ENST00000371959	ensembl	human	known	69_37n	missense	532	22.79	157	SNP	0.998	T
BAZ2B	29994	genome.wustl.edu	37	2	160181323	160181323	+	Splice_Site	SNP	G	G	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr2:160181323G>A	ENST00000392783.2	-	36	6847	c.6352C>T	c.(6352-6354)Cag>Tag	p.Q2118*	BAZ2B_ENST00000355831.2_Splice_Site_p.Q2084*|BAZ2B_ENST00000343439.5_Splice_Site_p.Q2018*|BAZ2B_ENST00000392782.1_Splice_Site_p.Q2082*	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	2118	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TTTACTTACTGTCCACTACTT	0.294																																						dbGAP											0													48.0	45.0	46.0					2																	160181323		1800	4064	5864	-	-	-	SO:0001630	splice_region_variant	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.6353+1C>T	2.37:g.160181323G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Nonsense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.Q2118*	ENST00000392783.2	37	c.6352	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	G	49	15.198450	0.99826	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	.	.	.	5.48	5.48	0.80851	.	0.000000	0.35320	U	0.003288	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-6.2644	19.7236	0.96153	0.0:0.0:1.0:0.0	.	.	.	.	X	2082;2118;2084;2018	.	ENSP00000339670:Q2018X	Q	-	1	0	BAZ2B	159889569	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.449000	0.80643	2.730000	0.93505	0.655000	0.94253	CAG	BAZ2B	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000123636		0.294	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	86	0.00	0	G		Nonsense_Mutation	160181323	160181323	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	nonsense	108	17.56	23	SNP	1.000	A
BRF1	2972	genome.wustl.edu	37	14	105683986	105683986	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr14:105683986C>T	ENST00000546474.1	-	15	16626	c.1667G>A	c.(1666-1668)aGg>aAg	p.R556K	BRF1_ENST00000551787.1_Intron|BRF1_ENST00000379937.2_Missense_Mutation_p.R529K|BRF1_ENST00000392557.4_Missense_Mutation_p.R352K|BRF1_ENST00000440513.3_Missense_Mutation_p.R463K|BRF1_ENST00000327359.3_Missense_Mutation_p.R441K|BRF1_ENST00000547530.1_Missense_Mutation_p.R82K|BRF1_ENST00000549044.1_5'UTR|BRF1_ENST00000446501.2_Missense_Mutation_p.R318K|BRF1_ENST00000379932.4_Intron	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	556					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		TGCATCCTCCCTGTGCGGACT	0.637																																						dbGAP											0													54.0	45.0	48.0					14																	105683986		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1667G>A	14.37:g.105683986C>T	ENSP00000448323:p.Arg556Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	pfam_TFIIB_cyclin,pfam_BRF1_TBP-bd,pfam_Znf_TFIIB,superfamily_Cyclin-like,smart_Cyclin-like,prints_TFIIB,pfscan_Znf_TFIIB	p.R556K	ENST00000546474.1	37	c.1667	CCDS10001.1	14	.	.	.	.	.	.	.	.	.	.	C	3.367	-0.129141	0.06753	.	.	ENSG00000185024	ENST00000392557;ENST00000379937;ENST00000546474;ENST00000547530;ENST00000446501;ENST00000327359;ENST00000440513;ENST00000547562	.	.	.	5.35	1.19	0.21007	.	1.159600	0.06009	N	0.649252	T	0.26991	0.0661	L	0.36672	1.1	0.20307	N	0.999916	B;B;B;B	0.19706	0.001;0.038;0.001;0.0	B;B;B;B	0.14023	0.006;0.01;0.003;0.002	T	0.20538	-1.0272	9	0.02654	T	1	.	4.8797	0.13674	0.0:0.3566:0.3884:0.255	.	463;115;529;556	F5H5Z7;Q6ZV39;Q92994-5;Q92994	.;.;.;TF3B_HUMAN	K	352;529;556;82;318;441;463;276	.	ENSP00000329029:R441K	R	-	2	0	BRF1	104755031	0.004000	0.15560	0.002000	0.10522	0.023000	0.10783	1.155000	0.31700	0.156000	0.19299	0.561000	0.74099	AGG	BRF1	-	NULL	ENSG00000185024		0.637	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF1	HGNC	protein_coding	OTTHUMT00000074548.4	81	0.00	0	C	NM_001519		105683986	105683986	-1	no_errors	ENST00000546474	ensembl	human	known	69_37n	missense	38	34.48	20	SNP	0.024	T
BZRAP1	9256	genome.wustl.edu	37	17	56386383	56386384	+	Frame_Shift_Ins	INS	-	-	T	rs373235874		TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr17:56386383_56386384insT	ENST00000343736.4	-	22	4412_4413	c.4249_4250insA	c.(4249-4251)agcfs	p.S1417fs	BZRAP1_ENST00000355701.3_Frame_Shift_Ins_p.S1417fs|BZRAP1_ENST00000268893.6_Frame_Shift_Ins_p.S1357fs			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1417						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCGCCTGCGGCTTGGGGGCTTC	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4250dupA	17.37:g.56386385_56386385dupT	ENSP00000345824:p.Ser1417fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75111|Q8N5W3	Frame_Shift_Ins	INS	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.S1417fs	ENST00000343736.4	37	c.4250_4249	CCDS11605.1	17																																																																																			BZRAP1	-	NULL	ENSG00000005379		0.653	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	19	0.00	0	-	NM_004758		56386383	56386384	-1	no_errors	ENST00000355701	ensembl	human	known	69_37n	frame_shift_ins	7	22.22	2	INS	0.000:0.001	T
C1orf94	84970	genome.wustl.edu	37	1	34663500	34663500	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:34663500G>A	ENST00000488417.1	+	2	1115	c.995G>A	c.(994-996)aGg>aAg	p.R332K	C1orf94_ENST00000373374.3_Missense_Mutation_p.R142K	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	332										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				GCTGTGGAGAGGCACCACTTG	0.587																																						dbGAP											0													40.0	37.0	38.0					1																	34663500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.995G>A	1.37:g.34663500G>A	ENSP00000435634:p.Arg332Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	NULL	p.R332K	ENST00000488417.1	37	c.995	CCDS44108.1	1	.	.	.	.	.	.	.	.	.	.	G	9.043	0.990114	0.18966	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	T;T	0.23950	1.88;1.88	4.99	4.07	0.47477	.	0.663604	0.13890	N	0.355655	T	0.17280	0.0415	N	0.22421	0.69	0.22240	N	0.999265	B	0.24426	0.103	B	0.19946	0.027	T	0.16453	-1.0402	10	0.40728	T	0.16	-2.0076	9.2651	0.37636	0.1015:0.0:0.8985:0.0	.	332	Q6P1W5	CA094_HUMAN	K	142;332	ENSP00000362472:R142K;ENSP00000435634:R332K	ENSP00000362472:R142K	R	+	2	0	C1orf94	34436087	0.999000	0.42202	0.979000	0.43373	0.427000	0.31564	0.930000	0.28858	1.083000	0.41159	0.557000	0.71058	AGG	C1orf94	-	NULL	ENSG00000142698		0.587	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf94	HGNC	protein_coding	OTTHUMT00000036845.2	56	0.00	0	G	NM_032884		34663500	34663500	+1	no_errors	ENST00000488417	ensembl	human	known	69_37n	missense	39	26.42	14	SNP	0.994	A
CALB2	794	genome.wustl.edu	37	16	71417313	71417313	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr16:71417313A>T	ENST00000302628.4	+	6	520	c.443A>T	c.(442-444)gAt>gTt	p.D148V	CALB2_ENST00000349553.5_Missense_Mutation_p.D148V	NM_001740.4	NP_001731.2	P22676	CALB2_HUMAN	calbindin 2	148					cytosolic calcium ion homeostasis (GO:0051480)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18		Ovarian(137;0.125)				CGGCCGTACGATGAGCCCAAG	0.552																																						dbGAP											0													117.0	89.0	98.0					16																	71417313		2198	4300	6498	-	-	-	SO:0001583	missense	0			X56667	CCDS10899.1	16q22.2	2013-01-10	2008-05-19		ENSG00000172137	ENSG00000172137		"""EF-hand domain containing"""	1435	protein-coding gene	gene with protein product	"""calretinin"""	114051	"""calbindin 2, 29kDa (calretinin)"""			1906795	Standard	NM_001740		Approved	CAL2	uc002faa.4	P22676	OTTHUMG00000137589	ENST00000302628.4:c.443A>T	16.37:g.71417313A>T	ENSP00000307508:p.Asp148Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Y1|Q53HD2|Q96BK4	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D148V	ENST00000302628.4	37	c.443	CCDS10899.1	16	.	.	.	.	.	.	.	.	.	.	a	17.77	3.472135	0.63737	.	.	ENSG00000172137	ENST00000349553;ENST00000302628	T;T	0.68903	-0.36;-0.36	5.6	5.6	0.85130	EF-hand-like domain (1);	0.096427	0.64402	D	0.000002	T	0.78811	0.4342	M	0.73319	2.225	0.80722	D	1	P;P	0.42941	0.794;0.658	P;P	0.56788	0.806;0.745	T	0.80594	-0.1313	10	0.66056	D	0.02	-22.2483	14.851	0.70297	1.0:0.0:0.0:0.0	.	148;148	A6NER6;P22676	.;CALB2_HUMAN	V	148	ENSP00000340294:D148V;ENSP00000307508:D148V	ENSP00000307508:D148V	D	+	2	0	CALB2	69974814	1.000000	0.71417	0.881000	0.34555	0.339000	0.28857	7.974000	0.88039	2.138000	0.66242	0.520000	0.50463	GAT	CALB2	-	NULL	ENSG00000172137		0.552	CALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALB2	HGNC	protein_coding	OTTHUMT00000268988.1	232	0.00	0	A	NM_001740		71417313	71417313	+1	no_errors	ENST00000302628	ensembl	human	known	69_37n	missense	116	32.18	56	SNP	1.000	T
CENPF	1063	genome.wustl.edu	37	1	214803928	214803928	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:214803928C>A	ENST00000366955.3	+	9	1414	c.1246C>A	c.(1246-1248)Cag>Aag	p.Q416K		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGAGTGCATCCAGATGAAGGC	0.527																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													195.0	175.0	182.0					1																	214803928		2203	4300	6503	-	-	-	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1246C>A	1.37:g.214803928C>A	ENSP00000355922:p.Gln416Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.Q416K	ENST00000366955.3	37	c.1246	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146991	0.57151	.	.	ENSG00000117724	ENST00000366955	T	0.75821	-0.97	5.46	5.46	0.80206	.	0.000000	0.36134	N	0.002771	T	0.81669	0.4871	.	.	.	0.46849	D	0.999227	D	0.59767	0.986	P	0.56514	0.8	T	0.80200	-0.1481	9	0.36615	T	0.2	.	16.6901	0.85319	0.0:0.8708:0.1291:0.0	.	416	P49454	CENPF_HUMAN	K	416	ENSP00000355922:Q416K	ENSP00000355922:Q416K	Q	+	1	0	CENPF	212870551	0.989000	0.36119	0.891000	0.34965	0.082000	0.17680	2.858000	0.48356	2.713000	0.92767	0.655000	0.94253	CAG	CENPF	-	NULL	ENSG00000117724		0.527	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	228	0.00	0	C	NM_016343		214803928	214803928	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	missense	263	21.26	71	SNP	0.996	A
CLCN3	1182	genome.wustl.edu	37	4	170557240	170557240	+	Splice_Site	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr4:170557240G>T	ENST00000513761.1	+	2	719		c.e2+1		CLCN3_ENST00000504131.2_Splice_Site|CLCN3_ENST00000347613.4_Splice_Site|CLCN3_ENST00000506924.1_Splice_Site|CLCN3_ENST00000360642.3_Splice_Site	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3						chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		ACTGCAGTTGGTAAGTTCAGC	0.323																																						dbGAP											0													101.0	96.0	98.0					4																	170557240		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.160+1G>T	4.37:g.170557240G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Splice_Site	SNP	-	e1+1	ENST00000513761.1	37	c.160+1	CCDS34101.1	4	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717905	0.48622	.	.	ENSG00000109572	ENST00000511092;ENST00000513761;ENST00000347613;ENST00000360642;ENST00000512813;ENST00000538301;ENST00000504131	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2378	0.93867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CLCN3	170793815	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	8.379000	0.90146	2.622000	0.88805	0.563000	0.77884	.	CLCN3	-	-	ENSG00000109572		0.323	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLCN3	HGNC	protein_coding	OTTHUMT00000363210.2	204	0.00	0	G		Intron	170557240	170557240	+1	no_errors	ENST00000347613	ensembl	human	known	69_37n	splice_site	125	28.57	50	SNP	1.000	T
OR5K2	402135	genome.wustl.edu	37	3	98217028	98217028	+	Silent	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr3:98217028C>T	ENST00000427338.1	+	1	581	c.504C>T	c.(502-504)ttC>ttT	p.F168F	CLDND1_ENST00000502288.1_Splice_Site	NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GGTTAGTTTTCTGTGGATTGA	0.408																																						dbGAP											0													241.0	243.0	242.0					3																	98217028		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.504C>T	3.37:g.98217028C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN70|Q6IF47	Splice_Site	SNP	-	e4-1	ENST00000427338.1	37	c.257-1	CCDS33804.1	3	.	.	.	.	.	.	.	.	.	.	.	4.772	0.143564	0.09134	.	.	ENSG00000080822	ENST00000502288	.	.	.	2.91	2.91	0.33838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.9451	0.19213	0.0:0.8576:0.0:0.1424	.	.	.	.	.	-1	.	.	.	-	.	.	CLDND1	99699718	0.022000	0.18835	0.795000	0.32087	0.248000	0.25809	0.022000	0.13511	1.922000	0.55676	0.305000	0.20034	.	CLDND1	-	-	ENSG00000080822		0.408	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDND1	HGNC	protein_coding	OTTHUMT00000359020.2	546	0.18	1	C			98217028	98217028	-1	no_errors	ENST00000502288	ensembl	human	putative	69_37n	splice_site	486	26.59	176	SNP	0.994	T
CMTM7	112616	genome.wustl.edu	37	3	32490993	32490993	+	Silent	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr3:32490993C>T	ENST00000334983.5	+	3	617	c.381C>T	c.(379-381)tcC>tcT	p.S127S	CMTM7_ENST00000349718.4_Intron	NM_138410.2	NP_612419.1	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing 7	127	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(1)|lung(2)	4						TCATCGCCTCCATTGTGGCAG	0.502																																						dbGAP											0													124.0	123.0	123.0					3																	32490993		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF479263	CCDS33730.1, CCDS33731.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000153551	ENSG00000153551			19178	protein-coding gene	gene with protein product		607890	"""chemokine-like factor super family 7"", ""chemokine-like factor superfamily 7"""	CKLFSF7			Standard	NM_138410		Approved	FLJ30992	uc003cey.1	Q96FZ5	OTTHUMG00000155869	ENST00000334983.5:c.381C>T	3.37:g.32490993C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VLK1	Silent	SNP	pfam_MARVEL-like_dom	p.S127	ENST00000334983.5	37	c.381	CCDS33730.1	3																																																																																			CMTM7	-	pfam_MARVEL-like_dom	ENSG00000153551		0.502	CMTM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMTM7	HGNC	protein_coding	OTTHUMT00000342084.1	352	0.00	0	C			32490993	32490993	+1	no_errors	ENST00000334983	ensembl	human	known	69_37n	silent	313	20.30	80	SNP	1.000	T
COL6A6	131873	genome.wustl.edu	37	3	130300437	130300437	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr3:130300437G>T	ENST00000358511.6	+	8	3611	c.3580G>T	c.(3580-3582)Gtc>Ttc	p.V1194F	COL6A6_ENST00000453409.2_Missense_Mutation_p.V1194F	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1194	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGGATTTGATGTCTCAACTCA	0.433																																						dbGAP											0													147.0	137.0	140.0					3																	130300437		1978	4171	6149	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3580G>T	3.37:g.130300437G>T	ENSP00000351310:p.Val1194Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V1194F	ENST00000358511.6	37	c.3580	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996387	0.35226	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.37752	1.18;1.18	5.96	2.08	0.27032	von Willebrand factor, type A (2);	.	.	.	.	T	0.16685	0.0401	N	0.14661	0.345	0.26338	N	0.9774	B	0.32245	0.361	B	0.24006	0.05	T	0.17961	-1.0352	9	0.23891	T	0.37	.	5.5371	0.17018	0.6965:0.1417:0.1618:0.0	.	1194	A6NMZ7	CO6A6_HUMAN	F	1194	ENSP00000351310:V1194F;ENSP00000399236:V1194F	ENSP00000351310:V1194F	V	+	1	0	COL6A6	131783127	0.994000	0.37717	0.916000	0.36221	0.684000	0.39900	1.790000	0.38734	0.115000	0.18071	-0.176000	0.13171	GTC	COL6A6	-	smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.433	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	383	0.00	0	G	NM_001102608		130300437	130300437	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	387	22.13	110	SNP	0.984	T
CLSTN2	64084	genome.wustl.edu	37	3	140122483	140122483	+	Missense_Mutation	SNP	C	C	T	rs529034321		TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr3:140122483C>T	ENST00000458420.3	+	3	435	c.245C>T	c.(244-246)gCg>gTg	p.A82V	AC092988.1_ENST00000580582.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	82	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GAAATCTGTGCGTTCAAGATC	0.532										HNSCC(16;0.037)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18997	0.0		0.0	False		,,,				2504	0.001				GBM(45;858 913 3709 36904 37282)	dbGAP											0													165.0	157.0	160.0					3																	140122483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.245C>T	3.37:g.140122483C>T	ENSP00000402460:p.Ala82Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A82V	ENST00000458420.3	37	c.245	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040343	0.75732	.	.	ENSG00000158258	ENST00000458420	T	0.37584	1.19	5.63	5.63	0.86233	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.44117	0.1278	L	0.38838	1.175	0.54753	D	0.999985	D	0.67145	0.996	P	0.54664	0.758	T	0.15636	-1.0430	10	0.40728	T	0.16	8.0285	17.1916	0.86881	0.0:1.0:0.0:0.0	.	82	Q9H4D0	CSTN2_HUMAN	V	82	ENSP00000402460:A82V	ENSP00000402460:A82V	A	+	2	0	CLSTN2	141605173	0.971000	0.33674	0.875000	0.34327	0.789000	0.44602	2.229000	0.42990	2.649000	0.89929	0.650000	0.86243	GCG	CLSTN2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000158258		0.532	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	155	0.00	0	C	NM_022131		140122483	140122483	+1	no_errors	ENST00000458420	ensembl	human	known	69_37n	missense	126	27.59	48	SNP	0.981	T
CTNNA3	29119	genome.wustl.edu	37	10	67726393	67726394	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr10:67726393_67726394insT	ENST00000433211.2	-	17	2550_2551	c.2376_2377insA	c.(2374-2379)ctgggafs	p.G793fs	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Frame_Shift_Ins_p.G793fs	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						AGCTCTCCTCCCAGGTTCTGGA	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2376_2377insA	10.37:g.67726393_67726394insT	ENSP00000389714:p.Gly793fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.G792fs	ENST00000433211.2	37	c.2377_2376	CCDS7269.1	10																																																																																			CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000183230		0.446	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	209	0.00	0	-	NM_013266		67726393	67726394	-1	no_errors	ENST00000373744	ensembl	human	known	69_37n	frame_shift_ins	204	22.43	59	INS	1.000:0.931	T
CTNNA3	29119	genome.wustl.edu	37	10	67726396	67726396	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr10:67726396G>T	ENST00000433211.2	-	17	2548	c.2374C>A	c.(2374-2376)Ctg>Atg	p.L792M	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.L792M	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TCTCCTCCCAGGTTCTGGATC	0.448																																						dbGAP											0													121.0	116.0	117.0					10																	67726396		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2374C>A	10.37:g.67726396G>T	ENSP00000389714:p.Leu792Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.L792M	ENST00000433211.2	37	c.2374	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326087	0.60743	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.38077	1.16;1.16;1.16	5.41	0.196	0.15159	.	0.000000	0.45126	D	0.000390	T	0.30262	0.0759	L	0.60455	1.87	0.80722	D	1	B	0.33135	0.399	B	0.35470	0.203	T	0.05468	-1.0883	10	0.54805	T	0.06	-13.3011	5.87	0.18799	0.3041:0.0:0.5682:0.1277	.	792	Q9UI47	CTNA3_HUMAN	M	792;792;131	ENSP00000389714:L792M;ENSP00000362849:L792M;ENSP00000362840:L131M	ENSP00000362840:L131M	L	-	1	2	CTNNA3	67396402	1.000000	0.71417	0.238000	0.24106	0.997000	0.91878	4.017000	0.57167	0.063000	0.16370	0.650000	0.86243	CTG	CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000183230		0.448	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	215	0.00	0	G	NM_013266		67726396	67726396	-1	no_errors	ENST00000373744	ensembl	human	known	69_37n	missense	207	23.62	64	SNP	0.999	T
DHRS2	10202	genome.wustl.edu	37	14	24113663	24113663	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr14:24113663A>G	ENST00000250383.6	+	7	1062	c.586A>G	c.(586-588)Act>Gct	p.T196A	DHRS2_ENST00000344777.7_Missense_Mutation_p.T196A	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	196					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		GCTGGGTCTCACTAGAACACT	0.522																																						dbGAP											0													84.0	83.0	84.0					14																	24113663		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.586A>G	14.37:g.24113663A>G	ENSP00000250383:p.Thr196Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.T196A	ENST00000250383.6	37	c.586	CCDS9604.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.34|11.34	1.610446|1.610446	0.28712|0.28712	.|.	.|.	ENSG00000100867|ENSG00000100867	ENST00000557535|ENST00000432832;ENST00000250383;ENST00000344777;ENST00000553600	.|T;T;T;T	.|0.29397	.|1.57;1.57;1.57;1.57	5.08|5.08	3.92|3.92	0.45320|0.45320	.|.	.|0.110432	.|0.64402	.|D	.|0.000013	T|T	0.35393|0.35393	0.0930|0.0930	M|M	0.63208|0.63208	1.945|1.945	0.48830|0.48830	D|D	0.999713|0.999713	.|P;P;P	.|0.44986	.|0.651;0.847;0.792	.|B;P;B	.|0.45712	.|0.438;0.491;0.279	T|T	0.14699|0.14699	-1.0463|-1.0463	5|10	.|0.59425	.|D	.|0.04	.|.	9.862|9.862	0.41120|0.41120	0.8472:0.0:0.0:0.1528|0.8472:0.0:0.0:0.1528	.|.	.|196;196;174	.|C9JZP6;D3DS54;Q13268-2	.|.;.;.	R|A	111|196;196;196;96	.|ENSP00000401213:T196A;ENSP00000250383:T196A;ENSP00000344674:T196A;ENSP00000451485:T96A	.|ENSP00000250383:T196A	H|T	+|+	2|1	0|0	DHRS2|DHRS2	23183503|23183503	0.996000|0.996000	0.38824|0.38824	0.039000|0.039000	0.18376|0.18376	0.107000|0.107000	0.19398|0.19398	2.685000|2.685000	0.46959|0.46959	1.027000|1.027000	0.39758|0.39758	0.379000|0.379000	0.24179|0.24179	CAC|ACT	DHRS2	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	ENSG00000100867		0.522	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHRS2	HGNC	protein_coding	OTTHUMT00000071842.2	111	0.00	0	A	NM_182908		24113663	24113663	+1	no_errors	ENST00000344777	ensembl	human	known	69_37n	missense	37	41.27	26	SNP	0.999	G
ENO3	2027	genome.wustl.edu	37	17	4857133	4857133	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr17:4857133C>T	ENST00000323997.6	+	6	569	c.437C>T	c.(436-438)cCa>cTa	p.P146L	ENO3_ENST00000519584.1_Missense_Mutation_p.P103L|ENO3_ENST00000518175.1_Missense_Mutation_p.P146L	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	146					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						CTCATACTCCCAGTGCCAGTG	0.642																																						dbGAP											0													97.0	83.0	88.0					17																	4857133		2203	4300	6503	-	-	-	SO:0001583	missense	0			X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.437C>T	17.37:g.4857133C>T	ENSP00000324105:p.Pro146Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.P146L	ENST00000323997.6	37	c.437	CCDS11062.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.744949	0.96882	.	.	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000519584;ENST00000518175	T;T;D;T;D;D	0.94723	0.73;-0.29;-3.5;0.25;-3.5;-3.5	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.97679	0.9239	H	0.95004	3.61	0.80722	D	1	P;D;D	0.54964	0.681;0.969;0.969	P;P;P	0.58077	0.519;0.832;0.832	D	0.98483	1.0606	10	0.87932	D	0	-31.6699	17.3501	0.87321	0.0:1.0:0.0:0.0	.	103;53;146	P13929-3;D3DTL4;D3DTL2	.;.;.	L	146;146;146;146;103;146	ENSP00000428502:P146L;ENSP00000430055:P146L;ENSP00000324105:P146L;ENSP00000428811:P146L;ENSP00000430636:P103L;ENSP00000431087:P146L	ENSP00000324105:P146L	P	+	2	0	ENO3	4797879	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.776000	0.85560	2.767000	0.95098	0.655000	0.94253	CCA	ENO3	-	pfam_Enolase_C,pirsf_Enolase,tigrfam_Enolase	ENSG00000108515		0.642	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO3	HGNC	protein_coding	OTTHUMT00000216851.2	158	0.00	0	C			4857133	4857133	+1	no_errors	ENST00000323997	ensembl	human	known	69_37n	missense	77	36.89	45	SNP	1.000	T
EVPL	2125	genome.wustl.edu	37	17	74017827	74017827	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr17:74017827C>A	ENST00000301607.3	-	8	1096	c.843G>T	c.(841-843)caG>caT	p.Q281H	EVPL_ENST00000586740.1_Missense_Mutation_p.Q281H	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	281	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						GGTTCACGCTCTGCTCCTGGC	0.721																																						dbGAP											0													18.0	22.0	20.0					17																	74017827		2198	4291	6489	-	-	-	SO:0001583	missense	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.843G>T	17.37:g.74017827C>A	ENSP00000301607:p.Gln281His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin/RR-like,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Q281H	ENST00000301607.3	37	c.843	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337305	0.60963	.	.	ENSG00000167880	ENST00000301607	T	0.35048	1.33	4.33	3.32	0.38043	.	0.530532	0.19087	N	0.123083	T	0.32882	0.0844	L	0.39898	1.24	0.24031	N	0.99611	P;P	0.47604	0.898;0.761	P;B	0.44447	0.45;0.275	T	0.12344	-1.0551	10	0.66056	D	0.02	-14.5454	11.034	0.47789	0.1865:0.8135:0.0:0.0	.	281;281	B7ZLH8;Q92817	.;EVPL_HUMAN	H	281	ENSP00000301607:Q281H	ENSP00000301607:Q281H	Q	-	3	2	EVPL	71529422	0.005000	0.15991	0.978000	0.43139	0.978000	0.69477	0.354000	0.20146	0.898000	0.36418	0.467000	0.42956	CAG	EVPL	-	smart_Spectrin/alpha-actinin	ENSG00000167880		0.721	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	25	0.00	0	C	NM_001988		74017827	74017827	-1	no_errors	ENST00000301607	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	0.890	A
FLG	2312	genome.wustl.edu	37	1	152286025	152286025	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:152286025C>G	ENST00000368799.1	-	3	1372	c.1337G>C	c.(1336-1338)aGa>aCa	p.R446T	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	446	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCTGCTGTCTCAGCCCAGC	0.587									Ichthyosis																													dbGAP											0													200.0	194.0	196.0					1																	152286025		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1337G>C	1.37:g.152286025C>G	ENSP00000357789:p.Arg446Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.R446T	ENST00000368799.1	37	c.1337	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	-	8.940	0.965660	0.18583	.	.	ENSG00000143631	ENST00000368799	T	0.00745	5.75	2.87	-1.65	0.08291	.	.	.	.	.	T	0.00144	0.0004	N	0.02539	-0.55	0.09310	N	1	P	0.45715	0.865	P	0.46510	0.519	T	0.16897	-1.0387	9	0.13853	T	0.58	.	4.2559	0.10717	0.0:0.3985:0.3606:0.2409	.	446	P20930	FILA_HUMAN	T	446	ENSP00000357789:R446T	ENSP00000357789:R446T	R	-	2	0	FLG	150552649	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.408000	0.07565	-0.687000	0.03738	AGA	FLG	-	NULL	ENSG00000143631		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	350	0.00	0	C	NM_002016		152286025	152286025	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	624	10.86	76	SNP	0.000	G
FSHR	2492	genome.wustl.edu	37	2	49190072	49190072	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr2:49190072T>C	ENST00000406846.2	-	10	2007	c.1888A>G	c.(1888-1890)Acc>Gcc	p.T630A	FSHR_ENST00000304421.4_Missense_Mutation_p.T604A|FSHR_ENST00000541117.1_Missense_Mutation_p.T366A|FSHR_ENST00000346173.3_Missense_Mutation_p.T568A	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	630					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.T630A(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	AAGTTTTTGGTAAAGATGGCA	0.463									Gonadal Dysgenesis, 46 XX																													dbGAP											1	Substitution - Missense(1)	lung(1)											81.0	83.0	82.0					2																	49190072		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1888A>G	2.37:g.49190072T>C	ENSP00000384708:p.Thr630Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_supfam,prints_FSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.T630A	ENST00000406846.2	37	c.1888	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785019	0.70222	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	D;D;D;D	0.96587	-4.06;-4.06;-4.06;-4.06	5.35	5.35	0.76521	.	0.103469	0.64402	D	0.000003	D	0.98457	0.9486	M	0.92833	3.35	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.80764	0.986;0.994;0.986	D	0.99552	1.0966	9	.	.	.	.	14.958	0.71131	0.0:0.0:0.0:1.0	.	604;568;630	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	A	630;568;604;366	ENSP00000384708:T630A;ENSP00000333908:T568A;ENSP00000306780:T604A;ENSP00000444172:T366A	.	T	-	1	0	FSHR	49043576	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.825000	0.86693	2.371000	0.80710	0.533000	0.62120	ACC	FSHR	-	prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000170820		0.463	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	315	0.00	0	T			49190072	49190072	-1	no_errors	ENST00000406846	ensembl	human	known	69_37n	missense	259	27.17	97	SNP	1.000	C
GNPAT	8443	genome.wustl.edu	37	1	231403518	231403518	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:231403518T>G	ENST00000366647.4	+	9	1317	c.1148T>G	c.(1147-1149)tTg>tGg	p.L383W	GNPAT_ENST00000366646.3_Missense_Mutation_p.L322W	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	383					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				AACATGGTTTTGAGCCCCTGG	0.443																																						dbGAP											0													118.0	110.0	113.0					1																	231403518		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1148T>G	1.37:g.231403518T>G	ENSP00000355607:p.Leu383Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.L383W	ENST00000366647.4	37	c.1148	CCDS1592.1	1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.651168	0.88056	.	.	ENSG00000116906	ENST00000366647;ENST00000366646;ENST00000416000	T;T;T	0.67698	-0.28;-0.28;-0.28	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000002	T	0.81616	0.4860	M	0.82056	2.57	0.80722	D	1	D;D	0.71674	0.996;0.998	P;D	0.69307	0.847;0.963	D	0.84758	0.0760	10	0.87932	D	0	.	14.8603	0.70376	0.0:0.0:0.0:1.0	.	322;383	B4DNM9;O15228	.;GNPAT_HUMAN	W	383;322;373	ENSP00000355607:L383W;ENSP00000355606:L322W;ENSP00000411640:L373W	ENSP00000355606:L322W	L	+	2	0	GNPAT	229470141	1.000000	0.71417	0.997000	0.53966	0.950000	0.60333	7.698000	0.84413	1.907000	0.55213	0.482000	0.46254	TTG	GNPAT	-	NULL	ENSG00000116906		0.443	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	HGNC	protein_coding	OTTHUMT00000092871.1	153	0.00	0	T			231403518	231403518	+1	no_errors	ENST00000366647	ensembl	human	known	69_37n	missense	193	17.17	40	SNP	1.000	G
HDX	139324	genome.wustl.edu	37	X	83581199	83581199	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chrX:83581199T>G	ENST00000297977.5	-	9	2045	c.1934A>C	c.(1933-1935)aAg>aCg	p.K645T	HDX_ENST00000506585.2_Missense_Mutation_p.K587T|HDX_ENST00000373177.2_Missense_Mutation_p.K645T	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	645						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						CTGTTGTTCCTTATCATCAGC	0.343																																					Pancreas(53;231 1169 36156 43751 51139)	dbGAP											0													130.0	118.0	122.0					X																	83581199		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1934A>C	X.37:g.83581199T>G	ENSP00000297977:p.Lys645Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.K645T	ENST00000297977.5	37	c.1934	CCDS35342.1	X	.	.	.	.	.	.	.	.	.	.	T	13.46	2.243184	0.39697	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.32272	1.48;1.46;1.48	5.14	5.14	0.70334	.	0.270966	0.36066	N	0.002805	T	0.42086	0.1187	L	0.27053	0.805	0.39804	D	0.972613	D	0.71674	0.998	D	0.78314	0.991	T	0.40308	-0.9570	10	0.48119	T	0.1	-3.358	14.2372	0.65934	0.0:0.0:0.0:1.0	.	645	Q7Z353	HDX_HUMAN	T	645;587;645	ENSP00000297977:K645T;ENSP00000362272:K587T;ENSP00000423670:K645T	ENSP00000297977:K645T	K	-	2	0	HDX	83467855	1.000000	0.71417	0.993000	0.49108	0.801000	0.45260	2.989000	0.49393	1.740000	0.51718	0.475000	0.43553	AAG	HDX	-	NULL	ENSG00000165259		0.343	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	HGNC	protein_coding	OTTHUMT00000057379.2	348	0.00	0	T	NM_144657		83581199	83581199	-1	no_errors	ENST00000297977	ensembl	human	known	69_37n	missense	277	28.05	108	SNP	1.000	G
ITGA10	8515	genome.wustl.edu	37	1	145530929	145530929	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:145530929G>A	ENST00000369304.3	+	7	836	c.661G>A	c.(661-663)Gat>Aat	p.D221N	ITGA10_ENST00000538811.1_Missense_Mutation_p.D90N|ITGA10_ENST00000539363.1_Missense_Mutation_p.D78N	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	221	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTCCCTGGGAGATTTCCGAAC	0.522																																						dbGAP											0													102.0	98.0	99.0					1																	145530929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.661G>A	1.37:g.145530929G>A	ENSP00000358310:p.Asp221Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.D221N	ENST00000369304.3	37	c.661	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242958	0.79912	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	D;D;D	0.84442	-1.85;-1.85;-1.85	5.4	5.4	0.78164	von Willebrand factor, type A (3);	0.068341	0.56097	D	0.000039	T	0.81456	0.4826	L	0.40543	1.245	0.45390	D	0.99837	P;P;P;P	0.49447	0.778;0.889;0.663;0.924	P;P;B;P	0.53760	0.498;0.498;0.247;0.734	T	0.82305	-0.0523	10	0.45353	T	0.12	.	12.4144	0.55486	0.0:0.1691:0.8308:0.0	.	187;90;78;221	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	N	221;187;78;90	ENSP00000358310:D221N;ENSP00000439894:D78N;ENSP00000440011:D90N	ENSP00000358310:D221N	D	+	1	0	ITGA10	144242286	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.758000	0.62220	2.539000	0.85634	0.655000	0.94253	GAT	ITGA10	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000143127		0.522	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	306	0.00	0	G	NM_003637		145530929	145530929	+1	no_errors	ENST00000369304	ensembl	human	known	69_37n	missense	408	22.14	116	SNP	1.000	A
ITIH4	3700	genome.wustl.edu	37	3	52860882	52860882	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr3:52860882C>A	ENST00000266041.4	-	4	540	c.444G>T	c.(442-444)gaG>gaT	p.E148D	ITIH4_ENST00000485816.1_Missense_Mutation_p.E148D|ITIH4_ENST00000406595.1_Missense_Mutation_p.E148D|ITIH4-AS1_ENST00000478366.1_RNA|ITIH4_ENST00000434759.3_Missense_Mutation_p.E60D|ITIH4_ENST00000346281.5_Missense_Mutation_p.E148D|RP5-966M1.6_ENST00000468472.1_3'UTR	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	148	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GCTTGAGCAGCTCCTCATAGA	0.607																																						dbGAP											0													71.0	69.0	69.0					3																	52860882		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.444G>T	3.37:g.52860882C>A	ENSP00000266041:p.Glu148Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.E148D	ENST00000266041.4	37	c.444	CCDS2865.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.95|18.95	3.732381|3.732381	0.69189|0.69189	.|.	.|.	ENSG00000055955|ENSG00000055955	ENST00000441637|ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000434759	.|T;T;T;T;T	.|0.32753	.|1.44;1.44;1.44;1.44;1.44	5.4|5.4	3.57|3.57	0.40892|0.40892	.|Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.64416|0.64416	0.2596|0.2596	M|M	0.92317|0.92317	3.295|3.295	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;1.0;0.999;0.997	T|T	0.72581|0.72581	-0.4250|-0.4250	5|10	.|0.87932	.|D	.|0	-38.8441|-38.8441	14.936|14.936	0.70954|0.70954	0.0:0.8659:0.0:0.1341|0.0:0.8659:0.0:0.1341	.|.	.|148;148;148;148	.|E9PGN5;B7ZKJ8;Q14624;Q14624-2	.|.;.;ITIH4_HUMAN;.	S|D	18|148;148;148;148;60	.|ENSP00000266041:E148D;ENSP00000340520:E148D;ENSP00000417824:E148D;ENSP00000384425:E148D;ENSP00000440036:E60D	.|ENSP00000266041:E148D	A|E	-|-	1|3	0|2	ITIH4|ITIH4	52835922|52835922	0.995000|0.995000	0.38212|0.38212	0.991000|0.991000	0.47740|0.47740	0.813000|0.813000	0.45954|0.45954	0.501000|0.501000	0.22578|0.22578	0.260000|0.260000	0.21731|0.21731	-1.134000|-1.134000	0.01955|0.01955	GCT|GAG	ITIH4	-	pfam_VIT,smart_VIT	ENSG00000055955		0.607	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITIH4	HGNC	protein_coding	OTTHUMT00000317715.1	101	0.00	0	C	NM_002218		52860882	52860882	-1	no_errors	ENST00000266041	ensembl	human	known	69_37n	missense	67	31.63	31	SNP	1.000	A
KLRF1	51348	genome.wustl.edu	37	12	9985925	9985925	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr12:9985925C>T	ENST00000279544.3	+	3	275	c.211C>T	c.(211-213)Caa>Taa	p.Q71*	KLRF1_ENST00000354855.3_Intron|KLRF1_ENST00000537723.1_Nonsense_Mutation_p.Q71*|KLRF1_ENST00000324214.4_Intron	NM_016523.1	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F, member 1	71					cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|MHC class I receptor activity (GO:0032393)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)	13						GCTAAAATGCCAAAAAGGAAG	0.358																																						dbGAP											0													105.0	100.0	101.0					12																	9985925		1856	4095	5951	-	-	-	SO:0001587	stop_gained	0			AF175206	CCDS41750.1	12p13.31	2011-08-30			ENSG00000150045	ENSG00000150045		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	13342	protein-coding gene	gene with protein product		605029				10671213	Standard	NM_001291823		Approved	CLEC5C, NKp80	uc021qux.1	Q9NZS2		ENST00000279544.3:c.211C>T	12.37:g.9985925C>T	ENSP00000279544:p.Gln71*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMT5|Q96PR2|Q96PR3|Q9NZS1	Nonsense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.Q71*	ENST00000279544.3	37	c.211	CCDS41750.1	12	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606514	0.28623	.	.	ENSG00000150045	ENST00000279544;ENST00000537723	.	.	.	2.75	1.85	0.25348	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.6931	0.17841	0.0:0.8479:0.0:0.1521	.	.	.	.	X	71	.	.	Q	+	1	0	KLRF1	9877192	0.322000	0.24634	0.684000	0.30055	0.257000	0.26127	0.235000	0.17948	0.755000	0.32990	0.461000	0.40582	CAA	KLRF1	-	NULL	ENSG00000150045		0.358	KLRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF1	HGNC	protein_coding	OTTHUMT00000399535.1	277	0.00	0	C	NM_016523		9985925	9985925	+1	no_errors	ENST00000279544	ensembl	human	known	69_37n	nonsense	167	32.11	79	SNP	0.681	T
KNG1	3827	genome.wustl.edu	37	3	186450435	186450435	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr3:186450435T>C	ENST00000265023.4	+	7	1114	c.902T>C	c.(901-903)aTt>aCt	p.I301T	RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000447445.1_Missense_Mutation_p.I265T|RP11-573D15.8_ENST00000354642.2_RNA|KNG1_ENST00000287611.2_Missense_Mutation_p.I301T	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	301	Cystatin kininogen-type 3. {ECO:0000255|PROSITE-ProRule:PRU00979}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		TATTTCAAGATTGACAATGTG	0.403																																						dbGAP											0													102.0	101.0	102.0					3																	186450435		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.902T>C	3.37:g.186450435T>C	ENSP00000265023:p.Ile301Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat,prints_Kininogen	p.I301T	ENST00000265023.4	37	c.902	CCDS43183.1	3	.	.	.	.	.	.	.	.	.	.	T	14.63	2.592612	0.46214	.	.	ENSG00000113889	ENST00000287611;ENST00000265023;ENST00000447445;ENST00000432028	T;T;T	0.26957	1.7;1.7;1.7	5.14	3.98	0.46160	Proteinase inhibitor I25, cystatin (2);	0.310015	0.28151	N	0.016406	T	0.29620	0.0739	M	0.79805	2.47	0.32338	N	0.560178	B;B	0.33448	0.412;0.162	B;B	0.33295	0.114;0.161	T	0.41627	-0.9498	10	0.46703	T	0.11	-16.0707	7.9748	0.30149	0.0:0.0945:0.0:0.9055	.	301;301	P01042;P01042-2	KNG1_HUMAN;.	T	301;301;265;289	ENSP00000287611:I301T;ENSP00000265023:I301T;ENSP00000396025:I265T	ENSP00000265023:I301T	I	+	2	0	KNG1	187933129	0.786000	0.28738	0.999000	0.59377	0.850000	0.48378	0.920000	0.28705	1.060000	0.40578	0.528000	0.53228	ATT	KNG1	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	ENSG00000113889		0.403	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KNG1	HGNC	protein_coding	OTTHUMT00000317738.1	162	0.00	0	T	NM_001102416		186450435	186450435	+1	no_errors	ENST00000265023	ensembl	human	known	69_37n	missense	164	30.80	73	SNP	1.000	C
LHX4	89884	genome.wustl.edu	37	1	180243387	180243387	+	Silent	SNP	C	C	T	rs139479246	byFrequency	TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:180243387C>T	ENST00000263726.2	+	6	1090	c.846C>T	c.(844-846)ggC>ggT	p.G282G	RP5-1180C10.2_ENST00000440959.2_RNA|RP5-1180C10.2_ENST00000415414.1_RNA	NM_033343.3	NP_203129.1	Q969G2	LHX4_HUMAN	LIM homeobox 4	282					medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)	16						ACGTTACAGGCGGACAGTTAA	0.502																																						dbGAP											0													109.0	101.0	104.0					1																	180243387		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037683	CCDS1338.1	1q25.3	2011-06-20			ENSG00000121454	ENSG00000121454		"""Homeoboxes / LIM class"""	21734	protein-coding gene	gene with protein product		602146				11844481, 11567216	Standard	NM_033343		Approved	Gsh4	uc001goe.2	Q969G2	OTTHUMG00000035115	ENST00000263726.2:c.846C>T	1.37:g.180243387C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHE0|Q8NHM1|Q8TCJ1|Q8WWX2|Q969W2	Silent	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.G282	ENST00000263726.2	37	c.846	CCDS1338.1	1																																																																																			LHX4	-	NULL	ENSG00000121454		0.502	LHX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX4	HGNC	protein_coding	OTTHUMT00000084995.2	90	0.00	0	C	NM_033343		180243387	180243387	+1	no_errors	ENST00000263726	ensembl	human	known	69_37n	silent	92	22.69	27	SNP	1.000	T
LINC00283	100874057	genome.wustl.edu	37	13	103396384	103396384	+	RNA	DEL	A	A	-			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr13:103396384delA	ENST00000430111.1	+	0	757									long intergenic non-protein coding RNA 283																		AGAGTTTATCAATCATTGATT	0.393																																						dbGAP											0													310.0	232.0	256.0					13																	103396384		692	1591	2283	-	-	-			0					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103396384delA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000430111.1	37	NULL		13																																																																																			LINC00283	-	-	ENSG00000231633		0.393	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	LINC00283	HGNC	antisense	OTTHUMT00000045714.1	438	0.00	0	A			103396384	103396384	+1	no_errors	ENST00000430111	ensembl	human	known	69_37n	rna	272	34.28	145	DEL	0.001	-
LRRK2	120892	genome.wustl.edu	37	12	40745430	40745430	+	Silent	SNP	T	T	G			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr12:40745430T>G	ENST00000298910.7	+	44	6529	c.6471T>G	c.(6469-6471)gcT>gcG	p.A2157A		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2157					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCATGGTTGCTACACATCACA	0.413																																						dbGAP											0													90.0	90.0	90.0					12																	40745430		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6471T>G	12.37:g.40745430T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.A2157	ENST00000298910.7	37	c.6471	CCDS31774.1	12																																																																																			LRRK2	-	NULL	ENSG00000188906		0.413	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	197	0.00	0	T	XM_058513		40745430	40745430	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	silent	88	39.31	57	SNP	0.137	G
LRSAM1	90678	genome.wustl.edu	37	9	130263396	130263396	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr9:130263396G>C	ENST00000323301.4	+	24	2624	c.2020G>C	c.(2020-2022)Gag>Cag	p.E674Q	LRSAM1_ENST00000483302.1_3'UTR|LRSAM1_ENST00000373322.1_Missense_Mutation_p.E674Q|LRSAM1_ENST00000300417.6_Missense_Mutation_p.E674Q|LRSAM1_ENST00000373324.4_Missense_Mutation_p.E647Q	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	674					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GCAGGCCTCAGAGTGTGTCGT	0.662																																						dbGAP											0													57.0	55.0	55.0					9																	130263396		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.2020G>C	9.37:g.130263396G>C	ENSP00000322937:p.Glu674Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.E674Q	ENST00000323301.4	37	c.2020	CCDS6873.1	9	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277910	0.80692	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	5.11	5.11	0.69529	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.87621	0.6223	M	0.76727	2.345	0.52501	D	0.999959	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	D	0.89104	0.3491	10	0.87932	D	0	-16.4953	16.0453	0.80717	0.0:0.0:1.0:0.0	.	647;674	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	Q	674;647;674;674	ENSP00000300417:E674Q;ENSP00000362421:E647Q;ENSP00000322937:E674Q;ENSP00000362419:E674Q	ENSP00000300417:E674Q	E	+	1	0	LRSAM1	129303217	1.000000	0.71417	0.145000	0.22337	0.910000	0.53928	6.981000	0.76166	2.379000	0.81126	0.462000	0.41574	GAG	LRSAM1	-	NULL	ENSG00000148356		0.662	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	71	0.00	0	G	NM_138361		130263396	130263396	+1	no_errors	ENST00000300417	ensembl	human	known	69_37n	missense	60	14.29	10	SNP	0.789	C
MIR381HG	378881	genome.wustl.edu	37	14	101509363	101509363	+	lincRNA	SNP	C	C	T	rs565750013		TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr14:101509363C>T	ENST00000553692.1	+	0	0				MIR381_ENST00000362150.1_RNA|MIR1185-2_ENST00000408687.1_RNA|MIR300_ENST00000401138.1_RNA|MIR376A1_ENST00000584362.1_RNA|MIR1185-1_ENST00000408598.1_RNA|MIR654_ENST00000385199.1_RNA	NR_104192.1				MIR381 host gene (non-protein coding)																		TGATTAATGGCGAATATACAG	0.512													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21842	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													101.0	92.0	95.0					14																	101509363		1568	3582	5150	-	-	-			0			AA861571		14q32.31	2013-07-30	2010-01-22	2010-01-22	ENSG00000258861	ENSG00000258861		"""Long non-coding RNAs"""	20136	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 225"""		"""chromosome 14 open reading frame 89"""	C14orf89			Standard	NR_104192		Approved	NCRNA00225			OTTHUMG00000171633		14.37:g.101509363C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000553692.1	37	NULL		14																																																																																			MIR1185-1	-	-	ENSG00000221525		0.512	MIR381HG-001	KNOWN	basic	lincRNA	MIR1185-1	HGNC	lincRNA	OTTHUMT00000414538.1	360	0.00	0	C			101509363	101509363	+1	no_errors	ENST00000408598	ensembl	human	known	69_37n	rna	333	20.53	86	SNP	0.211	T
MYO1F	4542	genome.wustl.edu	37	19	8601262	8601262	+	Silent	SNP	G	G	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr19:8601262G>A	ENST00000338257.8	-	19	2184	c.1917C>T	c.(1915-1917)ccC>ccT	p.P639P		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	639	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						GCCACGTCTCGGGGGTCAGAA	0.672																																						dbGAP											0													38.0	42.0	41.0					19																	8601262		2052	4202	6254	-	-	-	SO:0001819	synonymous_variant	0			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1917C>T	19.37:g.8601262G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WWN7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain	p.P639	ENST00000338257.8	37	c.1917	CCDS42494.1	19																																																																																			MYO1F	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000142347		0.672	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	102	0.00	0	G			8601262	8601262	-1	no_errors	ENST00000338257	ensembl	human	known	69_37n	silent	200	17.01	41	SNP	0.153	A
NPR3	4883	genome.wustl.edu	37	5	32724819	32724819	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr5:32724819C>T	ENST00000265074.8	+	2	1128	c.785C>T	c.(784-786)gCg>gTg	p.A262V	NPR3_ENST00000434067.2_Missense_Mutation_p.A46V|NPR3_ENST00000415685.2_Missense_Mutation_p.A46V|NPR3_ENST00000415167.2_Missense_Mutation_p.A262V	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	262					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	ATCATGTGTGCGAGCAGTGAC	0.532																																						dbGAP											0													173.0	175.0	175.0					5																	32724819		2194	4291	6485	-	-	-	SO:0001583	missense	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.785C>T	5.37:g.32724819C>T	ENSP00000265074:p.Ala262Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,prints_Ntpep_rcpt	p.A262V	ENST00000265074.8	37	c.785	CCDS56357.1	5	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487708	0.84854	.	.	ENSG00000113389	ENST00000509104;ENST00000434067;ENST00000415685;ENST00000265074;ENST00000415167	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	5.37	5.37	0.77165	Extracellular ligand-binding receptor (1);	0.150750	0.64402	D	0.000013	D	0.87034	0.6077	L	0.50333	1.59	0.38046	D	0.935622	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;P;P;P	0.64237	0.923;0.766;0.896;0.766	D	0.83726	0.0195	10	0.12103	T	0.63	-17.9107	18.7103	0.91653	0.0:1.0:0.0:0.0	.	46;46;262;262	E7EPG9;B4DT84;P17342;Q60I31	.;.;ANPRC_HUMAN;.	V	39;46;46;262;262	ENSP00000425325:A39V;ENSP00000388408:A46V;ENSP00000402490:A46V;ENSP00000265074:A262V;ENSP00000398028:A262V	ENSP00000265074:A262V	A	+	2	0	NPR3	32760576	0.997000	0.39634	1.000000	0.80357	0.989000	0.77384	3.122000	0.50446	2.472000	0.83506	0.655000	0.94253	GCG	NPR3	-	pfam_ANF_lig-bd_rcpt,prints_Ntpep_rcpt	ENSG00000113389		0.532	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPR3	HGNC	protein_coding	OTTHUMT00000317550.3	489	0.00	0	C	NM_000908		32724819	32724819	+1	no_errors	ENST00000265074	ensembl	human	known	69_37n	missense	244	36.53	141	SNP	1.000	T
OR14K1	343170	genome.wustl.edu	37	1	247902857	247902857	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:247902857G>C	ENST00000283225.2	+	1	941	c.941G>C	c.(940-942)aGa>aCa	p.R314T	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						gtaatgaaaagatgactaaag	0.368																																						dbGAP											0													46.0	41.0	43.0					1																	247902857		1887	4118	6005	-	-	-	SO:0001583	missense	0			BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.941G>C	1.37:g.247902857G>C	ENSP00000283225:p.Arg314Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R314T	ENST00000283225.2	37	c.941		1	.	.	.	.	.	.	.	.	.	.	G	6.694	0.496756	0.12762	.	.	ENSG00000153230	ENST00000283225	T	0.00297	8.23	2.01	-1.18	0.09617	.	.	.	.	.	T	0.00210	0.0006	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31336	-0.9947	6	0.66056	D	0.02	.	6.7228	0.23340	0.5258:0.0:0.4742:0.0	.	.	.	.	T	314	ENSP00000283225:R314T	ENSP00000283225:R314T	R	+	2	0	OR14K1	245969480	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.408000	0.07169	-0.332000	0.08489	-0.350000	0.07774	AGA	OR14K1	-	NULL	ENSG00000153230		0.368	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	OR14K1	HGNC	protein_coding	OTTHUMT00000096868.1	163	0.00	0	G	NM_001004732		247902857	247902857	+1	no_errors	ENST00000283225	ensembl	human	known	69_37n	missense	108	27.03	40	SNP	0.022	C
OR5D18	219438	genome.wustl.edu	37	11	55587494	55587494	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr11:55587494C>T	ENST00000333976.4	+	1	409	c.389C>T	c.(388-390)cCt>cTt	p.P130L		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				ATTTGCAACCCTCTGCTCTAC	0.483																																						dbGAP											0													183.0	170.0	174.0					11																	55587494		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.389C>T	11.37:g.55587494C>T	ENSP00000335025:p.Pro130Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P130L	ENST00000333976.4	37	c.389	CCDS31510.1	11	.	.	.	.	.	.	.	.	.	.	.	18.93	3.728272	0.69074	.	.	ENSG00000186119	ENST00000333976	T	0.01902	4.57	4.74	3.83	0.44106	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38959	N	0.001504	T	0.11153	0.0272	M	0.92604	3.325	0.51482	D	0.999926	P	0.42010	0.768	P	0.49752	0.621	T	0.00433	-1.1742	10	0.87932	D	0	-22.3243	12.0228	0.53352	0.0:0.9141:0.0:0.0859	.	130	Q8NGL1	OR5DI_HUMAN	L	130	ENSP00000335025:P130L	ENSP00000335025:P130L	P	+	2	0	OR5D18	55344070	1.000000	0.71417	0.745000	0.31077	0.607000	0.37147	7.470000	0.80973	1.182000	0.42928	0.560000	0.71715	CCT	OR5D18	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000186119		0.483	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D18	HGNC	protein_coding	OTTHUMT00000391515.1	371	0.00	0	C	NM_001001952		55587494	55587494	+1	no_errors	ENST00000333976	ensembl	human	known	69_37n	missense	289	21.89	81	SNP	1.000	T
PCDHA13	56136	genome.wustl.edu	37	5	140263908	140263908	+	Silent	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr5:140263908C>T	ENST00000289272.2	+	1	2055	c.2055C>T	c.(2053-2055)ggC>ggT	p.G685G	PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA13_ENST00000409494.1_Silent_p.G685G|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	685					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCGGCAGGCGCTGTGGGTC	0.632																																					Melanoma(147;1739 1852 5500 27947 37288)	dbGAP											0													62.0	53.0	56.0					5																	140263908		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.2055C>T	5.37:g.140263908C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75277	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G685	ENST00000289272.2	37	c.2055	CCDS4240.1	5																																																																																			PCDHA13	-	NULL	ENSG00000239389		0.632	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	44	0.00	0	C	NM_018904		140263908	140263908	+1	no_errors	ENST00000289272	ensembl	human	known	69_37n	silent	22	31.25	10	SNP	0.000	T
PPL	5493	genome.wustl.edu	37	16	4947726	4947726	+	Silent	SNP	G	G	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr16:4947726G>A	ENST00000345988.2	-	9	1011	c.922C>T	c.(922-924)Ctg>Ttg	p.L308L	PPL_ENST00000590782.2_Silent_p.L306L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	308					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CAGATGAGCAGGTTCAGGTAC	0.607																																						dbGAP											0													107.0	83.0	91.0					16																	4947726		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.922C>T	16.37:g.4947726G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60314|O60454|Q14C98	Silent	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L308	ENST00000345988.2	37	c.922	CCDS10526.1	16																																																																																			PPL	-	smart_Spectrin/alpha-actinin	ENSG00000118898		0.607	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	92	0.00	0	G	NM_002705		4947726	4947726	-1	no_errors	ENST00000345988	ensembl	human	known	69_37n	silent	59	28.92	24	SNP	1.000	A
PTPRZ1	5803	genome.wustl.edu	37	7	121624110	121624110	+	Silent	SNP	G	G	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr7:121624110G>A	ENST00000393386.2	+	8	1278	c.867G>A	c.(865-867)caG>caA	p.Q289Q	PTPRZ1_ENST00000449182.1_Silent_p.Q289Q	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	289	Alpha-carbonic anhydrase.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GAGAGCAACAGTACAAGTTCT	0.348																																						dbGAP											0													151.0	147.0	148.0					7																	121624110		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.867G>A	7.37:g.121624110G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a	p.Q289	ENST00000393386.2	37	c.867	CCDS34740.1	7																																																																																			PTPRZ1	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000106278		0.348	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	425	0.00	0	G	NM_002851		121624110	121624110	+1	no_errors	ENST00000393386	ensembl	human	known	69_37n	silent	430	23.76	134	SNP	1.000	A
PTRHD1	391356	genome.wustl.edu	37	2	25016138	25016138	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr2:25016138G>T	ENST00000328379.5	-	1	113	c.109C>A	c.(109-111)Caa>Aaa	p.Q37K	CENPO_ENST00000473706.1_5'UTR|PTRHD1_ENST00000487316.1_5'Flank|CENPO_ENST00000260662.1_5'Flank|CENPO_ENST00000380834.2_5'UTR	NM_001013663.1	NP_001013685.1	Q6GMV3	PTRD1_HUMAN	peptidyl-tRNA hydrolase domain containing 1	37						extracellular vesicular exosome (GO:0070062)	aminoacyl-tRNA hydrolase activity (GO:0004045)			autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|skin(1)	6						AACGGAGCTTGTGATAGATCC	0.657																																						dbGAP											0													73.0	77.0	76.0					2																	25016138		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33156.1	2p23.3	2011-05-09	2011-05-09	2011-05-09	ENSG00000184924	ENSG00000184924			33782	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 79"""	C2orf79		12477932	Standard	NM_001013663		Approved	LOC391356	uc002rfm.3	Q6GMV3	OTTHUMG00000151978	ENST00000328379.5:c.109C>A	2.37:g.25016138G>T	ENSP00000330389:p.Gln37Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Pep_tRNA_hydro_PTH2,superfamily_Pep_tRNA_hydro_II_dom	p.Q37K	ENST00000328379.5	37	c.109	CCDS33156.1	2	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560658	0.27827	.	.	ENSG00000184924	ENST00000328379	T	0.11930	2.73	5.99	4.18	0.49190	Peptidyl-tRNA hydrolase II domain (2);	0.202882	0.43919	D	0.000512	T	0.07548	0.0190	N	0.21373	0.66	0.80722	D	1	B	0.09022	0.002	B	0.12837	0.008	T	0.14868	-1.0457	10	0.05959	T	0.93	.	8.6222	0.33868	0.0718:0.0:0.6574:0.2707	.	37	Q6GMV3	PTRD1_HUMAN	K	37	ENSP00000330389:Q37K	ENSP00000330389:Q37K	Q	-	1	0	PTRHD1	24869642	0.993000	0.37304	0.791000	0.31998	0.997000	0.91878	2.102000	0.41796	0.847000	0.35167	0.655000	0.94253	CAA	PTRHD1	-	pfam_Pep_tRNA_hydro_PTH2,superfamily_Pep_tRNA_hydro_II_dom	ENSG00000184924		0.657	PTRHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRHD1	HGNC	protein_coding	OTTHUMT00000324626.3	44	0.00	0	G	NM_001013663		25016138	25016138	-1	no_errors	ENST00000328379	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	0.983	T
RPRD2	23248	genome.wustl.edu	37	1	150430016	150430016	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:150430016G>T	ENST00000369068.4	+	8	1127	c.1123G>T	c.(1123-1125)Gat>Tat	p.D375Y	RPRD2_ENST00000539519.1_Missense_Mutation_p.D349Y|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.D349Y	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	375						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						GGAACTCTCAGATGTGGAAGA	0.418																																						dbGAP											0													225.0	216.0	219.0					1																	150430016		1932	4144	6076	-	-	-	SO:0001583	missense	0			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.1123G>T	1.37:g.150430016G>T	ENSP00000358064:p.Asp375Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,superfamily_Ricin_B_lectin,smart_RNA_polymerase_II_lsu_CTD	p.D375Y	ENST00000369068.4	37	c.1123	CCDS44216.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523718	0.85600	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.55588	0.56;0.62;0.51	5.11	5.11	0.69529	.	0.046020	0.85682	D	0.000000	T	0.64724	0.2624	L	0.54323	1.7	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.981;0.986;0.994	T	0.66352	-0.5945	10	0.87932	D	0	-12.64	19.0813	0.93182	0.0:0.0:1.0:0.0	.	349;375;349	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	Y	349;349;375	ENSP00000383785:D349Y;ENSP00000445482:D349Y;ENSP00000358064:D375Y	ENSP00000358064:D375Y	D	+	1	0	RPRD2	148696640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.001000	0.93568	2.798000	0.96311	0.655000	0.94253	GAT	RPRD2	-	NULL	ENSG00000163125		0.418	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	HGNC	protein_coding	OTTHUMT00000035844.1	195	0.00	0	G	NM_015203		150430016	150430016	+1	no_errors	ENST00000369068	ensembl	human	known	69_37n	missense	377	11.50	49	SNP	1.000	T
RRAGB	10325	genome.wustl.edu	37	X	55757917	55757917	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chrX:55757917delT	ENST00000262850.7	+	6	941	c.498delT	c.(496-498)tatfs	p.Y167fs	RRAGB_ENST00000374941.4_Frame_Shift_Del_p.Y139fs|RRAGB_ENST00000474757.1_3'UTR	NM_016656.3	NP_057740.2			Ras-related GTP binding B											breast(1)|endometrium(3)|large_intestine(5)|lung(3)|pancreas(1)|prostate(1)	14						ACATGCACTATTACCAATCAT	0.448																																						dbGAP											0													68.0	56.0	60.0					X																	55757917		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X90530	CCDS14371.1, CCDS14372.1	Xp11.21	2008-02-05			ENSG00000083750	ENSG00000083750			19901	protein-coding gene	gene with protein product		300725				7499430, 9394008	Standard	NM_006064		Approved		uc004dup.3	Q5VZM2	OTTHUMG00000021662	ENST00000262850.7:c.498delT	X.37:g.55757917delT	ENSP00000262850:p.Tyr167fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Gtr1_RagA,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR	p.Y167fs	ENST00000262850.7	37	c.498	CCDS14372.1	X																																																																																			RRAGB	-	pfam_Gtr1_RagA,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR	ENSG00000083750		0.448	RRAGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAGB	HGNC	protein_coding	OTTHUMT00000056878.1	159	0.00	0	T	NM_016656		55757917	55757917	+1	no_errors	ENST00000262850	ensembl	human	known	69_37n	frame_shift_del	140	23.78	44	DEL	1.000	-
RTN2	6253	genome.wustl.edu	37	19	45991899	45991899	+	Silent	SNP	A	A	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr19:45991899A>T	ENST00000245923.4	-	8	1681	c.1446T>A	c.(1444-1446)atT>atA	p.I482I	RTN2_ENST00000590526.1_Silent_p.I208I|PPM1N_ENST00000401705.1_5'Flank|RTN2_ENST00000344680.4_Silent_p.I409I|RTN2_ENST00000430715.2_Silent_p.I142I	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	482	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GCTCACCCAGAATGAGAAGAG	0.572																																						dbGAP											0													47.0	47.0	47.0					19																	45991899		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1446T>A	19.37:g.45991899A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Silent	SNP	pfam_Reticulon,pfscan_Reticulon	p.I482	ENST00000245923.4	37	c.1446	CCDS12665.1	19																																																																																			RTN2	-	pfam_Reticulon,pfscan_Reticulon	ENSG00000125744		0.572	RTN2-001	KNOWN	basic|CCDS	protein_coding	RTN2	HGNC	protein_coding	OTTHUMT00000459574.1	171	0.00	0	A	NM_005619		45991899	45991899	-1	no_errors	ENST00000245923	ensembl	human	known	69_37n	silent	145	25.26	49	SNP	0.970	T
SNRNP48	154007	genome.wustl.edu	37	6	7609080	7609080	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr6:7609080C>T	ENST00000342415.5	+	9	1053	c.994C>T	c.(994-996)Cat>Tat	p.H332Y		NM_152551.3	NP_689764.3	Q6IEG0	SNR48_HUMAN	small nuclear ribonucleoprotein 48kDa (U11/U12)	332	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)			kidney(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						ACACCATAGTCATAAAAGAAG	0.274																																						dbGAP											0													39.0	41.0	40.0					6																	7609080		2194	4260	6454	-	-	-	SO:0001583	missense	0			AK056796	CCDS4502.1	6p24.3	2011-10-11	2008-10-29	2008-10-29	ENSG00000168566	ENSG00000168566			21368	protein-coding gene	gene with protein product	"""U11/U12 snRNP 48K"""		"""chromosome 6 open reading frame 151"""	C6orf151		15146077	Standard	XR_427825		Approved	FLJ32234, dJ512B11.2, dJ336K20B.1	uc003mxr.3	Q6IEG0	OTTHUMG00000014213	ENST00000342415.5:c.994C>T	6.37:g.7609080C>T	ENSP00000339834:p.His332Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P4|Q14C91|Q5T339|Q5THM1|Q5THM2|Q96MK1	Missense_Mutation	SNP	pfam_TRM13/UPF0224_CHHC_Znf_dom	p.H332Y	ENST00000342415.5	37	c.994	CCDS4502.1	6	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943964	0.73672	.	.	ENSG00000168566	ENST00000342415	T	0.33654	1.4	5.81	4.93	0.64822	.	0.282417	0.36200	N	0.002726	T	0.17831	0.0428	L	0.57536	1.79	0.28708	N	0.903701	B	0.15141	0.012	B	0.11329	0.006	T	0.09015	-1.0694	10	0.87932	D	0	-24.4196	6.8263	0.23885	0.1758:0.7376:0.0:0.0866	.	332	Q6IEG0	SNR48_HUMAN	Y	332	ENSP00000339834:H332Y	ENSP00000339834:H332Y	H	+	1	0	SNRNP48	7554079	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.644000	0.37228	2.744000	0.94065	0.655000	0.94253	CAT	SNRNP48	-	NULL	ENSG00000168566		0.274	SNRNP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP48	HGNC	protein_coding	OTTHUMT00000039787.3	135	0.00	0	C	NM_152551		7609080	7609080	+1	no_errors	ENST00000342415	ensembl	human	known	69_37n	missense	105	26.57	38	SNP	1.000	T
SLC22A16	85413	genome.wustl.edu	37	6	110778014	110778014	+	Missense_Mutation	SNP	G	G	A	rs201910262	byFrequency	TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr6:110778014G>A	ENST00000368919.3	-	2	326	c.260C>T	c.(259-261)aCg>aTg	p.T87M	SLC22A16_ENST00000456137.2_Missense_Mutation_p.T87M|SLC22A16_ENST00000461487.1_5'UTR|SLC22A16_ENST00000439654.1_Missense_Mutation_p.T87M|SLC22A16_ENST00000330550.4_Intron	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	87					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	CAACTGCACCGTAACATAATC	0.488													G|||	2	0.000399361	0.0	0.0	5008	,	,		19038	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													180.0	184.0	182.0					6																	110778014		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.260C>T	6.37:g.110778014G>A	ENSP00000357915:p.Thr87Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T87M	ENST00000368919.3	37	c.260	CCDS5084.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	9.328	1.059752	0.19987	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000439654;ENST00000437378;ENST00000456137;ENST00000424139	T;T;T;T;T;T	0.66460	1.28;-0.21;1.28;-0.21;1.28;-0.21	4.91	-3.9	0.04181	.	13.543100	0.00166	N	0.000000	T	0.27697	0.0681	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.28964	-1.0027	10	0.44086	T	0.13	.	10.8778	0.46921	0.6938:0.0:0.3062:0.0	.	87	Q86VW1	S22AG_HUMAN	M	87;4;87;44;87;44	ENSP00000357915:T87M;ENSP00000395642:T4M;ENSP00000408799:T87M;ENSP00000416310:T44M;ENSP00000402111:T87M;ENSP00000401007:T44M	ENSP00000357915:T87M	T	-	2	0	SLC22A16	110884707	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	1.115000	0.31209	-0.700000	0.05070	-1.458000	0.01028	ACG	SLC22A16	-	NULL	ENSG00000004809		0.488	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A16	HGNC	protein_coding	OTTHUMT00000043428.1	360	0.00	0	G	NM_033125		110778014	110778014	-1	no_errors	ENST00000368919	ensembl	human	known	69_37n	missense	306	25.18	103	SNP	0.000	A
SSX5	6758	genome.wustl.edu	37	X	48049613	48049613	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chrX:48049613G>T	ENST00000376923.1	-	5	421	c.422C>A	c.(421-423)cCc>cAc	p.P141H	SSX5_ENST00000311798.1_Missense_Mutation_p.P182H|SSX5_ENST00000347757.1_Missense_Mutation_p.P141H			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	141					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						TTTTCCTGAGGGGCGCAGCTG	0.468																																						dbGAP											0													154.0	136.0	142.0					X																	48049613		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.422C>A	X.37:g.48049613G>T	ENSP00000366122:p.Pro141His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.P182H	ENST00000376923.1	37	c.545	CCDS14289.1	X	.	.	.	.	.	.	.	.	.	.	N	10.03	1.238673	0.22711	.	.	ENSG00000165583	ENST00000311798;ENST00000376923;ENST00000347757;ENST00000403001	T;T;T;T	0.40476	2.94;2.95;2.95;1.03	1.36	-2.67	0.06059	.	1.986640	0.02945	N	0.140931	T	0.58750	0.2144	M	0.82517	2.595	0.09310	N	1	P;D	0.67145	0.865;0.996	P;D	0.63703	0.708;0.917	T	0.50915	-0.8771	10	0.37606	T	0.19	.	2.0103	0.03486	0.4099:0.0:0.3313:0.2587	.	141;182	O60225;O60225-2	SSX5_HUMAN;.	H	182;141;141;81	ENSP00000312415:P182H;ENSP00000366122:P141H;ENSP00000290558:P141H;ENSP00000385051:P81H	ENSP00000312415:P182H	P	-	2	0	SSX5	47934557	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.065000	0.00621	-0.973000	0.03555	0.171000	0.16805	CCC	SSX5	-	NULL	ENSG00000165583		0.468	SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SSX5	HGNC	protein_coding	OTTHUMT00000056466.1	553	0.00	0	G	NM_021015		48049613	48049613	-1	no_errors	ENST00000311798	ensembl	human	known	69_37n	missense	495	30.48	217	SNP	0.000	T
TAX1BP1	8887	genome.wustl.edu	37	7	27833979	27833979	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr7:27833979A>T	ENST00000396319.2	+	11	1536	c.1448A>T	c.(1447-1449)aAt>aTt	p.N483I	TAX1BP1_ENST00000433216.2_Missense_Mutation_p.N326I|TAX1BP1_ENST00000265393.6_Missense_Mutation_p.N483I|TAX1BP1_ENST00000543117.1_Missense_Mutation_p.N483I|TAX1BP1_ENST00000409980.1_Missense_Mutation_p.N483I	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	483					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)			breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			AAAACGGGGAATCAGCAGAAA	0.353																																						dbGAP											0													91.0	86.0	88.0					7																	27833979		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1448A>T	7.37:g.27833979A>T	ENSP00000379612:p.Asn483Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Missense_Mutation	SNP	pfam_CoCoA	p.N483I	ENST00000396319.2	37	c.1448	CCDS5415.1	7	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763174	0.49574	.	.	ENSG00000106052	ENST00000543117;ENST00000265393;ENST00000409980;ENST00000433216;ENST00000396319;ENST00000457186	T;T;T;T;T	0.32515	2.88;2.88;2.87;1.45;2.88	5.03	-3.38	0.04883	.	0.439265	0.20825	N	0.084997	T	0.33323	0.0859	L	0.39898	1.24	0.33839	D	0.631229	P;B;B	0.48350	0.909;0.228;0.015	P;B;B	0.57371	0.819;0.089;0.046	T	0.40942	-0.9536	10	0.23302	T	0.38	-6.1604	12.1688	0.54146	0.3807:0.0:0.6193:0.0	.	326;483;483	E7ENV2;Q86VP1;Q86VP1-2	.;TAXB1_HUMAN;.	I	483;483;483;326;483;38	ENSP00000444811:N483I;ENSP00000265393:N483I;ENSP00000386515:N483I;ENSP00000391907:N326I;ENSP00000379612:N483I	ENSP00000265393:N483I	N	+	2	0	TAX1BP1	27800504	0.005000	0.15991	0.685000	0.30070	0.447000	0.32167	-1.497000	0.02289	-0.559000	0.06110	-0.386000	0.06593	AAT	TAX1BP1	-	NULL	ENSG00000106052		0.353	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAX1BP1	HGNC	protein_coding	OTTHUMT00000214142.1	178	0.00	0	A	NM_006024		27833979	27833979	+1	no_errors	ENST00000396319	ensembl	human	known	69_37n	missense	147	24.23	47	SNP	0.869	T
TDRD9	122402	genome.wustl.edu	37	14	104484481	104484481	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr14:104484481T>C	ENST00000409874.4	+	23	2432	c.2384T>C	c.(2383-2385)cTc>cCc	p.L795P	TDRD9_ENST00000339063.5_Missense_Mutation_p.L795P	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	795					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				CTACAGTCTCTCTTTAGACAG	0.323																																						dbGAP											0													96.0	88.0	91.0					14																	104484481		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.2384T>C	14.37:g.104484481T>C	ENSP00000387303:p.Leu795Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L795P	ENST00000409874.4	37	c.2384	CCDS9987.2	14	.	.	.	.	.	.	.	.	.	.	T	14.84	2.655314	0.47467	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.54279	0.58;0.58	5.36	5.36	0.76844	.	0.118916	0.37261	N	0.002162	T	0.66645	0.2810	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.70227	0.968;0.929	T	0.69544	-0.5117	10	0.72032	D	0.01	.	11.6984	0.51556	0.1322:0.0:0.0:0.8678	.	795;795	Q8NDG6-2;Q8NDG6	.;TDRD9_HUMAN	P	795	ENSP00000387303:L795P;ENSP00000343545:L795P	ENSP00000343545:L795P	L	+	2	0	TDRD9	103554234	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	5.057000	0.64294	2.032000	0.59987	0.533000	0.62120	CTC	TDRD9	-	NULL	ENSG00000156414		0.323	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3	290	0.00	0	T	NM_153046		104484481	104484481	+1	no_errors	ENST00000409874	ensembl	human	known	69_37n	missense	321	28.03	125	SNP	1.000	C
TFE3	7030	genome.wustl.edu	37	X	48887874	48887874	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chrX:48887874T>A	ENST00000315869.7	-	10	1782	c.1523A>T	c.(1522-1524)gAc>gTc	p.D508V	TFE3_ENST00000487451.1_5'Flank	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	508					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						CCCCAGGTGGTCGCTGGGAAA	0.667			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																	dbGAP		Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	0													58.0	59.0	59.0					X																	48887874		2203	4297	6500	-	-	-	SO:0001583	missense	0			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1523A>T	X.37:g.48887874T>A	ENSP00000314129:p.Asp508Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Missense_Mutation	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D508V	ENST00000315869.7	37	c.1523	CCDS14315.3	X	.	.	.	.	.	.	.	.	.	.	T	19.13	3.767297	0.69878	.	.	ENSG00000068323	ENST00000315869	T	0.64438	-0.1	5.51	5.51	0.81932	.	0.307389	0.27284	U	0.020072	T	0.62060	0.2397	L	0.34521	1.04	0.80722	D	1	D	0.53462	0.96	P	0.51777	0.679	T	0.65598	-0.6129	10	0.62326	D	0.03	-11.2915	13.5603	0.61784	0.0:0.0:0.0:1.0	.	508	P19532	TFE3_HUMAN	V	508	ENSP00000314129:D508V	ENSP00000314129:D508V	D	-	2	0	TFE3	48774818	0.983000	0.35010	0.997000	0.53966	0.944000	0.59088	2.587000	0.46128	1.845000	0.53610	0.409000	0.27619	GAC	TFE3	-	pfam_bHLH_ZIP_TF_MiT/TFE	ENSG00000068323		0.667	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFE3	HGNC	protein_coding	OTTHUMT00000058872.2	106	0.00	0	T	NM_006521		48887874	48887874	-1	no_errors	ENST00000315869	ensembl	human	known	69_37n	missense	85	17.31	18	SNP	1.000	A
TINAG	27283	genome.wustl.edu	37	6	54254622	54254622	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr6:54254622G>T	ENST00000259782.4	+	11	1426	c.1330G>T	c.(1330-1332)Gag>Tag	p.E444*		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	444					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GTCATGGGGAGAGAATGGCTA	0.398																																						dbGAP											0													132.0	130.0	131.0					6																	54254622		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1330G>T	6.37:g.54254622G>T	ENSP00000259782:p.Glu444*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T467|Q9UJW1|Q9ULZ4	Nonsense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,smart_Peptidase_C1A_C,pfscan_Somatomedin_B_dom	p.E444*	ENST00000259782.4	37	c.1330	CCDS4955.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.857503	0.98528	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	.	.	.	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.7362	0.77846	0.0:0.0:1.0:0.0	.	.	.	.	X	303;444;123	.	ENSP00000259782:E444X	E	+	1	0	TINAG	54362581	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.551000	0.82182	2.791000	0.96007	0.591000	0.81541	GAG	TINAG	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000137251		0.398	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINAG	HGNC	protein_coding	OTTHUMT00000040984.1	198	0.00	0	G	NM_014464		54254622	54254622	+1	no_errors	ENST00000259782	ensembl	human	known	69_37n	nonsense	164	21.53	45	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7579419	7579419	+	Frame_Shift_Del	DEL	A	A	-	rs587783062		TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr17:7579419delA	ENST00000269305.4	-	4	457	c.268delT	c.(268-270)tccfs	p.S90fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.S90fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.S90fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.S90fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.S90fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.S90fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	90	Interaction with WWOX.		S -> F (in sporadic cancers; somatic mutation).|S -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.A76_S90del15(3)|p.A88fs*32(3)|p.S90fs*59(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.P85fs*58(1)|p.A88fs*52(1)|p.A86fs*33(1)|p.A86fs*32(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGGGCCAGGAGGGGGCTGGT	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Deletion - Frameshift(16)|Whole gene deletion(8)|Deletion - In frame(3)|Insertion - Frameshift(3)	upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|prostate(4)|bone(4)|liver(4)|central_nervous_system(2)|breast(2)|stomach(1)|urinary_tract(1)											45.0	51.0	49.0					17																	7579419		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.268delT	17.37:g.7579419delA	ENSP00000269305:p.Ser90fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S90fs	ENST00000269305.4	37	c.268	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	53	0.00	0	A	NM_000546		7579419	7579419	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	30	29.17	14	DEL	0.136	-
TTC31	64427	genome.wustl.edu	37	2	74719297	74719297	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr2:74719297C>G	ENST00000233623.5	+	10	967	c.960C>G	c.(958-960)ttC>ttG	p.F320L	TTC31_ENST00000410003.1_Missense_Mutation_p.F320L|TTC31_ENST00000442235.2_Intron	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	320										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						AAAATGGTTTCTACCATGAGG	0.597																																						dbGAP											0													96.0	93.0	94.0					2																	74719297		1900	4113	6013	-	-	-	SO:0001583	missense	0			AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.960C>G	2.37:g.74719297C>G	ENSP00000233623:p.Phe320Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN40|Q53FD4|Q9H9F7	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.F320L	ENST00000233623.5	37	c.960	CCDS42701.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.85|10.85	1.467038|1.467038	0.26335|0.26335	.|.	.|.	ENSG00000115282|ENSG00000115282	ENST00000410003;ENST00000233623|ENST00000414247	T;T|.	0.58940|.	1.61;0.3|.	3.94|3.94	0.726|0.726	0.18248|0.18248	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.743551|.	0.12628|.	N|.	0.452480|.	T|T	0.33933|0.33933	0.0880|0.0880	N|N	0.17082|0.17082	0.46|0.46	0.80722|0.80722	D|D	1|1	B;B|.	0.22346|.	0.068;0.068|.	B;B|.	0.20577|.	0.03;0.03|.	T|T	0.05818|0.05818	-1.0862|-1.0862	10|5	0.31617|.	T|.	0.26|.	.|.	5.5153|5.5153	0.16904|0.16904	0.3952:0.4114:0.1934:0.0|0.3952:0.4114:0.1934:0.0	.|.	288;320|.	Q86XF2;Q49AM3|.	.;TTC31_HUMAN|.	L|C	320|58	ENSP00000387213:F320L;ENSP00000233623:F320L|.	ENSP00000233623:F320L|.	F|S	+|+	3|2	2|0	TTC31|TTC31	74572805|74572805	0.985000|0.985000	0.35326|0.35326	0.998000|0.998000	0.56505|0.56505	0.982000|0.982000	0.71751|0.71751	0.391000|0.391000	0.20784|0.20784	0.745000|0.745000	0.32763|0.32763	0.561000|0.561000	0.74099|0.74099	TTC|TCT	TTC31	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000115282		0.597	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC31	HGNC	protein_coding	OTTHUMT00000328422.1	266	0.00	0	C	NM_022492		74719297	74719297	+1	no_errors	ENST00000233623	ensembl	human	novel	69_37n	missense	188	30.37	82	SNP	0.994	G
TTYH1	57348	genome.wustl.edu	37	19	54937907	54937907	+	Silent	SNP	C	C	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr19:54937907C>T	ENST00000376530.3	+	5	799	c.696C>T	c.(694-696)ctC>ctT	p.L232L	TTYH1_ENST00000376531.3_Silent_p.L232L|TTYH1_ENST00000391739.3_Silent_p.L281L|TTYH1_ENST00000301194.4_Silent_p.L232L|TTYH1_ENST00000489425.1_3'UTR	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	232					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		TCTTCACCCTCCTGGGCCTGG	0.642																																						dbGAP											0													93.0	75.0	81.0					19																	54937907		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.696C>T	19.37:g.54937907C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Silent	SNP	pfam_Tweety	p.L232	ENST00000376530.3	37	c.696	CCDS12893.1	19																																																																																			TTYH1	-	pfam_Tweety	ENSG00000167614		0.642	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TTYH1	HGNC	protein_coding	OTTHUMT00000140498.1	110	0.00	0	C			54937907	54937907	+1	no_errors	ENST00000376531	ensembl	human	known	69_37n	silent	89	23.93	28	SNP	1.000	T
UCK2	7371	genome.wustl.edu	37	1	165875164	165875164	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr1:165875164A>T	ENST00000367879.4	+	6	907	c.604A>T	c.(604-606)Aag>Tag	p.K202*	UCK2_ENST00000470820.1_Nonsense_Mutation_p.K52*|UCK2_ENST00000469256.2_Nonsense_Mutation_p.K52*|UCK2_ENST00000462329.1_3'UTR|UCK2_ENST00000372212.4_3'UTR	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	202				K -> Q (in Ref. 1; BAA11349). {ECO:0000305}.	cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					ACAGACAAAGAAGTATGCTGA	0.453																																						dbGAP											0													142.0	123.0	130.0					1																	165875164		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.604A>T	1.37:g.165875164A>T	ENSP00000356853:p.Lys202*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Nonsense_Mutation	SNP	pfam_PRK/URK,pfam_Depp_CoAkinase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.K202*	ENST00000367879.4	37	c.604	CCDS1252.1	1	.	.	.	.	.	.	.	.	.	.	A	39	7.785500	0.98489	.	.	ENSG00000143179	ENST00000367879	.	.	.	4.77	3.64	0.41730	.	0.139926	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1589	9.6144	0.39683	0.7943:0.2057:0.0:0.0	.	.	.	.	X	202	.	ENSP00000356853:K202X	K	+	1	0	UCK2	164141788	1.000000	0.71417	0.985000	0.45067	0.975000	0.68041	6.428000	0.73383	0.818000	0.34468	0.533000	0.62120	AAG	UCK2	-	pfam_PRK/URK,prints_Uridine_kinase,tigrfam_Uridine_kinase	ENSG00000143179		0.453	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK2	HGNC	protein_coding	OTTHUMT00000096753.1	336	0.30	1	A	NM_012474		165875164	165875164	+1	no_errors	ENST00000367879	ensembl	human	known	69_37n	nonsense	368	16.70	74	SNP	1.000	T
ZFAND2B	130617	genome.wustl.edu	37	2	220072393	220072393	+	Silent	SNP	T	T	C			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr2:220072393T>C	ENST00000289528.5	+	3	369	c.174T>C	c.(172-174)ccT>ccC	p.P58P	ZFAND2B_ENST00000468301.1_3'UTR|ZFAND2B_ENST00000409412.1_Silent_p.P58P|ZFAND2B_ENST00000409097.1_Silent_p.P58P|ZFAND2B_ENST00000444522.2_Silent_p.P58P|ZFAND2B_ENST00000409336.1_Silent_p.P58P|ZFAND2B_ENST00000409217.1_Silent_p.P58P|ZFAND2B_ENST00000409594.1_Silent_p.P58P|ZFAND2B_ENST00000409206.1_Silent_p.P58P|ZFAND2B_ENST00000409319.1_Silent_p.P58P	NM_001270998.1|NM_001270999.1|NM_138802.2	NP_001257927.1|NP_001257928.1|NP_620157.1	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	58						endoplasmic reticulum (GO:0005783)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|lung(4)|upper_aerodigestive_tract(1)	11		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGTGTGCCCTCTCTGTAATG	0.547																																						dbGAP											0													98.0	87.0	91.0					2																	220072393		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074571	CCDS2435.1, CCDS74656.1	2q35	2010-04-23	2005-08-22		ENSG00000158552	ENSG00000158552		"""Zinc fingers, AN1-type domain containing"""	25206	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein-like"""	613474	"""zinc finger, AN1-type 2B"""			18467495	Standard	NM_138802		Approved	AIRAPL	uc002vka.4	Q8WV99	OTTHUMG00000133135	ENST00000289528.5:c.174T>C	2.37:g.220072393T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB98	Silent	SNP	pfam_Znf_AN1,smart_Znf_AN1,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Znf_AN1	p.P58	ENST00000289528.5	37	c.174	CCDS2435.1	2																																																																																			ZFAND2B	-	NULL	ENSG00000158552		0.547	ZFAND2B-001	KNOWN	basic|CCDS	protein_coding	ZFAND2B	HGNC	protein_coding	OTTHUMT00000256824.2	186	0.00	0	T	NM_138802		220072393	220072393	+1	no_errors	ENST00000289528	ensembl	human	known	69_37n	silent	123	28.49	49	SNP	0.012	C
ZNF415	55786	genome.wustl.edu	37	19	53612856	53612856	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AR-01A-31D-A135-09	TCGA-AR-A1AR-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	008ba655-a0a3-42c4-8c72-f1341365ef02	0395a62f-3f37-4068-bab6-4c1d29cef2d5	g.chr19:53612856G>A	ENST00000500065.4	-	4	775	c.442C>T	c.(442-444)Cat>Tat	p.H148Y	ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.H160Y|ZNF415_ENST00000243643.4_Missense_Mutation_p.H148Y|ZNF415_ENST00000455735.2_Missense_Mutation_p.H196Y|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000448501.1_Missense_Mutation_p.H196Y|ZNF415_ENST00000440291.1_Missense_Mutation_p.H135Y|ZNF415_ENST00000601493.1_5'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TGCAGTTCATGGGGATGTGGT	0.393																																						dbGAP											0													120.0	113.0	115.0					19																	53612856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.442C>T	19.37:g.53612856G>A	ENSP00000439435:p.His148Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.H196Y	ENST00000500065.4	37	c.586	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	G	9.826	1.187180	0.21870	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1;3.1	2.74	-1.25	0.09405	.	.	.	.	.	T	0.04952	0.0133	N	0.21194	0.64	0.09310	N	1	B;B;B;B;B;B	0.18461	0.0;0.0;0.001;0.028;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.001;0.0;0.0	T	0.38824	-0.9643	9	0.52906	T	0.07	.	3.8638	0.09007	0.0:0.3836:0.281:0.3354	.	148;196;196;148;135;160	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	Y	148;148;196;160;196;135	ENSP00000243643:H148Y;ENSP00000439435:H148Y;ENSP00000396492:H196Y;ENSP00000395055:H160Y;ENSP00000388787:H196Y;ENSP00000414601:H135Y	ENSP00000243643:H148Y	H	-	1	0	ZNF415	58304668	0.000000	0.05858	0.001000	0.08648	0.317000	0.28152	0.049000	0.14099	-0.232000	0.09811	0.313000	0.20887	CAT	ZNF415	-	NULL	ENSG00000170954		0.393	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	243	0.00	0	G	NM_018355		53612856	53612856	-1	no_errors	ENST00000448501	ensembl	human	known	69_37n	missense	186	29.55	78	SNP	0.000	A
