#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AADAC	13	genome.wustl.edu	37	3	151532014	151532014	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr3:151532014C>T	ENST00000232892.7	+	1	190	c.64C>T	c.(64-66)Cct>Tct	p.P22S	RP11-454C18.2_ENST00000483843.2_RNA|AADAC_ENST00000488869.1_Missense_Mutation_p.P22S|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	22					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TATTTATACGCCTCTCCCAGA	0.403																																					Ovarian(30;839 841 2699 32801 46334)	dbGAP											0													109.0	108.0	108.0					3																	151532014		2203	4300	6503	-	-	-	SO:0001583	missense	0			L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.64C>T	3.37:g.151532014C>T	ENSP00000232892:p.Pro22Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	pfam_AB_hydrolase_3,pfam_CarbesteraseB,pirsf_Arylacetamide_deacetylase	p.P22S	ENST00000232892.7	37	c.64	CCDS33877.1	3	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595842	0.66332	.	.	ENSG00000114771	ENST00000232892;ENST00000488869	T;T	0.12361	3.55;2.69	5.04	3.08	0.35506	.	0.054567	0.85682	D	0.000000	T	0.38374	0.1038	M	0.87456	2.885	0.48696	D	0.999693	D	0.63880	0.993	D	0.65010	0.931	T	0.45934	-0.9227	10	0.72032	D	0.01	-6.0278	12.3554	0.55171	0.3004:0.6995:0.0:0.0	.	22	P22760	AAAD_HUMAN	S	22	ENSP00000232892:P22S;ENSP00000419620:P22S	ENSP00000232892:P22S	P	+	1	0	AADAC	153014704	0.132000	0.22450	0.014000	0.15608	0.067000	0.16453	1.823000	0.39062	1.195000	0.43115	0.655000	0.94253	CCT	AADAC	-	pirsf_Arylacetamide_deacetylase	ENSG00000114771		0.403	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADAC	HGNC	protein_coding	OTTHUMT00000357883.2	68	0.00	0	C	NM_001086		151532014	151532014	+1	no_errors	ENST00000232892	ensembl	human	known	69_37n	missense	160	32.77	78	SNP	0.714	T
ABCD3	5825	genome.wustl.edu	37	1	94953135	94953135	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr1:94953135C>T	ENST00000370214.4	+	11	959	c.935C>T	c.(934-936)tCa>tTa	p.S312L	ABCD3_ENST00000394233.2_Intron|ABCD3_ENST00000536817.1_Missense_Mutation_p.S239L|ABCD3_ENST00000454898.2_Missense_Mutation_p.S336L|ABCD3_ENST00000484213.1_3'UTR	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3	312	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TTTCGGTTTTCAATGGGCTTC	0.294																																						dbGAP											0													84.0	84.0	84.0					1																	94953135		2203	4299	6502	-	-	-	SO:0001583	missense	0			M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.935C>T	1.37:g.94953135C>T	ENSP00000359233:p.Ser312Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	Missense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	p.S336L	ENST00000370214.4	37	c.1007	CCDS749.1	1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.212909	0.39102	.	.	ENSG00000117528	ENST00000454898;ENST00000536817;ENST00000370214	D;D;D	0.93133	-3.17;-3.17;-3.17	5.97	5.97	0.96955	ABC transporter, N-terminal (1);ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.050136	0.85682	D	0.000000	D	0.85792	0.5779	L	0.41124	1.26	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.004	T	0.82047	-0.0651	10	0.11794	T	0.64	-15.3264	20.4209	0.99038	0.0:1.0:0.0:0.0	.	336;312	E7EUE1;P28288	.;ABCD3_HUMAN	L	336;239;312	ENSP00000403357:S336L;ENSP00000440692:S239L;ENSP00000359233:S312L	ENSP00000359233:S312L	S	+	2	0	ABCD3	94725723	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	7.368000	0.79567	2.823000	0.97156	0.591000	0.81541	TCA	ABCD3	-	pfam_ABC_Ald_N,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	ENSG00000117528		0.294	ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD3	HGNC	protein_coding	OTTHUMT00000029597.1	163	0.00	0	C	NM_002858		94953135	94953135	+1	no_errors	ENST00000454898	ensembl	human	known	69_37n	missense	239	41.13	167	SNP	1.000	T
AFF1	4299	genome.wustl.edu	37	4	88052306	88052307	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr4:88052306_88052307delAG	ENST00000307808.6	+	16	3435_3436	c.3015_3016delAG	c.(3013-3018)acagagfs	p.E1006fs	AFF1_ENST00000544085.1_Frame_Shift_Del_p.E644fs|AFF1_ENST00000395146.4_Frame_Shift_Del_p.E1013fs	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	1006					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GAATTGCCACAGAGTCTGAAAG	0.46																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.3015_3016delAG	4.37:g.88052308_88052309delAG	ENSP00000305689:p.Glu1006fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU1|E9PBM3	Frame_Shift_Del	DEL	pfam_TF_AF4/FMR2	p.E1013fs	ENST00000307808.6	37	c.3036_3037	CCDS3616.1	4																																																																																			AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.460	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	103	0.00	0	AG	NM_005935		88052306	88052307	+1	no_errors	ENST00000395146	ensembl	human	known	69_37n	frame_shift_del	188	45.35	156	DEL	0.857:1.000	-
AFP	174	genome.wustl.edu	37	4	74319576	74319576	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr4:74319576T>A	ENST00000395792.2	+	13	1847	c.1747T>A	c.(1747-1749)Tgc>Agc	p.C583S	AFP_ENST00000506820.1_3'UTR|AFP_ENST00000226359.2_Missense_Mutation_p.C583S	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	583	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGAGAAATGCTGCCAAGGCCA	0.423									Alpha-Fetoprotein, Hereditary Persistence of																													dbGAP											0													80.0	75.0	77.0					4																	74319576		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.1747T>A	4.37:g.74319576T>A	ENSP00000379138:p.Cys583Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBU3	Missense_Mutation	SNP	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr,prints_Alpha-fetoprotein,prints_Serum_albumin	p.C583S	ENST00000395792.2	37	c.1747	CCDS3556.1	4	.	.	.	.	.	.	.	.	.	.	T	14.47	2.545397	0.45280	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	D;D	0.95690	-3.78;-3.78	5.2	5.2	0.72013	Serum albumin, conserved site (1);Serum albumin-like (1);Serum albumin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.97337	0.9129	M	0.81682	2.555	0.53005	D	0.999964	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.97712	1.0191	10	0.87932	D	0	.	11.3686	0.49687	0.0:0.0:0.0:1.0	.	425;583	B4DMX4;P02771	.;FETA_HUMAN	S	583	ENSP00000379138:C583S;ENSP00000226359:C583S	ENSP00000226359:C583S	C	+	1	0	AFP	74538440	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	4.251000	0.58778	2.183000	0.69458	0.533000	0.62120	TGC	AFP	-	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr	ENSG00000081051		0.423	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	HGNC	protein_coding	OTTHUMT00000252284.3	31	0.00	0	T			74319576	74319576	+1	no_errors	ENST00000395792	ensembl	human	known	69_37n	missense	50	61.83	81	SNP	1.000	A
ARSF	416	genome.wustl.edu	37	X	3019142	3019142	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chrX:3019142G>A	ENST00000381127.1	+	8	1203	c.982G>A	c.(982-984)Gct>Act	p.A328T	ARSF_ENST00000359361.2_Missense_Mutation_p.A328T|ARSF_ENST00000537104.1_Missense_Mutation_p.A328T	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	328					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GATTCTTGATGCTATCGATGA	0.413																																						dbGAP											0													120.0	100.0	107.0					X																	3019142		2203	4299	6502	-	-	-	SO:0001583	missense	0			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.982G>A	X.37:g.3019142G>A	ENSP00000370519:p.Ala328Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCC5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.A328T	ENST00000381127.1	37	c.982	CCDS14123.1	X	.	.	.	.	.	.	.	.	.	.	G	0.658	-0.806844	0.02819	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.98732	-5.1;-5.1;-5.1	2.71	1.84	0.25277	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.292022	0.31772	U	0.007093	D	0.95085	0.8408	N	0.16656	0.425	0.09310	N	1	B	0.17038	0.02	B	0.35607	0.206	D	0.86643	0.1893	10	0.09338	T	0.73	.	8.8687	0.35303	0.1209:0.0:0.8791:0.0	.	328	P54793	ARSF_HUMAN	T	328	ENSP00000370519:A328T;ENSP00000445594:A328T;ENSP00000352319:A328T	ENSP00000352319:A328T	A	+	1	0	ARSF	3029142	0.014000	0.17966	0.000000	0.03702	0.004000	0.04260	1.653000	0.37323	0.274000	0.22072	-0.282000	0.10007	GCT	ARSF	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000062096		0.413	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSF	HGNC	protein_coding	OTTHUMT00000055652.1	154	0.00	0	G			3019142	3019142	+1	no_errors	ENST00000359361	ensembl	human	known	69_37n	missense	141	61.20	224	SNP	0.007	A
ATP2B1	490	genome.wustl.edu	37	12	90024403	90024403	+	Silent	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr12:90024403G>A	ENST00000428670.3	-	6	1263	c.807C>T	c.(805-807)ggC>ggT	p.G269G	ATP2B1_ENST00000348959.3_Silent_p.G269G|ATP2B1_ENST00000261173.2_Silent_p.G269G|ATP2B1_ENST00000359142.3_Silent_p.G269G|ATP2B1_ENST00000393164.2_Silent_p.G12G			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	269					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TTCTTCCAGAGCCTTCCATTA	0.353																																						dbGAP											0													90.0	85.0	87.0					12																	90024403		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.807C>T	12.37:g.90024403G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.G269	ENST00000428670.3	37	c.807	CCDS9035.1	12																																																																																			ATP2B1	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000070961		0.353	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1	88	0.00	0	G	NM_001682		90024403	90024403	-1	no_errors	ENST00000261173	ensembl	human	known	69_37n	silent	169	32.14	81	SNP	1.000	A
B3GALT5	10317	genome.wustl.edu	37	21	41032610	41032610	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr21:41032610G>C	ENST00000380620.4	+	5	716	c.124G>C	c.(124-126)Ggg>Cgg	p.G42R	AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000380618.1_Missense_Mutation_p.G42R|B3GALT5_ENST00000343118.4_Missense_Mutation_p.G42R|B3GALT5_ENST00000398714.2_Missense_Mutation_p.G42R			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	42					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				CAAGAAAGACGGGAACTTCCT	0.473																																						dbGAP											0													109.0	103.0	105.0					21																	41032610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.124G>C	21.37:g.41032610G>C	ENSP00000369994:p.Gly42Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.G42R	ENST00000380620.4	37	c.124	CCDS13667.1	21	.	.	.	.	.	.	.	.	.	.	G	10.08	1.252990	0.22965	.	.	ENSG00000183778	ENST00000380620;ENST00000380618;ENST00000343118;ENST00000398714	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.75	1.37	0.22104	.	0.738284	0.12521	N	0.461601	T	0.26412	0.0645	N	0.21448	0.665	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.24404	-1.0161	10	0.20519	T	0.43	.	9.2604	0.37608	0.3355:0.0:0.6645:0.0	.	42	Q9Y2C3	B3GT5_HUMAN	R	42	ENSP00000369994:G42R;ENSP00000369992:G42R;ENSP00000343318:G42R;ENSP00000381699:G42R	ENSP00000343318:G42R	G	+	1	0	B3GALT5	39954480	0.167000	0.22975	0.000000	0.03702	0.003000	0.03518	1.705000	0.37867	-0.039000	0.13602	-1.106000	0.02097	GGG	B3GALT5	-	NULL	ENSG00000183778		0.473	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT5	HGNC	protein_coding	OTTHUMT00000195008.2	97	0.00	0	G	NM_033170		41032610	41032610	+1	no_errors	ENST00000343118	ensembl	human	known	69_37n	missense	225	41.25	158	SNP	0.011	C
BRPF3	27154	genome.wustl.edu	37	6	36178029	36178029	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr6:36178029G>A	ENST00000357641.6	+	6	2156	c.1903G>A	c.(1903-1905)Gat>Aat	p.D635N	BRPF3_ENST00000534400.1_Missense_Mutation_p.D635N|BRPF3_ENST00000339717.7_Missense_Mutation_p.D635N|BRPF3_ENST00000543502.1_Missense_Mutation_p.D635N|BRPF3_ENST00000443324.2_Missense_Mutation_p.D635N|BRPF3_ENST00000534694.1_Missense_Mutation_p.D635N	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	635	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						CAAGCCAATGGATTTTTCTAC	0.423																																						dbGAP											0													81.0	81.0	81.0					6																	36178029		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.1903G>A	6.37:g.36178029G>A	ENSP00000350267:p.Asp635Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.D635N	ENST00000357641.6	37	c.1903	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761683	0.69763	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400;ENST00000394572	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46	6.02	6.02	0.97574	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.66742	0.2820	H	0.95679	3.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.75918	-0.3148	10	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	635;635;635	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	N	635;635;635;635;635;635;49	ENSP00000350267:D635N;ENSP00000345419:D635N;ENSP00000434501:D635N;ENSP00000445352:D635N;ENSP00000387368:D635N;ENSP00000436504:D635N	ENSP00000345419:D635N	D	+	1	0	BRPF3	36286007	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.865000	0.98341	0.655000	0.94253	GAT	BRPF3	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000096070		0.423	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	96	0.00	0	G	NM_015695		36178029	36178029	+1	no_errors	ENST00000357641	ensembl	human	known	69_37n	missense	394	22.44	114	SNP	1.000	A
TBC1D32	221322	genome.wustl.edu	37	6	121615779	121615779	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr6:121615779G>A	ENST00000398212.2	-	11	1217	c.1168C>T	c.(1168-1170)Cag>Tag	p.Q390*	TBC1D32_ENST00000275159.6_Nonsense_Mutation_p.Q390*	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	390					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TCAAAGTACTGAACACACTGT	0.318																																						dbGAP											0													132.0	127.0	128.0					6																	121615779		1827	4069	5896	-	-	-	SO:0001587	stop_gained	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1168C>T	6.37:g.121615779G>A	ENSP00000381270:p.Gln390*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Nonsense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.Q390*	ENST00000398212.2	37	c.1168	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	g	37	6.217194	0.97385	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	.	.	.	5.13	4.27	0.50696	.	0.356730	0.29100	N	0.013143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-10.2109	7.7278	0.28769	0.0876:0.1667:0.7457:0.0	.	.	.	.	X	390	.	ENSP00000275159:Q390X	Q	-	1	0	C6orf170	121657478	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.423000	0.34837	1.300000	0.44818	-0.127000	0.14921	CAG	C6orf170	-	NULL	ENSG00000146350		0.318	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	HGNC	protein_coding	OTTHUMT00000380937.2	126	0.00	0	G	NM_152730		121615779	121615779	-1	no_errors	ENST00000275159	ensembl	human	putative	69_37n	nonsense	135	38.91	86	SNP	1.000	A
STKLD1	169436	genome.wustl.edu	37	9	136266928	136266928	+	Silent	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr9:136266928G>A	ENST00000371957.3	+	13	1367	c.1260G>A	c.(1258-1260)ctG>ctA	p.L420L	C9orf96_ENST00000371955.1_Intron	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		420							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCACCCTGCTGAGTGCTCTTC	0.627																																						dbGAP											0													81.0	68.0	72.0					9																	136266928		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000371957.3:c.1260G>A	9.37:g.136266928G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T8U8|Q6ZMP6|Q6ZMQ5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L420	ENST00000371957.3	37	c.1260	CCDS35169.1	9																																																																																			C9orf96	-	superfamily_ARM-type_fold	ENSG00000198870		0.627	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf96	HGNC	protein_coding	OTTHUMT00000054855.1	21	0.00	0	G			136266928	136266928	+1	no_errors	ENST00000371957	ensembl	human	known	69_37n	silent	40	62.96	68	SNP	0.659	A
CARD10	29775	genome.wustl.edu	37	22	37892477	37892477	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr22:37892477G>A	ENST00000403299.1	-	14	2254	c.2038C>T	c.(2038-2040)Ccc>Tcc	p.P680S	CARD10_ENST00000406271.3_Missense_Mutation_p.P394S|CARD10_ENST00000251973.5_Missense_Mutation_p.P680S			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	680					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					ATCAGGGAGGGGAGTGTGGAC	0.632																																						dbGAP											0													74.0	64.0	67.0					22																	37892477		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.2038C>T	22.37:g.37892477G>A	ENSP00000384570:p.Pro680Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.P680S	ENST00000403299.1	37	c.2038	CCDS13948.1	22	.	.	.	.	.	.	.	.	.	.	G	7.084	0.570888	0.13623	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973;ENST00000437756;ENST00000433485	T;T;T;T	0.38722	1.12;2.83;1.12;1.6	4.94	3.81	0.43845	.	0.546836	0.19612	N	0.110112	T	0.26991	0.0661	N	0.16368	0.405	0.09310	N	1	B;B	0.17852	0.024;0.003	B;B	0.10450	0.005;0.003	T	0.13737	-1.0498	10	0.44086	T	0.13	-31.3367	11.59	0.50941	0.0:0.0:0.7757:0.2243	.	680;394	Q9BWT7;Q8NC81	CAR10_HUMAN;.	S	680;394;680;321;152	ENSP00000384570:P680S;ENSP00000385799:P394S;ENSP00000251973:P680S;ENSP00000416239:P321S	ENSP00000251973:P680S	P	-	1	0	CARD10	36222423	0.238000	0.23825	0.172000	0.22920	0.236000	0.25371	0.385000	0.20685	2.448000	0.82819	0.561000	0.74099	CCC	CARD10	-	NULL	ENSG00000100065		0.632	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD10	HGNC	protein_coding	OTTHUMT00000318997.1	16	0.00	0	G	NM_014550		37892477	37892477	-1	no_errors	ENST00000251973	ensembl	human	known	69_37n	missense	34	76.22	109	SNP	0.014	A
CATSPER2	117155	genome.wustl.edu	37	15	43927354	43927354	+	Intron	DEL	T	T	-	rs565591354		TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr15:43927354delT	ENST00000321596.5	-	10	1378				CATSPER2_ENST00000355438.2_Intron|CATSPER2_ENST00000396879.1_Intron|CATSPER2_ENST00000354127.4_Intron|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000381761.1_Intron|RNU6-610P_ENST00000384264.1_RNA			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2						calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		acttaggatcttttttttttt	0.393											OREG0003957	type=REGULATORY REGION|Gene=AK093318|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.1178+203A>-	15.37:g.43927354delT		Somatic	920	WXS	Illumina GAIIx	Phase_IV	Q8NHT9|Q96P54|Q96P55	Splice_Site	DEL	-	e2-2	ENST00000321596.5	37	c.34-2	CCDS10099.1	15																																																																																			CATSPER2	-	-	ENSG00000166762		0.393	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	28	0.00	0	T	NM_054020		43927354	43927354	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419262	ensembl	human	known	69_37n	splice_site_del	36	13.95	6	DEL	0.002	-
CBLC	23624	genome.wustl.edu	37	19	45303662	45303662	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr19:45303662C>G	ENST00000270279.3	+	10	1450	c.1387C>G	c.(1387-1389)Cca>Gca	p.P463A	CBLC_ENST00000341505.4_Missense_Mutation_p.P417A	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	463	Interaction with RET.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				GAACTCCCCTCCAGCTGCGCT	0.627			M		AML						OREG0025543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	0													51.0	53.0	52.0					19																	45303662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.1387C>G	19.37:g.45303662C>G	ENSP00000270279:p.Pro463Ala	Somatic	930	WXS	Illumina GAIIx	Phase_IV	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Adaptor_Cbl_N_hlx,pfam_Znf_C3HC4_RING-type,superfamily_Adaptor_Cbl_N_hlx,smart_Znf_RING,pfscan_Znf_RING	p.P463A	ENST00000270279.3	37	c.1387	CCDS12643.1	19	.	.	.	.	.	.	.	.	.	.	.	12.51	1.960886	0.34565	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	D;D	0.89681	-2.44;-2.55	3.07	0.756	0.18421	.	0.255981	0.19644	U	0.109364	T	0.77552	0.4147	N	0.19112	0.55	0.09310	N	1	B;B	0.19331	0.035;0.02	B;B	0.14023	0.01;0.004	T	0.63139	-0.6704	10	0.29301	T	0.29	-1.403	9.0175	0.36179	0.0:0.4905:0.5095:0.0	.	417;463	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	A	463;417	ENSP00000270279:P463A;ENSP00000340250:P417A	ENSP00000270279:P463A	P	+	1	0	CBLC	49995502	0.014000	0.17966	0.023000	0.16930	0.153000	0.21895	0.272000	0.18644	0.284000	0.22305	0.655000	0.94253	CCA	CBLC	-	NULL	ENSG00000142273		0.627	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLC	HGNC	protein_coding	OTTHUMT00000319732.2	20	0.00	0	C	NM_012116		45303662	45303662	+1	no_errors	ENST00000270279	ensembl	human	known	69_37n	missense	54	32.50	26	SNP	0.027	G
CXorf30	645090	genome.wustl.edu	37	X	36366361	36366361	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chrX:36366361G>A	ENST00000378657.4	+	12	1547	c.899G>A	c.(898-900)tGg>tAg	p.W300*		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	300										breast(1)|lung(2)|stomach(1)	4						GGAAAATATTGGCCTATTGAC	0.254																																						dbGAP											0													32.0	25.0	27.0					X																	36366361		690	1562	2252	-	-	-	SO:0001587	stop_gained	0				CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.899G>A	X.37:g.36366361G>A	ENSP00000367926:p.Trp300*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.W300*	ENST00000378657.4	37	c.899	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	G	40	8.321060	0.98759	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	.	.	.	4.61	4.61	0.57282	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9535	14.26	0.66078	0.0:0.0:1.0:0.0	.	.	.	.	X	585;300	.	ENSP00000367922:W585X	W	+	2	0	CXorf30	36276282	1.000000	0.71417	0.172000	0.22920	0.025000	0.11179	6.011000	0.70760	2.030000	0.59900	0.523000	0.50628	TGG	CXorf30	-	NULL	ENSG00000205081		0.254	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		58	0.00	0	G	NP_001092313		36366361	36366361	+1	no_errors	ENST00000378657	ensembl	human	known	69_37n	nonsense	15	60.53	23	SNP	0.903	A
CYLD	1540	genome.wustl.edu	37	16	50816338	50816338	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr16:50816338G>A	ENST00000427738.3	+	10	1992	c.1787G>A	c.(1786-1788)gGt>gAt	p.G596D	CYLD_ENST00000311559.9_Missense_Mutation_p.G596D|CYLD_ENST00000564326.1_Missense_Mutation_p.G593D|CYLD_ENST00000398568.2_Missense_Mutation_p.G593D|RP11-327F22.4_ENST00000564510.1_RNA|CYLD_ENST00000568704.2_Missense_Mutation_p.G411D|CYLD_ENST00000540145.1_Missense_Mutation_p.G596D|RP11-327F22.4_ENST00000575917.1_RNA|CYLD_ENST00000566206.1_Missense_Mutation_p.G593D|CYLD_ENST00000569418.1_Missense_Mutation_p.G593D			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	596	USP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				GGCATCCAGGGTCATTACAAT	0.383			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																													dbGAP	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	familial cylindromatosis gene		E	0			GRCh37	CM074130	CYLD	M							112.0	111.0	111.0					16																	50816338		1892	4121	6013	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.1787G>A	16.37:g.50816338G>A	ENSP00000392025:p.Gly596Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Peptidase_C19,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain,pfscan_Peptidase_C19	p.G596D	ENST00000427738.3	37	c.1787	CCDS45482.1	16	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904546	0.92035	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	T;T;D;T	0.98012	-0.74;-0.74;-4.66;-0.74	5.61	5.61	0.85477	Cytoskeleton-associated protein, Gly-rich domain (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.98710	0.9567	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99813	1.1042	10	0.87932	D	0	-18.959	19.6376	0.95740	0.0:0.0:1.0:0.0	.	593;596;593;596	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	D	596;596;593;593	ENSP00000445447:G596D;ENSP00000308928:G596D;ENSP00000392025:G593D;ENSP00000381574:G593D	ENSP00000308928:G596D	G	+	2	0	CYLD	49373839	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.368000	0.97152	2.633000	0.89246	0.591000	0.81541	GGT	CYLD	-	pfam_Peptidase_C19,superfamily_CAP-Gly_domain,pfscan_Peptidase_C19	ENSG00000083799		0.383	CYLD-010	KNOWN	basic|CCDS	protein_coding	CYLD	HGNC	protein_coding	OTTHUMT00000422998.2	117	0.00	0	G			50816338	50816338	+1	no_errors	ENST00000311559	ensembl	human	known	69_37n	missense	45	65.65	86	SNP	1.000	A
DRAM1	55332	genome.wustl.edu	37	12	102315029	102315029	+	Silent	SNP	T	T	C			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr12:102315029T>C	ENST00000258534.8	+	7	1147	c.708T>C	c.(706-708)ggT>ggC	p.G236G	DRAM1_ENST00000544152.1_Silent_p.G126G|RP11-512N21.3_ENST00000551918.1_RNA	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	236					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						AAATCAATGGTGATATTTGAA	0.388																																						dbGAP											0													127.0	118.0	121.0					12																	102315029		1867	4109	5976	-	-	-	SO:0001819	synonymous_variant	0			BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.708T>C	12.37:g.102315029T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4T0|Q7L3E3|Q9NUN1	Silent	SNP	pfam_Frag1/DRAM/Sfk1	p.G236	ENST00000258534.8	37	c.708	CCDS41823.1	12																																																																																			DRAM1	-	NULL	ENSG00000136048		0.388	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM1	HGNC	protein_coding	OTTHUMT00000409195.1	93	0.00	0	T	NM_018370		102315029	102315029	+1	no_errors	ENST00000258534	ensembl	human	known	69_37n	silent	223	31.08	101	SNP	0.395	C
DUSP27	92235	genome.wustl.edu	37	1	167095632	167095632	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr1:167095632G>A	ENST00000361200.2	+	6	1430	c.1264G>A	c.(1264-1266)Gac>Aac	p.D422N	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Missense_Mutation_p.D422N|DUSP27_ENST00000271385.5_Missense_Mutation_p.D422N			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	422					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ggaggagAGCGACGCTGGCTC	0.657																																						dbGAP											0													26.0	18.0	21.0					1																	167095632		2177	4259	6436	-	-	-	SO:0001583	missense	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1264G>A	1.37:g.167095632G>A	ENSP00000354483:p.Asp422Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.D422N	ENST00000361200.2	37	c.1264	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	5.302	0.241178	0.10077	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03801	3.8;3.8;3.8	3.73	-1.8	0.07907	.	1.750970	0.03367	N	0.198497	T	0.01092	0.0036	N	0.21448	0.665	0.09310	N	1	B	0.17268	0.021	B	0.10450	0.005	T	0.48103	-0.9064	10	0.34782	T	0.22	-0.3355	6.282	0.21013	0.3712:0.1187:0.5101:0.0	.	422	Q5VZP5	DUS27_HUMAN	N	422	ENSP00000354483:D422N;ENSP00000271385:D422N;ENSP00000404874:D422N	ENSP00000271385:D422N	D	+	1	0	DUSP27	165362256	0.942000	0.31987	0.000000	0.03702	0.009000	0.06853	3.076000	0.50081	-0.515000	0.06479	-1.074000	0.02243	GAC	DUSP27	-	NULL	ENSG00000198842		0.657	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	10	0.00	0	G	NM_001080426		167095632	167095632	+1	no_errors	ENST00000271385	ensembl	human	known	69_37n	missense	33	53.52	38	SNP	0.000	A
EEFSEC	60678	genome.wustl.edu	37	3	128060108	128060108	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr3:128060108C>A	ENST00000254730.6	+	5	873	c.819C>A	c.(817-819)ttC>ttA	p.F273L	EEFSEC_ENST00000483569.1_3'UTR|EEFSEC_ENST00000483457.1_Missense_Mutation_p.F218L	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	273					selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						TGCAGATGTTCCACATGCCCA	0.592																																						dbGAP											0													91.0	83.0	85.0					3																	128060108		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.819C>A	3.37:g.128060108C>A	ENSP00000254730:p.Phe273Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96HZ6	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Transl_elong_EF1A/Init_IF2_C,prints_ProtSyn_GTP-bd	p.F273L	ENST00000254730.6	37	c.819	CCDS33849.1	3	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215563	0.58452	.	.	ENSG00000132394	ENST00000254730;ENST00000483457	T;T	0.72282	-0.2;-0.64	5.34	1.54	0.23209	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.88607	0.6482	H	0.97852	4.09	0.53688	D	0.999975	D;D	0.89917	0.999;1.0	D;D	0.97110	0.994;1.0	D	0.88649	0.3181	10	0.87932	D	0	-3.7949	11.7703	0.51953	0.0:0.6777:0.0:0.3223	.	218;273	C9J8T0;P57772	.;SELB_HUMAN	L	273;218	ENSP00000254730:F273L;ENSP00000417660:F218L	ENSP00000254730:F273L	F	+	3	2	EEFSEC	129542798	1.000000	0.71417	0.978000	0.43139	0.825000	0.46686	1.288000	0.33296	-0.212000	0.10109	-1.094000	0.02160	TTC	EEFSEC	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel	ENSG00000132394		0.592	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEFSEC	HGNC	protein_coding	OTTHUMT00000356738.2	18	0.00	0	C	NM_021937		128060108	128060108	+1	no_errors	ENST00000254730	ensembl	human	known	69_37n	missense	85	46.91	76	SNP	0.996	A
FAM205A	259308	genome.wustl.edu	37	9	34724646	34724646	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr9:34724646delC	ENST00000378788.3	-	4	2630	c.2591delG	c.(2590-2592)ggafs	p.G864fs		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	864						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						CTCCATTGTTCCTTTTACTGG	0.473																																						dbGAP											0													6.0	5.0	5.0					9																	34724646		671	1537	2208	-	-	-	SO:0001589	frameshift_variant	0				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.2591delG	9.37:g.34724646delC	ENSP00000417711:p.Gly864fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVW7	Frame_Shift_Del	DEL	NULL	p.G864fs	ENST00000378788.3	37	c.2591	CCDS55305.1	9																																																																																			FAM205A	-	NULL	ENSG00000205108		0.473	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2	23	0.00	0	C	NM_001141917		34724646	34724646	-1	no_errors	ENST00000378788	ensembl	human	novel	69_37n	frame_shift_del	41	59.46	66	DEL	0.001	-
FEZF2	55079	genome.wustl.edu	37	3	62356997	62356997	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr3:62356997C>A	ENST00000283268.3	-	4	1309	c.1015G>T	c.(1015-1017)Ggc>Tgc	p.G339C	PTPRG-AS1_ENST00000495542.1_RNA|FEZF2_ENST00000475839.1_Missense_Mutation_p.G339C|PTPRG-AS1_ENST00000490916.1_RNA|FEZF2_ENST00000486811.1_Missense_Mutation_p.G339C	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	339					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		AACGCTTTGCCGCACTGGTTG	0.582																																					NSCLC(170;1772 2053 12525 15604 23984)	dbGAP											0													144.0	127.0	133.0					3																	62356997		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1015G>T	3.37:g.62356997C>A	ENSP00000283268:p.Gly339Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G339C	ENST00000283268.3	37	c.1015	CCDS2897.1	3	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537839	0.65085	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	T;T;T	0.60040	0.22;0.22;0.22	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.85647	0.5745	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88986	0.3411	10	0.87932	D	0	-19.6335	20.8598	0.99761	0.0:1.0:0.0:0.0	.	339	Q8TBJ5	FEZF2_HUMAN	C	339	ENSP00000418589:G339C;ENSP00000283268:G339C;ENSP00000418804:G339C	ENSP00000283268:G339C	G	-	1	0	FEZF2	62332037	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GGC	FEZF2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000153266		0.582	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF2	HGNC	protein_coding	OTTHUMT00000351813.1	42	0.00	0	C	NM_018008		62356997	62356997	-1	no_errors	ENST00000283268	ensembl	human	known	69_37n	missense	225	37.67	136	SNP	1.000	A
FHOD3	80206	genome.wustl.edu	37	18	34289239	34289239	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr18:34289239G>T	ENST00000359247.4	+	14	1842	c.1842G>T	c.(1840-1842)agG>agT	p.R614S	FHOD3_ENST00000445677.1_Missense_Mutation_p.R593S|FHOD3_ENST00000590592.1_Missense_Mutation_p.R806S|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000257209.4_Missense_Mutation_p.R631S	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	614					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AAAAAGAGAGGCAGAACGAGG	0.592																																						dbGAP											0													62.0	62.0	62.0					18																	34289239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1842G>T	18.37:g.34289239G>T	ENSP00000352186:p.Arg614Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.R631S	ENST00000359247.4	37	c.1893		18	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327639	0.60743	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.36157	1.32;1.27;2.24	5.88	2.13	0.27403	.	0.044256	0.85682	D	0.000000	T	0.53626	0.1808	M	0.67953	2.075	0.41694	D	0.989367	P;D;P;B	0.61697	0.51;0.99;0.51;0.376	B;D;B;B	0.68353	0.154;0.957;0.154;0.115	T	0.47368	-0.9123	10	0.40728	T	0.16	.	12.6759	0.56893	0.2549:0.0:0.7451:0.0	.	593;614;631;806	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	S	631;614;593	ENSP00000257209:R631S;ENSP00000352186:R614S;ENSP00000411430:R593S	ENSP00000257209:R631S	R	+	3	2	FHOD3	32543237	1.000000	0.71417	0.995000	0.50966	0.967000	0.64934	1.341000	0.33907	-0.076000	0.12775	-0.797000	0.03246	AGG	FHOD3	-	NULL	ENSG00000134775		0.592	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	14	0.00	0	G	XM_371114		34289239	34289239	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	54	34.52	29	SNP	0.999	T
KCNE2	9992	genome.wustl.edu	37	21	35742917	35742917	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr21:35742917A>T	ENST00000290310.3	+	2	280	c.140A>T	c.(139-141)tAc>tTc	p.Y47F	AP000320.6_ENST00000440403.1_RNA	NM_172201.1	NP_751951.1	Q9Y6J6	KCNE2_HUMAN	potassium voltage-gated channel, Isk-related family, member 2	47					aging (GO:0007568)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular protein localization (GO:0034613)|cellular response to drug (GO:0035690)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|positive regulation of proteasomal protein catabolic process (GO:1901800)|potassium ion export (GO:0071435)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of cyclic nucleotide-gated ion channel activity (GO:1902159)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of inward rectifier potassium channel activity (GO:1901979)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|tongue development (GO:0043586)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|large_intestine(1)	2						GAGAACTTCTACTATGTCATC	0.463																																						dbGAP											0													154.0	145.0	148.0					21																	35742917		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071002	CCDS13635.1	21q22.1	2014-09-17			ENSG00000159197	ENSG00000159197		"""Potassium channels"""	6242	protein-coding gene	gene with protein product		603796				10219239	Standard	NM_172201		Approved	MiRP1, LQT6	uc002ytt.1	Q9Y6J6	OTTHUMG00000086189	ENST00000290310.3:c.140A>T	21.37:g.35742917A>T	ENSP00000290310:p.Tyr47Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5H1P3|D3DSF8|Q52LJ5	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_bsu_KCNE,prints_K_chnl_volt-dep_bsu_KCNE2	p.Y47F	ENST00000290310.3	37	c.140	CCDS13635.1	21	.	.	.	.	.	.	.	.	.	.	A	17.06	3.293389	0.60086	.	.	ENSG00000159197	ENST00000290310	D	0.91124	-2.79	5.53	4.31	0.51392	.	0.449079	0.21906	N	0.067376	D	0.86318	0.5904	L	0.36672	1.1	0.35025	D	0.758244	P	0.36753	0.568	B	0.38712	0.28	D	0.90440	0.4431	10	0.59425	D	0.04	-10.2134	11.9598	0.53001	0.8551:0.1449:0.0:0.0	.	47	Q9Y6J6	KCNE2_HUMAN	F	47	ENSP00000290310:Y47F	ENSP00000290310:Y47F	Y	+	2	0	KCNE2	34664787	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.846000	0.55888	2.092000	0.63282	0.459000	0.35465	TAC	KCNE2	-	prints_K_chnl_volt-dep_bsu_KCNE2	ENSG00000159197		0.463	KCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNE2	HGNC	protein_coding	OTTHUMT00000194068.2	81	0.00	0	A			35742917	35742917	+1	no_errors	ENST00000290310	ensembl	human	known	69_37n	missense	250	38.73	158	SNP	1.000	T
KIF4B	285643	genome.wustl.edu	37	5	154395359	154395359	+	Missense_Mutation	SNP	G	G	A	rs149307043		TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr5:154395359G>A	ENST00000435029.4	+	1	2100	c.1940G>A	c.(1939-1941)cGg>cAg	p.R647Q		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	647					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AAAAACCAGCGGGTACAGTTA	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22493	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													155.0	154.0	155.0					5																	154395359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1940G>A	5.37:g.154395359G>A	ENSP00000387875:p.Arg647Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R647Q	ENST00000435029.4	37	c.1940	CCDS47324.1	5	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	g	17.18	3.323858	0.60634	.	.	ENSG00000226650	ENST00000435029	T	0.17528	2.27	2.54	2.54	0.30619	.	.	.	.	.	T	0.35566	0.0936	M	0.65498	2.005	0.50632	D	0.999881	D	0.89917	1.0	D	0.70716	0.97	T	0.13308	-1.0514	9	0.62326	D	0.03	.	10.7682	0.46305	0.0:0.0:1.0:0.0	.	647	Q2VIQ3	KIF4B_HUMAN	Q	647	ENSP00000387875:R647Q	ENSP00000387875:R647Q	R	+	2	0	KIF4B	154375552	1.000000	0.71417	0.978000	0.43139	0.989000	0.77384	3.481000	0.53179	1.138000	0.42230	0.563000	0.77884	CGG	KIF4B	-	NULL	ENSG00000226650		0.403	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	224	0.00	0	G			154395359	154395359	+1	no_errors	ENST00000435029	ensembl	human	known	69_37n	missense	122	64.43	221	SNP	0.996	A
LAMA3	3909	genome.wustl.edu	37	18	21451420	21451420	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr18:21451420G>A	ENST00000313654.9	+	38	5034	c.4793G>A	c.(4792-4794)cGt>cAt	p.R1598H	LAMA3_ENST00000269217.6_5'Flank|LAMA3_ENST00000587184.1_5'Flank|LAMA3_ENST00000399516.3_Missense_Mutation_p.R1598H	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1598	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GCCAGCAGCCGTGCCCCAGTG	0.552																																						dbGAP											0													63.0	66.0	65.0					18																	21451420		2038	4186	6224	-	-	-	SO:0001583	missense	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4793G>A	18.37:g.21451420G>A	ENSP00000324532:p.Arg1598His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Growth_fac_rcpt,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.R1598H	ENST00000313654.9	37	c.4793	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275805	0.23307	.	.	ENSG00000053747	ENST00000313654;ENST00000399516	T;T	0.37058	1.22;1.22	5.43	3.2	0.36748	Laminin B type IV (2);Laminin B, subgroup (1);Growth factor, receptor (1);	.	.	.	.	T	0.18676	0.0448	N	0.13003	0.285	0.21652	N	0.9996	D;D	0.54397	0.966;0.958	B;B	0.42798	0.398;0.322	T	0.03249	-1.1056	9	0.22706	T	0.39	.	3.8936	0.09130	0.2394:0.0:0.5566:0.2039	.	1598;1598	Q6VU67;Q16787	.;LAMA3_HUMAN	H	1598	ENSP00000324532:R1598H;ENSP00000382432:R1598H	ENSP00000324532:R1598H	R	+	2	0	LAMA3	19705418	0.441000	0.25626	0.002000	0.10522	0.911000	0.54048	3.572000	0.53849	1.383000	0.46405	0.655000	0.94253	CGT	LAMA3	-	pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV	ENSG00000053747		0.552	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	11	0.00	0	G	NM_000227, NM_198129		21451420	21451420	+1	no_errors	ENST00000313654	ensembl	human	known	69_37n	missense	80	41.61	57	SNP	0.002	A
LELP1	149018	genome.wustl.edu	37	1	153177464	153177464	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr1:153177464G>A	ENST00000368747.1	+	2	391	c.281G>A	c.(280-282)tGc>tAc	p.C94Y		NM_001010857.1	NP_001010857.1	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	94	Cys/Pro-rich.									NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|pancreas(1)|prostate(1)	19	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCACCTCCCTGCCCTCCCCCA	0.622																																						dbGAP											0													54.0	45.0	48.0					1																	153177464		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30869.1	1q21.3	2008-02-05			ENSG00000203784	ENSG00000203784			32046	protein-coding gene	gene with protein product		611042					Standard	NM_001010857		Approved		uc001fbl.4	Q5T871	OTTHUMG00000013935	ENST00000368747.1:c.281G>A	1.37:g.153177464G>A	ENSP00000357736:p.Cys94Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4E1	Missense_Mutation	SNP	NULL	p.C94Y	ENST00000368747.1	37	c.281	CCDS30869.1	1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785651	0.31593	.	.	ENSG00000203784	ENST00000368747	.	.	.	5.23	4.31	0.51392	.	.	.	.	.	T	0.52725	0.1752	.	.	.	0.24009	N	0.996185	D	0.69078	0.997	D	0.66497	0.944	T	0.48725	-0.9010	7	0.87932	D	0	-4.3001	11.2671	0.49116	0.0:0.0:0.8191:0.1809	.	94	Q5T871	LELP1_HUMAN	Y	94	.	ENSP00000357736:C94Y	C	+	2	0	LELP1	151444088	0.577000	0.26708	0.423000	0.26634	0.524000	0.34500	2.639000	0.46570	1.406000	0.46857	0.561000	0.74099	TGC	LELP1	-	NULL	ENSG00000203784		0.622	LELP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LELP1	HGNC	protein_coding	OTTHUMT00000039104.1	18	0.00	0	G	NM_001010857		153177464	153177464	+1	no_errors	ENST00000368747	ensembl	human	known	69_37n	missense	80	54.81	114	SNP	0.598	A
MAGED1	9500	genome.wustl.edu	37	X	51639993	51639993	+	Silent	SNP	T	T	C			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chrX:51639993T>C	ENST00000375722.1	+	4	1494	c.1242T>C	c.(1240-1242)ccT>ccC	p.P414P	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375772.3_Silent_p.P414P|MAGED1_ENST00000375695.2_Silent_p.P470P|MAGED1_ENST00000326587.7_Silent_p.P414P			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	414	22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.|Pro-rich.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CACTGCCACCTGATTGGCCAC	0.642										Multiple Myeloma(10;0.10)																												dbGAP											0													30.0	19.0	23.0					X																	51639993		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1242T>C	X.37:g.51639993T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.P470	ENST00000375722.1	37	c.1410	CCDS14337.1	X																																																																																			MAGED1	-	NULL	ENSG00000179222		0.642	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	8	0.00	0	T	NM_001005332		51639993	51639993	+1	no_errors	ENST00000375695	ensembl	human	known	69_37n	silent	21	36.36	12	SNP	0.184	C
MYL1	4632	genome.wustl.edu	37	2	211179766	211179766	+	Start_Codon_Del	DEL	T	T	-			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr2:211179766delT	ENST00000352451.3	-	0	148					NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast						cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		TTTGGTGCCATTTTTTTTTTT	0.527																																						dbGAP											0										406,181,73,3588		24,5,3,350,0,0,176,1,68,1497	86.0	117.0	107.0			5.4	1.0	2	dbSNP_130	111	68,327,4,7851		0,1,0,67,0,0,326,0,4,3727	no	codingComplex	MYL1	NM_079420.2		24,6,3,417,0,0,502,1,72,5224	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		4.8364,15.5367,8.4734			211179766	474,508,77,11439	2199	4299	6498	-	-	-	SO:0001582	initiator_codon_variant	0				CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992		2.37:g.211179766delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4N6|B2R4T6|P06741|Q6IBD5	Frame_Shift_Del	DEL	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.M1fs	ENST00000352451.3	37	c.1	CCDS2390.1	2																																																																																			MYL1	-	NULL	ENSG00000168530		0.527	MYL1-001	KNOWN	basic|CCDS	protein_coding	MYL1	HGNC	protein_coding	OTTHUMT00000256566.2	39	0.00	0	T	NM_079420		211179766	211179766	-1	no_errors	ENST00000352451	ensembl	human	known	69_37n	frame_shift_del	25	45.83	22	DEL	1.000	-
NAA50	80218	genome.wustl.edu	37	3	113440684	113440684	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr3:113440684C>T	ENST00000240922.3	-	5	757	c.433G>A	c.(433-435)Gca>Aca	p.A145T	NAA50_ENST00000477813.1_Missense_Mutation_p.A105T|NAA50_ENST00000493454.1_Missense_Mutation_p.A71T|NAA50_ENST00000493900.1_Missense_Mutation_p.A144T|NAA50_ENST00000497255.1_Intron|NAA50_ENST00000497525.1_Missense_Mutation_p.A71T|NAA50_ENST00000467022.1_5'Flank	NM_025146.2	NP_079422.1	Q9GZZ1	NAA50_HUMAN	N(alpha)-acetyltransferase 50, NatE catalytic subunit	145	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				histone H4 acetylation (GO:0043967)|mitotic sister chromatid cohesion, centromeric (GO:0071962)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)|peptidyl-lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0052858)			large_intestine(2)|lung(2)|skin(1)	5						TGAGCATCTGCGGGCTCTATC	0.408																																						dbGAP											0													154.0	147.0	149.0					3																	113440684		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023256	CCDS2975.1	3q13.31	2010-05-07	2010-01-14	2010-01-14	ENSG00000121579	ENSG00000121579	2.3.1.-	"""N(alpha)-acetyltransferase subunits"""	29533	protein-coding gene	gene with protein product		610834	"""Mak3 homolog (S. cerevisiae)"", ""N-acetyltransferase 13"", ""N-acetyltransferase 13 (GCN5-related)"""	MAK3, NAT13		16507339, 17502424, 19660095	Standard	NM_025146		Approved	FLJ13194, NAT5, San	uc003ean.2	Q9GZZ1	OTTHUMG00000159294	ENST00000240922.3:c.433G>A	3.37:g.113440684C>T	ENSP00000240922:p.Ala145Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN74|Q68DQ1	Missense_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.A145T	ENST00000240922.3	37	c.433	CCDS2975.1	3	.	.	.	.	.	.	.	.	.	.	.	15.48	2.845825	0.51164	.	.	ENSG00000121579	ENST00000240922;ENST00000313396;ENST00000477813;ENST00000497525;ENST00000493454;ENST00000493900	T;T	0.55760	0.5;0.5	5.41	4.54	0.55810	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	L	0.48935	1.535	0.80722	D	1	P	0.36412	0.552	B	0.20955	0.032	T	0.27839	-1.0062	10	0.24483	T	0.36	-2.6835	14.5601	0.68130	0.0:0.9292:0.0:0.0708	.	145	Q9GZZ1	NAA50_HUMAN	T	145;57;105;71;71;144	ENSP00000240922:A145T;ENSP00000417837:A144T	ENSP00000240922:A145T	A	-	1	0	NAA50	114923374	1.000000	0.71417	0.934000	0.37439	0.974000	0.67602	7.520000	0.81821	1.423000	0.47198	0.655000	0.94253	GCA	NAA50	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000121579		0.408	NAA50-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA50	HGNC	protein_coding	OTTHUMT00000354446.2	173	0.00	0	C	NM_025146		113440684	113440684	-1	no_errors	ENST00000240922	ensembl	human	known	69_37n	missense	516	17.44	109	SNP	1.000	T
NUAK1	9891	genome.wustl.edu	37	12	106466578	106466578	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr12:106466578A>C	ENST00000261402.2	-	5	2002	c.623T>G	c.(622-624)tTc>tGc	p.F208C		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	208	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						CGTTTGTAAGAACTTATCCTT	0.463																																						dbGAP											0													125.0	115.0	118.0					12																	106466578		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.623T>G	12.37:g.106466578A>C	ENSP00000261402:p.Phe208Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F208C	ENST00000261402.2	37	c.623	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	A	14.47	2.544208	0.45280	.	.	ENSG00000074590	ENST00000261402;ENST00000548902	T;T	0.65549	-0.16;-0.16	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000013	T	0.56543	0.1992	L	0.37850	1.14	0.50632	D	0.999884	B	0.18863	0.031	B	0.23852	0.049	T	0.54248	-0.8322	10	0.62326	D	0.03	.	16.3123	0.82883	1.0:0.0:0.0:0.0	.	208	O60285	NUAK1_HUMAN	C	208;77	ENSP00000261402:F208C;ENSP00000448288:F77C	ENSP00000261402:F208C	F	-	2	0	NUAK1	104990708	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.143000	0.64826	2.254000	0.74563	0.459000	0.35465	TTC	NUAK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000074590		0.463	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	63	0.00	0	A	NM_014840		106466578	106466578	-1	no_errors	ENST00000261402	ensembl	human	known	69_37n	missense	135	41.05	94	SNP	1.000	C
PCDHA8	56140	genome.wustl.edu	37	5	140222367	140222367	+	Silent	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr5:140222367C>T	ENST00000531613.1	+	1	1461	c.1461C>T	c.(1459-1461)aaC>aaT	p.N487N	PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000378123.3_Silent_p.N487N|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	487	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCAGGAGAACGCGCTGGTGT	0.662																																						dbGAP											0													51.0	58.0	56.0					5																	140222367		2195	4263	6458	-	-	-	SO:0001819	synonymous_variant	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1461C>T	5.37:g.140222367C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGT7|O75281	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N487	ENST00000531613.1	37	c.1461	CCDS54919.1	5																																																																																			PCDHA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204962		0.662	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	9	0.00	0	C	NM_018911		140222367	140222367	+1	no_errors	ENST00000531613	ensembl	human	known	69_37n	silent	54	28.95	22	SNP	0.912	T
PTPRO	5800	genome.wustl.edu	37	12	15661533	15661533	+	Silent	SNP	G	G	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr12:15661533G>T	ENST00000281171.4	+	7	1626	c.1296G>T	c.(1294-1296)ctG>ctT	p.L432L	PTPRO_ENST00000348962.2_Silent_p.L432L|PTPRO_ENST00000543886.1_Silent_p.L432L	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	432					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TTGAAGAACTGACCGAGAAGC	0.468																																						dbGAP											0													75.0	71.0	72.0					12																	15661533		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1296G>T	12.37:g.15661533G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.L432	ENST00000281171.4	37	c.1296	CCDS8675.1	12																																																																																			PTPRO	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000151490		0.468	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	18	0.00	0	G			15661533	15661533	+1	no_errors	ENST00000281171	ensembl	human	known	69_37n	silent	89	42.58	66	SNP	0.867	T
RBM22	55696	genome.wustl.edu	37	5	150076368	150076368	+	Silent	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr5:150076368C>T	ENST00000199814.4	-	5	478	c.357G>A	c.(355-357)caG>caA	p.Q119Q	RBM22_ENST00000540000.1_Silent_p.Q70Q|RBM22_ENST00000447771.2_Silent_p.Q70Q	NM_018047.2	NP_060517.1	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	119					cellular response to drug (GO:0035690)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of RNA splicing (GO:0033120)|protein import into nucleus, translocation (GO:0000060)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|snRNA binding (GO:0017069)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(1)	17		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCCATATTCTGTGTATAGT	0.388																																						dbGAP											0													80.0	80.0	80.0					5																	150076368		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136933	CCDS34278.1	5q33.1	2013-02-12			ENSG00000086589	ENSG00000086589		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	25503	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 47"""	612430				20013661, 19133299	Standard	NM_018047		Approved	FLJ10290, ZC3H16, fSAP47, Cwc2	uc031slu.1	Q9NW64	OTTHUMG00000163589	ENST00000199814.4:c.357G>A	5.37:g.150076368C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDM5|B4DLI9|O95607	Silent	SNP	pfam_RRM_dom,superfamily_Znf_CCHC,smart_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.Q119	ENST00000199814.4	37	c.357	CCDS34278.1	5																																																																																			RBM22	-	NULL	ENSG00000086589		0.388	RBM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM22	HGNC	protein_coding	OTTHUMT00000374431.2	77	0.00	0	C	NM_018047		150076368	150076368	-1	no_errors	ENST00000199814	ensembl	human	known	69_37n	silent	43	67.18	88	SNP	1.000	T
REG1B	5968	genome.wustl.edu	37	2	79312688	79312688	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr2:79312688G>T	ENST00000305089.3	-	5	443	c.363C>A	c.(361-363)taC>taA	p.Y121*		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	121	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						CCCAGGACTTGTAGGAGACCA	0.537																																						dbGAP											0													93.0	85.0	87.0					2																	79312688		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.363C>A	2.37:g.79312688G>T	ENSP00000303206:p.Tyr121*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_Pancreatis_ac,pfscan_C-type_lectin	p.Y121*	ENST00000305089.3	37	c.363	CCDS1963.1	2	.	.	.	.	.	.	.	.	.	.	g	16.78	3.218227	0.58560	.	.	ENSG00000172023	ENST00000454188;ENST00000305089	.	.	.	3.37	2.48	0.30137	.	0.797569	0.10291	N	0.692274	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2461	0.20818	0.144:0.0:0.856:0.0	.	.	.	.	X	72;121	.	ENSP00000303206:Y121X	Y	-	3	2	REG1B	79166196	0.057000	0.20700	0.045000	0.18777	0.652000	0.38707	0.086000	0.14935	0.734000	0.32515	0.491000	0.48974	TAC	REG1B	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_Pancreatis_ac,pfscan_C-type_lectin	ENSG00000172023		0.537	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REG1B	HGNC	protein_coding	OTTHUMT00000252292.2	58	0.00	0	G	NM_006507		79312688	79312688	-1	no_errors	ENST00000305089	ensembl	human	known	69_37n	nonsense	180	35.94	101	SNP	0.158	T
RPL13A	23521	genome.wustl.edu	37	19	49995067	49995067	+	Missense_Mutation	SNP	G	G	C	rs367814477		TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr19:49995067G>C	ENST00000391857.4	+	8	683	c.607G>C	c.(607-609)Gtc>Ctc	p.V203L	SNORD33_ENST00000362761.1_RNA|RPL13A_ENST00000477613.2_3'UTR|SNORD32A_ENST00000364805.1_RNA|SNORD34_ENST00000365633.1_RNA|SNORD35A_ENST00000363389.1_RNA	NM_001270491.1|NM_012423.3	NP_001257420.1|NP_036555.1	P40429	RL13A_HUMAN	ribosomal protein L13a	203					cellular protein metabolic process (GO:0044267)|cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of formation of translation preinitiation complex (GO:1901194)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|GAIT complex (GO:0097452)|large ribosomal subunit (GO:0015934)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)	2		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CGGACTCCTGGTCTGAGCCCA	0.527																																						dbGAP											0													30.0	29.0	29.0					19																	49995067		2202	4300	6502	-	-	-	SO:0001583	missense	0			X56932	CCDS12768.1, CCDS74421.1	19q13.3	2011-04-06			ENSG00000142541	ENSG00000142541		"""L ribosomal proteins"""	10304	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 1"""	TSTA1			Standard	NM_012423		Approved	L13A	uc031rlt.1	P40429	OTTHUMG00000134289	ENST00000391857.4:c.607G>C	19.37:g.49995067G>C	ENSP00000375730:p.Val203Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K505	Missense_Mutation	SNP	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc	p.V203L	ENST00000391857.4	37	c.607	CCDS12768.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.09|18.09	3.547100|3.547100	0.65311|0.65311	.|.	.|.	ENSG00000142541|ENSG00000142541	ENST00000391857|ENST00000396949	.|.	.|.	.|.	5.73|5.73	4.7|4.7	0.59300|0.59300	.|.	0.000000|.	0.64402|.	U|.	0.000016|.	T|T	0.71693|0.71693	0.3370|0.3370	M|M	0.72479|0.72479	2.2|2.2	0.46376|0.46376	D|D	0.999017|0.999017	B;B|.	0.13594|.	0.008;0.005|.	B;B|.	0.14023|.	0.01;0.007|.	T|T	0.71945|0.71945	-0.4439|-0.4439	8|5	.|.	.|.	.|.	.|.	12.8302|12.8302	0.57742|0.57742	0.0794:0.0:0.9206:0.0|0.0794:0.0:0.9206:0.0	.|.	203;203|.	Q5QTS3;P40429|.	.;RL13A_HUMAN|.	L|C	203|137	.|.	.|.	V|W	+|+	1|3	0|0	RPL13A|RPL13A	54686879|54686879	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.143000|4.143000	0.58051|0.58051	1.434000|1.434000	0.47414|0.47414	0.561000|0.561000	0.74099|0.74099	GTC|TGG	RPL13A	-	NULL	ENSG00000142541		0.527	RPL13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL13A	HGNC	protein_coding	OTTHUMT00000258989.1	13	0.00	0	G			49995067	49995067	+1	no_errors	ENST00000391857	ensembl	human	known	69_37n	missense	11	72.50	29	SNP	1.000	C
SEMA3F	6405	genome.wustl.edu	37	3	50211374	50211374	+	Silent	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr3:50211374C>T	ENST00000002829.3	+	3	745	c.261C>T	c.(259-261)cgC>cgT	p.R87R	SEMA3F_ENST00000413852.1_Silent_p.R19R|MIR566_ENST00000385187.1_RNA|SEMA3F_ENST00000434342.1_Silent_p.R87R	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	87	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		ACATCAACCGCGAGCCCCTCA	0.632																																						dbGAP											0													99.0	87.0	91.0					3																	50211374		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.261C>T	3.37:g.50211374C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,smart_Ig_sub2,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.R87	ENST00000002829.3	37	c.261	CCDS2811.1	3																																																																																			SEMA3F	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000001617		0.632	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3F	HGNC	protein_coding	OTTHUMT00000345929.1	33	0.00	0	C	NM_004186		50211374	50211374	+1	no_errors	ENST00000002829	ensembl	human	known	69_37n	silent	249	19.09	59	SNP	0.055	T
SERINC2	347735	genome.wustl.edu	37	1	31898637	31898637	+	Missense_Mutation	SNP	G	G	A	rs201000290		TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr1:31898637G>A	ENST00000373709.3	+	5	637	c.487G>A	c.(487-489)Ggc>Agc	p.G163S	SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000536859.1_Missense_Mutation_p.G167S|SERINC2_ENST00000373710.1_Missense_Mutation_p.G172S|SERINC2_ENST00000536384.1_Missense_Mutation_p.G167S	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	163					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		GTTCTACTTCGGCGTCGTGGG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		19205	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													213.0	179.0	191.0					1																	31898637		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.487G>A	1.37:g.31898637G>A	ENSP00000362813:p.Gly163Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	pfam_TMS_TDE	p.G172S	ENST00000373709.3	37	c.514	CCDS30662.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	22.6	4.308340	0.81247	.	.	ENSG00000168528	ENST00000373710;ENST00000536859;ENST00000373709;ENST00000536384	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.30230	0.0758	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.992;0.981	T	0.06516	-1.0822	10	0.87932	D	0	-28.2786	16.2466	0.82448	0.0:0.0:1.0:0.0	.	167;172;163	B4DJK5;E7EUZ9;Q96SA4	.;.;SERC2_HUMAN	S	172;167;163;167	ENSP00000362814:G172S;ENSP00000444307:G167S;ENSP00000362813:G163S;ENSP00000439048:G167S	ENSP00000362813:G163S	G	+	1	0	SERINC2	31671224	1.000000	0.71417	0.988000	0.46212	0.375000	0.29983	9.547000	0.98100	2.233000	0.73108	0.491000	0.48974	GGC	SERINC2	-	pfam_TMS_TDE	ENSG00000168528		0.602	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC2	HGNC	protein_coding	OTTHUMT00000010680.1	38	0.00	0	G	NM_018565		31898637	31898637	+1	no_errors	ENST00000373710	ensembl	human	known	69_37n	missense	255	36.16	145	SNP	1.000	A
SGCZ	137868	genome.wustl.edu	37	8	13965683	13965683	+	Silent	SNP	G	G	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr8:13965683G>T	ENST00000382080.1	-	6	1324	c.609C>A	c.(607-609)tcC>tcA	p.S203S	SGCZ_ENST00000421524.2_Silent_p.S156S	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	190					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TGAGATCTTGGGATGGCTCTG	0.438																																						dbGAP											0													101.0	90.0	94.0					8																	13965683		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.609C>A	8.37:g.13965683G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6REU0	Silent	SNP	pfam_Sarcoglycan	p.S203	ENST00000382080.1	37	c.609	CCDS5992.2	8																																																																																			SGCZ	-	pfam_Sarcoglycan	ENSG00000185053		0.438	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGCZ	HGNC	protein_coding	OTTHUMT00000207636.2	66	0.00	0	G	NM_139167		13965683	13965683	-1	no_errors	ENST00000382080	ensembl	human	known	69_37n	silent	161	51.94	174	SNP	0.983	T
SYNCRIP	10492	genome.wustl.edu	37	6	86351074	86351074	+	Silent	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr6:86351074C>T	ENST00000369622.3	-	2	584	c.84G>A	c.(82-84)caG>caA	p.Q28Q	SYNCRIP_ENST00000355238.6_Silent_p.Q28Q	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	28					cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		CAAGCAATGTCTGAAAATTTT	0.358																																						dbGAP											0													90.0	88.0	89.0					6																	86351074		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.84G>A	6.37:g.86351074C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.Q28	ENST00000369622.3	37	c.84	CCDS5005.1	6																																																																																			SYNCRIP	-	NULL	ENSG00000135316		0.358	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNCRIP	HGNC	protein_coding	OTTHUMT00000041396.1	149	0.00	0	C	NM_006372		86351074	86351074	-1	no_errors	ENST00000369622	ensembl	human	known	69_37n	silent	244	35.79	136	SNP	1.000	T
TECTA	7007	genome.wustl.edu	37	11	121028626	121028626	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr11:121028626C>G	ENST00000392793.1	+	14	4653	c.4382C>G	c.(4381-4383)cCg>cGg	p.P1461R	TECTA_ENST00000264037.2_Missense_Mutation_p.P1461R			O75443	TECTA_HUMAN	tectorin alpha	1461					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CAGTGCGACCCGCGCCAATGC	0.652																																						dbGAP											0													42.0	42.0	42.0					11																	121028626		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4382C>G	11.37:g.121028626C>G	ENSP00000376543:p.Pro1461Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.P1461R	ENST00000392793.1	37	c.4382	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787158	0.90367	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.05382	3.45;3.45	5.55	5.55	0.83447	VWC out (1);	0.000000	0.85682	D	0.000000	T	0.25005	0.0607	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00203	-1.1924	10	0.34782	T	0.22	.	19.4878	0.95037	0.0:1.0:0.0:0.0	.	1461	O75443	TECTA_HUMAN	R	1461	ENSP00000376543:P1461R;ENSP00000264037:P1461R	ENSP00000264037:P1461R	P	+	2	0	TECTA	120533836	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.679000	0.68160	2.600000	0.87896	0.462000	0.41574	CCG	TECTA	-	smart_VWC_out	ENSG00000109927		0.652	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	9	0.00	0	C	NM_005422		121028626	121028626	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	missense	63	16.00	12	SNP	1.000	G
TOMM40L	84134	genome.wustl.edu	37	1	161198536	161198536	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr1:161198536C>G	ENST00000367988.3	+	9	985	c.716C>G	c.(715-717)aCa>aGa	p.T239R	TOMM40L_ENST00000545897.1_Missense_Mutation_p.T205R|MIR5187_ENST00000583479.1_RNA|NR1I3_ENST00000479324.1_5'Flank|TOMM40L_ENST00000474486.1_3'UTR|TOMM40L_ENST00000367987.1_Missense_Mutation_p.T239R	NM_032174.4	NP_115550.2	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)-like	239					ion transport (GO:0006811)|protein transport (GO:0015031)	mitochondrial outer membrane (GO:0005741)|pore complex (GO:0046930)|protein complex (GO:0043234)	porin activity (GO:0015288)			large_intestine(2)|liver(4)|lung(4)	10	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GAGGCAAACACAAGGCTACAA	0.488																																						dbGAP											0													122.0	103.0	109.0					1																	161198536		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1227.1, CCDS65700.1	1q23.3	2008-02-05	2007-01-12		ENSG00000158882	ENSG00000158882			25756	protein-coding gene	gene with protein product			"""translocase of outer mitochondrial membrane 40 homolog-like (yeast)"""				Standard	NM_032174		Approved	FLJ12770, TOMM40B	uc001fzd.3	Q969M1	OTTHUMG00000034345	ENST00000367988.3:c.716C>G	1.37:g.161198536C>G	ENSP00000356967:p.Thr239Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4U0|D3DVG9	Missense_Mutation	SNP	pfam_Porin_Euk	p.T239R	ENST00000367988.3	37	c.716	CCDS1227.1	1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.257523	0.59321	.	.	ENSG00000158882	ENST00000367988;ENST00000545897;ENST00000542686;ENST00000367987	T;T;T	0.44083	0.93;0.93;0.93	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	M	0.71206	2.165	0.40834	D	0.983619	P;P;P	0.38395	0.629;0.629;0.629	B;B;B	0.44044	0.326;0.439;0.326	T	0.19679	-1.0298	9	0.25106	T	0.35	-21.9932	17.5205	0.87786	0.0:1.0:0.0:0.0	.	205;121;239	B7Z4U0;Q9H9G4;Q969M1	.;.;TM40L_HUMAN	R	239;205;141;239	ENSP00000356967:T239R;ENSP00000443233:T205R;ENSP00000356966:T239R	ENSP00000356966:T239R	T	+	2	0	TOMM40L	159465160	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.593000	0.61034	2.802000	0.96397	0.561000	0.74099	ACA	TOMM40L	-	pfam_Porin_Euk	ENSG00000158882		0.488	TOMM40L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM40L	HGNC	protein_coding	OTTHUMT00000083029.1	59	0.00	0	C	NM_032174		161198536	161198536	+1	no_errors	ENST00000367987	ensembl	human	known	69_37n	missense	374	22.52	109	SNP	1.000	G
TOR1AIP2	163590	genome.wustl.edu	37	1	179816677	179816677	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr1:179816677C>A	ENST00000367612.3	-	5	1035	c.648G>T	c.(646-648)tgG>tgT	p.W216C	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.W216C	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						CACCATAGCTCCAAAAACCCT	0.373																																						dbGAP											0													198.0	181.0	187.0					1																	179816677		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.648G>T	1.37:g.179816677C>A	ENSP00000356584:p.Trp216Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BU2	Missense_Mutation	SNP	pfam_Lamina-ass_polypeptide_CLAP1C	p.W216C	ENST00000367612.3	37	c.648	CCDS1334.1	1	.	.	.	.	.	.	.	.	.	.	C	1.650	-0.514198	0.04200	.	.	ENSG00000169905	ENST00000367612	T	0.41400	1.0	5.43	3.51	0.40186	.	0.845105	0.10252	N	0.697068	T	0.34106	0.0886	L	0.35723	1.085	0.21147	N	0.999775	B	0.12013	0.005	B	0.15052	0.012	T	0.27971	-1.0058	10	0.54805	T	0.06	8.0883	8.8305	0.35080	0.1708:0.6649:0.1644:0.0	.	216	Q8NFQ8	TOIP2_HUMAN	C	216	ENSP00000356584:W216C	ENSP00000356584:W216C	W	-	3	0	TOR1AIP2	178083300	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.315000	0.19451	0.623000	0.30267	0.591000	0.81541	TGG	TOR1AIP2	-	pfam_Lamina-ass_polypeptide_CLAP1C	ENSG00000169905		0.373	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR1AIP2	HGNC	protein_coding	OTTHUMT00000085304.1	263	0.00	0	C	NM_145034		179816677	179816677	-1	no_errors	ENST00000367612	ensembl	human	known	69_37n	missense	913	42.40	672	SNP	0.004	A
TP53	7157	genome.wustl.edu	37	17	7579321	7579322	+	Frame_Shift_Del	DEL	CA	CA	-	rs587780067		TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr17:7579321_7579322delCA	ENST00000269305.4	-	4	554_555	c.365_366delTG	c.(364-366)gtgfs	p.V122fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.V122fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.V122fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	122	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.V122fs*26(5)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.V122fs*46(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGTGCAAGTCACAGACTTGGC	0.554		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	23	Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(2)	upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|breast(2)|stomach(1)|liver(1)|ovary(1)	GRCh37	CM065494	TP53	M																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.365_366delTG	17.37:g.7579323_7579324delCA	ENSP00000269305:p.Val122fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V122fs	ENST00000269305.4	37	c.366_365	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.554	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	11	0.00	0	CA	NM_000546		7579321	7579322	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	19	43.24	16	DEL	0.949:0.997	-
TSGA10IP	254187	genome.wustl.edu	37	11	65715545	65715545	+	RNA	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr11:65715545C>T	ENST00000532620.1	+	0	1308				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						AGGCCTATGCCTCGGGATACG	0.577																																						dbGAP											0													33.0	33.0	33.0					11																	65715545		1927	4123	6050	-	-	-			0			AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65715545C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXZ9|Q3SY01|Q96M26	RNA	SNP	-	NULL	ENST00000532620.1	37	NULL		11																																																																																			TSGA10IP	-	-	ENSG00000175513		0.577	TSGA10IP-001	KNOWN	basic	processed_transcript	TSGA10IP	HGNC	polymorphic_pseudogene	OTTHUMT00000391373.2	18	0.00	0	C	NM_152762		65715545	65715545	+1	no_errors	ENST00000532620	ensembl	human	known	69_37n	rna	68	33.98	35	SNP	0.003	T
TRPC6	7225	genome.wustl.edu	37	11	101353892	101353892	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr11:101353892C>A	ENST00000344327.3	-	5	1722	c.1298G>T	c.(1297-1299)gGg>gTg	p.G433V	TRPC6_ENST00000348423.4_Missense_Mutation_p.G317V|TRPC6_ENST00000360497.4_Missense_Mutation_p.G378V|TRPC6_ENST00000532133.1_Missense_Mutation_p.G433V	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	433					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CATTATCTTCCCCATCTGCCA	0.403																																					Colon(166;1315 1927 11094 12848 34731)	dbGAP											0													68.0	63.0	64.0					11																	101353892		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1298G>T	11.37:g.101353892C>A	ENSP00000340913:p.Gly433Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.G433V	ENST00000344327.3	37	c.1298	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273719	0.80580	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.52	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.979;1.0	D	0.85206	0.1018	10	0.59425	D	0.04	-4.8616	16.3833	0.83489	0.0:0.868:0.132:0.0	.	378;317;433	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	V	433;433;317;378	ENSP00000340913:G433V;ENSP00000435574:G433V;ENSP00000343672:G317V;ENSP00000353687:G378V	ENSP00000340913:G433V	G	-	2	0	TRPC6	100859102	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.079000	0.57613	1.310000	0.45006	0.591000	0.81541	GGG	TRPC6	-	tigrfam_TRP_channel	ENSG00000137672		0.403	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1	50	0.00	0	C	NM_004621		101353892	101353892	-1	no_errors	ENST00000344327	ensembl	human	known	69_37n	missense	158	33.47	80	SNP	1.000	A
UBN2	254048	genome.wustl.edu	37	7	138946092	138946092	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr7:138946092G>A	ENST00000473989.3	+	6	1000	c.1000G>A	c.(1000-1002)Gag>Aag	p.E334K	UBN2_ENST00000288561.8_Missense_Mutation_p.E251K	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	334	Lys-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						ATTCCAGAAAGAGAAGGATGC	0.423																																						dbGAP											0													59.0	60.0	60.0					7																	138946092		1836	4085	5921	-	-	-	SO:0001583	missense	0			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1000G>A	7.37:g.138946092G>A	ENSP00000418648:p.Glu334Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	NULL	p.E334K	ENST00000473989.3	37	c.1000	CCDS43655.2	7	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881747	0.91740	.	.	ENSG00000157741	ENST00000473989;ENST00000288561	T;T	0.23147	1.92;1.92	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.34948	0.0915	M	0.75777	2.31	0.58432	D	0.999999	P	0.38020	0.615	B	0.36186	0.219	T	0.08166	-1.0735	9	.	.	.	-16.9321	20.4561	0.99145	0.0:0.0:1.0:0.0	.	334	Q6ZU65	UBN2_HUMAN	K	334;251	ENSP00000418648:E334K;ENSP00000288561:E251K	.	E	+	1	0	UBN2	138596632	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.313000	0.96297	2.847000	0.97988	0.591000	0.81541	GAG	UBN2	-	NULL	ENSG00000157741		0.423	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	HGNC	protein_coding	OTTHUMT00000349272.3	50	0.00	0	G	NM_173569		138946092	138946092	+1	no_errors	ENST00000473989	ensembl	human	known	69_37n	missense	68	38.18	42	SNP	1.000	A
VCL	7414	genome.wustl.edu	37	10	75854054	75854054	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr10:75854054C>T	ENST00000211998.4	+	11	1472	c.1378C>T	c.(1378-1380)Cga>Tga	p.R460*	VCL_ENST00000372755.3_Nonsense_Mutation_p.R460*|VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	460	3 X 112 AA tandem repeats.|N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					TCCAGAGGCTCGAGCCTTGGC	0.522																																						dbGAP											0													38.0	42.0	40.0					10																	75854054		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1378C>T	10.37:g.75854054C>T	ENSP00000211998:p.Arg460*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Nonsense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.R460*	ENST00000211998.4	37	c.1378	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	C	34	5.327578	0.95733	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	.	.	.	5.56	5.56	0.83823	.	0.060397	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5853	0.95488	0.0:1.0:0.0:0.0	.	.	.	.	X	460;460;367;387;132	.	ENSP00000211998:R460X	R	+	1	2	VCL	75524060	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.139000	0.50577	2.630000	0.89119	0.650000	0.86243	CGA	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.522	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		16	0.00	0	C	NM_003373, NM_014000		75854054	75854054	+1	no_errors	ENST00000211998	ensembl	human	known	69_37n	nonsense	36	50.00	36	SNP	1.000	T
VIT	5212	genome.wustl.edu	37	2	36994428	36994428	+	Splice_Site	SNP	G	G	A			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr2:36994428G>A	ENST00000389975.3	+	7	981	c.679G>A	c.(679-681)Gat>Aat	p.D227N	VIT_ENST00000401530.1_Splice_Site_p.D227N|VIT_ENST00000379241.3_Splice_Site_p.D227N|VIT_ENST00000379242.3_Splice_Site_p.D227N|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000404084.1_Splice_Site_p.G205R	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	227					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CCAGGAGATGGGTCAGTAGGT	0.552																																						dbGAP											0													56.0	51.0	52.0					2																	36994428		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.679+1G>A	2.37:g.36994428G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.D227N	ENST00000389975.3	37	c.679	CCDS54347.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.58|13.58	2.279554|2.279554	0.40294|0.40294	.|.	.|.	ENSG00000205221|ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000379241;ENST00000401530|ENST00000404084	T;T;T;T|T	0.66280|0.67171	-0.18;-0.13;-0.13;-0.2|-0.25	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.980099|.	0.08308|.	N|.	0.965840|.	T|T	0.66761|0.66761	0.2822|0.2822	L|L	0.40543|0.40543	1.245|1.245	0.41952|0.41952	D|D	0.990664|0.990664	B;B;B;B|.	0.34015|.	0.089;0.13;0.201;0.435|.	B;B;B;B|.	0.27170|.	0.038;0.077;0.034;0.051|.	T|T	0.62286|0.62286	-0.6886|-0.6886	10|7	0.23302|0.24483	T|T	0.38|0.36	-0.3616|-0.3616	15.0158|15.0158	0.71584|0.71584	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	227;227;227;227|.	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4|.	.;.;VITRN_HUMAN;.|.	N|R	227|205	ENSP00000368544:D227N;ENSP00000374625:D227N;ENSP00000368543:D227N;ENSP00000385658:D227N|ENSP00000384154:G205R	ENSP00000368543:D227N|ENSP00000384154:G205R	D|G	+|+	1|1	0|0	VIT|VIT	36847932|36847932	1.000000|1.000000	0.71417|0.71417	0.959000|0.959000	0.39883|0.39883	0.379000|0.379000	0.30106|0.30106	4.619000|4.619000	0.61218|0.61218	2.602000|2.602000	0.87976|0.87976	0.650000|0.650000	0.86243|0.86243	GAT|GGA	VIT	-	NULL	ENSG00000205221		0.552	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		25	0.00	0	G		Missense_Mutation	36994428	36994428	+1	no_errors	ENST00000379242	ensembl	human	known	69_37n	missense	145	35.96	82	SNP	0.983	A
YLPM1	56252	genome.wustl.edu	37	14	75264973	75264973	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr14:75264973T>G	ENST00000325680.7	+	5	3097	c.2973T>G	c.(2971-2973)caT>caG	p.H991Q	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.H796Q	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	796	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GTCTACCCCATTCAGAAAACA	0.443																																						dbGAP											0													55.0	56.0	56.0					14																	75264973		1876	4100	5976	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.2973T>G	14.37:g.75264973T>G	ENSP00000324463:p.His991Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.H991Q	ENST00000325680.7	37	c.2973	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	T	10.04	1.242270	0.22796	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.34	1.49	0.22878	.	0.349679	0.28192	N	0.016244	T	0.21267	0.0512	N	0.16478	0.41	0.24912	N	0.992031	B	0.06786	0.001	B	0.06405	0.002	T	0.11518	-1.0584	9	0.27785	T	0.31	-4.5552	5.4108	0.16346	0.0:0.1648:0.1469:0.6883	.	991	P49750-4	.	Q	991;796;704	.	ENSP00000238571:H796Q	H	+	3	2	YLPM1	74334726	0.978000	0.34361	1.000000	0.80357	0.956000	0.61745	0.824000	0.27379	0.446000	0.26666	0.523000	0.50628	CAT	YLPM1	-	NULL	ENSG00000119596		0.443	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	34	0.00	0	T	NM_019589		75264973	75264973	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	41	48.75	39	SNP	1.000	G
ZNF157	7712	genome.wustl.edu	37	X	47272787	47272787	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chrX:47272787G>C	ENST00000377073.3	+	4	1401	c.1315G>C	c.(1315-1317)Gag>Cag	p.E439Q		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	439					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						TCACACAGGAGAGAAACCTTA	0.433																																						dbGAP											0													73.0	65.0	68.0					X																	47272787		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.1315G>C	X.37:g.47272787G>C	ENSP00000366273:p.Glu439Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LE9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E439Q	ENST00000377073.3	37	c.1315	CCDS14278.1	X	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793641	0.50102	.	.	ENSG00000147117	ENST00000377073	T	0.25912	1.77	3.37	3.37	0.38596	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26593	0.0650	L	0.31157	0.91	0.34171	D	0.669798	D	0.54601	0.967	P	0.50136	0.632	T	0.42515	-0.9447	9	0.72032	D	0.01	.	11.8906	0.52626	0.0:0.0:1.0:0.0	.	439	P51786	ZN157_HUMAN	Q	439	ENSP00000366273:E439Q	ENSP00000366273:E439Q	E	+	1	0	ZNF157	47157731	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.106000	0.77039	1.946000	0.56461	0.600000	0.82982	GAG	ZNF157	-	pfscan_Znf_C2H2	ENSG00000147117		0.433	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF157	HGNC	protein_coding	OTTHUMT00000056415.1	103	0.00	0	G	NM_003446		47272787	47272787	+1	no_errors	ENST00000377073	ensembl	human	known	69_37n	missense	59	70.65	142	SNP	1.000	C
ZNF654	55279	genome.wustl.edu	37	3	88188575	88188575	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr3:88188575C>T	ENST00000309495.5	+	1	322	c.115C>T	c.(115-117)Ctt>Ttt	p.L39F	CGGBP1_ENST00000462901.1_Intron	NM_018293.2	NP_060763.2	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	39					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(3)	12		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		AAACAGAGGACTTATGCAGAA	0.403																																						dbGAP											0													104.0	100.0	101.0					3																	88188575		1883	4117	6000	-	-	-	SO:0001583	missense	0			AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105			25612	protein-coding gene	gene with protein product							Standard	NM_018293		Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.115C>T	3.37:g.88188575C>T	ENSP00000312141:p.Leu39Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H791|Q9NV14	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L39F	ENST00000309495.5	37	c.115	CCDS46874.1	3	.	.	.	.	.	.	.	.	.	.	C	14.56	2.572068	0.45798	.	.	ENSG00000175105	ENST00000309495	T	0.54479	0.57	5.65	5.65	0.86999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.64951	0.2645	L	0.42744	1.35	0.31531	N	0.661207	D	0.89917	1.0	D	0.79784	0.993	T	0.67122	-0.5750	9	0.52906	T	0.07	.	13.6996	0.62599	0.154:0.846:0.0:0.0	.	39	Q8IZM8	ZN654_HUMAN	F	39	ENSP00000312141:L39F	ENSP00000312141:L39F	L	+	1	0	ZNF654	88271265	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.741000	0.26202	2.678000	0.91216	0.549000	0.68633	CTT	ZNF654	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175105		0.403	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF654	HGNC	protein_coding	OTTHUMT00000353285.2	104	0.00	0	C	NM_018293		88188575	88188575	+1	no_errors	ENST00000309495	ensembl	human	known	69_37n	missense	269	32.58	130	SNP	1.000	T
ZNF730	100129543	genome.wustl.edu	37	19	23329065	23329065	+	Missense_Mutation	SNP	C	C	T	rs570613743	byFrequency	TCGA-AR-A1AY-01A-21D-A12Q-09	TCGA-AR-A1AY-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15f90ef0-831b-40a3-98bd-ec226a9e8b26	1c6d0926-e635-4f26-97a6-642c012e930d	g.chr19:23329065C>T	ENST00000597761.2	+	4	1418	c.1219C>T	c.(1219-1221)Cgt>Tgt	p.R407C		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						AGCCTTTAGCCGTATCTCACA	0.373													.|||	3	0.000599042	0.0008	0.0014	5008	,	,		18808	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.1219C>T	19.37:g.23329065C>T	ENSP00000472959:p.Arg407Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R407C	ENST00000597761.2	37	c.1219	CCDS59371.1	19	.	.	.	.	.	.	.	.	.	.	C	1.357	-0.589721	0.03799	.	.	ENSG00000183850	ENST00000327867	.	.	.	0.819	0.819	0.18785	.	.	.	.	.	T	0.23014	0.0556	N	0.20845	0.615	0.09310	N	1	.	.	.	.	.	.	T	0.24261	-1.0165	6	0.33141	T	0.24	.	6.4244	0.21762	0.0:0.6898:0.3102:0.0	.	.	.	.	C	407	.	ENSP00000329365:R407C	R	+	1	0	ZNF730	23120905	0.000000	0.05858	0.011000	0.14972	0.011000	0.07611	-3.595000	0.00420	0.283000	0.22279	0.289000	0.19496	CGT	ZNF730	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000183850		0.373	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF730	HGNC	protein_coding	OTTHUMT00000465737.2	40	0.00	0	C	XM_001719792		23329065	23329065	+1	no_errors	ENST00000327867	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	0.000	T
