#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALX1	8092	genome.wustl.edu	37	12	85680747	85680747	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr12:85680747C>A	ENST00000316824.3	+	3	803	c.648C>A	c.(646-648)gaC>gaA	p.D216E		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	216					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		CAAGGACTGACAGCTACCCAC	0.378																																						dbGAP											0													129.0	116.0	121.0					12																	85680747		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.648C>A	12.37:g.85680747C>A	ENSP00000315417:p.Asp216Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q546C8|Q96FH4	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.D216E	ENST00000316824.3	37	c.648	CCDS9028.1	12	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342362	0.24339	.	.	ENSG00000180318	ENST00000316824	D	0.92545	-3.06	5.78	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.86435	0.5932	L	0.31294	0.92	0.52501	D	0.999955	B	0.18610	0.029	B	0.24974	0.057	T	0.80808	-0.1217	10	0.22706	T	0.39	.	11.7474	0.51828	0.0:0.8585:0.0:0.1415	.	216	Q15699	ALX1_HUMAN	E	216	ENSP00000315417:D216E	ENSP00000315417:D216E	D	+	3	2	ALX1	84204878	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.675000	0.37555	1.421000	0.47157	0.650000	0.86243	GAC	ALX1	-	NULL	ENSG00000180318		0.378	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX1	HGNC	protein_coding	OTTHUMT00000406072.1	45	0.00	0	C	NM_006982		85680747	85680747	+1	no_errors	ENST00000316824	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	1.000	A
APOB	338	genome.wustl.edu	37	2	21245741	21245741	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr2:21245741A>C	ENST00000233242.1	-	18	2905	c.2778T>G	c.(2776-2778)atT>atG	p.I926M		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	926	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGGGAAGGAATGATAAACT	0.498																																						dbGAP											0													69.0	62.0	65.0					2																	21245741		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2778T>G	2.37:g.21245741A>C	ENSP00000233242:p.Ile926Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.I926M	ENST00000233242.1	37	c.2778	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	A	16.52	3.146241	0.57044	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.18960	2.18	5.61	-3.06	0.05379	Lipid transport protein, beta-sheet shell (1);Vitellinogen, open beta-sheet (1);Vitellinogen, open beta-sheet, subdomain 2 (1);	0.422713	0.21682	N	0.070702	T	0.29882	0.0747	M	0.69248	2.105	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	T	0.38735	-0.9647	10	0.87932	D	0	.	0.9615	0.01397	0.4194:0.1121:0.251:0.2175	.	926	P04114	APOB_HUMAN	M	926	ENSP00000233242:I926M	ENSP00000233242:I926M	I	-	3	3	APOB	21099246	0.273000	0.24181	0.063000	0.19743	0.609000	0.37215	-0.228000	0.09114	-0.101000	0.12219	0.533000	0.62120	ATT	APOB	-	pfam_Vitellinogen_open_b-sht,superfamily_Lipid_transp_b-sht_shell	ENSG00000084674		0.498	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	44	0.00	0	A			21245741	21245741	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	0.875	C
CCDC78	124093	genome.wustl.edu	37	16	775286	775286	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr16:775286G>A	ENST00000293889.6	-	5	548	c.443C>T	c.(442-444)cCc>cTc	p.P148L	HAGHL_ENST00000389703.3_5'Flank|HAGHL_ENST00000564537.1_5'Flank|HAGHL_ENST00000341413.4_5'Flank|HAGHL_ENST00000564545.1_5'Flank|HAGHL_ENST00000549114.1_5'Flank|HAGHL_ENST00000561546.1_5'Flank	NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	148					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				GGTGTTCTTGGGCTGCACCTG	0.632																																						dbGAP											0													68.0	78.0	74.0					16																	775286		2195	4294	6489	-	-	-	SO:0001583	missense	0			BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.443C>T	16.37:g.775286G>A	ENSP00000293889:p.Pro148Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Missense_Mutation	SNP	NULL	p.P148L	ENST00000293889.6	37	c.443	CCDS32353.1	16	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453262	0.43531	.	.	ENSG00000162004	ENST00000293889	T	0.49139	0.79	3.4	2.44	0.29823	.	0.499327	0.18022	N	0.154218	T	0.53029	0.1771	L	0.52573	1.65	0.09310	N	0.999995	P;P;P;D;D	0.67145	0.933;0.933;0.933;0.961;0.996	P;P;P;P;P	0.57620	0.585;0.585;0.585;0.585;0.824	T	0.39722	-0.9600	10	0.66056	D	0.02	-2.4614	8.9093	0.35543	0.0:0.2287:0.7713:0.0	.	148;137;148;222;148	A2IDD5-4;A2IDD5-6;A2IDD5-3;A2IDD5-5;A2IDD5	.;.;.;.;CCD78_HUMAN	L	148	ENSP00000293889:P148L	ENSP00000293889:P148L	P	-	2	0	CCDC78	715287	0.000000	0.05858	0.013000	0.15412	0.005000	0.04900	-0.400000	0.07241	1.033000	0.39918	-0.666000	0.03841	CCC	CCDC78	-	NULL	ENSG00000162004		0.632	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC78	HGNC	protein_coding	OTTHUMT00000241665.3	32	0.00	0	G	NM_173476		775286	775286	-1	no_errors	ENST00000293889	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	0.013	A
CCDC80	151887	genome.wustl.edu	37	3	112357487	112357487	+	Silent	SNP	C	C	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr3:112357487C>T	ENST00000206423.3	-	2	2219	c.1266G>A	c.(1264-1266)caG>caA	p.Q422Q	CCDC80_ENST00000439685.2_Silent_p.Q422Q|CCDC80_ENST00000475181.1_5'Flank	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	422					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						TCTCCCTGTGCTGATCCTTCC	0.592																																						dbGAP											0													70.0	68.0	69.0					3																	112357487		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1266G>A	3.37:g.112357487C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Silent	SNP	NULL	p.Q422	ENST00000206423.3	37	c.1266	CCDS2968.1	3																																																																																			CCDC80	-	NULL	ENSG00000091986		0.592	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	79	0.00	0	C	NM_199511		112357487	112357487	-1	no_errors	ENST00000206423	ensembl	human	known	69_37n	silent	53	27.40	20	SNP	0.320	T
CD53	963	genome.wustl.edu	37	1	111435055	111435055	+	Missense_Mutation	SNP	C	C	G	rs200779902		TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr1:111435055C>G	ENST00000271324.5	+	3	264	c.152C>G	c.(151-153)aCg>aGg	p.T51R	CD53_ENST00000429072.2_Missense_Mutation_p.T51R	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule	51					positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		CCCTCCCTCACGCTGGGCAAT	0.502																																						dbGAP											0													207.0	183.0	191.0					1																	111435055		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.152C>G	1.37:g.111435055C>G	ENSP00000271324:p.Thr51Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R905|Q5U0D6	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T51R	ENST00000271324.5	37	c.152	CCDS829.1	1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595944	0.66332	.	.	ENSG00000143119	ENST00000429072;ENST00000271324	T;T	0.79653	-1.29;-1.29	5.93	5.93	0.95920	.	0.088398	0.42172	U	0.000752	T	0.80798	0.4692	N	0.24115	0.695	0.50467	D	0.999878	D;D	0.76494	0.999;0.998	D;D	0.72338	0.977;0.969	T	0.82829	-0.0264	10	0.59425	D	0.04	.	17.8477	0.88736	0.0:1.0:0.0:0.0	.	51;51	B4DQB5;P19397	.;CD53_HUMAN	R	51	ENSP00000412250:T51R;ENSP00000271324:T51R	ENSP00000271324:T51R	T	+	2	0	CD53	111236578	1.000000	0.71417	0.963000	0.40424	0.863000	0.49368	5.638000	0.67861	2.826000	0.97356	0.655000	0.94253	ACG	CD53	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000143119		0.502	CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD53	HGNC	protein_coding	OTTHUMT00000032931.1	131	0.00	0	C	NM_000560		111435055	111435055	+1	no_errors	ENST00000271324	ensembl	human	known	69_37n	missense	97	32.64	47	SNP	0.999	G
CD5L	922	genome.wustl.edu	37	1	157805923	157805923	+	Silent	SNP	C	C	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr1:157805923C>A	ENST00000368174.4	-	3	174	c.78G>T	c.(76-78)ctG>ctT	p.L26L	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	26	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGCCCCCCACCAGCCGCACTC	0.607																																						dbGAP											0													38.0	42.0	41.0					1																	157805923		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.78G>T	1.37:g.157805923C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7M5|Q6UX63	Silent	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.L26	ENST00000368174.4	37	c.78	CCDS1171.1	1																																																																																			CD5L	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	ENSG00000073754		0.607	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5L	HGNC	protein_coding	OTTHUMT00000058346.1	48	0.00	0	C	NM_005894		157805923	157805923	-1	no_errors	ENST00000368174	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	0.999	A
CD72	971	genome.wustl.edu	37	9	35612972	35612972	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr9:35612972C>G	ENST00000396757.1	-	7	871	c.707G>C	c.(706-708)gGa>gCa	p.G236A	CD72_ENST00000490239.1_5'UTR|CD72_ENST00000259633.4_Missense_Mutation_p.G236A			P21854	CD72_HUMAN	CD72 molecule	236	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CATTATCCATCCCGACGGACA	0.428																																						dbGAP											0													150.0	134.0	140.0					9																	35612972		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.707G>C	9.37:g.35612972C>G	ENSP00000379980:p.Gly236Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G236A	ENST00000396757.1	37	c.707	CCDS6581.1	9	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308103	0.60305	.	.	ENSG00000137101	ENST00000396757;ENST00000396759;ENST00000259633	T;T	0.25579	1.79;1.79	5.54	4.6	0.57074	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.106561	0.41396	D	0.000884	T	0.44159	0.1280	M	0.65498	2.005	0.41010	D	0.984998	D;D	0.63880	0.993;0.993	P;P	0.59825	0.864;0.864	T	0.43829	-0.9367	10	0.72032	D	0.01	-15.5317	13.5199	0.61561	0.0:0.8445:0.1555:0.0	.	236;236	Q5TLG3;P21854	.;CD72_HUMAN	A	236	ENSP00000379980:G236A;ENSP00000259633:G236A	ENSP00000259633:G236A	G	-	2	0	CD72	35602972	0.991000	0.36638	0.990000	0.47175	0.005000	0.04900	2.395000	0.44459	2.606000	0.88127	0.655000	0.94253	GGA	CD72	-	superfamily_C-type_lectin_fold,smart_C-type_lectin	ENSG00000137101		0.428	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD72	HGNC	protein_coding	OTTHUMT00000052336.1	101	0.00	0	C	NM_001782		35612972	35612972	-1	no_errors	ENST00000259633	ensembl	human	known	69_37n	missense	82	23.36	25	SNP	0.998	G
CDC27	996	genome.wustl.edu	37	17	45219311	45219311	+	Missense_Mutation	SNP	T	T	C	rs140737545		TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr17:45219311T>C	ENST00000066544.3	-	12	1552	c.1459A>G	c.(1459-1461)Att>Gtt	p.I487V	CDC27_ENST00000531206.1_Missense_Mutation_p.I493V|CDC27_ENST00000446365.2_Missense_Mutation_p.I426V|CDC27_ENST00000527547.1_Missense_Mutation_p.I486V	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	487					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGCTCAAAATATTTATAGCT	0.383																																						dbGAP											0													112.0	118.0	116.0					17																	45219311		2203	4299	6502	-	-	-	SO:0001583	missense	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1459A>G	17.37:g.45219311T>C	ENSP00000066544:p.Ile487Val	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I493V	ENST00000066544.3	37	c.1477	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	T	4.731	0.135890	0.09032	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.92	3.6	0.41247	.	0.089833	0.85682	D	0.000000	T	0.53384	0.1793	L	0.31476	0.935	0.49798	D	0.999821	B;B;B;B	0.23316	0.05;0.083;0.083;0.024	B;B;B;B	0.17098	0.008;0.017;0.017;0.005	T	0.44590	-0.9318	10	0.02654	T	1	-23.2923	6.9274	0.24422	0.0:0.0792:0.1504:0.7704	.	426;486;493;487	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	V	487;493;426;486	ENSP00000066544:I487V;ENSP00000434614:I493V;ENSP00000392802:I426V;ENSP00000437339:I486V	ENSP00000066544:I487V	I	-	1	0	CDC27	42574310	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.907000	0.63300	1.072000	0.40860	0.528000	0.53228	ATT	CDC27	-	NULL	ENSG00000004897		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	20	0.00	0	T			45219311	45219311	-1	no_errors	ENST00000531206	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	C
CHRNB4	1143	genome.wustl.edu	37	15	78927917	78927917	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr15:78927917A>G	ENST00000261751.3	-	2	179	c.68T>C	c.(67-69)gTg>gCg	p.V23A	CHRNB4_ENST00000560511.1_5'UTR|CHRNB4_ENST00000412074.2_Missense_Mutation_p.V23A	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	23					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	CGCATTGGCCACGCGGCAGTT	0.587																																						dbGAP											0													258.0	243.0	248.0					15																	78927917		2196	4293	6489	-	-	-	SO:0001583	missense	0			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.68T>C	15.37:g.78927917A>G	ENSP00000261751:p.Val23Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V23A	ENST00000261751.3	37	c.68	CCDS10306.1	15	.	.	.	.	.	.	.	.	.	.	A	0.321	-0.961717	0.02249	.	.	ENSG00000117971	ENST00000261751;ENST00000412074	T;T	0.76709	-1.04;-0.84	3.98	2.74	0.32292	.	1.274940	0.05259	N	0.515430	T	0.44912	0.1316	N	0.01482	-0.84	0.09310	N	0.999999	B;B	0.18013	0.025;0.0	B;B	0.10450	0.005;0.0	T	0.56232	-0.8013	10	0.02654	T	1	.	1.7493	0.02969	0.48:0.0:0.2624:0.2577	.	23;23	E9PHE8;P30926	.;ACHB4_HUMAN	A	23	ENSP00000261751:V23A;ENSP00000416386:V23A	ENSP00000261751:V23A	V	-	2	0	CHRNB4	76714972	0.166000	0.22962	0.924000	0.36721	0.790000	0.44656	0.846000	0.27682	1.466000	0.48025	0.353000	0.21931	GTG	CHRNB4	-	tigrfam_Neur_channel	ENSG00000117971		0.587	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	HGNC	protein_coding	OTTHUMT00000290108.1	187	0.00	0	A			78927917	78927917	-1	no_errors	ENST00000261751	ensembl	human	known	69_37n	missense	114	25.49	39	SNP	0.542	G
CNPY3	10695	genome.wustl.edu	37	6	42897358	42897360	+	In_Frame_Del	DEL	TGC	TGC	-	rs570105218	byFrequency	TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr6:42897358_42897360delTGC	ENST00000372836.4	+	1	421_423	c.50_52delTGC	c.(49-54)ttgctg>ttg	p.17_18LL>L	CNPY3_ENST00000394142.3_In_Frame_Del_p.17_18LL>L	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CTTCTTCCCTtgctgctgctgct	0.695																																						dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.50_52delTGC	6.37:g.42897367_42897369delTGC	ENSP00000361926:p.Leu25del	Somatic		WXS	Illumina GAIIx	Phase_IV	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Del	DEL	pfam_DUF3456	p.L21in_frame_del	ENST00000372836.4	37	c.50_52	CCDS4875.1	6																																																																																			CNPY3	-	NULL	ENSG00000137161		0.695	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY3	HGNC	protein_coding	OTTHUMT00000040564.1	10	0.00	0	TGC	NM_006586		42897358	42897360	+1	no_errors	ENST00000372836	ensembl	human	known	69_37n	in_frame_del	15	21.05	4	DEL	0.122:0.131:0.153	-
CSPG4	1464	genome.wustl.edu	37	15	75982085	75982085	+	Missense_Mutation	SNP	C	C	T	rs79463888	byFrequency	TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr15:75982085C>T	ENST00000308508.5	-	3	1413	c.1321G>A	c.(1321-1323)Gag>Aag	p.E441K		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	441	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GTGCCCCCCTCGGCCACCACC	0.637																																						dbGAP											0													43.0	42.0	43.0					15																	75982085		2197	4292	6489	-	-	-	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1321G>A	15.37:g.75982085C>T	ENSP00000312506:p.Glu441Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.E441K	ENST00000308508.5	37	c.1321	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	18.26	3.584924	0.65992	.	.	ENSG00000173546	ENST00000308508	T	0.31510	1.49	5.26	5.26	0.73747	.	0.170667	0.41001	D	0.000974	T	0.48642	0.1511	M	0.78049	2.395	0.80722	D	1	D	0.71674	0.998	P	0.56278	0.795	T	0.52041	-0.8628	10	0.59425	D	0.04	.	11.3564	0.49617	0.0:0.9168:0.0:0.0831	.	441	Q6UVK1	CSPG4_HUMAN	K	441	ENSP00000312506:E441K	ENSP00000312506:E441K	E	-	1	0	CSPG4	73769140	1.000000	0.71417	0.998000	0.56505	0.513000	0.34164	4.634000	0.61325	2.463000	0.83235	0.555000	0.69702	GAG	CSPG4	-	NULL	ENSG00000173546		0.637	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	14	0.00	0	C	NM_001897		75982085	75982085	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.996	T
DCAF6	55827	genome.wustl.edu	37	1	168044671	168044671	+	Nonstop_Mutation	SNP	T	T	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr1:168044671T>A	ENST00000312263.6	+	19	2785	c.2581T>A	c.(2581-2583)Taa>Aaa	p.*861K	DCAF6_ENST00000367840.3_Nonstop_Mutation_p.*952K|DCAF6_ENST00000367843.3_Nonstop_Mutation_p.*881K|DCAF6_ENST00000432587.2_Nonstop_Mutation_p.*921K	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	0					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						GGATGAGGAATAATAAACTCT	0.338																																						dbGAP											0													69.0	70.0	70.0					1																	168044671		2203	4299	6502	-	-	-	SO:0001578	stop_lost	0			AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.2581T>A	1.37:g.168044671T>A	ENSP00000311949:p.*861Lysext*1	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Nonstop_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_IQ_motif_EF-hand-BS,pfscan_WD40_repeat_dom	p.*952K	ENST00000312263.6	37	c.2854	CCDS30933.1	1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417538	0.62622	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	.	.	.	6.17	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2423	0.54549	0.0:0.0658:0.0:0.9342	.	.	.	.	K	881;921;861;952	.	.	X	+	1	0	DCAF6	166311295	1.000000	0.71417	0.921000	0.36526	0.977000	0.68977	4.164000	0.58190	1.151000	0.42436	0.533000	0.62120	TAA	DCAF6	-	NULL	ENSG00000143164		0.338	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCAF6	HGNC	protein_coding	OTTHUMT00000083661.2	74	0.00	0	T	NM_018442		168044671	168044671	+1	no_errors	ENST00000367840	ensembl	human	known	69_37n	nonstop	124	28.81	51	SNP	0.355	A
DYNC2H1	79659	genome.wustl.edu	37	11	103116068	103116069	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr11:103116068_103116069delTT	ENST00000375735.2	+	65	10151_10152	c.10007_10008delTT	c.(10006-10008)cttfs	p.L3336fs	DYNC2H1_ENST00000398093.3_Frame_Shift_Del_p.L3343fs|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3336	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GAACCTGTTCTTTATCCATTAT	0.322																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10007_10008delTT	11.37:g.103116068_103116069delTT	ENSP00000364887:p.Leu3336fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Frame_Shift_Del	DEL	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Y3344fs	ENST00000375735.2	37	c.10028_10029	CCDS53701.1	11																																																																																			DYNC2H1	-	NULL	ENSG00000187240		0.322	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	53	0.00	0	TT	XM_370652		103116068	103116069	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	frame_shift_del	57	10.94	7	DEL	1.000:0.983	-
DYNC2H1	79659	genome.wustl.edu	37	11	103116072	103116073	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr11:103116072_103116073delTC	ENST00000375735.2	+	65	10155_10156	c.10011_10012delTC	c.(10009-10014)tatccafs	p.P3338fs	DYNC2H1_ENST00000398093.3_Frame_Shift_Del_p.P3345fs|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3338	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTGTTCTTTATCCATTATTGAG	0.337																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10011_10012delTC	11.37:g.103116072_103116073delTC	ENSP00000364887:p.Pro3338fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Frame_Shift_Del	DEL	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.P3345fs	ENST00000375735.2	37	c.10032_10033	CCDS53701.1	11																																																																																			DYNC2H1	-	NULL	ENSG00000187240		0.337	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	52	0.00	0	TC	XM_370652		103116072	103116073	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	frame_shift_del	56	11.11	7	DEL	1.000:1.000	-
ETV5	2119	genome.wustl.edu	37	3	185783746	185783746	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr3:185783746G>A	ENST00000306376.5	-	8	1012	c.766C>T	c.(766-768)Ccc>Tcc	p.P256S	ETV5_ENST00000537818.1_Missense_Mutation_p.P298S|ETV5_ENST00000434744.1_Missense_Mutation_p.P256S|ETV5_ENST00000480706.1_5'Flank	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	256					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GGGGGCGGGGGAGCTGCAGGG	0.592			T	"""TMPRSS2, SCL45A3"""	Prostate																																	dbGAP		Dom	yes		3	3q28	2119	ets variant gene 5		E	0													60.0	68.0	65.0					3																	185783746		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.766C>T	3.37:g.185783746G>A	ENSP00000306894:p.Pro256Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.P298S	ENST00000306376.5	37	c.892	CCDS33906.1	3	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226826	0.39399	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.09163	3.03;3.03;3.01	6.17	6.17	0.99709	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.116322	0.64402	D	0.000013	T	0.09555	0.0235	L	0.44542	1.39	0.40709	D	0.982556	B;P	0.34892	0.336;0.474	B;B	0.39617	0.225;0.305	T	0.08911	-1.0699	10	0.02654	T	1	.	8.4192	0.32690	0.076:0.0:0.7689:0.1551	.	256;298	P41161;B7Z7D7	ETV5_HUMAN;.	S	256;256;298	ENSP00000306894:P256S;ENSP00000413755:P256S;ENSP00000441737:P298S	ENSP00000306894:P256S	P	-	1	0	ETV5	187266440	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.427000	0.52785	2.941000	0.99782	0.655000	0.94253	CCC	ETV5	-	pfam_ETS_PEA3_N	ENSG00000244405		0.592	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV5	HGNC	protein_coding	OTTHUMT00000344947.1	46	0.00	0	G	NM_004454		185783746	185783746	-1	no_errors	ENST00000537818	ensembl	human	known	69_37n	missense	69	25.00	23	SNP	1.000	A
FAM111B	374393	genome.wustl.edu	37	11	58892377	58892377	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr11:58892377delA	ENST00000343597.3	+	4	998	c.807delA	c.(805-807)tcafs	p.S269fs	FAM111B_ENST00000529618.1_Frame_Shift_Del_p.S239fs|FAM111B_ENST00000411426.1_Frame_Shift_Del_p.S239fs	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	269							catalytic activity (GO:0003824)	p.A273fs*9(1)|p.K272delK(1)|p.A273fs*26(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TGGACATTTCAAAAAAAAAAG	0.313																																						dbGAP											3	Deletion - Frameshift(1)|Deletion - In frame(1)|Insertion - Frameshift(1)	kidney(2)|ovary(1)																																								-	-	-	SO:0001589	frameshift_variant	0			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.807delA	11.37:g.58892377delA	ENSP00000341565:p.Ser269fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2G2|Q6P661	Frame_Shift_Del	DEL	superfamily_Pept_cys/ser_Trypsin-like	p.K272fs	ENST00000343597.3	37	c.807	CCDS7972.1	11																																																																																			FAM111B	-	NULL	ENSG00000189057		0.313	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM111B	HGNC	protein_coding	OTTHUMT00000393974.1	22	0.00	0	A	NM_198947		58892377	58892377	+1	no_errors	ENST00000343597	ensembl	human	known	69_37n	frame_shift_del	28	12.50	4	DEL	0.000	-
FGA	2243	genome.wustl.edu	37	4	155507138	155507138	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr4:155507138T>G	ENST00000302053.3	-	5	1521	c.1443A>C	c.(1441-1443)gaA>gaC	p.E481D	FGA_ENST00000403106.3_Missense_Mutation_p.E481D	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	481					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AGGTCACCACTTCTTTGGTAA	0.502																																					NSCLC(143;340 1922 20892 22370 48145)	dbGAP											0													167.0	164.0	165.0					4																	155507138		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1443A>C	4.37:g.155507138T>G	ENSP00000306361:p.Glu481Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,pfam_Fibrinogen_aC,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E481D	ENST00000302053.3	37	c.1443	CCDS3787.1	4	.	.	.	.	.	.	.	.	.	.	T	17.66	3.445180	0.63178	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.76839	-1.05;-1.05	5.99	2.27	0.28462	Fibrinogen alpha C domain (1);	6.610440	0.00166	N	0.000000	D	0.88343	0.6411	M	0.73962	2.25	0.28055	N	0.933229	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.64305	-0.6439	10	0.87932	D	0	.	8.987	0.35999	0.0:0.2785:0.0:0.7215	.	481;481	P02671-2;P02671	.;FIBA_HUMAN	D	481	ENSP00000306361:E481D;ENSP00000385981:E481D	ENSP00000306361:E481D	E	-	3	2	FGA	155726588	0.998000	0.40836	0.987000	0.45799	0.395000	0.30598	0.328000	0.19681	0.174000	0.19809	0.533000	0.62120	GAA	FGA	-	pfam_Fibrinogen_aC	ENSG00000171560		0.502	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	HGNC	protein_coding	OTTHUMT00000317593.1	69	0.00	0	T	NM_000508		155507138	155507138	-1	no_errors	ENST00000302053	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	0.995	G
GOLGA6L2	283685	genome.wustl.edu	37	15	23685218	23685220	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr15:23685218_23685220delCTC	ENST00000567107.1	-	8	2454_2456	c.2402_2404delGAG	c.(2401-2406)ggagaa>gaa	p.G801del	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						cccgcatcttctcctcctgctcc	0.591																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2402_2404delGAG	15.37:g.23685221_23685223delCTC	ENSP00000454407:p.Gly801del	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	In_Frame_Del	DEL	NULL	p.G801in_frame_del	ENST00000567107.1	37	c.2404_2402		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.591	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	34	0.00	0	CTC	NM_182561		23685218	23685220	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	in_frame_del	45	11.76	6	DEL	0.015:0.016:0.021	-
HAPLN3	145864	genome.wustl.edu	37	15	89424727	89424727	+	Silent	SNP	G	G	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr15:89424727G>A	ENST00000359595.3	-	3	568	c.354C>T	c.(352-354)cgC>cgT	p.R118R	HAPLN3_ENST00000562889.1_Silent_p.R180R	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	118	Ig-like V-type. {ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	GCAGGTGCACGCGGCCTTGGT	0.627																																						dbGAP											0													101.0	78.0	86.0					15																	89424727		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.354C>T	15.37:g.89424727G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P0	Silent	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,prints_Link,pfscan_Link,pfscan_Ig-like	p.R118	ENST00000359595.3	37	c.354	CCDS10346.1	15																																																																																			HAPLN3	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000140511		0.627	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN3	HGNC	protein_coding	OTTHUMT00000309070.1	22	0.00	0	G	NM_178232		89424727	89424727	-1	no_errors	ENST00000359595	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	0.551	A
HLA-B	3106	genome.wustl.edu	37	6	31323974	31323974	+	Missense_Mutation	SNP	C	C	T	rs41545114		TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr6:31323974C>T	ENST00000412585.2	-	3	617	c.589G>A	c.(589-591)Gag>Aag	p.E197K		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	197	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TTCCCGTTCTCCAGGTATCTG	0.672									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																													dbGAP											0													19.0	19.0	19.0					6																	31323974		2128	4141	6269	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.589G>A	6.37:g.31323974C>T	ENSP00000399168:p.Glu197Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q29764	Nonsense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	p.W197*	ENST00000412585.2	37	c.591	CCDS34394.1	6	.	.	.	.	.	.	.	.	.	.	N	12.16	1.853263	0.32699	.	.	ENSG00000234745	ENST00000412585;ENST00000428231;ENST00000452596;ENST00000434333	T;T	0.00864	5.6;5.6	3.18	1.3	0.21679	MHC class I, alpha chain, alpha1/alpha2 (4);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	0.866418	0.09417	U	0.805050	T	0.03305	0.0096	H	0.95260	3.645	0.28841	N	0.896629	D;P	0.64830	0.994;0.632	D;B	0.75020	0.985;0.417	T	0.12016	-1.0564	10	0.72032	D	0.01	.	7.4791	0.27393	0.0:0.7684:0.0:0.2316	rs41545114	197;197	P30480;P01889	1B42_HUMAN;1B07_HUMAN	K	197;76;76;208	ENSP00000399168:E197K;ENSP00000405931:E208K	ENSP00000399168:E197K	E	-	1	0	HLA-B	31431953	0.086000	0.21541	0.525000	0.27900	0.024000	0.10985	0.314000	0.19432	0.183000	0.20059	0.297000	0.19635	GAG	HLA-B	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	ENSG00000234745		0.672	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	21	0.00	0	C	NM_005514		31323974	31323974	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426590	ensembl	human	known	69_37n	nonsense	12	25.00	4	SNP	0.903	T
HLA-B	3106	genome.wustl.edu	37	6	31324104	31324104	+	Silent	SNP	G	G	A	rs281864624		TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr6:31324104G>A	ENST00000412585.2	-	3	487	c.459C>T	c.(457-459)gaC>gaT	p.D153D		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	153	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						AGGAGCGCAGGTCCTCGTTCA	0.701									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																													dbGAP											0													31.0	22.0	25.0					6																	31324104		2114	4208	6322	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.459C>T	6.37:g.31324104G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q29764	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	p.T154I	ENST00000412585.2	37	c.461	CCDS34394.1	6																																																																																			HLA-B	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	ENSG00000234745		0.701	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	12	0.00	0	G	NM_005514		31324104	31324104	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426590	ensembl	human	known	69_37n	missense	6	33.33	3	SNP	0.113	A
KIAA1210	57481	genome.wustl.edu	37	X	118221786	118221786	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chrX:118221786G>T	ENST00000402510.2	-	11	3406	c.3407C>A	c.(3406-3408)tCc>tAc	p.S1136Y		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1136										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GAAATTTGAGGACAGTTGCTG	0.468																																						dbGAP											0													89.0	83.0	85.0					X																	118221786		1870	4090	5960	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3407C>A	X.37:g.118221786G>T	ENSP00000384670:p.Ser1136Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.S1136Y	ENST00000402510.2	37	c.3407	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080575	0.36662	.	.	ENSG00000250423	ENST00000402510	T	0.11385	2.78	4.34	1.64	0.23874	.	.	.	.	.	T	0.13884	0.0336	L	0.32530	0.975	0.09310	N	1	D	0.58268	0.982	P	0.55260	0.772	T	0.14980	-1.0453	9	0.59425	D	0.04	.	5.8582	0.18732	0.3463:0.0:0.6537:0.0	.	1136	Q9ULL0	K1210_HUMAN	Y	1136	ENSP00000384670:S1136Y	ENSP00000384670:S1136Y	S	-	2	0	RP13-347D8.6	118105814	0.003000	0.15002	0.000000	0.03702	0.037000	0.13140	1.437000	0.34991	0.213000	0.20722	0.600000	0.82982	TCC	KIAA1210	-	NULL	ENSG00000250423		0.468	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	47	0.00	0	G	NM_020721		118221786	118221786	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.000	T
KNDC1	85442	genome.wustl.edu	37	10	135020480	135020480	+	Intron	SNP	T	T	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr10:135020480T>A	ENST00000304613.3	+	19	3600				KNDC1_ENST00000368572.2_Intron|KNDC1_ENST00000368571.2_Missense_Mutation_p.L1136H			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1						cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGGGCCCCGCTCTGCCCCGTG	0.542																																						dbGAP											0													42.0	45.0	44.0					10																	135020480		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3579+23T>A	10.37:g.135020480T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	superfamily_Kinase-like_dom,smart_KIND	p.L1136H	ENST00000304613.3	37	c.3407	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	T	10.17	1.276432	0.23307	.	.	ENSG00000171798	ENST00000368571	T	0.20332	2.08	3.02	-1.26	0.09376	.	.	.	.	.	T	0.23210	0.0561	.	.	.	0.09310	N	1	P	0.43352	0.804	P	0.50192	0.634	T	0.20075	-1.0286	7	.	.	.	.	5.649	0.17606	0.0:0.3499:0.0:0.6501	.	1136	Q76NI1-2	.	H	1136	ENSP00000357560:L1136H	.	L	+	2	0	KNDC1	134870470	.	.	0.000000	0.03702	0.003000	0.03518	.	.	-0.041000	0.13558	-0.537000	0.04273	CTC	KNDC1	-	NULL	ENSG00000171798		0.542	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	40	0.00	0	T	NM_152643		135020480	135020480	+1	no_errors	ENST00000368571	ensembl	human	putative	69_37n	missense	39	17.02	8	SNP	0.000	A
LAMP5	24141	genome.wustl.edu	37	20	9498735	9498735	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr20:9498735C>G	ENST00000246070.2	+	5	1016	c.524C>G	c.(523-525)cCc>cGc	p.P175R	LAMP5_ENST00000427562.2_Missense_Mutation_p.P131R	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	175						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											TTGGTCACCCCCGCTGGGAAG	0.532																																						dbGAP											0													113.0	89.0	97.0					20																	9498735		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.524C>G	20.37:g.9498735C>G	ENSP00000246070:p.Pro175Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	pfam_Lysosome-assoc_membr_glycop	p.P175R	ENST00000246070.2	37	c.524	CCDS13106.1	20	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751437	0.89753	.	.	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.35048	1.33;1.33	5.93	5.93	0.95920	.	0.099859	0.64402	D	0.000001	T	0.49762	0.1576	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.986	T	0.31641	-0.9936	9	.	.	.	-11.1971	20.3539	0.98825	0.0:1.0:0.0:0.0	.	131;175	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	R	175;131	ENSP00000246070:P175R;ENSP00000406360:P131R	.	P	+	2	0	C20orf103	9446735	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.361000	0.79497	2.826000	0.97356	0.655000	0.94253	CCC	LAMP5	-	pfam_Lysosome-assoc_membr_glycop	ENSG00000125869		0.532	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP5	HGNC	protein_coding	OTTHUMT00000077946.2	54	0.00	0	C	NM_012261		9498735	9498735	+1	no_errors	ENST00000246070	ensembl	human	known	69_37n	missense	27	37.21	16	SNP	1.000	G
MED24	9862	genome.wustl.edu	37	17	38176104	38176104	+	Silent	SNP	C	C	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr17:38176104C>T	ENST00000394128.2	-	25	2868	c.2787G>A	c.(2785-2787)gaG>gaA	p.E929E	MED24_ENST00000501516.3_Silent_p.E948E|MED24_ENST00000394127.2_Silent_p.E916E|MED24_ENST00000394126.1_Silent_p.E954E|MED24_ENST00000356271.3_Silent_p.E916E	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	929					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CCACACACTCCTCCATGAACC	0.637																																						dbGAP											0													38.0	32.0	34.0					17																	38176104		2196	4299	6495	-	-	-	SO:0001819	synonymous_variant	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2787G>A	17.37:g.38176104C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	pfam_Mediator_Med24_N	p.E929	ENST00000394128.2	37	c.2787	CCDS11359.1	17	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316584	0.23908	.	.	ENSG00000008838	ENST00000422942	.	.	.	5.05	2.03	0.26663	.	.	.	.	.	T	0.58680	0.2139	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52208	-0.8606	4	.	.	.	-29.5944	10.029	0.42090	0.0:0.7847:0.0:0.2153	.	.	.	.	R	227	.	.	G	-	1	0	MED24	35429630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.476000	0.35420	0.319000	0.23209	0.650000	0.86243	GGA	MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.637	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	33	0.00	0	C	NM_014815		38176104	38176104	-1	no_errors	ENST00000394128	ensembl	human	known	69_37n	silent	24	52.94	27	SNP	1.000	T
MN1	4330	genome.wustl.edu	37	22	28195783	28195783	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr22:28195783G>C	ENST00000302326.4	-	1	1703	c.749C>G	c.(748-750)tCt>tGt	p.S250C		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	250					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						TTCGGAGTCAGAGGGCGAAAA	0.647			T	ETV6	"""AML, meningioma"""																																	dbGAP		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0													11.0	12.0	12.0					22																	28195783		2010	4174	6184	-	-	-	SO:0001583	missense	0			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.749C>G	22.37:g.28195783G>C	ENSP00000304956:p.Ser250Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1V9	Missense_Mutation	SNP	NULL	p.S250C	ENST00000302326.4	37	c.749	CCDS42998.1	22	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434565	0.62955	.	.	ENSG00000169184	ENST00000302326	T	0.67523	-0.27	5.19	4.15	0.48705	.	1.165770	0.06160	N	0.675864	T	0.67429	0.2892	N	0.24115	0.695	0.41698	D	0.989387	P	0.51791	0.948	P	0.51355	0.667	T	0.59182	-0.7502	10	0.72032	D	0.01	0.3963	14.3094	0.66405	0.0:0.0:0.8505:0.1495	.	250	Q10571	MN1_HUMAN	C	250	ENSP00000304956:S250C	ENSP00000304956:S250C	S	-	2	0	MN1	26525783	1.000000	0.71417	0.329000	0.25429	0.991000	0.79684	4.816000	0.62642	1.280000	0.44463	0.561000	0.74099	TCT	MN1	-	NULL	ENSG00000169184		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1	17	0.00	0	G	NM_002430		28195783	28195783	-1	no_errors	ENST00000302326	ensembl	human	known	69_37n	missense	14	36.36	8	SNP	0.990	C
MYO7A	4647	genome.wustl.edu	37	11	76903324	76903324	+	Splice_Site	SNP	G	G	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr11:76903324G>T	ENST00000409709.3	+	31	4424		c.e31+1		MYO7A_ENST00000458637.2_Splice_Site|MYO7A_ENST00000409619.2_Splice_Site	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA						actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GTGTGAGAAGGTGAGTGGGAG	0.602											OREG0021258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													106.0	118.0	114.0					11																	76903324		2187	4269	6456	-	-	-	SO:0001630	splice_region_variant	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.4152+1G>T	11.37:g.76903324G>T		Somatic	1171	WXS	Illumina GAIIx	Phase_IV	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Splice_Site	SNP	-	e30+1	ENST00000409709.3	37	c.4152+1	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392699	0.83011	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6283	0.88099	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO7A	76580972	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.466000	0.97665	2.146000	0.66826	0.478000	0.44815	.	MYO7A	-	-	ENSG00000137474		0.602	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	64	0.00	0	G	NM_000260	Intron	76903324	76903324	+1	no_errors	ENST00000409709	ensembl	human	known	69_37n	splice_site	45	31.82	21	SNP	1.000	T
NFKB1	4790	genome.wustl.edu	37	4	103501694	103501694	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr4:103501694G>A	ENST00000505458.1	+	9	1007	c.730G>A	c.(730-732)Gcc>Acc	p.A244T	NFKB1_ENST00000226574.4_Missense_Mutation_p.A245T|NFKB1_ENST00000510638.1_3'UTR|NFKB1_ENST00000600343.1_Missense_Mutation_p.A64T|NFKB1_ENST00000394820.4_Missense_Mutation_p.A244T			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	244	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	GTGAACAGAAGCCCCCAATGC	0.433																																						dbGAP											0													97.0	97.0	97.0					4																	103501694		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.730G>A	4.37:g.103501694G>A	ENSP00000424790:p.Ala244Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like,smart_IPT_TIG_rcpt,smart_Ankyrin_rpt,smart_Death,prints_NF_Rel_dor,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD	p.A245T	ENST00000505458.1	37	c.733	CCDS54783.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.654386	0.96724	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458;ENST00000508584	T;T;T;T	0.43294	0.97;0.95;0.95;1.36	5.5	5.5	0.81552	Rel homology (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.68026	0.2956	M	0.78801	2.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.91635	0.996;0.999;0.955	T	0.71126	-0.4683	10	0.72032	D	0.01	.	19.4314	0.94768	0.0:0.0:1.0:0.0	.	64;244;245	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	T	245;244;244;38	ENSP00000226574:A245T;ENSP00000378297:A244T;ENSP00000424790:A244T;ENSP00000424815:A38T	ENSP00000226574:A245T	A	+	1	0	NFKB1	103720732	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.382000	0.73167	2.588000	0.87417	0.650000	0.86243	GCC	NFKB1	-	superfamily_p53-like_TF_DNA-bd,prints_NF_Rel_dor,pfscan_RHD	ENSG00000109320		0.433	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	NFKB1	HGNC	protein_coding	OTTHUMT00000363411.1	77	0.00	0	G			103501694	103501694	+1	no_errors	ENST00000226574	ensembl	human	known	69_37n	missense	88	16.19	17	SNP	1.000	A
NMS	129521	genome.wustl.edu	37	2	101087011	101087011	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr2:101087011C>T	ENST00000376865.1	+	1	68	c.61C>T	c.(61-63)Cag>Tag	p.Q21*		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	21					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						CTGCATGCTACAGATTCCCTC	0.537																																						dbGAP											0													323.0	279.0	294.0					2																	101087011		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.61C>T	2.37:g.101087011C>T	ENSP00000366061:p.Gln21*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_NMU_C	p.Q21*	ENST00000376865.1	37	c.61	CCDS33259.1	2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173618	0.78452	.	.	ENSG00000204640	ENST00000376865	.	.	.	4.32	4.32	0.51571	.	0.424498	0.20170	N	0.097757	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-3.2686	12.5066	0.55986	0.0:1.0:0.0:0.0	.	.	.	.	X	21	.	ENSP00000366061:Q21X	Q	+	1	0	NMS	100453443	0.317000	0.24589	0.005000	0.12908	0.616000	0.37450	2.162000	0.42367	2.399000	0.81585	0.650000	0.86243	CAG	NMS	-	NULL	ENSG00000204640		0.537	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMS	HGNC	protein_coding	OTTHUMT00000329737.1	169	0.00	0	C	NM_001011717		101087011	101087011	+1	no_errors	ENST00000376865	ensembl	human	known	69_37n	nonsense	104	33.76	53	SNP	0.008	T
OR10S1	219873	genome.wustl.edu	37	11	123848195	123848195	+	Silent	SNP	G	G	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr11:123848195G>T	ENST00000531945.1	-	1	293	c.204C>A	c.(202-204)ctC>ctA	p.L68L		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L68L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TGGGTAAGCTGAGGTGAGAGT	0.542																																						dbGAP											1	Substitution - coding silent(1)	urinary_tract(1)											80.0	70.0	74.0					11																	123848195		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.204C>A	11.37:g.123848195G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH43|Q6IEV3|Q96R78	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L68	ENST00000531945.1	37	c.204	CCDS31701.1	11																																																																																			OR10S1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196248		0.542	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	HGNC	protein_coding	OTTHUMT00000387265.2	46	0.00	0	G	NM_001004474		123848195	123848195	-1	no_errors	ENST00000531945	ensembl	human	known	69_37n	silent	22	38.89	14	SNP	0.355	T
PADI2	11240	genome.wustl.edu	37	1	17395659	17395659	+	Silent	SNP	G	G	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr1:17395659G>T	ENST00000375486.4	-	16	1941	c.1878C>A	c.(1876-1878)ggC>ggA	p.G626G	PADI2_ENST00000466151.1_5'UTR|PADI2_ENST00000444885.2_Silent_p.G510G	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	626					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TGCATTCGAGGCCCAGGGGCT	0.592																																						dbGAP											0													112.0	101.0	105.0					1																	17395659		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1878C>A	1.37:g.17395659G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DA7|Q9UPN2	Silent	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.G626	ENST00000375486.4	37	c.1878	CCDS177.1	1																																																																																			PADI2	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub	ENSG00000117115		0.592	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	HGNC	protein_coding	OTTHUMT00000006624.1	42	0.00	0	G			17395659	17395659	-1	no_errors	ENST00000375486	ensembl	human	known	69_37n	silent	35	10.26	4	SNP	0.996	T
PDE1A	5136	genome.wustl.edu	37	2	183088590	183088590	+	Splice_Site	DEL	C	C	-			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr2:183088590delC	ENST00000410103.1	-	8	908		c.e8+1		PDE1A_ENST00000409365.1_Splice_Site|PDE1A_ENST00000456212.1_Splice_Site|PDE1A_ENST00000331935.6_Splice_Site|PDE1A_ENST00000536095.1_Splice_Site|PDE1A_ENST00000358139.2_Splice_Site|PDE1A_ENST00000435564.1_Splice_Site|PDE1A_ENST00000482538.1_5'Flank|PDE1A_ENST00000346717.4_Splice_Site|PDE1A_ENST00000351439.5_Splice_Site	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TTCAGACTTACCTTGTCTGAA	0.299																																						dbGAP											0													63.0	59.0	61.0					2																	183088590		2203	4298	6501	-	-	-	SO:0001630	splice_region_variant	0				CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.824+1G>-	2.37:g.183088590delC		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Splice_Site	DEL	-	e7+1	ENST00000410103.1	37	c.824+1	CCDS33344.1	2																																																																																			PDE1A	-	-	ENSG00000115252		0.299	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	PDE1A	HGNC	protein_coding	OTTHUMT00000334356.1	73	0.00	0	C		Intron	183088590	183088590	-1	no_errors	ENST00000456212	ensembl	human	known	69_37n	splice_site_del	89	30.23	39	DEL	1.000	-
PDYN	5173	genome.wustl.edu	37	20	1961218	1961218	+	Silent	SNP	G	G	C			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr20:1961218G>C	ENST00000217305.2	-	4	741	c.516C>G	c.(514-516)gtC>gtG	p.V172V	RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000540134.1_Silent_p.V172V|PDYN_ENST00000539905.1_Silent_p.V172V	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	172					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CATAGCGTTTGACCTGCTCCT	0.587																																						dbGAP											0													105.0	106.0	105.0					20																	1961218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.516C>G	20.37:g.1961218G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Q3	Silent	SNP	pfam_Opioid_neupept,prints_Proenkphlin_B,prints_Opioid_neupept	p.V172	ENST00000217305.2	37	c.516	CCDS13023.1	20																																																																																			PDYN	-	prints_Opioid_neupept	ENSG00000101327		0.587	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDYN	HGNC	protein_coding	OTTHUMT00000077569.2	62	0.00	0	G			1961218	1961218	-1	no_errors	ENST00000217305	ensembl	human	known	69_37n	silent	51	28.17	20	SNP	1.000	C
PIWIL4	143689	genome.wustl.edu	37	11	94331003	94331003	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr11:94331003G>C	ENST00000299001.6	+	11	1513	c.1302G>C	c.(1300-1302)tgG>tgC	p.W434C	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	434					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TAGAGACCTGGGGACTGCATT	0.368																																						dbGAP											0													107.0	110.0	109.0					11																	94331003		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1302G>C	11.37:g.94331003G>C	ENSP00000299001:p.Trp434Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.W434C	ENST00000299001.6	37	c.1302	CCDS31656.1	11	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665515	0.67700	.	.	ENSG00000134627	ENST00000299001	T	0.04502	3.61	4.83	4.83	0.62350	Ribonuclease H-like (1);	0.000000	0.64402	D	0.000010	T	0.24736	0.0600	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01405	-1.1363	10	0.87932	D	0	-16.6272	16.8559	0.86006	0.0:0.0:1.0:0.0	.	434	Q7Z3Z4	PIWL4_HUMAN	C	434	ENSP00000299001:W434C	ENSP00000299001:W434C	W	+	3	0	PIWIL4	93970651	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.048000	0.71046	2.520000	0.84964	0.591000	0.81541	TGG	PIWIL4	-	superfamily_RNaseH-like_dom	ENSG00000134627		0.368	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL4	HGNC	protein_coding	OTTHUMT00000396388.1	116	0.00	0	G	NM_152431		94331003	94331003	+1	no_errors	ENST00000299001	ensembl	human	known	69_37n	missense	63	42.20	46	SNP	1.000	C
PKHD1L1	93035	genome.wustl.edu	37	8	110464392	110464392	+	Silent	SNP	C	C	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr8:110464392C>A	ENST00000378402.5	+	42	6494	c.6390C>A	c.(6388-6390)gcC>gcA	p.A2130A		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2130	IPT/TIG 14.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAGCTGAAGCCAAATGTGATG	0.403										HNSCC(38;0.096)																												dbGAP											0													106.0	100.0	102.0					8																	110464392		1940	4143	6083	-	-	-	SO:0001819	synonymous_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6390C>A	8.37:g.110464392C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.A2130	ENST00000378402.5	37	c.6390	CCDS47911.1	8																																																																																			PKHD1L1	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000205038		0.403	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	64	0.00	0	C	NM_177531		110464392	110464392	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	silent	48	30.43	21	SNP	0.024	A
PLEK	5341	genome.wustl.edu	37	2	68613653	68613653	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr2:68613653G>T	ENST00000234313.7	+	5	671	c.492G>T	c.(490-492)tgG>tgT	p.W164C		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	164	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		TCATTGATTGGCTGGTATCCA	0.522																																						dbGAP											0													111.0	96.0	101.0					2																	68613653		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.492G>T	2.37:g.68613653G>T	ENSP00000234313:p.Trp164Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_DEP_dom,smart_Pleckstrin_homology,smart_DEP_dom,pfscan_DEP_dom,pfscan_Pleckstrin_homology	p.W164C	ENST00000234313.7	37	c.492	CCDS1887.1	2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070742	0.76301	.	.	ENSG00000115956	ENST00000234313	T	0.50548	0.74	5.38	5.38	0.77491	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.73032	0.3535	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77267	-0.2651	10	0.87932	D	0	.	19.1359	0.93428	0.0:0.0:1.0:0.0	.	182;164	Q59GZ2;P08567	.;PLEK_HUMAN	C	164	ENSP00000234313:W164C	ENSP00000234313:W164C	W	+	3	0	PLEK	68467157	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	9.697000	0.98697	2.517000	0.84864	0.655000	0.94253	TGG	PLEK	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000115956		0.522	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK	HGNC	protein_coding	OTTHUMT00000251755.1	65	0.00	0	G	NM_002664		68613653	68613653	+1	no_errors	ENST00000234313	ensembl	human	known	69_37n	missense	64	25.58	22	SNP	1.000	T
PTCHD2	57540	genome.wustl.edu	37	1	11591069	11591069	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr1:11591069G>A	ENST00000294484.6	+	16	3346	c.3208G>A	c.(3208-3210)Ggg>Agg	p.G1070R	PTCHD2_ENST00000389575.3_Missense_Mutation_p.G1070R|PTCHD2_ENST00000304391.6_5'Flank	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1070					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GAAGCCGGGTGGGGCCCAGTG	0.617																																						dbGAP											0													66.0	77.0	74.0					1																	11591069		2056	4198	6254	-	-	-	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3208G>A	1.37:g.11591069G>A	ENSP00000294484:p.Gly1070Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.G1070R	ENST00000294484.6	37	c.3208	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860240	0.71834	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.94330	-3.33;-3.4	4.98	4.07	0.47477	.	0.000000	0.85682	D	0.000000	D	0.93926	0.8056	L	0.32530	0.975	0.54753	D	0.999984	D	0.89917	1.0	D	0.91635	0.999	D	0.93731	0.7041	10	0.56958	D	0.05	-19.4267	12.4728	0.55797	0.0811:0.0:0.9189:0.0	.	1070	Q9P2K9	PTHD2_HUMAN	R	1070	ENSP00000294484:G1070R;ENSP00000374226:G1070R	ENSP00000294484:G1070R	G	+	1	0	PTCHD2	11513656	1.000000	0.71417	0.997000	0.53966	0.478000	0.33099	9.590000	0.98238	1.108000	0.41662	0.591000	0.81541	GGG	PTCHD2	-	NULL	ENSG00000204624		0.617	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	29	0.00	0	G	XM_052561		11591069	11591069	+1	no_errors	ENST00000294484	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	A
RALGAPB	57148	genome.wustl.edu	37	20	37177413	37177413	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr20:37177413C>G	ENST00000262879.6	+	20	3268	c.2984C>G	c.(2983-2985)cCc>cGc	p.P995R	RALGAPB_ENST00000397040.1_Missense_Mutation_p.P995R|RALGAPB_ENST00000397038.1_Missense_Mutation_p.P773R|RALGAPB_ENST00000397042.3_Missense_Mutation_p.P991R			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	995					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TGTCTTTTACCCAGAGGAGCA	0.403																																						dbGAP											0													93.0	94.0	94.0					20																	37177413		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.2984C>G	20.37:g.37177413C>G	ENSP00000262879:p.Pro995Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP	p.P995R	ENST00000262879.6	37	c.2984	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.264310	0.95399	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	.	.	.	5.96	5.96	0.96718	.	0.049084	0.85682	D	0.000000	T	0.77110	0.4082	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.77048	-0.2732	9	0.87932	D	0	.	20.4192	0.99033	0.0:1.0:0.0:0.0	.	991;995	A2A2E9;Q86X10	.;RLGPB_HUMAN	R	995;991;773;995;823	.	ENSP00000262879:P995R	P	+	2	0	RALGAPB	36610827	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.831000	0.97527	0.650000	0.86243	CCC	RALGAPB	-	NULL	ENSG00000170471		0.403	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1	116	0.00	0	C	NM_020336		37177413	37177413	+1	no_errors	ENST00000262879	ensembl	human	known	69_37n	missense	160	16.67	32	SNP	1.000	G
SERPINA12	145264	genome.wustl.edu	37	14	94953679	94953679	+	Silent	SNP	C	C	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr14:94953679C>G	ENST00000341228.2	-	6	2001	c.1206G>C	c.(1204-1206)gtG>gtC	p.V402V	SERPINA12_ENST00000556881.1_Silent_p.V402V	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	402					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		CCAGGAAGAGCACGGAAGGTA	0.488																																						dbGAP											0													119.0	103.0	109.0					14																	94953679		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.1206G>C	14.37:g.94953679C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.V402	ENST00000341228.2	37	c.1206	CCDS9926.1	14																																																																																			SERPINA12	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000165953		0.488	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA12	HGNC	protein_coding	OTTHUMT00000413097.1	24	0.00	0	C	NM_173850		94953679	94953679	-1	no_errors	ENST00000341228	ensembl	human	known	69_37n	silent	14	46.15	12	SNP	0.039	G
TCF4	6925	genome.wustl.edu	37	18	52899822	52899822	+	Missense_Mutation	SNP	G	G	C	rs538071467		TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr18:52899822G>C	ENST00000356073.4	-	17	2178	c.1567C>G	c.(1567-1569)Ctg>Gtg	p.L523V	TCF4_ENST00000568673.1_Missense_Mutation_p.L499V|TCF4_ENST00000570287.2_Missense_Mutation_p.L363V|TCF4_ENST00000564228.1_Missense_Mutation_p.L452V|TCF4_ENST00000565018.2_Missense_Mutation_p.L523V|TCF4_ENST00000564999.1_Missense_Mutation_p.L523V|TCF4_ENST00000566286.1_Missense_Mutation_p.L520V|TCF4_ENST00000398339.1_Missense_Mutation_p.L625V|TCF4_ENST00000567880.1_Missense_Mutation_p.L463V|TCF4_ENST00000537578.1_Missense_Mutation_p.L499V|TCF4_ENST00000540999.1_Missense_Mutation_p.L499V|TCF4_ENST00000537856.3_Missense_Mutation_p.L393V|TCF4_ENST00000566279.1_Missense_Mutation_p.L463V|TCF4_ENST00000561992.1_Missense_Mutation_p.L393V|TCF4_ENST00000543082.1_Missense_Mutation_p.L481V|TCF4_ENST00000564403.2_Missense_Mutation_p.L529V|TCF4_ENST00000544241.2_Missense_Mutation_p.L452V|TCF4_ENST00000457482.3_Missense_Mutation_p.L363V|TCF4_ENST00000561831.3_Missense_Mutation_p.L363V|TCF4_ENST00000354452.3_Missense_Mutation_p.L523V|TCF4_ENST00000570177.2_Missense_Mutation_p.L393V|TCF4_ENST00000568740.1_Missense_Mutation_p.L498V	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	523					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GTGTCTTGCAGGTTCTCATCA	0.443																																						dbGAP											0													142.0	118.0	127.0					18																	52899822		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1567C>G	18.37:g.52899822G>C	ENSP00000348374:p.Leu523Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.L625V	ENST00000356073.4	37	c.1873	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036981	0.35893	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.18338	2.48;2.22;2.54;2.54;2.54;2.48;2.47;2.28;2.46	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.34454	0.0898	L	0.52759	1.655	0.58432	D	0.999998	B;P;B;P;P;B;B;D;P	0.56035	0.048;0.929;0.081;0.774;0.956;0.196;0.103;0.974;0.891	B;P;B;B;P;B;B;D;P	0.67725	0.041;0.614;0.034;0.379;0.899;0.083;0.083;0.953;0.487	T	0.01626	-1.1309	10	0.18710	T	0.47	-8.0938	17.8399	0.88712	0.0:0.0:1.0:0.0	.	499;523;363;625;523;481;452;363;520	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	V	523;363;523;481;499;499;452;393;625	ENSP00000346440:L523V;ENSP00000409447:L363V;ENSP00000348374:L523V;ENSP00000439656:L481V;ENSP00000445202:L499V;ENSP00000440731:L499V;ENSP00000441562:L452V;ENSP00000439827:L393V;ENSP00000381382:L625V	ENSP00000346440:L523V	L	-	1	2	TCF4	51050820	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.135000	0.77276	2.510000	0.84645	0.467000	0.42956	CTG	TCF4	-	NULL	ENSG00000196628		0.443	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	80	0.00	0	G	NM_003199		52899822	52899822	-1	no_errors	ENST00000398339	ensembl	human	known	69_37n	missense	68	23.60	21	SNP	1.000	C
TNFRSF11B	4982	genome.wustl.edu	37	8	119936866	119936866	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr8:119936866G>C	ENST00000297350.4	-	5	1331	c.953C>G	c.(952-954)gCa>gGa	p.A318G		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	318	Death 2.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			GGGTTTGCATGCCTTTATTGT	0.468																																						dbGAP											0													220.0	175.0	190.0					8																	119936866		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.953C>G	8.37:g.119936866G>C	ENSP00000297350:p.Ala318Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	pirsf_TNFR_11B,pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,prints_TNFR_11B,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg	p.A318G	ENST00000297350.4	37	c.953	CCDS6326.1	8	.	.	.	.	.	.	.	.	.	.	G	4.810	0.150667	0.09185	.	.	ENSG00000164761	ENST00000297350	D	0.93307	-3.2	5.43	3.6	0.41247	Death (1);	3.453980	0.02816	U	0.125000	D	0.88235	0.6382	N	0.22421	0.69	0.09310	N	1	B	0.23185	0.081	B	0.21917	0.037	T	0.76471	-0.2947	9	.	.	.	-1.0993	6.6324	0.22863	0.3584:0.0:0.6416:0.0	.	318	O00300	TR11B_HUMAN	G	318	ENSP00000297350:A318G	.	A	-	2	0	TNFRSF11B	120006047	0.044000	0.20184	0.143000	0.22291	0.103000	0.19146	1.939000	0.40213	1.428000	0.47296	0.563000	0.77884	GCA	TNFRSF11B	-	pirsf_TNFR_11B,pfam_Death,superfamily_DEATH-like,smart_Death	ENSG00000164761		0.468	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11B	HGNC	protein_coding	OTTHUMT00000381220.1	163	0.00	0	G			119936866	119936866	-1	no_errors	ENST00000297350	ensembl	human	known	69_37n	missense	117	25.00	39	SNP	0.007	C
TRIM60	166655	genome.wustl.edu	37	4	165961691	165961691	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr4:165961691A>G	ENST00000512596.1	+	3	683	c.467A>G	c.(466-468)gAa>gGa	p.E156G	TRIM60_ENST00000341062.5_Missense_Mutation_p.E156G|TRIM60_ENST00000508504.1_Missense_Mutation_p.E156G	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	156						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		AATAATATAGAACGAGTTGAA	0.378																																						dbGAP											0													54.0	54.0	54.0					4																	165961691		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.467A>G	4.37:g.165961691A>G	ENSP00000421142:p.Glu156Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA35	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E156G	ENST00000512596.1	37	c.467	CCDS3808.1	4	.	.	.	.	.	.	.	.	.	.	A	12.07	1.827522	0.32329	.	.	ENSG00000176979	ENST00000512596;ENST00000508504;ENST00000341062	T;T;T	0.64803	-0.12;-0.12;-0.12	2.36	2.36	0.29203	.	0.309729	0.20989	U	0.082070	T	0.57242	0.2040	M	0.67397	2.05	0.09310	N	1	B	0.15141	0.012	B	0.19946	0.027	T	0.56685	-0.7938	10	0.66056	D	0.02	.	8.5692	0.33558	1.0:0.0:0.0:0.0	.	156	Q495X7	TRI60_HUMAN	G	156	ENSP00000421142:E156G;ENSP00000426496:E156G;ENSP00000343765:E156G	ENSP00000343765:E156G	E	+	2	0	TRIM60	166181141	0.025000	0.19082	0.002000	0.10522	0.699000	0.40488	1.352000	0.34033	1.327000	0.45338	0.459000	0.35465	GAA	TRIM60	-	NULL	ENSG00000176979		0.378	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM60	HGNC	protein_coding	OTTHUMT00000364325.1	55	0.00	0	A	NM_152620		165961691	165961691	+1	no_errors	ENST00000341062	ensembl	human	known	69_37n	missense	26	45.83	22	SNP	0.006	G
TRIM66	9866	genome.wustl.edu	37	11	8670021	8670021	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr11:8670021C>G	ENST00000299550.6	-	4	426	c.232G>C	c.(232-234)Gag>Cag	p.E78Q	TRIM66_ENST00000402157.2_Missense_Mutation_p.E78Q|TRIM66_ENST00000531498.1_5'UTR	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	78						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						tcacatgtctcacagaatagc	0.512																																						dbGAP											0													148.0	124.0	131.0					11																	8670021		692	1591	2283	-	-	-	SO:0001583	missense	0			AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.232G>C	11.37:g.8670021C>G	ENSP00000299550:p.Glu78Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQQ4	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_B-box,smart_Znf_PHD,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.E78Q	ENST00000299550.6	37	c.232		11	.	.	.	.	.	.	.	.	.	.	C	28.4	4.912959	0.92178	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	T;T	0.42900	0.96;0.96	5.65	5.65	0.86999	Zinc finger, B-box (2);	0.000000	0.64402	D	0.000001	T	0.60064	0.2240	L	0.50919	1.6	0.39418	D	0.96687	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.58358	-0.7650	10	0.48119	T	0.1	-25.2848	17.2513	0.87043	0.0:1.0:0.0:0.0	.	78;78	O15016;B5MCJ9	TRI66_HUMAN;.	Q	78	ENSP00000299550:E78Q;ENSP00000384876:E78Q	ENSP00000299550:E78Q	E	-	1	0	TRIM66	8626597	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.737000	0.62066	2.824000	0.97209	0.655000	0.94253	GAG	TRIM66	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000166436		0.512	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	HGNC	protein_coding		73	0.00	0	C	XM_084529		8670021	8670021	-1	no_errors	ENST00000299550	ensembl	human	known	69_37n	missense	45	31.82	21	SNP	1.000	G
TTF2	8458	genome.wustl.edu	37	1	117618034	117618034	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr1:117618034G>C	ENST00000369466.4	+	5	872	c.828G>C	c.(826-828)caG>caC	p.Q276H		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	276					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		GCAAGCCCCAGAAAGGGGGAC	0.488																																						dbGAP											0													88.0	97.0	94.0					1																	117618034		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.828G>C	1.37:g.117618034G>C	ENSP00000358478:p.Gln276His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q276H	ENST00000369466.4	37	c.828	CCDS892.1	1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872746	0.51695	.	.	ENSG00000116830	ENST00000369466	D	0.87491	-2.26	5.65	0.514	0.17007	.	0.982019	0.08267	N	0.972036	T	0.65585	0.2705	L	0.53249	1.67	0.09310	N	1	B;B	0.27700	0.03;0.186	B;B	0.25759	0.007;0.063	T	0.50533	-0.8817	10	0.16420	T	0.52	-0.3482	5.6901	0.17825	0.2805:0.0:0.5933:0.1262	.	276;276	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	H	276	ENSP00000358478:Q276H	ENSP00000358478:Q276H	Q	+	3	2	TTF2	117419557	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	0.560000	0.23500	-0.071000	0.12886	-0.150000	0.13652	CAG	TTF2	-	NULL	ENSG00000116830		0.488	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	19	0.00	0	G			117618034	117618034	+1	no_errors	ENST00000369466	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	0.004	C
ULK4	54986	genome.wustl.edu	37	3	41942265	41942265	+	Silent	SNP	G	G	A			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr3:41942265G>A	ENST00000301831.4	-	13	1701	c.1239C>T	c.(1237-1239)atC>atT	p.I413I	U8_ENST00000390843.2_RNA|ULK4_ENST00000420927.1_Silent_p.I413I	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	413					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AGTCCGTGTAGATAAGCTCTC	0.418																																						dbGAP											0													209.0	198.0	201.0					3																	41942265		1893	4131	6024	-	-	-	SO:0001819	synonymous_variant	0			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1239C>T	3.37:g.41942265G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I413	ENST00000301831.4	37	c.1239	CCDS43071.1	3																																																																																			ULK4	-	NULL	ENSG00000168038		0.418	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	72	0.00	0	G	XM_929989		41942265	41942265	-1	no_errors	ENST00000301831	ensembl	human	known	69_37n	silent	105	19.23	25	SNP	1.000	A
UNC13A	23025	genome.wustl.edu	37	19	17728543	17728543	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr19:17728543A>G	ENST00000519716.2	-	41	4525	c.4526T>C	c.(4525-4527)aTc>aCc	p.I1509T	UNC13A_ENST00000428389.2_Missense_Mutation_p.I1597T|UNC13A_ENST00000252773.7_Missense_Mutation_p.I1509T|UNC13A_ENST00000552293.1_Missense_Mutation_p.I1484T|UNC13A_ENST00000551649.1_Missense_Mutation_p.I1509T|UNC13A_ENST00000550896.1_Missense_Mutation_p.I1482T	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1509	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						AAAGGTCTTGATTAGCAGGTC	0.627																																						dbGAP											0													111.0	120.0	117.0					19																	17728543		2068	4226	6294	-	-	-	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.4526T>C	19.37:g.17728543A>G	ENSP00000429562:p.Ile1509Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.I1597T	ENST00000519716.2	37	c.4790	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	A	15.07	2.724443	0.48728	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	4.01	4.01	0.46588	Mammalian uncoordinated homology 13, domain 2 (1);Mammalian uncoordinated homology 13, subgroup, domain 2 (1);	0.061315	0.64402	D	0.000004	D	0.91526	0.7324	M	0.89904	3.07	0.53688	D	0.999977	D	0.69078	0.997	D	0.75484	0.986	D	0.92573	0.6068	10	0.87932	D	0	-28.5057	11.1527	0.48469	1.0:0.0:0.0:0.0	.	1509	Q9UPW8	UN13A_HUMAN	T	1509;1597;1509;1509;1484;1482	ENSP00000429562:I1509T;ENSP00000400409:I1597T;ENSP00000252773:I1509T;ENSP00000447236:I1509T;ENSP00000447572:I1484T;ENSP00000446831:I1482T	ENSP00000252773:I1509T	I	-	2	0	UNC13A	17589543	1.000000	0.71417	1.000000	0.80357	0.049000	0.14656	9.166000	0.94766	1.588000	0.49971	0.260000	0.18958	ATC	UNC13A	-	pfam_Munc13_subgr_dom-2	ENSG00000130477		0.627	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	51	0.00	0	A	XM_038604		17728543	17728543	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	missense	52	26.76	19	SNP	1.000	G
ZNF76	7629	genome.wustl.edu	37	6	35262260	35262260	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24L-01A-11D-A167-09	TCGA-AR-A24L-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2a93298a-d272-487c-ae4a-ec385844536e	7bb4ec17-22de-45cf-8ec8-637526f4752b	g.chr6:35262260G>T	ENST00000373953.3	+	13	1788	c.1522G>T	c.(1522-1524)Gtg>Ttg	p.V508L	ZNF76_ENST00000339411.5_Missense_Mutation_p.V453L|ZNF76_ENST00000440666.2_Missense_Mutation_p.V482L	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	508					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						TGGGGCTGTGGTGGCTGAGGA	0.507											OREG0017373	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(52;92 1039 20612 23956 34676)	dbGAP											0													210.0	161.0	178.0					6																	35262260		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1522G>T	6.37:g.35262260G>T	ENSP00000363064:p.Val508Leu	Somatic	854	WXS	Illumina GAIIx	Phase_IV	Q9BQB2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V508L	ENST00000373953.3	37	c.1522	CCDS4801.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.30|12.30	1.896005|1.896005	0.33442|0.33442	.|.	.|.	ENSG00000065029|ENSG00000065029	ENST00000373953;ENST00000440666;ENST00000339411|ENST00000498555	T;T;T|.	0.09445|.	3.04;3.03;2.98|.	5.42|5.42	3.64|3.64	0.41730|0.41730	.|.	0.000000|.	0.40554|.	N|.	0.001062|.	T|T	0.30103|0.30103	0.0754|0.0754	L|L	0.36672|0.36672	1.1|1.1	0.38759|0.38759	D|D	0.954278|0.954278	B;P|.	0.35507|.	0.408;0.506|.	B;B|.	0.31751|.	0.135;0.091|.	T|T	0.08534|0.08534	-1.0717|-1.0717	10|5	0.33141|.	T|.	0.24|.	.|.	8.2028|8.2028	0.31434|0.31434	0.0788:0.0:0.7658:0.1554|0.0788:0.0:0.7658:0.1554	.|.	453;508|.	P36508-2;P36508|.	.;ZNF76_HUMAN|.	L|C	508;482;453|40	ENSP00000363064:V508L;ENSP00000392243:V482L;ENSP00000344097:V453L|.	ENSP00000344097:V453L|.	V|W	+|+	1|3	0|0	ZNF76|ZNF76	35370238|35370238	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.815000|0.815000	0.46073|0.46073	0.558000|0.558000	0.23469|0.23469	0.663000|0.663000	0.31027|0.31027	-0.142000|-0.142000	0.14014|0.14014	GTG|TGG	ZNF76	-	NULL	ENSG00000065029		0.507	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	HGNC	protein_coding	OTTHUMT00000040279.2	128	0.00	0	G	NM_003427		35262260	35262260	+1	no_errors	ENST00000373953	ensembl	human	known	69_37n	missense	119	12.50	17	SNP	0.994	T
