#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
C11orf24	53838	genome.wustl.edu	37	11	68031210	68031210	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr11:68031210C>G	ENST00000304271.6	-	3	428	c.26G>C	c.(25-27)tGg>tCg	p.W9S	C11orf24_ENST00000533310.1_Missense_Mutation_p.W9S|C11orf24_ENST00000530166.1_Intron	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	9						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						GGAGAAAATCCAAATGAGCAC	0.572																																					NSCLC(21;855 905 4198 36694)	dbGAP											0													68.0	61.0	63.0					11																	68031210		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.26G>C	11.37:g.68031210C>G	ENSP00000307264:p.Trp9Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H2K4	Missense_Mutation	SNP	NULL	p.W9S	ENST00000304271.6	37	c.26	CCDS8180.1	11	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427393	0.62733	.	.	ENSG00000171067	ENST00000304271;ENST00000533310;ENST00000527280	T	0.67698	-0.28	4.68	1.44	0.22558	.	0.000000	0.30714	U	0.009032	T	0.53722	0.1814	L	0.43923	1.385	0.09310	N	1	P;P	0.41784	0.762;0.762	B;B	0.39379	0.298;0.298	T	0.51284	-0.8725	10	0.87932	D	0	1.0E-4	7.2836	0.26324	0.4352:0.4196:0.1452:0.0	.	9;9	E9PRU5;Q96F05	.;CK024_HUMAN	S	9	ENSP00000307264:W9S	ENSP00000307264:W9S	W	-	2	0	C11orf24	67787786	0.090000	0.21635	0.004000	0.12327	0.696000	0.40369	1.382000	0.34374	0.656000	0.30886	0.281000	0.19383	TGG	C11orf24	-	NULL	ENSG00000171067		0.572	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf24	HGNC	protein_coding	OTTHUMT00000394750.1	31	0.00	0	C	NM_022338		68031210	68031210	-1	no_errors	ENST00000304271	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.001	G
CACNA1B	774	genome.wustl.edu	37	9	140865931	140865931	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr9:140865931G>A	ENST00000371372.1	+	11	1575	c.1430G>A	c.(1429-1431)cGc>cAc	p.R477H	CACNA1B_ENST00000371363.1_Missense_Mutation_p.R477H|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000277551.2_Missense_Mutation_p.R477H|CACNA1B_ENST00000371355.4_Missense_Mutation_p.R478H|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R478H	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	477					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TTTATCCGGCGCATGGTGAAG	0.592																																						dbGAP											0													97.0	110.0	106.0					9																	140865931		2162	4249	6411	-	-	-	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1430G>A	9.37:g.140865931G>A	ENSP00000360423:p.Arg477His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.R478H	ENST00000371372.1	37	c.1433	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569452	0.28003	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.96716	-4.09;-4.1;-4.09;-4.07;-4.07	5.1	4.2	0.49525	.	0.000000	0.85682	D	0.000000	D	0.92763	0.7699	L	0.39898	1.24	0.80722	D	1	B;B	0.26041	0.017;0.14	B;B	0.16289	0.005;0.015	D	0.89561	0.3806	10	0.20046	T	0.44	.	15.5338	0.75986	0.0:0.1388:0.8612:0.0	.	477;477	B1AQK4;B1AQK6	.;.	H	477;477;477;478;478	ENSP00000360423:R477H;ENSP00000277551:R477H;ENSP00000360414:R477H;ENSP00000360408:R478H;ENSP00000360406:R478H	ENSP00000277551:R477H	R	+	2	0	CACNA1B	139985752	1.000000	0.71417	0.991000	0.47740	0.349000	0.29174	6.587000	0.74071	1.128000	0.42052	-0.502000	0.04539	CGC	CACNA1B	-	NULL	ENSG00000148408		0.592	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	106	0.93	1	G	NM_000718		140865931	140865931	+1	no_errors	ENST00000371355	ensembl	human	known	69_37n	missense	56	39.78	37	SNP	1.000	A
TMED5	50999	genome.wustl.edu	37	1	93646095	93646095	+	5'UTR	DEL	C	C	-			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr1:93646095delC	ENST00000370282.3	-	0	190				TMED5_ENST00000479918.1_5'Flank|CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000557479.1_Frame_Shift_Del_p.S3fs|CCDC18_ENST00000401026.3_5'UTR|CCDC18_ENST00000343253.7_Intron|CCDC18_ENST00000338949.4_5'UTR|TMED5_ENST00000370280.1_5'Flank	NM_016040.4	NP_057124.3	Q9Y3A6	TMED5_HUMAN	transmembrane emp24 protein transport domain containing 5						Golgi ribbon formation (GO:0090161)|protein transport (GO:0015031)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6		all_lung(203;0.0223)|Lung NSC(277;0.071)|Melanoma(281;0.147)|Glioma(108;0.188)		all cancers(265;0.00108)|GBM - Glioblastoma multiforme(16;0.00407)|Epithelial(280;0.0797)		CCCATGGCTTCCCCCACCAAT	0.687																																						dbGAP											0													17.0	19.0	18.0					1																	93646095		1859	4072	5931	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC070051	CCDS743.1, CCDS53342.1	1p22.1	2013-09-19			ENSG00000117500	ENSG00000117500			24251	protein-coding gene	gene with protein product						10810093	Standard	NM_016040		Approved	CGI-100	uc001dpn.3	Q9Y3A6	OTTHUMG00000010162	ENST00000370282.3:c.-296G>-	1.37:g.93646095delC		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKT4|B2R703|D3DT38|Q96AX8	Frame_Shift_Del	DEL	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.T5fs	ENST00000370282.3	37	c.8	CCDS743.1	1																																																																																			CCDC18	-	NULL	ENSG00000122483		0.687	TMED5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC18	HGNC	protein_coding	OTTHUMT00000028076.3	13	0.00	0	C	NM_016040		93646095	93646095	+1	no_errors	ENST00000557479	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.004	-
CWC25	54883	genome.wustl.edu	37	17	36977158	36977158	+	Missense_Mutation	SNP	C	C	T	rs555146635		TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr17:36977158C>T	ENST00000225428.5	-	2	484	c.187G>A	c.(187-189)Gtc>Atc	p.V63I	CWC25_ENST00000536127.1_5'UTR	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	63										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						ACTTACTTGACGGCCCCAACA	0.557													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18902	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													146.0	142.0	143.0					17																	36977158		2108	4237	6345	-	-	-	SO:0001583	missense	0			AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.187G>A	17.37:g.36977158C>T	ENSP00000225428:p.Val63Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLM3|Q68DK5	Missense_Mutation	SNP	pfam_CWC25,pfam_CIR_N_dom	p.V63I	ENST00000225428.5	37	c.187	CCDS45663.1	17	.	.	.	.	.	.	.	.	.	.	C	10.02	1.235499	0.22626	.	.	ENSG00000108296	ENST00000225428	.	.	.	5.2	4.23	0.50019	.	0.062950	0.64402	D	0.000004	T	0.27205	0.0667	N	0.04260	-0.245	0.80722	D	1	B	0.25206	0.12	B	0.16289	0.015	T	0.07481	-1.0770	9	0.13853	T	0.58	.	12.7532	0.57320	0.0:0.9197:0.0:0.0802	.	63	Q9NXE8	CWC25_HUMAN	I	63	.	ENSP00000225428:V63I	V	-	1	0	CWC25	34230684	0.991000	0.36638	0.988000	0.46212	0.285000	0.27093	2.825000	0.48096	1.206000	0.43276	-0.143000	0.13931	GTC	CWC25	-	NULL	ENSG00000108296		0.557	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC25	HGNC	protein_coding	OTTHUMT00000442186.6	40	0.00	0	C	NM_017748		36977158	36977158	-1	no_errors	ENST00000225428	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	0.998	T
FOXK2	3607	genome.wustl.edu	37	17	80525932	80525932	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr17:80525932C>T	ENST00000335255.5	+	3	791	c.617C>T	c.(616-618)gCt>gTt	p.A206V		NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	206					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			TTCCACAGCGCTGCAAACTCC	0.507																																						dbGAP											0													39.0	38.0	39.0					17																	80525932		2203	4300	6503	-	-	-	SO:0001583	missense	0			U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.617C>T	17.37:g.80525932C>T	ENSP00000335677:p.Ala206Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEP5|Q13622|Q13623|Q13624	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,prints_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head	p.A206V	ENST00000335255.5	37	c.617	CCDS11813.1	17	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125972	0.56721	.	.	ENSG00000141568	ENST00000535184;ENST00000335255;ENST00000335241;ENST00000531030;ENST00000526383	D;D;D	0.95690	-3.36;-3.78;-3.74	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.93789	0.8014	L	0.45352	1.415	0.80722	D	1	B;B;B	0.25521	0.128;0.029;0.083	B;B;B	0.31614	0.106;0.021;0.133	D	0.90702	0.4621	10	0.34782	T	0.22	.	19.2561	0.93947	0.0:1.0:0.0:0.0	.	206;206;206	Q01167-3;Q01167;Q01167-2	.;FOXK2_HUMAN;.	V	202;206;206;17;86	ENSP00000335677:A206V;ENSP00000433167:A17V;ENSP00000432663:A86V	ENSP00000334321:A206V	A	+	2	0	FOXK2	78119221	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.540000	0.82074	2.659000	0.90383	0.655000	0.94253	GCT	FOXK2	-	NULL	ENSG00000141568		0.507	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK2	HGNC	protein_coding	OTTHUMT00000277099.2	39	0.00	0	C	NM_181430		80525932	80525932	+1	no_errors	ENST00000335255	ensembl	human	known	69_37n	missense	16	42.86	12	SNP	1.000	T
GATA3	2625	genome.wustl.edu	37	10	8115703	8115703	+	Splice_Site	DEL	T	T	-			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr10:8115703delT	ENST00000346208.3	+	6	1504	c.1049delT	c.(1048-1050)att>at	p.I350fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Splice_Site_p.I351fs			P23771	GATA3_HUMAN	GATA binding protein 3	350					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(3)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TTTGTTTAGATTAACAGACCC	0.418			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	3	Unknown(3)	breast(3)											33.0	36.0	35.0					10																	8115703		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1048-1T>-	10.37:g.8115703delT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Del	DEL	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.N352fs	ENST00000346208.3	37	c.1052	CCDS7083.1	10																																																																																			GATA3	-	smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.418	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	28	0.00	0	T	NM_001002295	Frame_Shift_Del	8115703	8115703	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_del	14	26.32	5	DEL	1.000	-
KCNA5	3741	genome.wustl.edu	37	12	5154181	5154181	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr12:5154181C>A	ENST00000252321.3	+	1	1097	c.868C>A	c.(868-870)Cag>Aag	p.Q290K		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	290					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GGCGCCCCACCAGCCTCCCGC	0.697																																						dbGAP											0													35.0	40.0	38.0					12																	5154181		2201	4297	6498	-	-	-	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.868C>A	12.37:g.5154181C>A	ENSP00000252321:p.Gln290Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.Q290K	ENST00000252321.3	37	c.868	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	C	4.448	0.082896	0.08533	.	.	ENSG00000130037	ENST00000252321	D	0.97352	-4.35	4.77	4.77	0.60923	.	7739.210000	0.00166	N	0.000000	D	0.94128	0.8117	N	0.22421	0.69	0.09310	N	1	B	0.25441	0.126	B	0.18263	0.021	T	0.77127	-0.2702	10	0.07325	T	0.83	.	16.9696	0.86295	0.0:1.0:0.0:0.0	.	290	P22460	KCNA5_HUMAN	K	290	ENSP00000252321:Q290K	ENSP00000252321:Q290K	Q	+	1	0	KCNA5	5024442	0.001000	0.12720	0.060000	0.19600	0.126000	0.20510	1.096000	0.30976	2.478000	0.83669	0.561000	0.74099	CAG	KCNA5	-	NULL	ENSG00000130037		0.697	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	23	0.00	0	C	NM_002234		5154181	5154181	+1	no_errors	ENST00000252321	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	0.135	A
KCNK9	51305	genome.wustl.edu	37	8	140714982	140714982	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr8:140714982T>C	ENST00000520439.1	-	1	317	c.254A>G	c.(253-255)tAc>tGc	p.Y85C	KCNK9_ENST00000303015.1_Missense_Mutation_p.Y85C	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	85					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GATCGCAAAGTAGAAGGAGCC	0.682																																						dbGAP											0													36.0	37.0	37.0					8																	140714982		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.254A>G	8.37:g.140714982T>C	ENSP00000430676:p.Tyr85Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M290|Q540F2	Missense_Mutation	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TASK3,prints_2pore_dom_K_chnl	p.Y85C	ENST00000520439.1	37	c.254	CCDS6377.1	8	.	.	.	.	.	.	.	.	.	.	T	20.9	4.065939	0.76187	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.48201	0.82;0.82;0.82	3.87	3.87	0.44632	Ion transport 2 (1);	0.176734	0.39615	N	0.001315	T	0.78698	0.4324	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85590	0.1245	10	0.87932	D	0	.	12.1363	0.53972	0.0:0.0:0.0:1.0	.	85	Q9NPC2	KCNK9_HUMAN	C	85	ENSP00000429847:Y85C;ENSP00000302166:Y85C;ENSP00000430676:Y85C	ENSP00000302166:Y85C	Y	-	2	0	KCNK9	140784164	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.086000	0.76885	1.499000	0.48617	0.454000	0.30748	TAC	KCNK9	-	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK	ENSG00000169427		0.682	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK9	HGNC	protein_coding	OTTHUMT00000378473.1	38	0.00	0	T	NM_016601		140714982	140714982	-1	no_errors	ENST00000303015	ensembl	human	known	69_37n	missense	70	17.24	15	SNP	1.000	C
KMT2C	58508	genome.wustl.edu	37	7	151860728	151860728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr7:151860728G>A	ENST00000262189.6	-	43	10152	c.9934C>T	c.(9934-9936)Cag>Tag	p.Q3312*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.Q3312*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3312	Gln-rich.|Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Q3312*(2)									TGCTGGTGCTGAAGCTGCTGT	0.572																																						dbGAP											2	Substitution - Nonsense(2)	biliary_tract(2)											149.0	124.0	132.0					7																	151860728		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.9934C>T	7.37:g.151860728G>A	ENSP00000262189:p.Gln3312*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3312*	ENST00000262189.6	37	c.9934	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	53|53	20.438130|20.438130	0.99930|0.99930	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193|ENST00000360104	.|.	.|.	.|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.195128|.	0.25792|.	N|.	0.028267|.	.|T	.|0.74176	.|0.3682	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73871	.|-0.3846	.|4	0.02654|.	T|.	1|.	.|.	18.2295|18.2295	0.89929|0.89929	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	3312|817	.|.	ENSP00000262189:Q3312X|.	Q|S	-|-	1|2	0|0	MLL3|MLL3	151491661|151491661	1.000000|1.000000	0.71417|0.71417	0.960000|0.960000	0.40013|0.40013	0.994000|0.994000	0.84299|0.84299	9.109000|9.109000	0.94291|0.94291	2.275000|2.275000	0.75901|0.75901	0.655000|0.655000	0.94253|0.94253	CAG|TCA	MLL3	-	NULL	ENSG00000055609		0.572	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	159	0.00	0	G			151860728	151860728	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	nonsense	75	42.31	55	SNP	1.000	A
MUC5B	727897	genome.wustl.edu	37	11	1251806	1251806	+	Silent	SNP	G	G	A	rs562331900	byFrequency	TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr11:1251806G>A	ENST00000529681.1	+	12	1504	c.1446G>A	c.(1444-1446)acG>acA	p.T482T	MUC5B_ENST00000447027.1_Silent_p.T485T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	482	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AAGCGGTGACGCTCAGCCTGG	0.652													g|||	2	0.000399361	0.0015	0.0	5008	,	,		14778	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													42.0	50.0	47.0					11																	1251806		2135	4231	6366	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1446G>A	11.37:g.1251806G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T485	ENST00000529681.1	37	c.1455	CCDS44515.2	11																																																																																			MUC5B	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000117983		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	18	0.00	0	G	XM_001126093		1251806	1251806	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	10	54.17	13	SNP	0.192	A
NEGR1	257194	genome.wustl.edu	37	1	72241932	72241932	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr1:72241932C>T	ENST00000357731.5	-	3	697	c.458G>A	c.(457-459)gGa>gAa	p.G153E	NEGR1_ENST00000306821.3_Missense_Mutation_p.G25E|NEGR1_ENST00000467479.1_5'UTR|NEGR1_ENST00000434200.1_Missense_Mutation_p.G151E	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	153	Ig-like C2-type 2.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		GACGTTGGTTCCTTCATTGAC	0.388																																						dbGAP											0													115.0	104.0	108.0					1																	72241932		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.458G>A	1.37:g.72241932C>T	ENSP00000350364:p.Gly153Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G153E	ENST00000357731.5	37	c.458	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535609	0.64972	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.80653	-1.4;-1.4;-1.4	5.67	5.67	0.87782	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91036	0.7180	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.92232	0.5793	10	0.87932	D	0	-8.9553	18.5327	0.90999	0.0:1.0:0.0:0.0	.	151;153	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	E	153;25;151	ENSP00000350364:G153E;ENSP00000305938:G25E;ENSP00000413294:G151E	ENSP00000305938:G25E	G	-	2	0	NEGR1	72014520	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	7.137000	0.77295	2.670000	0.90874	0.655000	0.94253	GGA	NEGR1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000172260		0.388	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	HGNC	protein_coding	OTTHUMT00000026722.4	65	0.00	0	C	NM_173808		72241932	72241932	-1	no_errors	ENST00000357731	ensembl	human	known	69_37n	missense	32	43.86	25	SNP	1.000	T
NPIPB15	440348	genome.wustl.edu	37	16	74419288	74419288	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr16:74419288T>C	ENST00000429990.1	+	3	394	c.298T>C	c.(298-300)Tcc>Ccc	p.S100P				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	100						extracellular region (GO:0005576)											ACATGATGGATCCACGGATGT	0.488																																						dbGAP											0													9.0	8.0	9.0					16																	74419288		1291	2203	3494	-	-	-	SO:0001583	missense	0			BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.298T>C	16.37:g.74419288T>C	ENSP00000411140:p.Ser100Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J9U8	Missense_Mutation	SNP	pfam_NPIP	p.S100P	ENST00000429990.1	37	c.298		16	.	.	.	.	.	.	.	.	.	.	t	9.335	1.061474	0.19987	.	.	ENSG00000196436	ENST00000429990	T	0.58652	0.32	.	.	.	.	.	.	.	.	T	0.66499	0.2795	L	0.54323	1.7	0.09310	N	1	D	0.76494	0.999	D	0.91635	0.999	T	0.54576	-0.8273	7	0.87932	D	0	.	.	.	.	.	39	A6NHN6	NPPL2_HUMAN	P	100	ENSP00000411140:S100P	ENSP00000411140:S100P	S	+	1	0	NPIPL2	72976789	0.999000	0.42202	0.040000	0.18447	0.052000	0.14988	0.648000	0.24828	0.056000	0.16144	0.055000	0.15244	TCC	NPIPL2	-	pfam_NPIP	ENSG00000196436		0.488	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPL2	HGNC	protein_coding	OTTHUMT00000346597.2	344	0.00	0	T	NM_001018059		74419288	74419288	+1	no_errors	ENST00000429990	ensembl	human	known	69_37n	missense	167	32.93	82	SNP	0.043	C
NPLOC4	55666	genome.wustl.edu	37	17	79526303	79526303	+	Silent	SNP	G	G	A			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr17:79526303G>A	ENST00000331134.6	-	17	2024	c.1809C>T	c.(1807-1809)tgC>tgT	p.C603C	NPLOC4_ENST00000573876.1_3'UTR|NPLOC4_ENST00000572760.1_3'UTR	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	603					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TGGGGAGGCTGCACATCTCGC	0.662																																						dbGAP											0													19.0	25.0	23.0					17																	79526303		2071	4202	6273	-	-	-	SO:0001819	synonymous_variant	0			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1809C>T	17.37:g.79526303G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Silent	SNP	pfam_NPL4,pfam_NPL4_Zn-bd_put,pfam_Npl4_Ub-like_dom,smart_Znf_RanBP2,pirsf_PolyUb_recognition_cplx_Npl4,pfscan_Znf_RanBP2	p.C603	ENST00000331134.6	37	c.1809	CCDS45812.1	17																																																																																			NPLOC4	-	smart_Znf_RanBP2,pfscan_Znf_RanBP2	ENSG00000182446		0.662	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	HGNC	protein_coding	OTTHUMT00000440140.1	18	0.00	0	G			79526303	79526303	-1	no_errors	ENST00000331134	ensembl	human	known	69_37n	silent	19	17.39	4	SNP	1.000	A
OR2W5	441932	genome.wustl.edu	37	1	247655187	247655187	+	RNA	SNP	G	G	A	rs532925117		TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr1:247655187G>A	ENST00000522351.1	+	0	818							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R253Q(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCTCTTCTACGGAACCATCAT	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		17854	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	endometrium(1)											135.0	118.0	124.0					1																	247655187		2203	4300	6503	-	-	-			0					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655187G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH85	RNA	SNP	-	NULL	ENST00000522351.1	37	NULL		1																																																																																			OR2W5	-	-	ENSG00000203664		0.537	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	HGNC	pseudogene	OTTHUMT00000375789.1	33	0.00	0	G	NM_001004698		247655187	247655187	+1	no_errors	ENST00000522351	ensembl	human	known	69_37n	rna	31	13.89	5	SNP	0.375	A
PRR16	51334	genome.wustl.edu	37	5	120022380	120022380	+	Silent	SNP	G	G	A			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr5:120022380G>A	ENST00000407149.2	+	2	1100	c.891G>A	c.(889-891)agG>agA	p.R297R	PRR16_ENST00000505123.1_Silent_p.R227R|PRR16_ENST00000379551.2_Silent_p.R274R|PRR16_ENST00000446965.1_Silent_p.R227R			Q569H4	LARGN_HUMAN	proline rich 16	297					positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CGATCTTGAGGAAGTCAACCA	0.398																																						dbGAP											0													58.0	59.0	59.0					5																	120022380		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.891G>A	5.37:g.120022380G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ0|Q8IXY1|Q9NYI5	Silent	SNP	NULL	p.R297	ENST00000407149.2	37	c.891		5																																																																																			PRR16	-	NULL	ENSG00000184838		0.398	PRR16-002	KNOWN	basic|appris_principal	protein_coding	PRR16	HGNC	protein_coding	OTTHUMT00000371059.1	27	0.00	0	G	NM_016644		120022380	120022380	+1	no_errors	ENST00000407149	ensembl	human	known	69_37n	silent	5	50.00	5	SNP	1.000	A
PCDHGA11	56105	genome.wustl.edu	37	5	140802650	140802650	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr5:140802650C>T	ENST00000398587.2	+	1	1889	c.1856C>T	c.(1855-1857)gCg>gTg	p.A619V	PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.A619V|PCDHGA6_ENST00000517434.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	619	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACTCTTCGCGGTGGGGGAG	0.662																																						dbGAP											0													46.0	55.0	52.0					5																	140802650		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1856C>T	5.37:g.140802650C>T	ENSP00000381589:p.Ala619Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A619V	ENST00000398587.2	37	c.1856	CCDS47294.1	5	.	.	.	.	.	.	.	.	.	.	c	2.679	-0.275823	0.05679	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.53206	0.63;2.09	5.37	3.58	0.41010	Cadherin (4);Cadherin-like (1);	0.000000	0.28527	U	0.015025	T	0.27063	0.0663	N	0.20304	0.555	0.09310	N	1	B;B;B	0.31351	0.06;0.32;0.084	B;B;B	0.22753	0.015;0.041;0.014	T	0.18967	-1.0320	10	0.72032	D	0.01	.	5.6543	0.17635	0.2966:0.5546:0.0:0.1489	.	619;619;619	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	V	619	ENSP00000381589:A619V;ENSP00000428333:A619V	ENSP00000381589:A619V	A	+	2	0	PCDHGA11	140782834	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.663000	0.01968	0.641000	0.30601	0.561000	0.74099	GCG	PCDHGA11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253873		0.662	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1	32	0.00	0	C	NM_018914		140802650	140802650	+1	no_errors	ENST00000398587	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.000	T
PRRG2	5639	genome.wustl.edu	37	19	50091757	50091757	+	Missense_Mutation	SNP	G	G	A	rs538503371		TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr19:50091757G>A	ENST00000246794.5	+	5	474	c.305G>A	c.(304-306)cGt>cAt	p.R102H	PRRG2_ENST00000596700.1_Intron	NM_000951.2	NP_000942.1	O14669	TMG2_HUMAN	proline rich Gla (G-carboxyglutamic acid) 2	102						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			lung(1)|skin(1)|soft_tissue(1)	3		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)		CCTGCAGGGCGTGGACGAGTG	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17662	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													36.0	29.0	32.0					19																	50091757		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS12773.1	19q13.33	2008-02-05	2004-05-27						9470	protein-coding gene	gene with protein product		604429	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 2"""			9256434	Standard	NM_000951		Approved	PRGP2	uc002pon.3	O14669		ENST00000246794.5:c.305G>A	19.37:g.50091757G>A	ENSP00000246794:p.Arg102His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IBF8	Missense_Mutation	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,prints_GLA_domain,pfscan_GLA_domain	p.R102H	ENST00000246794.5	37	c.305	CCDS12773.1	19	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659726	0.29515	.	.	ENSG00000126460	ENST00000246794;ENST00000543867	D	0.99771	-6.71	5.62	0.723	0.18231	Gamma-carboxyglutamic acid-rich (GLA) domain (1);	0.617241	0.16399	N	0.216122	D	0.98839	0.9608	M	0.70275	2.135	0.24772	N	0.992868	B;B	0.14805	0.011;0.006	B;B	0.12156	0.007;0.003	D	0.99979	1.2389	10	0.51188	T	0.08	-8.1878	3.8455	0.08933	0.2985:0.1813:0.5202:0.0	.	79;102	F5GZ13;O14669	.;TMG2_HUMAN	H	102;79	ENSP00000246794:R102H	ENSP00000246794:R102H	R	+	2	0	PRRG2	54783569	0.917000	0.31117	0.728000	0.30774	0.447000	0.32167	0.539000	0.23175	0.744000	0.32741	0.563000	0.77884	CGT	PRRG2	-	superfamily_GLA_domain	ENSG00000126460		0.612	PRRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG2	HGNC	protein_coding	OTTHUMT00000465257.1	31	0.00	0	G	NM_000951		50091757	50091757	+1	no_errors	ENST00000246794	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.245	A
RECQL	5965	genome.wustl.edu	37	12	21639494	21639494	+	Silent	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr12:21639494C>T	ENST00000444129.2	-	5	888	c.420G>A	c.(418-420)ttG>ttA	p.L140L	RECQL_ENST00000421138.2_Silent_p.L140L	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	140	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TAAGAGAGATCAATGGGCAAA	0.333								Other identified genes with known or suspected DNA repair function																														dbGAP											0													56.0	55.0	55.0					12																	21639494		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.420G>A	12.37:g.21639494C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G2	Silent	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.L140	ENST00000444129.2	37	c.420	CCDS31756.1	12																																																																																			RECQL	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.333	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	49	0.00	0	C	NM_002907		21639494	21639494	-1	no_errors	ENST00000421138	ensembl	human	known	69_37n	silent	16	50.00	16	SNP	1.000	T
SAMD4A	23034	genome.wustl.edu	37	14	55169153	55169153	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr14:55169153G>T	ENST00000554335.1	+	3	1233	c.570G>T	c.(568-570)tgG>tgT	p.W190C	SAMD4A_ENST00000555112.1_3'UTR|SAMD4A_ENST00000392067.3_Missense_Mutation_p.W190C|SAMD4A_ENST00000251091.5_Missense_Mutation_p.W190C|SAMD4A_ENST00000357634.3_Missense_Mutation_p.W189C			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	190					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						TCAATGGGTGGCAGAACTCTC	0.522																																						dbGAP											0													70.0	61.0	64.0					14																	55169153		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.570G>T	14.37:g.55169153G>T	ENSP00000452535:p.Trp190Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.W190C	ENST00000554335.1	37	c.570	CCDS32084.2	14	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202433	0.79127	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634	T;T;T	0.73258	-0.73;-0.73;-0.73	6.02	6.02	0.97574	.	0.063077	0.64402	D	0.000002	D	0.84275	0.5436	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.81320	-0.0986	10	0.38643	T	0.18	-2.5991	20.5407	0.99260	0.0:0.0:1.0:0.0	.	89;190;190	Q9UPU9-2;Q9UPU9-3;Q9UPU9	.;.;SMAG1_HUMAN	C	190;190;190;189;189	ENSP00000452535:W190C;ENSP00000375919:W190C;ENSP00000350261:W189C	ENSP00000306381:W190C	W	+	3	0	SAMD4A	54238903	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.298000	0.78815	2.865000	0.98341	0.655000	0.94253	TGG	SAMD4A	-	NULL	ENSG00000020577		0.522	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4A	HGNC	protein_coding	OTTHUMT00000411186.1	34	0.00	0	G	NM_015589		55169153	55169153	+1	no_errors	ENST00000392067	ensembl	human	known	69_37n	missense	11	56.00	14	SNP	1.000	T
SHANK1	50944	genome.wustl.edu	37	19	51165718	51165718	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr19:51165718C>T	ENST00000293441.1	-	23	6008	c.5990G>A	c.(5989-5991)cGg>cAg	p.R1997Q	SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000483981.2_5'UTR|SHANK1_ENST00000359082.3_Missense_Mutation_p.R1988Q|SHANK1_ENST00000391813.1_Missense_Mutation_p.R1384Q|SHANK1_ENST00000391814.1_Missense_Mutation_p.R2005Q	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1997					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GCTGGGGGCCCGGCGGAGCAG	0.741																																						dbGAP											0													9.0	10.0	10.0					19																	51165718		2122	4146	6268	-	-	-	SO:0001583	missense	0			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5990G>A	19.37:g.51165718C>T	ENSP00000293441:p.Arg1997Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.R2005Q	ENST00000293441.1	37	c.6014	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	c	13.63	2.294582	0.40594	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.46819	0.95;1.47;0.97;0.86	3.97	3.97	0.46021	.	1.376210	0.05344	U	0.530587	T	0.50017	0.1591	L	0.36672	1.1	0.44110	D	0.996884	P;D	0.54207	0.89;0.965	B;P	0.46718	0.254;0.525	T	0.47812	-0.9088	10	0.46703	T	0.11	.	15.2986	0.73928	0.0:1.0:0.0:0.0	.	1997;1384	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	Q	1997;1384;1988;2005	ENSP00000293441:R1997Q;ENSP00000375689:R1384Q;ENSP00000351984:R1988Q;ENSP00000375690:R2005Q	ENSP00000293441:R1997Q	R	-	2	0	SHANK1	55857530	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.451000	0.44952	2.222000	0.72286	0.455000	0.32223	CGG	SHANK1	-	NULL	ENSG00000161681		0.741	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	18	0.00	0	C	NM_016148		51165718	51165718	-1	no_errors	ENST00000391814	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	1.000	T
JMJD8	339123	genome.wustl.edu	37	16	731865	731865	+	3'UTR	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr16:731865C>T	ENST00000293882.4	-	0	1933				STUB1_ENST00000566181.2_3'UTR|STUB1_ENST00000219548.4_Silent_p.C199C|LA16c-313D11.9_ENST00000571933.1_RNA|LA16c-313D11.9_ENST00000567091.1_RNA|JMJD8_ENST00000609261.1_3'UTR|JMJD8_ENST00000454700.1_3'UTR|STUB1_ENST00000565677.1_Silent_p.C127C|JMJD8_ENST00000412368.2_3'UTR|STUB1_ENST00000564370.1_Silent_p.C127C			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						AGCAGGCCTGCATTGAGGCCA	0.662																																						dbGAP											0													42.0	43.0	43.0					16																	731865		2199	4300	6499	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.*929G>A	16.37:g.731865C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Missense_Mutation	SNP	pfam_Ubox_domain,smart_Ubox_domain,pfscan_TPR-contain_dom	p.A105V	ENST00000293882.4	37	c.314		16																																																																																			STUB1	-	NULL	ENSG00000103266		0.662	JMJD8-201	KNOWN	basic	protein_coding	STUB1	HGNC	protein_coding		29	0.00	0	C	NM_001005920		731865	731865	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000566408	ensembl	human	putative	69_37n	missense	16	55.56	20	SNP	1.000	T
TGM2	7052	genome.wustl.edu	37	20	36776418	36776418	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr20:36776418C>T	ENST00000361475.2	-	5	799	c.626G>A	c.(625-627)cGt>cAt	p.R209H	TGM2_ENST00000536701.1_Missense_Mutation_p.R128H|TGM2_ENST00000536724.1_Missense_Mutation_p.R149H	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	209					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	GGAGCAGTCACGGCCGGCGTT	0.602																																						dbGAP											0													31.0	30.0	30.0					20																	36776418		2203	4300	6503	-	-	-	SO:0001583	missense	0			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.626G>A	20.37:g.36776418C>T	ENSP00000355330:p.Arg209His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.R209H	ENST00000361475.2	37	c.626	CCDS13302.1	20	.	.	.	.	.	.	.	.	.	.	C	6.884	0.532633	0.13127	.	.	ENSG00000198959	ENST00000361475;ENST00000536701;ENST00000536724;ENST00000373403	D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47	4.78	2.87	0.33458	.	0.258529	0.36740	N	0.002429	D	0.86723	0.6001	L	0.51422	1.61	0.09310	N	1	P;P;D;P;P;P	0.58620	0.956;0.909;0.983;0.905;0.926;0.752	B;B;P;B;B;B	0.49332	0.429;0.239;0.607;0.358;0.247;0.176	T	0.77986	-0.2381	10	0.41790	T	0.15	-5.8723	8.1852	0.31335	0.0:0.7385:0.0:0.2615	.	149;128;209;209;149;209	F5H6P0;B4DIT7;P21980-3;P21980-2;B4DTN7;P21980	.;.;.;.;.;TGM2_HUMAN	H	209;128;149;209	ENSP00000355330:R209H;ENSP00000444701:R128H;ENSP00000437479:R149H;ENSP00000362502:R209H	ENSP00000355330:R209H	R	-	2	0	TGM2	36209832	0.003000	0.15002	0.010000	0.14722	0.159000	0.22180	0.493000	0.22451	0.628000	0.30357	-0.379000	0.06801	CGT	TGM2	-	NULL	ENSG00000198959		0.602	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM2	HGNC	protein_coding	OTTHUMT00000079151.2	13	0.00	0	C	NM_198951		36776418	36776418	-1	no_errors	ENST00000361475	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.003	T
TTC39A	22996	genome.wustl.edu	37	1	51767913	51767913	+	Intron	DEL	C	C	-	rs375305601		TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr1:51767913delC	ENST00000447632.2	-	11	1048				TTC39A_ENST00000262676.5_Frame_Shift_Del_p.G368fs|TTC39A_ENST00000262675.7_Intron|TTC39A_ENST00000413473.2_Intron|TTC39A_ENST00000371747.3_Intron|TTC39A_ENST00000371750.5_Intron|TTC39A_ENST00000451380.1_Intron			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A									p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						TCTCTCTTGGCCCCCCCCCCG	0.647																																						dbGAP											2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)																																								-	-	-	SO:0001627	intron_variant	0			AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.999+115G>-	1.37:g.51767913delC		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Frame_Shift_Del	DEL	pfam_OMP_IML2_mit/TPR_39	p.G368fs	ENST00000447632.2	37	c.1103		1																																																																																			TTC39A	-	NULL	ENSG00000085831		0.647	TTC39A-004	KNOWN	basic	protein_coding	TTC39A	HGNC	protein_coding	OTTHUMT00000022434.2	10	0.00	0	C			51767913	51767913	-1	no_errors	ENST00000262676	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.000	-
TP53BP2	7159	genome.wustl.edu	37	1	223971901	223971901	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr1:223971901G>C	ENST00000343537.7	-	17	3570	c.3279C>G	c.(3277-3279)atC>atG	p.I1093M	TP53BP2_ENST00000391878.2_Missense_Mutation_p.I964M|TP53BP2_ENST00000391879.2_Missense_Mutation_p.I326M|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	1087	Mediates interaction with APC2.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		CTTCCCTGTGGATGATTGTCA	0.448																																						dbGAP											0													225.0	207.0	213.0					1																	223971901		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.3279C>G	1.37:g.223971901G>C	ENSP00000341957:p.Ile1093Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.I1093M	ENST00000343537.7	37	c.3279	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764384	0.31228	.	.	ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879	T;T;T	0.55588	0.51;0.51;0.51	5.97	1.76	0.24704	Src homology-3 domain (4);Spectrin alpha chain, SH3 domain (1);	0.786148	0.11966	N	0.512289	T	0.50377	0.1612	M	0.71871	2.18	0.46356	D	0.999006	B;B	0.28419	0.106;0.211	B;B	0.33196	0.159;0.101	T	0.49418	-0.8942	10	0.56958	D	0.05	.	5.2939	0.15741	0.1319:0.4468:0.3138:0.1076	.	1093;1087	B4DG66;Q13625	.;ASPP2_HUMAN	M	964;1093;326	ENSP00000375750:I964M;ENSP00000341957:I1093M;ENSP00000375751:I326M	ENSP00000341957:I1093M	I	-	3	3	TP53BP2	222038524	0.990000	0.36364	0.901000	0.35422	0.668000	0.39293	0.190000	0.17057	0.386000	0.24997	0.585000	0.79938	ATC	TP53BP2	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	ENSG00000143514		0.448	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	62	0.00	0	G	NM_001031685, NM_005426		223971901	223971901	-1	no_errors	ENST00000343537	ensembl	human	known	69_37n	missense	37	66.67	74	SNP	0.970	C
UBC	7316	genome.wustl.edu	37	12	125396630	125396631	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr12:125396630_125396631insG	ENST00000538617.1	-	4	863_864	c.547_548insC	c.(547-549)caafs	p.Q183fs	UBC_ENST00000536661.1_5'Flank|UBC_ENST00000546120.1_Frame_Shift_Ins_p.Q487fs|UBC_ENST00000339647.5_Frame_Shift_Ins_p.Q563fs|UBC_ENST00000536769.1_Frame_Shift_Ins_p.Q563fs			P0CG48	UBC_HUMAN	ubiquitin C	563	Ubiquitin-like 3. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TTCCTTGTCTTGGATCTTTGCC	0.51																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.548dupC	12.37:g.125396632_125396632dupG	ENSP00000443053:p.Gln183fs	Somatic		WXS	Illumina GAIIx	Phase_IV	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Frame_Shift_Ins	INS	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.Q563fs	ENST00000538617.1	37	c.1688_1687		12																																																																																			UBC	-	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	ENSG00000150991		0.510	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400179.1	43	0.00	0	-	NM_021009		125396630	125396631	-1	no_errors	ENST00000339647	ensembl	human	known	69_37n	frame_shift_ins	22	37.14	13	INS	1.000:1.000	G
UBE2Q2P1	388165	genome.wustl.edu	37	15	85070737	85070738	+	RNA	INS	-	-	A	rs202234771|rs368120520|rs148315064	byFrequency	TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr15:85070737_85070738insA	ENST00000560239.1	-	0	0				UBE2Q2P1_ENST00000339094.1_RNA																							caaaacaaaacaaacaaaaAAC	0.386																																						dbGAP											0																																										-	-	-			0																															15.37:g.85070740_85070740dupA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000560239.1	37	NULL		15																																																																																			UBE2Q2P1	-	-	ENSG00000189136		0.386	RP11-182J1.12-001	KNOWN	mRNA_end_NF|basic|readthrough_transcript	processed_transcript	UBE2Q2P1	HGNC	processed_transcript	OTTHUMT00000418581.1	11	0.00	0	-			85070737	85070738	-1	no_errors	ENST00000339094	ensembl	human	known	69_37n	rna	5	37.50	3	INS	0.007:0.009	A
UBN1	29855	genome.wustl.edu	37	16	4924371	4924371	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr16:4924371C>T	ENST00000396658.4	+	14	2663	c.1960C>T	c.(1960-1962)Cct>Tct	p.P654S	UBN1_ENST00000545171.1_Missense_Mutation_p.P654S|UBN1_ENST00000590769.1_Missense_Mutation_p.P654S|UBN1_ENST00000262376.6_Missense_Mutation_p.P654S	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	654					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						TAACCCTCCTCCTGTCAACCT	0.572																																						dbGAP											0													106.0	104.0	105.0					16																	4924371		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1960C>T	16.37:g.4924371C>T	ENSP00000379894:p.Pro654Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	NULL	p.P654S	ENST00000396658.4	37	c.1960	CCDS10525.1	16	.	.	.	.	.	.	.	.	.	.	C	1.994	-0.431053	0.04669	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.41065	1.6;1.01;1.6	4.64	-2.4	0.06583	.	0.585151	0.16534	N	0.210238	T	0.18841	0.0452	L	0.28740	0.885	0.09310	N	0.999995	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.16482	-1.0401	10	0.11485	T	0.65	-2.2166	0.438	0.00482	0.2148:0.2049:0.2803:0.2999	.	654;654	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	S	654	ENSP00000262376:P654S;ENSP00000442379:P654S;ENSP00000379894:P654S	ENSP00000262376:P654S	P	+	1	0	UBN1	4864372	0.013000	0.17824	0.015000	0.15790	0.339000	0.28857	0.159000	0.16442	-0.237000	0.09739	-0.254000	0.11334	CCT	UBN1	-	NULL	ENSG00000118900		0.572	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBN1	HGNC	protein_coding	OTTHUMT00000251719.1	17	0.00	0	C	NM_016936		4924371	4924371	+1	no_errors	ENST00000262376	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.096	T
UBQLN3	50613	genome.wustl.edu	37	11	5530467	5530467	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr11:5530467G>A	ENST00000311659.4	-	2	469	c.322C>T	c.(322-324)Cct>Tct	p.P108S	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	108										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCTGGGTAGGGACAGAGGCA	0.607																																					Ovarian(72;684 1260 12332 41642 52180)	dbGAP											0													70.0	66.0	67.0					11																	5530467		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.322C>T	11.37:g.5530467G>A	ENSP00000347997:p.Pro108Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NRE0	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,superfamily_ARM-type_fold,smart_Ubiquitin,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.P108S	ENST00000311659.4	37	c.322	CCDS7758.1	11	.	.	.	.	.	.	.	.	.	.	G	5.246	0.230794	0.09969	.	.	ENSG00000175520	ENST00000311659;ENST00000445998	T;T	0.52754	1.22;0.65	4.87	3.95	0.45737	.	0.142117	0.32687	N	0.005768	T	0.35653	0.0939	L	0.45228	1.405	0.26849	N	0.968208	B	0.18741	0.03	B	0.12156	0.007	T	0.17077	-1.0381	10	0.21014	T	0.42	.	8.9439	0.35747	0.1081:0.0:0.8919:0.0	.	108	Q9H347	UBQL3_HUMAN	S	108	ENSP00000347997:P108S;ENSP00000412561:P108S	ENSP00000347997:P108S	P	-	1	0	UBQLN3	5487043	0.926000	0.31397	0.920000	0.36463	0.943000	0.58893	1.646000	0.37249	1.343000	0.45638	0.484000	0.47621	CCT	UBQLN3	-	NULL	ENSG00000175520		0.607	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN3	HGNC	protein_coding	OTTHUMT00000143348.1	53	0.00	0	G	NM_017481		5530467	5530467	-1	no_errors	ENST00000311659	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	0.840	A
USP53	54532	genome.wustl.edu	37	4	120193097	120193097	+	Silent	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr4:120193097C>T	ENST00000274030.6	+	16	3261	c.2082C>T	c.(2080-2082)atC>atT	p.I694I	USP53_ENST00000450251.1_Silent_p.I694I	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						GTGATCACATCAGTAATGGTT	0.393																																						dbGAP											0													139.0	129.0	132.0					4																	120193097		1947	4170	6117	-	-	-	SO:0001819	synonymous_variant	0			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.2082C>T	4.37:g.120193097C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.I694	ENST00000274030.6	37	c.2082	CCDS43265.1	4																																																																																			USP53	-	NULL	ENSG00000145390		0.393	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP53	HGNC	protein_coding	OTTHUMT00000364564.2	32	0.00	0	C	XM_052597		120193097	120193097	+1	no_errors	ENST00000274030	ensembl	human	known	69_37n	silent	18	40.00	12	SNP	1.000	T
VRK1	7443	genome.wustl.edu	37	14	97299833	97299833	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr14:97299833G>A	ENST00000216639.3	+	2	174	c.25G>A	c.(25-27)Gct>Act	p.A9T		NM_003384.2	NP_003375.1	Q99986	VRK1_HUMAN	vaccinia related kinase 1	9					Golgi disassembly (GO:0090166)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-T3 phosphorylation (GO:0072355)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi stack (GO:0005795)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H3-S10 specific) (GO:0035175)|histone kinase activity (H3-T3 specific) (GO:0072354)|nucleosomal histone binding (GO:0031493)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(1)|stomach(1)	12		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		AGCAGCTCAAGCTGGAAGACA	0.363																																						dbGAP											0													91.0	88.0	89.0					14																	97299833		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB000449	CCDS9947.1	14q32.2	2012-07-05			ENSG00000100749	ENSG00000100749			12718	protein-coding gene	gene with protein product		602168				9344656	Standard	XM_006720247		Approved		uc001yft.3	Q99986	OTTHUMG00000171459	ENST00000216639.3:c.25G>A	14.37:g.97299833G>A	ENSP00000216639:p.Ala9Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYL2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.A9T	ENST00000216639.3	37	c.25	CCDS9947.1	14	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882796	0.33255	.	.	ENSG00000100749	ENST00000216639	T	0.21191	2.02	5.95	2.96	0.34315	.	0.393637	0.27705	N	0.018195	T	0.18173	0.0436	L	0.54323	1.7	0.09310	N	0.999998	B	0.29212	0.237	B	0.19391	0.025	T	0.16041	-1.0416	10	0.59425	D	0.04	-10.9595	8.7646	0.34696	0.0694:0.1201:0.6999:0.1106	.	9	Q99986	VRK1_HUMAN	T	9	ENSP00000216639:A9T	ENSP00000216639:A9T	A	+	1	0	VRK1	96369586	0.998000	0.40836	0.247000	0.24249	0.638000	0.38207	2.196000	0.42686	0.857000	0.35407	-0.894000	0.02916	GCT	VRK1	-	NULL	ENSG00000100749		0.363	VRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VRK1	HGNC	protein_coding	OTTHUMT00000413520.1	60	0.00	0	G	NM_003384		97299833	97299833	+1	no_errors	ENST00000216639	ensembl	human	known	69_37n	missense	24	42.86	18	SNP	0.120	A
ZNF429	353088	genome.wustl.edu	37	19	21719514	21719514	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr19:21719514A>G	ENST00000358491.4	+	4	867	c.659A>G	c.(658-660)aAg>aGg	p.K220R	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						ACTAACCATAAGAGAATTTAT	0.353																																						dbGAP											0													56.0	62.0	60.0					19																	21719514		2163	4269	6432	-	-	-	SO:0001583	missense	0			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.659A>G	19.37:g.21719514A>G	ENSP00000351280:p.Lys220Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLV7|Q9BZE6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K220R	ENST00000358491.4	37	c.659	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	7.232	0.599568	0.13939	.	.	ENSG00000197013	ENST00000358491	T	0.01178	5.22	0.81	-1.62	0.08372	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00875	0.0029	L	0.31207	0.915	0.09310	N	0.999996	P	0.42409	0.779	B	0.37480	0.251	T	0.48790	-0.9004	9	0.41790	T	0.15	.	2.626	0.04929	0.4887:0.2711:0.2401:0.0	.	220	Q86V71	ZN429_HUMAN	R	220	ENSP00000351280:K220R	ENSP00000351280:K220R	K	+	2	0	ZNF429	21511354	0.000000	0.05858	0.154000	0.22540	0.153000	0.21895	0.486000	0.22340	0.156000	0.19299	0.155000	0.16302	AAG	ZNF429	-	pfscan_Znf_C2H2	ENSG00000197013		0.353	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	HGNC	protein_coding	OTTHUMT00000463981.1	81	0.00	0	A	NM_001001415		21719514	21719514	+1	no_errors	ENST00000358491	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.713	G
ZNF285	26974	genome.wustl.edu	37	19	44891754	44891754	+	Missense_Mutation	SNP	G	G	A	rs187757032		TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr19:44891754G>A	ENST00000330997.4	-	4	717	c.653C>T	c.(652-654)aCg>aTg	p.T218M	ZNF285_ENST00000591679.1_Missense_Mutation_p.T225M|ZNF285_ENST00000544719.2_Missense_Mutation_p.T218M|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TTTTTCAACCGTTGATTTCAT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		19475	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													102.0	100.0	100.0					19																	44891754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.653C>T	19.37:g.44891754G>A	ENSP00000333595:p.Thr218Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T218M	ENST00000330997.4	37	c.653	CCDS12638.1	19	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	7.314	0.615506	0.14129	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.28895	1.59	3.37	2.29	0.28610	.	.	.	.	.	T	0.27967	0.0689	L	0.56199	1.76	0.09310	N	1	D;D	0.69078	0.997;0.997	B;B	0.44315	0.446;0.446	T	0.11324	-1.0592	9	0.37606	T	0.19	.	6.0692	0.19879	0.0:0.1797:0.4728:0.3474	.	242;218	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	M	241;218	ENSP00000333595:T218M	ENSP00000333595:T218M	T	-	2	0	ZNF285	49583594	0.002000	0.14202	0.001000	0.08648	0.147000	0.21601	0.765000	0.26546	0.722000	0.32252	0.454000	0.30748	ACG	ZNF285	-	NULL	ENSG00000267508		0.463	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	41	0.00	0	G	NM_152354		44891754	44891754	-1	no_errors	ENST00000330997	ensembl	human	known	69_37n	missense	28	30.00	12	SNP	0.000	A
ZNF548	147694	genome.wustl.edu	37	19	57908526	57908526	+	Silent	SNP	C	C	T			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr19:57908526C>T	ENST00000366197.5	+	2	376	c.126C>T	c.(124-126)gcC>gcT	p.A42A	AC004076.7_ENST00000597410.1_Intron|ZNF548_ENST00000597400.1_Silent_p.A54A|ZNF548_ENST00000598895.1_Silent_p.A54A|AC003002.6_ENST00000596400.1_Intron|AC003002.6_ENST00000600421.1_3'UTR|AC003002.4_ENST00000597658.1_Intron|ZNF548_ENST00000336128.7_Silent_p.A54A	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	42	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGAATTTGGCCCTTTTGTCCT	0.527																																						dbGAP											0													444.0	401.0	416.0					19																	57908526		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.126C>T	19.37:g.57908526C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96M05	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A54	ENST00000366197.5	37	c.162	CCDS46209.1	19																																																																																			ZNF548	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000188785		0.527	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF548	HGNC	protein_coding	OTTHUMT00000465937.1	140	0.71	1	C	NM_152909		57908526	57908526	+1	no_errors	ENST00000336128	ensembl	human	known	69_37n	silent	93	43.29	71	SNP	0.001	T
ZNF623	9831	genome.wustl.edu	37	8	144732952	144732952	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24N-01A-11D-A167-09	TCGA-AR-A24N-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b85b311c-1b29-44e3-8585-6995f9259221	ea4ba75b-b641-4127-8705-e9bc15f24f4c	g.chr8:144732952T>C	ENST00000501748.2	+	1	999	c.910T>C	c.(910-912)Tca>Cca	p.S304P	ZNF623_ENST00000458270.2_Missense_Mutation_p.S264P|ZNF623_ENST00000526926.1_Missense_Mutation_p.S264P	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CCGTCATCGCTCAGACCTTAT	0.453																																						dbGAP											0													98.0	90.0	93.0					8																	144732952		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.910T>C	8.37:g.144732952T>C	ENSP00000445979:p.Ser304Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S304P	ENST00000501748.2	37	c.910	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	T	14.45	2.540350	0.45176	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.07908	3.15;3.15;3.15	4.01	4.01	0.46588	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12305	0.0299	M	0.67517	2.055	0.09310	N	1	D	0.56287	0.975	P	0.44623	0.455	T	0.21177	-1.0253	9	0.87932	D	0	-6.2125	6.9004	0.24279	0.2056:0.0:0.0:0.7944	.	304	O75123	ZN623_HUMAN	P	264;264;264;304;304	ENSP00000435232:S264P;ENSP00000411139:S264P;ENSP00000445979:S304P	ENSP00000330358:S264P	S	+	1	0	ZNF623	144804095	0.000000	0.05858	0.978000	0.43139	0.783000	0.44284	-0.664000	0.05292	1.817000	0.53016	0.533000	0.62120	TCA	ZNF623	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000183309		0.453	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	71	0.00	0	T	NM_014789		144732952	144732952	+1	no_errors	ENST00000501748	ensembl	human	known	69_37n	missense	36	73.57	103	SNP	0.036	C
