#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APPL2	55198	genome.wustl.edu	37	12	105605050	105605050	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr12:105605050T>C	ENST00000258530.3	-	5	556	c.331A>G	c.(331-333)Atg>Gtg	p.M111V	APPL2_ENST00000539978.2_Missense_Mutation_p.M68V|APPL2_ENST00000551662.1_Missense_Mutation_p.M111V	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GGTAGAACCATTGTGTCTGCC	0.333																																						dbGAP											0													157.0	144.0	148.0					12																	105605050		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.331A>G	12.37:g.105605050T>C	ENSP00000258530:p.Met111Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_Pleckstrin_homology,pfam_PTB,smart_Pleckstrin_homology,smart_PTyr_interaction_dom,pfscan_Pleckstrin_homology,pfscan_PTyr_interaction_dom	p.M111V	ENST00000258530.3	37	c.331	CCDS9101.1	12	.	.	.	.	.	.	.	.	.	.	T	12.96	2.094863	0.36952	.	.	ENSG00000136044	ENST00000258530;ENST00000539978;ENST00000551662;ENST00000553097	T;T;T;T	0.03386	3.95;3.95;3.95;3.95	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.10637	0.0260	L	0.46157	1.445	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.996;0.996	D;D;D	0.78314	0.991;0.971;0.968	T	0.31308	-0.9948	10	0.07482	T	0.82	-27.8357	14.3616	0.66776	0.0:0.0:0.0:1.0	.	111;68;111	F8W1P5;B7Z1Q8;Q8NEU8	.;.;DP13B_HUMAN	V	111;68;111;78	ENSP00000258530:M111V;ENSP00000444472:M68V;ENSP00000446917:M111V;ENSP00000449767:M78V	ENSP00000258530:M111V	M	-	1	0	APPL2	104129180	1.000000	0.71417	0.974000	0.42286	0.978000	0.69477	7.006000	0.76329	2.037000	0.60232	0.533000	0.62120	ATG	APPL2	-	NULL	ENSG00000136044		0.333	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPL2	HGNC	protein_coding	OTTHUMT00000406238.3	74	0.00	0	T	NM_018171		105605050	105605050	-1	no_errors	ENST00000551662	ensembl	human	known	69_37n	missense	87	10.31	10	SNP	0.996	C
CHD6	84181	genome.wustl.edu	37	20	40065975	40065975	+	Splice_Site	SNP	C	C	G			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr20:40065975C>G	ENST00000373233.3	-	27	4185		c.e27-1		CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.?(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGTGTTGCCTCTAAATAAAAG	0.398																																						dbGAP											1	Unknown(1)	urinary_tract(1)											153.0	122.0	133.0					20																	40065975		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4008-1G>C	20.37:g.40065975C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Splice_Site	SNP	-	e26-1	ENST00000373233.3	37	c.4008-1	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953572	0.73902	.	.	ENSG00000124177	ENST00000373233	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6951	0.77490	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHD6	39499389	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.487000	0.60293	2.473000	0.83533	0.655000	0.94253	.	CHD6	-	-	ENSG00000124177		0.398	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	63	0.00	0	C		Intron	40065975	40065975	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	splice_site	66	25.00	22	SNP	1.000	G
NDUFA6-AS1	100132273	genome.wustl.edu	37	22	42536703	42536703	+	RNA	SNP	G	G	A	rs145472480	byFrequency	TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr22:42536703G>A	ENST00000416037.2	+	0	8970				RP4-669P10.16_ENST00000428786.1_RNA|CYP2D7P1_ENST00000433992.1_RNA|CYP2D7P1_ENST00000424775.1_RNA|CYP2D7P1_ENST00000358097.4_RNA	NR_034118.1				NDUFA6 antisense RNA 1 (head to head)																		GATGAGTGTCGTTCCCTGGGC	0.617													g|||	10	0.00199681	0.0068	0.0014	5008	,	,		20041	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			BC039542		22q13.2	2013-03-18	2013-03-18		ENSG00000237037	ENSG00000237037		"""Long non-coding RNAs"""	45273	non-coding RNA	RNA, long non-coding							Standard	NR_034118		Approved		uc003bcd.1		OTTHUMG00000150917		22.37:g.42536703G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B,prints_Cyt_P450_E_grp-IV	p.T47M	ENST00000416037.2	37	c.140		22	5	0.0022893772893772895	4	0.008130081300813009	0	0.0	1	0.0017482517482517483	0	0.0	g	14.07	2.424978	0.43020	.	.	ENSG00000205702	ENST00000435101;ENST00000428297;ENST00000354609;ENST00000381321;ENST00000436260	D	0.83506	-1.73	3.88	3.88	0.44766	.	0.144440	0.48767	D	0.000177	D	0.87434	0.6176	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.81936	-0.0705	9	0.87932	D	0	.	16.0428	0.80695	0.0:0.0:1.0:0.0	.	303	F5H167	.	M	47;392;341;339;303	ENSP00000437680:T47M	ENSP00000442416:T341M	T	-	2	0	CYP2D7P1	40866647	1.000000	0.71417	0.041000	0.18516	0.007000	0.05969	4.902000	0.63266	2.140000	0.66376	0.508000	0.49915	ACG	CYP2D7P1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_B	ENSG00000205702		0.617	NDUFA6-AS1-001	KNOWN	basic|exp_conf	antisense	CYP2D7P1	HGNC	processed_transcript	OTTHUMT00000320522.4	91	0.00	0	G	NR_034118		42536703	42536703	-1	no_errors	ENST00000435101	ensembl	human	putative	69_37n	missense	63	14.86	11	SNP	0.008	A
DOCK10	55619	genome.wustl.edu	37	2	225661753	225661753	+	Silent	SNP	G	G	C			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr2:225661753G>C	ENST00000258390.7	-	43	4822	c.4755C>G	c.(4753-4755)gcC>gcG	p.A1585A	DOCK10_ENST00000409592.3_Silent_p.A1579A	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1585					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGTACAGAAGGGCTGAGGCTT	0.433																																						dbGAP											0													112.0	111.0	111.0					2																	225661753		1859	4097	5956	-	-	-	SO:0001819	synonymous_variant	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4755C>G	2.37:g.225661753G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	NULL	p.P311A	ENST00000258390.7	37	c.931	CCDS46528.1	2																																																																																			DOCK10	-	NULL	ENSG00000135905		0.433	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	48	0.00	0	G			225661753	225661753	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000409802	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	0.930	C
EFNB2	1948	genome.wustl.edu	37	13	107145608	107145608	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr13:107145608G>A	ENST00000245323.4	-	5	931	c.782C>T	c.(781-783)cCg>cTg	p.P261L		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	261					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)	p.P261L(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					CGTGTGCTGCGGCGAGTGCTT	0.567																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											150.0	115.0	127.0					13																	107145608		2203	4300	6503	-	-	-	SO:0001583	missense	0			L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.782C>T	13.37:g.107145608G>A	ENSP00000245323:p.Pro261Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JV56	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.P261L	ENST00000245323.4	37	c.782	CCDS9507.1	13	.	.	.	.	.	.	.	.	.	.	G	32	5.135729	0.94517	.	.	ENSG00000125266	ENST00000245323	D	0.90563	-2.69	5.81	5.81	0.92471	.	0.144593	0.64402	D	0.000005	D	0.88070	0.6338	L	0.43152	1.355	0.80722	D	1	P	0.52692	0.955	B	0.39876	0.312	D	0.89187	0.3548	10	0.62326	D	0.03	.	20.0825	0.97783	0.0:0.0:1.0:0.0	.	261	P52799	EFNB2_HUMAN	L	261	ENSP00000245323:P261L	ENSP00000245323:P261L	P	-	2	0	EFNB2	105943609	1.000000	0.71417	0.922000	0.36590	0.997000	0.91878	9.787000	0.99055	2.746000	0.94184	0.655000	0.94253	CCG	EFNB2	-	NULL	ENSG00000125266		0.567	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB2	HGNC	protein_coding	OTTHUMT00000045733.4	49	0.00	0	G	NM_004093		107145608	107145608	-1	no_errors	ENST00000245323	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	1.000	A
FGF18	8817	genome.wustl.edu	37	5	170883788	170883788	+	Silent	SNP	C	C	A			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr5:170883788C>A	ENST00000274625.5	+	5	1147	c.603C>A	c.(601-603)atC>atA	p.I201I		NM_003862.2	NP_003853.1	O76093	FGF18_HUMAN	fibroblast growth factor 18	201					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte development (GO:0002063)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intramembranous ossification (GO:0001957)|lung development (GO:0030324)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleolus (GO:0005730)	growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	9	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCCGTCGGATCCGGCCCACAC	0.607																																						dbGAP											0													29.0	37.0	34.0					5																	170883788		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AB007422	CCDS4378.1	5q34	2008-02-05			ENSG00000156427	ENSG00000156427			3674	protein-coding gene	gene with protein product		603726				9660775, 9742123	Standard	NM_003862		Approved	FGF-18, ZFGF5	uc003mbk.3	O76093	OTTHUMG00000130464	ENST00000274625.5:c.603C>A	5.37:g.170883788C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQL7|Q6UWF1	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	p.I201	ENST00000274625.5	37	c.603	CCDS4378.1	5																																																																																			FGF18	-	NULL	ENSG00000156427		0.607	FGF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF18	HGNC	protein_coding	OTTHUMT00000252857.2	12	0.00	0	C	NM_033649, NM_003862		170883788	170883788	+1	no_errors	ENST00000274625	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	1.000	A
FOXA1	3169	genome.wustl.edu	37	14	38061463	38061463	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr14:38061463T>C	ENST00000250448.2	-	2	587	c.526A>G	c.(526-528)Atc>Gtc	p.I176V	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.I143V	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	176					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		ATGAGCGAGATGTACGAGTAG	0.657																																						dbGAP											0													96.0	88.0	91.0					14																	38061463		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.526A>G	14.37:g.38061463T>C	ENSP00000250448:p.Ile176Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.I176V	ENST00000250448.2	37	c.526	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	T	19.29	3.798359	0.70567	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95342	-3.68;-3.68	3.88	3.88	0.44766	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95310	0.8478	L	0.42686	1.345	0.58432	D	0.999999	D	0.67145	0.996	D	0.83275	0.996	D	0.95406	0.8494	10	0.87932	D	0	.	11.8192	0.52228	0.0:0.0:0.0:1.0	.	176	P55317	FOXA1_HUMAN	V	176;143	ENSP00000250448:I176V;ENSP00000440178:I143V	ENSP00000250448:I176V	I	-	1	0	FOXA1	37131214	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	7.800000	0.85949	1.626000	0.50381	0.413000	0.27773	ATC	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000129514		0.657	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	51	0.00	0	T			38061463	38061463	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	C
KCNQ3	3786	genome.wustl.edu	37	8	133142164	133142164	+	Missense_Mutation	SNP	G	G	A	rs199942237		TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr8:133142164G>A	ENST00000388996.4	-	15	2384	c.1964C>T	c.(1963-1965)aCg>aTg	p.T655M	KCNQ3_ENST00000519445.1_Missense_Mutation_p.T643M|KCNQ3_ENST00000521134.1_Missense_Mutation_p.T535M	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	655					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GTAATACTCCGTGACCTGCAC	0.498																																						dbGAP											0													117.0	98.0	105.0					8																	133142164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1964C>T	8.37:g.133142164G>A	ENSP00000373648:p.Thr655Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.T655M	ENST00000388996.4	37	c.1964	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	G	4.235	0.042589	0.08196	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99656	-6.31;-6.31;-6.31	5.73	3.89	0.44902	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	1.080860	0.06944	N	0.813382	D	0.98394	0.9466	N	0.22421	0.69	0.09310	N	1	P;P	0.42010	0.673;0.768	B;B	0.44224	0.444;0.282	D	0.97041	0.9757	10	0.46703	T	0.11	-0.5437	10.1881	0.43011	0.0711:0.0:0.7929:0.136	.	643;655	E7ET42;O43525	.;KCNQ3_HUMAN	M	655;535;643;632;534	ENSP00000373648:T655M;ENSP00000429799:T535M;ENSP00000428790:T643M	ENSP00000373648:T655M	T	-	2	0	KCNQ3	133211346	0.925000	0.31364	0.001000	0.08648	0.070000	0.16714	4.813000	0.62620	0.731000	0.32448	0.555000	0.69702	ACG	KCNQ3	-	pfam_K_chnl_volt-dep_KCNQ_C	ENSG00000184156		0.498	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	36	0.00	0	G	NM_004519		133142164	133142164	-1	no_errors	ENST00000388996	ensembl	human	known	69_37n	missense	33	28.26	13	SNP	0.009	A
NHS	4810	genome.wustl.edu	37	X	17705913	17705913	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chrX:17705913C>T	ENST00000380060.3	+	2	955	c.617C>T	c.(616-618)cCg>cTg	p.P206L	NHS_ENST00000398097.3_Missense_Mutation_p.P29L	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	206	WAVE homology domain (WHD).				cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					TACCGCGCCCCGTGGCACCAG	0.612																																						dbGAP											0													121.0	100.0	107.0					X																	17705913		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.617C>T	X.37:g.17705913C>T	ENSP00000369400:p.Pro206Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.P206L	ENST00000380060.3	37	c.617	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681436	0.47991	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.57436	0.69;0.4	5.63	4.75	0.60458	.	0.186531	0.47455	D	0.000226	T	0.63674	0.2531	M	0.77486	2.375	0.58432	D	0.999999	D;D;D;D	0.60575	0.988;0.988;0.988;0.988	P;P;P;P	0.51453	0.67;0.67;0.67;0.67	T	0.69045	-0.5249	10	0.87932	D	0	-7.4971	12.7514	0.57310	0.298:0.702:0.0:0.0	.	206;27;29;206	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	L	206;29;27	ENSP00000369400:P206L;ENSP00000381170:P29L	ENSP00000369397:P27L	P	+	2	0	NHS	17615834	0.998000	0.40836	0.030000	0.17652	0.535000	0.34838	4.526000	0.60566	1.097000	0.41459	0.513000	0.50165	CCG	NHS	-	NULL	ENSG00000188158		0.612	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	HGNC	protein_coding	OTTHUMT00000059120.1	45	0.00	0	C	NM_198270		17705913	17705913	+1	no_errors	ENST00000380060	ensembl	human	known	69_37n	missense	53	23.19	16	SNP	0.904	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	3.37:g.178952085A>T	ENSP00000263967:p.His1047Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047L	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	40	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	T
PCYT1A	5130	genome.wustl.edu	37	3	195968901	195968901	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr3:195968901A>C	ENST00000292823.2	-	8	798	c.626T>G	c.(625-627)aTt>aGt	p.I209S	PCYT1A_ENST00000431016.1_Missense_Mutation_p.I209S|PCYT1A_ENST00000419333.1_Missense_Mutation_p.I209S	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	209					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	ATCCCGCACAATTCGGGTGAT	0.483																																						dbGAP											0													148.0	124.0	132.0					3																	195968901		2203	4300	6503	-	-	-	SO:0001583	missense	0			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.626T>G	3.37:g.195968901A>C	ENSP00000292823:p.Ile209Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A9LYK9|D3DXB1|Q86Y88	Missense_Mutation	SNP	pfam_Cytidylyltransf,superfamily_NA-bd_OB-fold-like,tigrfam_Cyt_trans-rel	p.I209S	ENST00000292823.2	37	c.626	CCDS3315.1	3	.	.	.	.	.	.	.	.	.	.	A	27.5	4.840237	0.91117	.	.	ENSG00000161217	ENST00000419333;ENST00000292823;ENST00000416798;ENST00000431016;ENST00000411591;ENST00000433733;ENST00000430755	.	.	.	5.65	5.65	0.86999	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.84611	0.5510	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	D	0.88252	0.2917	9	0.87932	D	0	-12.0114	15.1136	0.72380	1.0:0.0:0.0:0.0	.	209	P49585	PCY1A_HUMAN	S	209;209;170;209;209;82;143	.	ENSP00000292823:I209S	I	-	2	0	PCYT1A	197453298	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.958000	0.93099	2.169000	0.68431	0.529000	0.55759	ATT	PCYT1A	-	NULL	ENSG00000161217		0.483	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1A	HGNC	protein_coding	OTTHUMT00000341147.1	56	0.00	0	A	NM_005017		195968901	195968901	-1	no_errors	ENST00000292823	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	1.000	C
PKHD1L1	93035	genome.wustl.edu	37	8	110454342	110454342	+	Silent	SNP	T	T	C			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr8:110454342T>C	ENST00000378402.5	+	35	4415	c.4311T>C	c.(4309-4311)taT>taC	p.Y1437Y		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1437	IPT/TIG 7.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGATAGGATATAGGATTTTTT	0.428										HNSCC(38;0.096)																												dbGAP											0													136.0	140.0	139.0					8																	110454342		1853	4102	5955	-	-	-	SO:0001819	synonymous_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4311T>C	8.37:g.110454342T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.Y1437	ENST00000378402.5	37	c.4311	CCDS47911.1	8																																																																																			PKHD1L1	-	superfamily_Cupredoxin	ENSG00000205038		0.428	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	75	0.00	0	T	NM_177531		110454342	110454342	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	silent	65	25.29	22	SNP	0.842	C
POLG	5428	genome.wustl.edu	37	15	89876861	89876861	+	Missense_Mutation	SNP	C	C	T	rs74382477		TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr15:89876861C>T	ENST00000268124.5	-	2	458	c.125G>A	c.(124-126)cGg>cAg	p.R42Q	POLG_ENST00000442287.2_Missense_Mutation_p.R42Q|RP11-217B1.2_ENST00000569473.1_RNA|POLG_ENST00000525806.1_5'Flank|RP11-217B1.2_ENST00000562356.1_RNA	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	42					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ctgctgctgccgccgccgctg	0.736								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.125G>A	15.37:g.89876861C>T	ENSP00000268124:p.Arg42Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFM2|Q92515	Missense_Mutation	SNP	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.R42Q	ENST00000268124.5	37	c.125	CCDS10350.1	15	.	.	.	.	.	.	.	.	.	.	C	4.741	0.137797	0.09032	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.96200	-3.94;-3.94	2.53	-0.795	0.10915	.	0.227039	0.13631	U	0.373696	D	0.84511	0.5488	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.72805	-0.4182	10	0.10636	T	0.68	.	5.1171	0.14840	0.0:0.2444:0.3969:0.3588	.	42	P54098	DPOG1_HUMAN	Q	42	ENSP00000268124:R42Q;ENSP00000399851:R42Q	ENSP00000268124:R42Q	R	-	2	0	POLG	87677865	0.017000	0.18338	0.003000	0.11579	0.012000	0.07955	-0.201000	0.09464	-0.338000	0.08413	-1.937000	0.00501	CGG	POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub	ENSG00000140521		0.736	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	9	0.00	0	C	NM_002693		89876861	89876861	-1	no_errors	ENST00000268124	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.003	T
SENP1	29843	genome.wustl.edu	37	12	48482684	48482684	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr12:48482684C>T	ENST00000004980.5	-	5	758	c.280G>A	c.(280-282)Gca>Aca	p.A94T	SENP1_ENST00000551330.1_Missense_Mutation_p.A94T|SENP1_ENST00000549595.1_Missense_Mutation_p.A94T|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000448372.1_Missense_Mutation_p.A94T|SENP1_ENST00000547886.1_5'UTR|SENP1_ENST00000549518.1_Missense_Mutation_p.A94T			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	94	Ser-rich.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TGGCCATTTGCACTCTGGCCA	0.378																																						dbGAP											0													117.0	102.0	107.0					12																	48482684		1819	4080	5899	-	-	-	SO:0001583	missense	0			AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.280G>A	12.37:g.48482684C>T	ENSP00000004980:p.Ala94Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P5|Q86XC8	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.A94T	ENST00000004980.5	37	c.280	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152845	0.57259	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518;ENST00000551798	T;T;T;T;T	0.13657	2.57;2.57;2.57;2.57;2.57	5.17	4.26	0.50523	.	0.284712	0.30244	N	0.010072	T	0.06600	0.0169	N	0.08118	0	0.80722	D	1	B;B	0.23937	0.057;0.094	B;B	0.18871	0.01;0.023	T	0.36672	-0.9738	10	0.22109	T	0.4	-11.5223	10.6147	0.45443	0.0:0.9084:0.0:0.0916	.	94;94	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	T	94;94;94;94;94;87	ENSP00000004980:A94T;ENSP00000394791:A94T;ENSP00000446681:A94T;ENSP00000450076:A94T;ENSP00000447328:A94T	ENSP00000004980:A94T	A	-	1	0	SENP1	46768951	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.737000	0.47393	2.572000	0.86782	0.555000	0.69702	GCA	SENP1	-	NULL	ENSG00000079387		0.378	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP1	HGNC	protein_coding	OTTHUMT00000406471.1	130	0.00	0	C	NM_014554		48482684	48482684	-1	no_errors	ENST00000004980	ensembl	human	known	69_37n	missense	99	23.26	30	SNP	1.000	T
SLC30A10	55532	genome.wustl.edu	37	1	220091665	220091665	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr1:220091665G>A	ENST00000366926.3	-	3	1051	c.890C>T	c.(889-891)cCg>cTg	p.P297L	SLC30A10_ENST00000484079.1_5'UTR|SLC30A10_ENST00000536446.1_Missense_Mutation_p.P52L	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	297					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.P297Q(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		CTTGATAAGCGGGAAGGCAGA	0.493																																					Colon(76;360 1614 43677 51136)	dbGAP											1	Substitution - Missense(1)	lung(1)											157.0	153.0	155.0					1																	220091665		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.890C>T	1.37:g.220091665G>A	ENSP00000355893:p.Pro297Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AL9|Q9NPW0	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.P297L	ENST00000366926.3	37	c.890	CCDS31026.1	1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811971	0.90707	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.66099	-0.19;-0.19	6.01	6.01	0.97437	.	0.122036	0.56097	D	0.000024	D	0.83198	0.5202	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83624	0.0141	9	.	.	.	-16.409	20.5073	0.99209	0.0:0.0:1.0:0.0	.	297	Q6XR72	ZNT10_HUMAN	L	297;52	ENSP00000355893:P297L;ENSP00000439489:P52L	.	P	-	2	0	SLC30A10	218158288	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	7.592000	0.82676	2.855000	0.98099	0.585000	0.79938	CCG	SLC30A10	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000196660		0.493	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1	56	0.00	0	G	NM_018713		220091665	220091665	-1	no_errors	ENST00000366926	ensembl	human	known	69_37n	missense	64	21.95	18	SNP	1.000	A
TMEM247	388946	genome.wustl.edu	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																						dbGAP											0													30.0	40.0	37.0					2																	46707808		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q128E	ENST00000434431.1	37	c.382	CCDS56117.1	2	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	TMEM247	-	NULL	ENSG00000187600		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	TMEM247	HGNC	protein_coding	OTTHUMT00000329726.1	27	0.00	0	C	NM_001145051		46707808	46707808	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000434431	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	G
TUBGCP3	10426	genome.wustl.edu	37	13	113212589	113212589	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr13:113212589C>T	ENST00000261965.3	-	5	655	c.469G>A	c.(469-471)Gtg>Atg	p.V157M	TUBGCP3_ENST00000375669.3_Missense_Mutation_p.V157M	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	157					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CTGCTGCCCACGCTGCCGGAG	0.622																																						dbGAP											0													71.0	69.0	70.0					13																	113212589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.469G>A	13.37:g.113212589C>T	ENSP00000261965:p.Val157Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.V157M	ENST00000261965.3	37	c.469	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	C	9.161	1.018681	0.19355	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.22743	1.95;1.94	4.81	-9.63	0.00544	.	0.538666	0.21390	N	0.075335	T	0.02767	0.0083	N	0.00538	-1.39	0.09310	N	1	B;B;B;B	0.27380	0.002;0.177;0.003;0.001	B;B;B;B	0.15870	0.001;0.014;0.002;0.001	T	0.27400	-1.0075	10	0.36615	T	0.2	-2.2379	2.1391	0.03770	0.1487:0.2516:0.3778:0.2219	.	147;157;157;157	B4DYP7;Q96CW5-3;Q96CW5-2;Q96CW5	.;.;.;GCP3_HUMAN	M	157	ENSP00000261965:V157M;ENSP00000364821:V157M	ENSP00000261965:V157M	V	-	1	0	TUBGCP3	112260590	0.099000	0.21834	0.016000	0.15963	0.725000	0.41563	-0.267000	0.08619	-2.546000	0.00482	-0.401000	0.06369	GTG	TUBGCP3	-	NULL	ENSG00000126216		0.622	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	51	0.00	0	C	NM_006322		113212589	113212589	-1	no_errors	ENST00000261965	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	0.021	T
ZNF75A	7627	genome.wustl.edu	37	16	3363109	3363109	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24O-01A-11D-A167-09	TCGA-AR-A24O-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2c9fc77f-951b-4764-911a-f0cff3174fb1	118ecd9e-4983-464f-921b-f12f91c40dbf	g.chr16:3363109G>A	ENST00000574298.1	+	4	507	c.34G>A	c.(34-36)Gat>Aat	p.D12N	ZNF75A_ENST00000498240.2_Intron	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	12	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						GGAGTTATTGGATCCCACTCA	0.423																																						dbGAP											0													119.0	108.0	112.0					16																	3363109		2197	4300	6497	-	-	-	SO:0001583	missense	0			X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.34G>A	16.37:g.3363109G>A	ENSP00000459566:p.Asp12Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VDI8|Q92669	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D12N	ENST00000574298.1	37	c.34	CCDS10501.1	16	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281217	0.23392	.	.	ENSG00000162086	ENST00000293995	.	.	.	3.11	1.14	0.20703	Krueppel-associated box (4);	.	.	.	.	T	0.28830	0.0715	L	0.36672	1.1	0.22918	N	0.998565	B	0.06786	0.001	B	0.08055	0.003	T	0.20405	-1.0276	8	0.39692	T	0.17	.	5.0948	0.14727	0.3964:0.0:0.6036:0.0	.	12	Q96N20	ZN75A_HUMAN	N	12	.	ENSP00000293995:D12N	D	+	1	0	ZNF75A	3303110	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	2.384000	0.44362	0.362000	0.24319	0.462000	0.41574	GAT	ZNF75A	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000162086		0.423	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF75A	HGNC	protein_coding	OTTHUMT00000251506.2	81	0.00	0	G	NM_153028		3363109	3363109	+1	no_errors	ENST00000574298	ensembl	human	known	69_37n	missense	88	11.11	11	SNP	0.981	A
