#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAR	103	genome.wustl.edu	37	1	154557805	154557805	+	Missense_Mutation	SNP	T	T	G	rs536100209		TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr1:154557805T>G	ENST00000368474.4	-	14	3530	c.3331A>C	c.(3331-3333)Ata>Cta	p.I1111L	ADAR_ENST00000368471.3_Missense_Mutation_p.I816L|ADAR_ENST00000292205.5_Missense_Mutation_p.I1154L	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	1111	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GAATCATATATGCTGACTCTG	0.493																																						dbGAP											0													109.0	110.0	110.0					1																	154557805		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.3331A>C	1.37:g.154557805T>G	ENSP00000357459:p.Ile1111Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_Ds-RNA-bd,smart_dsRNA_A_deaminase,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.I1154L	ENST00000368474.4	37	c.3460	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376558	0.61735	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17	5.29	4.36	0.52297	Adenosine deaminase/editase (3);	0.061400	0.64402	D	0.000004	T	0.81178	0.4768	L	0.31578	0.945	0.23204	N	0.998123	B;B;B	0.13594	0.0;0.0;0.008	B;B;B	0.11329	0.002;0.002;0.006	T	0.72004	-0.4421	10	0.36615	T	0.2	-14.5849	12.7586	0.57350	0.0:0.8591:0.0:0.1409	.	1066;1085;1111	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	L	1154;1111;816;1080	ENSP00000292205:I1154L;ENSP00000357459:I1111L;ENSP00000357456:I816L;ENSP00000431794:I1080L	ENSP00000292205:I1154L	I	-	1	0	ADAR	152824429	1.000000	0.71417	0.686000	0.30086	0.985000	0.73830	4.436000	0.59948	1.382000	0.46385	-0.119000	0.15052	ATA	ADAR	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000160710		0.493	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	44	0.00	0	T	NM_001111		154557805	154557805	-1	no_errors	ENST00000292205	ensembl	human	known	69_37n	missense	46	31.34	21	SNP	1.000	G
APPL2	55198	genome.wustl.edu	37	12	105589107	105589107	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr12:105589107A>C	ENST00000258530.3	-	14	1398	c.1173T>G	c.(1171-1173)aaT>aaG	p.N391K	APPL2_ENST00000539978.2_Missense_Mutation_p.N348K|APPL2_ENST00000551662.1_Missense_Mutation_p.N397K|APPL2_ENST00000549573.1_5'Flank	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GAGCGGTCTGATTCAACTTGA	0.468																																						dbGAP											0													138.0	118.0	125.0					12																	105589107		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.1173T>G	12.37:g.105589107A>C	ENSP00000258530:p.Asn391Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_Pleckstrin_homology,pfam_PTB,smart_Pleckstrin_homology,smart_PTyr_interaction_dom,pfscan_Pleckstrin_homology,pfscan_PTyr_interaction_dom	p.N397K	ENST00000258530.3	37	c.1191	CCDS9101.1	12	.	.	.	.	.	.	.	.	.	.	A	22.3	4.266382	0.80358	.	.	ENSG00000136044	ENST00000258530;ENST00000539978;ENST00000551662	T;T;T	0.25579	2.58;1.79;2.37	5.84	-1.75	0.08031	.	0.000000	0.85682	D	0.000000	T	0.36441	0.0967	M	0.69823	2.125	0.53688	D	0.99997	D;D;P	0.56746	0.977;0.962;0.835	P;P;P	0.55303	0.773;0.598;0.476	T	0.24440	-1.0160	10	0.51188	T	0.08	-26.5457	10.856	0.46800	0.6031:0.0:0.3969:0.0	.	397;348;391	F8W1P5;B7Z1Q8;Q8NEU8	.;.;DP13B_HUMAN	K	391;348;397	ENSP00000258530:N391K;ENSP00000444472:N348K;ENSP00000446917:N397K	ENSP00000258530:N391K	N	-	3	2	APPL2	104113237	0.995000	0.38212	0.990000	0.47175	0.935000	0.57460	0.511000	0.22739	-0.303000	0.08856	0.514000	0.50259	AAT	APPL2	-	NULL	ENSG00000136044		0.468	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPL2	HGNC	protein_coding	OTTHUMT00000406238.3	80	0.00	0	A	NM_018171		105589107	105589107	-1	no_errors	ENST00000551662	ensembl	human	known	69_37n	missense	52	24.64	17	SNP	0.998	C
ARHGEF38	54848	genome.wustl.edu	37	4	106552056	106552058	+	Splice_Site	DEL	AGA	AGA	-			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr4:106552056_106552058delAGA	ENST00000420470.2	+	4	654_656	c.510_512delAGA	c.(508-513)ggagaa>gga	p.E171del	ARHGEF38_ENST00000265154.2_Splice_Site_p.E171del	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	171	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						ATTTATCAGGAGAAGTATTCTTG	0.365																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.509-1AGA>-	4.37:g.106552056_106552058delAGA		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JIB4	In_Frame_Del	DEL	pfam_DH-domain,superfamily_DH-domain,pfscan_DH-domain	p.E171in_frame_del	ENST00000420470.2	37	c.510_512	CCDS56338.1	4																																																																																			ARHGEF38	-	pfam_DH-domain,superfamily_DH-domain,pfscan_DH-domain	ENSG00000236699		0.365	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	61	0.00	0	AGA	NM_017700	In_Frame_Del	106552056	106552058	+1	no_errors	ENST00000265154	ensembl	human	known	69_37n	in_frame_del	43	20.37	11	DEL	0.987:1.000:1.000	-
CHUK	1147	genome.wustl.edu	37	10	101978864	101978864	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr10:101978864G>A	ENST00000370397.7	-	7	676	c.590C>T	c.(589-591)cCt>cTt	p.P197L		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	GGCTGTGTAAGGCTTATTCTC	0.393																																					Ovarian(159;52 1904 10536 35305 37148)	dbGAP											0													77.0	78.0	77.0					10																	101978864		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.590C>T	10.37:g.101978864G>A	ENSP00000359424:p.Pro197Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P197L	ENST00000370397.7	37	c.590	CCDS7488.1	10	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397133	0.62177	.	.	ENSG00000213341	ENST00000370397	T	0.65549	-0.16	5.75	5.75	0.90469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.158723	0.56097	N	0.000022	T	0.69522	0.3120	L	0.41906	1.305	0.80722	D	1	D	0.60575	0.988	P	0.58266	0.836	T	0.70432	-0.4873	10	0.59425	D	0.04	-8.8882	17.446	0.87579	0.0:0.0:1.0:0.0	.	197	O15111	IKKA_HUMAN	L	197	ENSP00000359424:P197L	ENSP00000359424:P197L	P	-	2	0	CHUK	101968854	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.602000	0.82796	2.725000	0.93324	0.655000	0.94253	CCT	CHUK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000213341		0.393	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	HGNC	protein_coding	OTTHUMT00000049836.1	49	0.00	0	G	NM_001278		101978864	101978864	-1	no_errors	ENST00000370397	ensembl	human	known	69_37n	missense	25	51.92	27	SNP	1.000	A
CNPY3	10695	genome.wustl.edu	37	6	42897358	42897360	+	In_Frame_Del	DEL	TGC	TGC	-	rs570105218	byFrequency	TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr6:42897358_42897360delTGC	ENST00000372836.4	+	1	421_423	c.50_52delTGC	c.(49-54)ttgctg>ttg	p.17_18LL>L	CNPY3_ENST00000394142.3_In_Frame_Del_p.17_18LL>L	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CTTCTTCCCTtgctgctgctgct	0.695																																						dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.50_52delTGC	6.37:g.42897367_42897369delTGC	ENSP00000361926:p.Leu25del	Somatic		WXS	Illumina GAIIx	Phase_IV	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Del	DEL	pfam_DUF3456	p.L21in_frame_del	ENST00000372836.4	37	c.50_52	CCDS4875.1	6																																																																																			CNPY3	-	NULL	ENSG00000137161		0.695	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY3	HGNC	protein_coding	OTTHUMT00000040564.1	10	0.00	0	TGC	NM_006586		42897358	42897360	+1	no_errors	ENST00000372836	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	0.122:0.131:0.153	-
CXorf65	158830	genome.wustl.edu	37	X	70325861	70325861	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chrX:70325861C>T	ENST00000374251.5	-	3	287	c.239G>A	c.(238-240)cGt>cAt	p.R80H		NM_001025265.2	NP_001020436.1	A6NEN9	CX065_HUMAN	chromosome X open reading frame 65	80										breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)	10						TGGTGGCCCACGTTCCACCTT	0.453																																						dbGAP											0													146.0	113.0	124.0					X																	70325861		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC144434	CCDS35324.1	Xq13.1	2009-03-06			ENSG00000204165	ENSG00000204165			33713	protein-coding gene	gene with protein product							Standard	NM_001025265		Approved		uc011mpo.2	A6NEN9	OTTHUMG00000021785	ENST00000374251.5:c.239G>A	X.37:g.70325861C>T	ENSP00000363369:p.Arg80His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R80H	ENST00000374251.5	37	c.239	CCDS35324.1	X	.	.	.	.	.	.	.	.	.	.	C	14.15	2.449630	0.43531	.	.	ENSG00000204165	ENST00000374251;ENST00000438526	T;T	0.49432	0.78;0.78	4.87	4.01	0.46588	.	0.435071	0.21676	N	0.070781	T	0.54870	0.1885	L	0.42245	1.32	0.29070	N	0.88335	D	0.76494	0.999	D	0.68943	0.961	T	0.51060	-0.8753	10	0.62326	D	0.03	5.3552	6.8608	0.24066	0.0:0.7901:0.0:0.2099	.	80	A6NEN9	CX065_HUMAN	H	80	ENSP00000363369:R80H;ENSP00000411354:R80H	ENSP00000363369:R80H	R	-	2	0	CXorf65	70242586	0.315000	0.24571	0.732000	0.30844	0.291000	0.27294	0.063000	0.14410	1.047000	0.40274	0.529000	0.55759	CGT	CXorf65	-	NULL	ENSG00000204165		0.453	CXorf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf65	HGNC	protein_coding	OTTHUMT00000057089.2	64	0.00	0	C	NM_001025265		70325861	70325861	-1	no_errors	ENST00000374251	ensembl	human	known	69_37n	missense	40	34.43	21	SNP	0.812	T
DGKB	1607	genome.wustl.edu	37	7	14737756	14737756	+	Silent	SNP	T	T	C			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr7:14737756T>C	ENST00000403951.2	-	8	974	c.555A>G	c.(553-555)gcA>gcG	p.A185A	DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000399322.3_Silent_p.A185A|DGKB_ENST00000444700.2_Silent_p.A178A|DGKB_ENST00000402815.1_Silent_p.A185A|DGKB_ENST00000407950.1_Silent_p.A178A|DGKB_ENST00000406247.3_Silent_p.A185A|DGKB_ENST00000258767.5_Silent_p.A185A			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	185					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						CAAGGTATTCTGCAACATGCA	0.343																																						dbGAP											0													73.0	69.0	70.0					7																	14737756		1849	4097	5946	-	-	-	SO:0001819	synonymous_variant	0			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.555A>G	7.37:g.14737756T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.A185	ENST00000403951.2	37	c.555	CCDS47547.1	7																																																																																			DGKB	-	NULL	ENSG00000136267		0.343	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	HGNC	protein_coding	OTTHUMT00000326356.2	60	0.00	0	T	NM_004080		14737756	14737756	-1	no_errors	ENST00000258767	ensembl	human	known	69_37n	silent	31	41.51	22	SNP	0.996	C
DNAI2	64446	genome.wustl.edu	37	17	72310298	72310298	+	Silent	SNP	G	G	A			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr17:72310298G>A	ENST00000311014.6	+	13	1828	c.1761G>A	c.(1759-1761)gaG>gaA	p.E587E	DNAI2_ENST00000579490.1_Silent_p.E644E|DNAI2_ENST00000307504.5_Missense_Mutation_p.G393R|DNAI2_ENST00000582036.1_Silent_p.E575E|DNAI2_ENST00000446837.2_Silent_p.E587E			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	587					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						tggtggaggagggagaggaag	0.577									Kartagener syndrome																													dbGAP											0													192.0	143.0	160.0					17																	72310298		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1761G>A	17.37:g.72310298G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G393R	ENST00000311014.6	37	c.1177	CCDS11697.1	17	.	.	.	.	.	.	.	.	.	.	G	9.796	1.179191	0.21787	.	.	ENSG00000171595	ENST00000307504	T	0.71103	-0.54	3.13	-1.02	0.10135	.	.	.	.	.	T	0.46927	0.1418	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29397	-1.0013	6	0.18276	T	0.48	-0.2105	2.5683	0.04788	0.5288:0.0:0.2675:0.2037	.	.	.	.	R	393	ENSP00000302929:G393R	ENSP00000302929:G393R	G	+	1	0	DNAI2	69821893	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.924000	0.03996	-0.237000	0.09739	0.556000	0.70494	GGG	DNAI2	-	NULL	ENSG00000171595		0.577	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DNAI2	HGNC	protein_coding	OTTHUMT00000442537.1	72	0.00	0	G	NM_023036		72310298	72310298	+1	no_errors	ENST00000307504	ensembl	human	known	69_37n	missense	78	16.13	15	SNP	0.000	A
GDAP1	54332	genome.wustl.edu	37	8	75263607	75263607	+	Silent	SNP	C	C	T			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr8:75263607C>T	ENST00000220822.7	+	2	296	c.216C>T	c.(214-216)aaC>aaT	p.N72N	GDAP1_ENST00000434412.2_Silent_p.N4N|GDAP1_ENST00000521096.1_Intron|CTD-2320G14.2_ENST00000521872.1_RNA	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	72	GST N-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			TGCGTTTGAACTCAACTGGAG	0.448																																						dbGAP											0													336.0	287.0	304.0					8																	75263607		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.216C>T	8.37:g.75263607C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K957|E7FJF3|E7FJF4	Silent	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.N72	ENST00000220822.7	37	c.216	CCDS34911.1	8																																																																																			GDAP1	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold	ENSG00000104381		0.448	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP1	HGNC	protein_coding	OTTHUMT00000379061.1	81	0.00	0	C	NM_018972		75263607	75263607	+1	no_errors	ENST00000220822	ensembl	human	known	69_37n	silent	92	23.33	28	SNP	1.000	T
INPP5B	3633	genome.wustl.edu	37	1	38341357	38341357	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr1:38341357T>A	ENST00000373026.1	-	16	1949	c.1949A>T	c.(1948-1950)aAg>aTg	p.K650M	INPP5B_ENST00000373027.1_Missense_Mutation_p.K406M|INPP5B_ENST00000373024.3_Missense_Mutation_p.K570M|INPP5B_ENST00000373023.2_Missense_Mutation_p.K650M|INPP5B_ENST00000458109.2_3'UTR			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	650	5-phosphatase. {ECO:0000250}.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTCCAGTGTCTTCCGGTAAAG	0.478																																						dbGAP											0													104.0	107.0	106.0					1																	38341357		1948	4139	6087	-	-	-	SO:0001583	missense	0			M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.1949A>T	1.37:g.38341357T>A	ENSP00000362117:p.Lys650Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K650M	ENST00000373026.1	37	c.1949		1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.166997	0.78339	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	5.39	4.27	0.50696	Endonuclease/exonuclease/phosphatase (1);	0.101503	0.64402	D	0.000004	D	0.97216	0.9090	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.65684	0.923;0.937	D	0.97114	0.9806	10	0.87932	D	0	.	11.3076	0.49345	0.0:0.0715:0.0:0.9285	.	650;570	P32019;P32019-2	I5P2_HUMAN;.	M	406;650;650;650;570	ENSP00000362118:K406M;ENSP00000362114:K650M;ENSP00000362117:K650M;ENSP00000362115:K570M	ENSP00000362114:K650M	K	-	2	0	INPP5B	38113944	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.229000	0.51278	1.003000	0.39130	0.533000	0.62120	AAG	INPP5B	-	superfamily_Endo/exonuclease/phosphatase	ENSG00000204084		0.478	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	HGNC	protein_coding	OTTHUMT00000012968.1	41	0.00	0	T	NM_005540		38341357	38341357	-1	no_errors	ENST00000373023	ensembl	human	known	69_37n	missense	11	57.69	15	SNP	1.000	A
LETM1	3954	genome.wustl.edu	37	4	1818540	1818540	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr4:1818540C>T	ENST00000302787.2	-	12	2141	c.1845G>A	c.(1843-1845)atG>atA	p.M615I		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	615					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			TCTGCCCGATCATTTGCTGCA	0.537																																						dbGAP											0													142.0	117.0	125.0					4																	1818540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1845G>A	4.37:g.1818540C>T	ENSP00000305653:p.Met615Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DED2|Q9UF65	Missense_Mutation	SNP	pfam_LETM1,pfscan_EF_HAND_2	p.M615I	ENST00000302787.2	37	c.1845	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	c	16.51	3.144404	0.57044	.	.	ENSG00000168924	ENST00000302787	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.78910	0.4358	M	0.79475	2.455	0.80722	D	1	D	0.54964	0.969	D	0.63381	0.914	T	0.81743	-0.0793	9	0.72032	D	0.01	-69.4314	18.3363	0.90288	0.0:1.0:0.0:0.0	.	615	O95202	LETM1_HUMAN	I	615	.	ENSP00000305653:M615I	M	-	3	0	LETM1	1788338	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	6.807000	0.75201	2.505000	0.84491	0.655000	0.94253	ATG	LETM1	-	NULL	ENSG00000168924		0.537	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	79	0.00	0	C			1818540	1818540	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	missense	61	26.51	22	SNP	1.000	T
MLLT4	4301	genome.wustl.edu	37	6	168323655	168323655	+	Intron	SNP	G	G	T			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr6:168323655G>T	ENST00000447894.2	+	21	2991				MLLT4_ENST00000366806.2_Intron|MLLT4_ENST00000392112.1_Intron|MLLT4_ENST00000351017.4_Intron|MLLT4_ENST00000400822.3_Intron|MLLT4_ENST00000344191.4_Intron|MLLT4_ENST00000392108.3_Intron			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TATTTTGAGGGTACCATGAAG	0.408			T	MLL	AL																																	dbGAP		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													88.0	82.0	84.0					6																	168323655		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.2991+16G>T	6.37:g.168323655G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Dil_domain,pfscan_Dilute	p.V166L	ENST00000447894.2	37	c.496		6	.	.	.	.	.	.	.	.	.	.	G	5.138	0.211074	0.09757	.	.	ENSG00000130396	ENST00000497596	.	.	.	3.62	-5.82	0.02333	.	.	.	.	.	T	0.09024	0.0223	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24297	-1.0164	4	.	.	.	.	5.5774	0.17231	0.4989:0.2711:0.2301:0.0	.	.	.	.	L	166	.	.	V	+	1	0	MLLT4	168066504	0.028000	0.19301	0.000000	0.03702	0.245000	0.25701	3.443000	0.52907	-1.655000	0.01497	-0.302000	0.09304	GTA	MLLT4	-	NULL	ENSG00000130396		0.408	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	48	0.00	0	G	NM_005936		168323655	168323655	+1	no_start_codon	ENST00000497596	ensembl	human	putative	69_37n	missense	11	50.00	11	SNP	0.000	T
OR4N5	390437	genome.wustl.edu	37	14	20612744	20612744	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr14:20612744C>T	ENST00000333629.1	+	1	850	c.850C>T	c.(850-852)Cct>Tct	p.P284S	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TTTGATGAACCCTGTTATTTA	0.413																																						dbGAP											0													118.0	118.0	118.0					14																	20612744		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.850C>T	14.37:g.20612744C>T	ENSP00000332110:p.Pro284Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF11	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P284S	ENST00000333629.1	37	c.850	CCDS32031.1	14	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356064	0.61293	.	.	ENSG00000184394	ENST00000333629	T	0.63417	-0.04	4.0	3.1	0.35709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000563	T	0.82254	0.4997	H	0.94658	3.565	0.36222	D	0.852074	D	0.89917	1.0	D	0.87578	0.998	D	0.87150	0.2208	10	0.72032	D	0.01	.	9.7604	0.40528	0.0:0.8958:0.0:0.1042	.	284	Q8IXE1	OR4N5_HUMAN	S	284	ENSP00000332110:P284S	ENSP00000332110:P284S	P	+	1	0	OR4N5	19682584	0.974000	0.33945	1.000000	0.80357	0.966000	0.64601	2.400000	0.44504	1.017000	0.39495	0.655000	0.94253	CCT	OR4N5	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184394		0.413	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N5	HGNC	protein_coding	OTTHUMT00000410347.1	35	0.00	0	C			20612744	20612744	+1	no_errors	ENST00000333629	ensembl	human	known	69_37n	missense	38	30.91	17	SNP	1.000	T
OR5C1	392391	genome.wustl.edu	37	9	125551282	125551282	+	Missense_Mutation	SNP	G	G	A	rs558073644		TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr9:125551282G>A	ENST00000373680.2	+	1	133	c.71G>A	c.(70-72)cGc>cAc	p.R24H		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						ATCACAAATCGCTGGGACCTG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		18310	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													95.0	90.0	92.0					9																	125551282		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.71G>A	9.37:g.125551282G>A	ENSP00000362784:p.Arg24His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN54|B9EGT0|Q96RC4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R24H	ENST00000373680.2	37	c.71	CCDS35131.1	9	.	.	.	.	.	.	.	.	.	.	G	1.141	-0.649594	0.03506	.	.	ENSG00000148215	ENST00000373680	T	0.01084	5.36	5.29	3.45	0.39498	.	0.000000	0.37053	U	0.002261	T	0.00608	0.0020	N	0.04669	-0.19	0.09310	N	1	B	0.27679	0.185	B	0.17098	0.017	T	0.49341	-0.8950	10	0.24483	T	0.36	.	4.3472	0.11138	0.0803:0.2895:0.4809:0.1493	.	24	Q8NGR4	OR5C1_HUMAN	H	24	ENSP00000362784:R24H	ENSP00000362784:R24H	R	+	2	0	OR5C1	124591103	0.000000	0.05858	0.476000	0.27291	0.167000	0.22549	-1.099000	0.03343	0.795000	0.33922	0.650000	0.86243	CGC	OR5C1	-	NULL	ENSG00000148215		0.602	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5C1	HGNC	protein_coding	OTTHUMT00000053953.1	58	0.00	0	G			125551282	125551282	+1	no_errors	ENST00000373680	ensembl	human	known	69_37n	missense	18	51.28	20	SNP	0.001	A
PIGW	284098	genome.wustl.edu	37	17	34894403	34894403	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr17:34894403T>C	ENST00000592983.1	+	2	2033	c.1453T>C	c.(1453-1455)Ttt>Ctt	p.F485L	MYO19_ENST00000590081.1_Intron|PIGW_ENST00000328396.2_Missense_Mutation_p.F485L			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	485					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCTCTATATGTTTTCCAACTG	0.348																																						dbGAP											0													58.0	56.0	57.0					17																	34894403		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.1453T>C	17.37:g.34894403T>C	ENSP00000468778:p.Phe485Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N9G3	Missense_Mutation	SNP	pfam_GWT1,pirsf_GWT1	p.F485L	ENST00000592983.1	37	c.1453	CCDS11313.1	17	.	.	.	.	.	.	.	.	.	.	T	11.20	1.569897	0.28003	.	.	ENSG00000184886	ENST00000328396	.	.	.	5.8	1.85	0.25348	.	0.167291	0.53938	N	0.000058	T	0.44371	0.1290	L	0.50333	1.59	0.58432	D	0.999999	B	0.17465	0.022	B	0.14578	0.011	T	0.19224	-1.0312	8	.	.	.	-4.1344	6.063	0.19848	0.2644:0.0816:0.0:0.654	.	485	Q7Z7B1	PIGW_HUMAN	L	485	.	.	F	+	1	0	PIGW	31968516	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	3.063000	0.49978	0.433000	0.26313	0.379000	0.24179	TTT	PIGW	-	pirsf_GWT1	ENSG00000184886		0.348	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIGW	HGNC	protein_coding	OTTHUMT00000451318.1	18	0.00	0	T	NM_178517		34894403	34894403	+1	no_errors	ENST00000328396	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.997	C
REXO1	57455	genome.wustl.edu	37	19	1825883	1825883	+	Silent	SNP	G	G	A	rs567534715		TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr19:1825883G>A	ENST00000170168.4	-	3	2065	c.1971C>T	c.(1969-1971)ccC>ccT	p.P657P	CTB-31O20.4_ENST00000593201.1_RNA|REXO1_ENST00000587524.1_5'Flank|CTB-31O20.4_ENST00000590531.1_RNA|CTB-31O20.4_ENST00000587741.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	657						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTCTGCCCGGGGAACAGAG	0.557													.|||	1	0.000199681	0.0	0.0014	5008	,	,		16006	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													120.0	108.0	112.0					19																	1825883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1971C>T	19.37:g.1825883G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULT2	Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.P657	ENST00000170168.4	37	c.1971	CCDS32866.1	19																																																																																			REXO1	-	NULL	ENSG00000079313		0.557	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	40	0.00	0	G	NM_020695		1825883	1825883	-1	no_errors	ENST00000170168	ensembl	human	known	69_37n	silent	24	35.14	13	SNP	0.862	A
RUNX1	861	genome.wustl.edu	37	21	36171623	36171624	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr21:36171623_36171624delAG	ENST00000344691.4	-	5	2437_2438	c.860_861delCT	c.(859-861)tctfs	p.S287fs	RUNX1_ENST00000437180.1_Frame_Shift_Del_p.S314fs|RUNX1_ENST00000325074.5_Frame_Shift_Del_p.S302fs|RUNX1_ENST00000300305.3_Frame_Shift_Del_p.S314fs|RUNX1_ENST00000399240.1_Frame_Shift_Del_p.S223fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	287	Pro/Ser/Thr-rich.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S314fs*168(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						AAAGTTCTGCAGAGAGGGTTGT	0.53			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.860_861delCT	21.37:g.36171627_36171628delAG	ENSP00000340690:p.Ser287fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Del	DEL	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.S314fs	ENST00000344691.4	37	c.942_941	CCDS42922.1	21																																																																																			RUNX1	-	pirsf_TF_Runt-rel_RUNX	ENSG00000159216		0.530	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	66	0.00	0	AG			36171623	36171624	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_del	41	41.67	30	DEL	0.839:0.999	-
THOP1	7064	genome.wustl.edu	37	19	2807034	2807034	+	Silent	SNP	C	C	T	rs201840395		TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr19:2807034C>T	ENST00000307741.6	+	7	1073	c.870C>T	c.(868-870)acC>acT	p.T290T	THOP1_ENST00000395212.4_5'Flank|THOP1_ENST00000586677.1_Silent_p.T169T|THOP1_ENST00000591149.1_3'UTR	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	290					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGCCAGACCGTGGCCACCT	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		18191	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													86.0	71.0	76.0					19																	2807034		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.870C>T	19.37:g.2807034C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSE2|Q9UCB3	Silent	SNP	pfam_Pept_M3A_M3B	p.T290	ENST00000307741.6	37	c.870	CCDS12095.1	19																																																																																			THOP1	-	pfam_Pept_M3A_M3B	ENSG00000172009		0.642	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOP1	HGNC	protein_coding	OTTHUMT00000451587.2	48	0.00	0	C			2807034	2807034	+1	no_errors	ENST00000307741	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	0.152	T
SUPT5H	6829	genome.wustl.edu	37	19	39959953	39959953	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr19:39959953A>C	ENST00000599117.1	+	17	1656	c.1289A>C	c.(1288-1290)gAg>gCg	p.E430A	SUPT5H_ENST00000402194.2_Missense_Mutation_p.E426A|SUPT5H_ENST00000598725.1_Missense_Mutation_p.E430A|SUPT5H_ENST00000359191.6_Missense_Mutation_p.E426A|SUPT5H_ENST00000432763.2_Missense_Mutation_p.E430A			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	430	KOW 2.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GAGGTCTGTGAGGGTGAGCTC	0.617																																						dbGAP											0													95.0	78.0	84.0					19																	39959953		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1289A>C	19.37:g.39959953A>C	ENSP00000470252:p.Glu430Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O43279|Q59G52|Q99639	Missense_Mutation	SNP	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N,smart_KOW,pirsf_TF_Spt5	p.E430A	ENST00000599117.1	37	c.1289	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	A	16.83	3.232555	0.58777	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.82	5.82	0.92795	KOW (1);	0.051342	0.85682	D	0.000000	T	0.67373	0.2886	M	0.73217	2.22	0.80722	D	1	B;P;B	0.36768	0.264;0.569;0.264	B;B;B	0.42692	0.057;0.395;0.17	T	0.66893	-0.5808	8	.	.	.	-19.5275	15.1572	0.72752	1.0:0.0:0.0:0.0	.	222;426;430	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	A	430;426;408;430	.	.	E	+	2	0	SUPT5H	44651793	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.082000	0.94059	2.232000	0.73038	0.528000	0.53228	GAG	SUPT5H	-	superfamily_Translation_prot_SH3-like,smart_KOW,pirsf_TF_Spt5	ENSG00000196235		0.617	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	HGNC	protein_coding	OTTHUMT00000464918.1	38	0.00	0	A	NM_003169		39959953	39959953	+1	no_errors	ENST00000359191	ensembl	human	known	69_37n	missense	8	50.00	8	SNP	1.000	C
TMED10	10972	genome.wustl.edu	37	14	75643124	75643124	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr14:75643124delT	ENST00000303575.4	-	1	210	c.159delA	c.(157-159)ctafs	p.L53fs		NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	53	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.|Required for interaction with STX17.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		CGCCAGTCACTAGCAGGTCCT	0.622																																						dbGAP											0													75.0	75.0	75.0					14																	75643124		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.159delA	14.37:g.75643124delT	ENSP00000303145:p.Leu53fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Frame_Shift_Del	DEL	pfam_GOLD,pfscan_GOLD	p.V54fs	ENST00000303575.4	37	c.159	CCDS9840.1	14																																																																																			TMED10	-	pfam_GOLD,pfscan_GOLD	ENSG00000170348		0.622	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1	17	0.00	0	T	NM_006827		75643124	75643124	-1	no_errors	ENST00000303575	ensembl	human	known	69_37n	frame_shift_del	11	31.25	5	DEL	0.998	-
TMED10	10972	genome.wustl.edu	37	14	75643142	75643145	+	Frame_Shift_Del	DEL	CTCC	CTCC	-			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	CTCC	CTCC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr14:75643142_75643145delCTCC	ENST00000303575.4	-	1	189_192	c.138_141delGGAG	c.(136-141)gaggagfs	p.EE46fs		NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	46	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.|Required for interaction with STX17.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		CCTTGTGAATCTCCTCACGGAGGC	0.598																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.138_141delGGAG	14.37:g.75643142_75643145delCTCC	ENSP00000303145:p.Glu46fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Frame_Shift_Del	DEL	pfam_GOLD,pfscan_GOLD	p.E47fs	ENST00000303575.4	37	c.141_138	CCDS9840.1	14																																																																																			TMED10	-	pfam_GOLD,pfscan_GOLD	ENSG00000170348		0.598	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1	20	0.00	0	CTCC	NM_006827		75643142	75643145	-1	no_errors	ENST00000303575	ensembl	human	known	69_37n	frame_shift_del	15	25.00	5	DEL	1.000:1.000:1.000:1.000	-
TTLL5	23093	genome.wustl.edu	37	14	76187037	76187037	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr14:76187037A>G	ENST00000298832.9	+	12	1238	c.1033A>G	c.(1033-1035)Agt>Ggt	p.S345G	TTLL5_ENST00000555422.1_Intron|TTLL5_ENST00000557636.1_Missense_Mutation_p.S345G	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	345	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		TCATCGCAGCAGTTGTTTTGG	0.418																																						dbGAP											0													197.0	182.0	187.0					14																	76187037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.1033A>G	14.37:g.76187037A>G	ENSP00000298832:p.Ser345Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.S345G	ENST00000298832.9	37	c.1033	CCDS32124.1	14	.	.	.	.	.	.	.	.	.	.	A	22.1	4.249254	0.80024	.	.	ENSG00000119685	ENST00000418433;ENST00000557636;ENST00000298832	T;T	0.04119	3.7;3.7	5.73	5.73	0.89815	.	0.117912	0.85682	D	0.000000	T	0.07954	0.0199	N	0.17564	0.495	0.80722	D	1	P;P	0.50272	0.917;0.933	P;P	0.56343	0.693;0.796	T	0.29427	-1.0012	10	0.62326	D	0.03	.	11.1639	0.48531	0.9275:0.0:0.0724:0.0	.	345;345	G3V2J9;Q6EMB2	.;TTLL5_HUMAN	G	32;345;345	ENSP00000450713:S345G;ENSP00000298832:S345G	ENSP00000298832:S345G	S	+	1	0	TTLL5	75256790	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.204000	0.77872	2.323000	0.78572	0.529000	0.55759	AGT	TTLL5	-	pfam_Tub_tyr_ligase	ENSG00000119685		0.418	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	62	0.00	0	A	NM_015072		76187037	76187037	+1	no_errors	ENST00000298832	ensembl	human	known	69_37n	missense	49	37.97	30	SNP	1.000	G
VWA3B	200403	genome.wustl.edu	37	2	98928335	98928335	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr2:98928335C>T	ENST00000477737.1	+	27	3779	c.3575C>T	c.(3574-3576)gCg>gTg	p.A1192V	VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1192										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CTGAAAGAAGCGGACACGCAG	0.602																																						dbGAP											0													25.0	31.0	29.0					2																	98928335		1921	4124	6045	-	-	-	SO:0001583	missense	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3575C>T	2.37:g.98928335C>T	ENSP00000417955:p.Ala1192Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.A1192V	ENST00000477737.1	37	c.3575	CCDS42718.1	2	.	.	.	.	.	.	.	.	.	.	C	0.039	-1.292707	0.01375	.	.	ENSG00000168658	ENST00000477737;ENST00000358269	T	0.05580	3.42	3.89	-7.78	0.01223	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	0.999999	B;B	0.14012	0.009;0.003	B;B	0.04013	0.001;0.001	T	0.45991	-0.9223	9	0.22109	T	0.4	.	10.9592	0.47374	0.1077:0.1413:0.0:0.751	.	584;1192	Q502W6-5;Q502W6	.;VWA3B_HUMAN	V	1192;314	ENSP00000417955:A1192V	ENSP00000351009:A314V	A	+	2	0	VWA3B	98294767	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.806000	0.01735	-2.613000	0.00444	-0.339000	0.08088	GCG	VWA3B	-	NULL	ENSG00000168658		0.602	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2	20	0.00	0	C	NM_144992		98928335	98928335	+1	no_errors	ENST00000477737	ensembl	human	known	69_37n	missense	13	31.82	7	SNP	0.000	T
WASH3P	374666	genome.wustl.edu	37	15	102516539	102516539	+	RNA	SNP	C	C	G	rs62028686		TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr15:102516539C>G	ENST00000557932.1	+	0	1487				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						ACAGCCAGGACAAGCTGCTCA	0.612																																						dbGAP											0																																										-	-	-			0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516539C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			WASH3P	-	-	ENSG00000185596		0.612	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1	12	0.00	0	C	NM_199163		102516539	102516539	+1	no_errors	ENST00000557932	ensembl	human	known	69_37n	rna	3	50.00	3	SNP	0.000	G
WDFY3	23001	genome.wustl.edu	37	4	85731339	85731339	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr4:85731339delA	ENST00000295888.4	-	14	2453	c.2046delT	c.(2044-2046)tttfs	p.F682fs	WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Frame_Shift_Del_p.F682fs	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	682					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GAAGAAGTTCAAACACTTGAT	0.443																																						dbGAP											0													93.0	90.0	91.0					4																	85731339		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2046delT	4.37:g.85731339delA	ENSP00000295888:p.Phe682fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Frame_Shift_Del	DEL	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F682fs	ENST00000295888.4	37	c.2046	CCDS3609.1	4																																																																																			WDFY3	-	superfamily_ARM-type_fold	ENSG00000163625		0.443	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	42	0.00	0	A	NM_014991		85731339	85731339	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	frame_shift_del	26	35.00	14	DEL	0.993	-
ZDHHC22	283576	genome.wustl.edu	37	14	77600207	77600207	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24R-01A-11D-A167-09	TCGA-AR-A24R-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baf43433-0001-4495-a37f-9132eb213157	b45104f7-fe20-40de-ae99-af24c080a284	g.chr14:77600207C>T	ENST00000319374.4	-	3	813	c.611G>A	c.(610-612)tGc>tAc	p.C204Y	RP11-463C8.4_ENST00000557752.1_Intron	NM_174976.2	NP_777636.2	Q8N966	ZDH22_HUMAN	zinc finger, DHHC-type containing 22	204					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)|urinary_tract(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		CAGCTGGTGGCAGCAGAAGCC	0.652																																						dbGAP											0													19.0	27.0	24.0					14																	77600207		1987	4162	6149	-	-	-	SO:0001583	missense	0			AK095612	CCDS45140.1	14q24.3	2008-08-06	2004-03-05	2004-03-10	ENSG00000177108	ENSG00000177108		"""Zinc fingers, DHHC-type"""	20106	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 59"""	C14orf59			Standard	NM_174976		Approved		uc010asp.3	Q8N966		ENST00000319374.4:c.611G>A	14.37:g.77600207C>T	ENSP00000318222:p.Cys204Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH02|B7Z2L5|Q149P4	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_SSD,pfscan_Znf_DHHC_palmitoyltrfase	p.C204Y	ENST00000319374.4	37	c.611	CCDS45140.1	14	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192592	0.58017	.	.	ENSG00000177108	ENST00000319374	T	0.24151	1.87	5.27	5.27	0.74061	.	.	.	.	.	T	0.21801	0.0525	L	0.42487	1.325	0.58432	D	0.999997	P	0.41673	0.759	B	0.41374	0.355	T	0.02736	-1.1117	9	0.02654	T	1	.	15.2811	0.73784	0.1406:0.8594:0.0:0.0	.	204	Q8N966	ZDH22_HUMAN	Y	204	ENSP00000318222:C204Y	ENSP00000318222:C204Y	C	-	2	0	ZDHHC22	76669960	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.803000	0.55560	2.445000	0.82738	0.561000	0.74099	TGC	ZDHHC22	-	NULL	ENSG00000177108		0.652	ZDHHC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC22	HGNC	protein_coding	OTTHUMT00000414289.1	28	0.00	0	C	NM_174976		77600207	77600207	-1	no_errors	ENST00000319374	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	1.000	T
