#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACPP	55	genome.wustl.edu	37	3	132047117	132047117	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr3:132047117C>T	ENST00000336375.5	+	2	217	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W	ACPP_ENST00000351273.7_Missense_Mutation_p.R43W|ACPP_ENST00000475741.1_Missense_Mutation_p.R43W|ACPP_ENST00000489084.1_3'UTR	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	43					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TCAGGTGTTTCGGCATGGAGA	0.443																																						dbGAP											0													78.0	68.0	71.0					3																	132047117		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.127C>T	3.37:g.132047117C>T	ENSP00000337471:p.Arg43Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.R43W	ENST00000336375.5	37	c.127	CCDS3073.1	3	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940883	0.73557	.	.	ENSG00000014257	ENST00000336375;ENST00000495911;ENST00000475741;ENST00000351273	D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24	5.72	4.8	0.61643	.	0.000000	0.64402	D	0.000006	D	0.97748	0.9261	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.98376	1.0556	10	0.87932	D	0	.	13.1682	0.59583	0.2078:0.7922:0.0:0.0	.	43;43;43	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	W	43	ENSP00000337471:R43W;ENSP00000418366:R43W;ENSP00000417744:R43W;ENSP00000323036:R43W	ENSP00000337471:R43W	R	+	1	2	ACPP	133529807	1.000000	0.71417	0.990000	0.47175	0.812000	0.45895	3.460000	0.53028	1.271000	0.44313	0.655000	0.94253	CGG	ACPP	-	pfam_His_Pase_superF_clade-2	ENSG00000014257		0.443	ACPP-001	KNOWN	basic|CCDS	protein_coding	ACPP	HGNC	protein_coding	OTTHUMT00000356699.2	20	0.00	0	C	NM_001099		132047117	132047117	+1	no_errors	ENST00000351273	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	T
ALG13	79868	genome.wustl.edu	37	X	110951473	110951473	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chrX:110951473T>C	ENST00000394780.3	+	4	614	c.602T>C	c.(601-603)cTg>cCg	p.L201P	ALG13-AS1_ENST00000430794.1_RNA|ALG13_ENST00000251943.4_Missense_Mutation_p.L97P	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	201	Deubiquitinase activity.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						ACCCCCACCCTGTACAAAATG	0.463																																						dbGAP											0													103.0	88.0	92.0					X																	110951473		1568	3582	5150	-	-	-	SO:0001583	missense	0			AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.602T>C	X.37:g.110951473T>C	ENSP00000378260:p.Leu201Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU,pfscan_Tudor	p.L97P	ENST00000394780.3	37	c.290	CCDS55477.1	X	.	.	.	.	.	.	.	.	.	.	T	9.248	1.040126	0.19669	.	.	ENSG00000101901	ENST00000251943;ENST00000486353;ENST00000394780;ENST00000495283	T;T;T;T	0.80123	1.36;-1.34;0.38;1.31	4.55	-5.53	0.02552	.	.	.	.	.	T	0.53222	0.1783	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.43702	-0.9375	9	0.72032	D	0.01	.	7.6852	0.28536	0.1128:0.2607:0.0:0.6265	.	123;201;97	Q9NP73-3;Q9NP73;Q9NP73-4	.;ALG13_HUMAN;.	P	97;201;201;97	ENSP00000251943:L97P;ENSP00000426892:L201P;ENSP00000378260:L201P;ENSP00000427093:L97P	ENSP00000251943:L97P	L	+	2	0	ALG13	110838129	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.212000	0.09319	-1.365000	0.02158	-1.124000	0.02001	CTG	ALG13	-	NULL	ENSG00000101901		0.463	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	HGNC	protein_coding	OTTHUMT00000272895.1	74	0.00	0	T	NM_018466		110951473	110951473	+1	no_errors	ENST00000251943	ensembl	human	known	69_37n	missense	46	38.67	29	SNP	0.000	C
AMY2A	279	genome.wustl.edu	37	1	104166496	104166496	+	Silent	SNP	T	T	C	rs1140401		TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr1:104166496T>C	ENST00000414303.2	+	8	1174	c.1110T>C	c.(1108-1110)aaT>aaC	p.N370N	AMY2A_ENST00000497748.1_3'UTR	NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	370					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	AGGATGTTAATGATTGGGTTG	0.393																																						dbGAP											0													4.0	4.0	4.0					1																	104166496		1472	3368	4840	-	-	-	SO:0001819	synonymous_variant	0			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.1110T>C	1.37:g.104166496T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJG1|Q9UBH3	Silent	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.N370	ENST00000414303.2	37	c.1110	CCDS783.1	1																																																																																			AMY2A	-	superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000243480		0.393	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2A	HGNC	protein_coding	OTTHUMT00000030315.1	60	0.00	0	T	NM_000699		104166496	104166496	+1	no_errors	ENST00000414303	ensembl	human	known	69_37n	silent	45	11.76	6	SNP	1.000	C
B4GALT1	2683	genome.wustl.edu	37	9	33135286	33135286	+	Silent	SNP	T	T	C			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr9:33135286T>C	ENST00000379731.4	-	2	735	c.549A>G	c.(547-549)ccA>ccG	p.P183P	B4GALT1_ENST00000535206.1_Silent_p.P183P	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	183	UDP-alpha-D-galactose binding.				acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	GGTTGCGGAATGGAATGATGA	0.557																																						dbGAP											0													110.0	97.0	102.0					9																	33135286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.549A>G	9.37:g.33135286T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Silent	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.P183	ENST00000379731.4	37	c.549	CCDS6535.1	9																																																																																			B4GALT1	-	pfam_Galactosyl_T_2_met	ENSG00000086062		0.557	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT1	HGNC	protein_coding	OTTHUMT00000052039.1	55	0.00	0	T	NM_001497		33135286	33135286	-1	no_errors	ENST00000379731	ensembl	human	known	69_37n	silent	34	26.09	12	SNP	0.990	C
CARD6	84674	genome.wustl.edu	37	5	40841761	40841761	+	Silent	SNP	A	A	C			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr5:40841761A>C	ENST00000254691.5	+	1	476	c.277A>C	c.(277-279)Agg>Cgg	p.R93R	CARD6_ENST00000381677.3_Silent_p.R93R	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	93	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.		R -> K (in dbSNP:rs7715491).		apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						TTGCGGCTTAAGGCATGGTAA	0.388																																						dbGAP											0													89.0	93.0	92.0					5																	40841761		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.277A>C	5.37:g.40841761A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LR2	Silent	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.R93	ENST00000254691.5	37	c.277	CCDS3935.1	5																																																																																			CARD6	-	superfamily_DEATH-like	ENSG00000132357		0.388	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3	63	0.00	0	A			40841761	40841761	+1	no_errors	ENST00000254691	ensembl	human	known	69_37n	silent	48	32.39	23	SNP	0.003	C
CCDC114	93233	genome.wustl.edu	37	19	48821779	48821779	+	Silent	SNP	G	G	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr19:48821779G>A	ENST00000315396.7	-	3	796	c.114C>T	c.(112-114)agC>agT	p.S38S	CCDC114_ENST00000497803.1_5'UTR	NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	38					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		TCTGGGCTGCGCTGATCTGCA	0.662																																						dbGAP											0													28.0	30.0	30.0					19																	48821779		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.114C>T	19.37:g.48821779G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRL4|Q96M06|Q9UFG8	Silent	SNP	NULL	p.S38	ENST00000315396.7	37	c.114	CCDS12714.2	19																																																																																			CCDC114	-	NULL	ENSG00000105479		0.662	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC114	HGNC	protein_coding	OTTHUMT00000343207.1	20	0.00	0	G	NM_144577		48821779	48821779	-1	no_errors	ENST00000315396	ensembl	human	known	69_37n	silent	17	43.33	13	SNP	0.000	A
CDH1	999	genome.wustl.edu	37	16	68862076	68862076	+	Splice_Site	SNP	G	G	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr16:68862076G>T	ENST00000261769.5	+	14	2355		c.e14-1		CDH1_ENST00000422392.2_Splice_Site|CDH1_ENST00000562836.1_Splice_Site	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CACCATCCCAGTTCTGATTCT	0.537			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	1	Unknown(1)	breast(1)											111.0	103.0	106.0					16																	68862076		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2165-1G>T	16.37:g.68862076G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Splice_Site	SNP	-	e14-1	ENST00000261769.5	37	c.2165-1	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	24.7	4.556819	0.86231	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000422392	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2544	0.98414	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH1	67419577	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.339000	0.96797	2.885000	0.99019	0.655000	0.94253	.	CDH1	-	-	ENSG00000039068		0.537	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	74	0.00	0	G	NM_004360	Intron	68862076	68862076	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	splice_site	27	46.00	23	SNP	1.000	T
CRK	1398	genome.wustl.edu	37	17	1340206	1340206	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr17:1340206C>T	ENST00000300574.2	-	2	625	c.485G>A	c.(484-486)cGg>cAg	p.R162Q	CRK_ENST00000572145.1_5'UTR|CRK_ENST00000574295.1_Intron|CRK_ENST00000398970.5_Missense_Mutation_p.R162Q	NM_016823.3	NP_058431.2	P46108	CRK_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog	162	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|ephrin receptor signaling pathway (GO:0048013)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Rho GTPase activity (GO:0032319)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|SH2 domain binding (GO:0042169)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)	9				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		AGGCTTGTCCCGGATTCTCAA	0.527																																						dbGAP											0													145.0	132.0	136.0					17																	1340206		2203	4300	6503	-	-	-	SO:0001583	missense	0			D10656	CCDS11002.1, CCDS45561.1	17p13	2013-07-09	2013-07-09		ENSG00000167193	ENSG00000167193		"""SH2 domain containing"""	2362	protein-coding gene	gene with protein product		164762				1690891	Standard	NM_005206		Approved		uc002fsl.3	P46108	OTTHUMG00000090317	ENST00000300574.2:c.485G>A	17.37:g.1340206C>T	ENSP00000300574:p.Arg162Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWE8|B0LPE8|D3DTH6|Q96GA9|Q96HJ0	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH2,smart_SH3_domain,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.R162Q	ENST00000300574.2	37	c.485	CCDS11002.1	17	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554715	0.65425	.	.	ENSG00000167193	ENST00000300574;ENST00000398970	T;T	0.47869	0.83;0.83	5.93	5.93	0.95920	Src homology-3 domain (5);	0.057912	0.64402	D	0.000001	T	0.36303	0.0962	N	0.17082	0.46	0.80722	D	1	P;B	0.42296	0.775;0.124	B;B	0.38683	0.279;0.097	T	0.35822	-0.9773	10	0.87932	D	0	-13.5561	17.8219	0.88653	0.0:1.0:0.0:0.0	.	162;162	P46108-2;P46108	.;CRK_HUMAN	Q	162	ENSP00000300574:R162Q;ENSP00000381942:R162Q	ENSP00000300574:R162Q	R	-	2	0	CRK	1286956	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.009000	0.57110	2.802000	0.96397	0.561000	0.74099	CGG	CRK	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	ENSG00000167193		0.527	CRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRK	HGNC	protein_coding	OTTHUMT00000206679.1	52	0.00	0	C	NM_016823		1340206	1340206	-1	no_errors	ENST00000300574	ensembl	human	known	69_37n	missense	22	47.62	20	SNP	1.000	T
CROCCP2	84809	genome.wustl.edu	37	1	16950687	16950687	+	lincRNA	SNP	G	G	T	rs1762940		TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr1:16950687G>T	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GCCCCTGGGGGCCCGTGCCTG	0.667																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950687G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.667	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	9	0.00	0	G	NR_026752.1		16950687	16950687	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	17	22.73	5	SNP	0.003	T
ELF4	2000	genome.wustl.edu	37	X	129201171	129201171	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chrX:129201171C>T	ENST00000308167.5	-	9	1896	c.1517G>A	c.(1516-1518)gGg>gAg	p.G506E	ELF4_ENST00000335997.7_Missense_Mutation_p.G506E	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TGGTCCAGCCCCTGTGACCGT	0.667			T	ERG	AML																																	dbGAP		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	0													25.0	27.0	26.0					X																	129201171		2200	4286	6486	-	-	-	SO:0001583	missense	0			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.1517G>A	X.37:g.129201171C>T	ENSP00000311280:p.Gly506Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.G506E	ENST00000308167.5	37	c.1517	CCDS14617.1	X	.	.	.	.	.	.	.	.	.	.	c	11.47	1.647158	0.29246	.	.	ENSG00000102034	ENST00000335997;ENST00000308167	T;T	0.20069	2.1;2.1	3.62	2.73	0.32206	.	0.363612	0.25753	N	0.028531	T	0.13372	0.0324	L	0.27053	0.805	0.09310	N	0.999999	B	0.32968	0.392	B	0.34346	0.18	T	0.17623	-1.0363	10	0.30078	T	0.28	.	7.9647	0.30091	0.0:0.7533:0.2467:0.0	.	506	Q99607	ELF4_HUMAN	E	506	ENSP00000338608:G506E;ENSP00000311280:G506E	ENSP00000311280:G506E	G	-	2	0	ELF4	129028852	0.793000	0.28825	0.076000	0.20297	0.995000	0.86356	0.764000	0.26532	0.874000	0.35823	0.509000	0.49947	GGG	ELF4	-	NULL	ENSG00000102034		0.667	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF4	HGNC	protein_coding	OTTHUMT00000058243.1	22	0.00	0	C	NM_001421		129201171	129201171	-1	no_errors	ENST00000308167	ensembl	human	known	69_37n	missense	12	45.45	10	SNP	0.152	T
EP400	57634	genome.wustl.edu	37	12	132466866	132466866	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr12:132466866A>G	ENST00000333577.4	+	6	1989	c.1880A>G	c.(1879-1881)cAa>cGa	p.Q627R	EP400_ENST00000332482.4_Missense_Mutation_p.Q554R|EP400_ENST00000389562.2_Missense_Mutation_p.Q590R|EP400_ENST00000389561.2_Missense_Mutation_p.Q591R|EP400_ENST00000330386.6_Missense_Mutation_p.Q591R			Q96L91	EP400_HUMAN	E1A binding protein p400	627					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		ACACAGCTCCAAATCCCGGTG	0.662																																						dbGAP											0													120.0	110.0	113.0					12																	132466866		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.1880A>G	12.37:g.132466866A>G	ENSP00000333602:p.Gln627Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q627R	ENST00000333577.4	37	c.1880		12	.	.	.	.	.	.	.	.	.	.	A	12.61	1.989557	0.35131	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.90788	-2.73;-2.72;-2.72;-2.72;-2.71	5.52	3.04	0.35103	.	0.174851	0.51477	D	0.000094	D	0.87712	0.6246	M	0.62723	1.935	0.30989	N	0.72163	P;P;P;P;P	0.44195	0.493;0.493;0.493;0.828;0.787	B;B;B;B;B	0.41988	0.3;0.3;0.3;0.302;0.372	D	0.83586	0.0120	10	0.13853	T	0.58	.	13.1094	0.59265	0.5974:0.4026:0.0:0.0	.	591;591;590;627;554	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	R	554;627;591;590;554;591;627;591;591	ENSP00000333602:Q627R;ENSP00000374212:Q591R;ENSP00000374213:Q590R;ENSP00000331737:Q554R;ENSP00000330620:Q591R	ENSP00000330620:Q591R	Q	+	2	0	EP400	131032819	0.977000	0.34250	0.985000	0.45067	0.881000	0.50899	2.897000	0.48664	0.900000	0.36469	0.533000	0.62120	CAA	EP400	-	NULL	ENSG00000183495		0.662	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		33	0.00	0	A	NM_015409		132466866	132466866	+1	no_errors	ENST00000333577	ensembl	human	known	69_37n	missense	15	33.33	8	SNP	0.996	G
FAM188B	84182	genome.wustl.edu	37	7	30825399	30825399	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr7:30825399T>A	ENST00000265299.6	+	4	531	c.454T>A	c.(454-456)Ttt>Att	p.F152I	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	152										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACTTGGTAATTTTGTATCATC	0.418																																						dbGAP											0													115.0	120.0	118.0					7																	30825399		1841	4098	5939	-	-	-	SO:0001583	missense	0			AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.454T>A	7.37:g.30825399T>A	ENSP00000265299:p.Phe152Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71AZ7|Q9H6D2	Missense_Mutation	SNP	NULL	p.F152I	ENST00000265299.6	37	c.454	CCDS43565.1	7	.	.	.	.	.	.	.	.	.	.	T	9.872	1.199162	0.22121	.	.	ENSG00000106125	ENST00000265299	T	0.02737	4.18	5.19	2.71	0.32032	.	1.225800	0.05364	N	0.534189	T	0.04092	0.0114	L	0.50919	1.6	0.21220	N	0.999755	B	0.24823	0.112	B	0.19148	0.024	T	0.41288	-0.9517	10	0.87932	D	0	-17.2886	4.5981	0.12340	0.168:0.0914:0.0:0.7406	.	152	Q4G0A6	F188B_HUMAN	I	152	ENSP00000265299:F152I	ENSP00000265299:F152I	F	+	1	0	FAM188B	30791924	0.785000	0.28726	0.792000	0.32020	0.352000	0.29268	0.637000	0.24659	1.015000	0.39444	0.529000	0.55759	TTT	FAM188B	-	NULL	ENSG00000106125		0.418	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188B	HGNC	protein_coding	OTTHUMT00000327962.1	54	0.00	0	T	NM_032222		30825399	30825399	+1	no_errors	ENST00000265299	ensembl	human	known	69_37n	missense	39	36.07	22	SNP	0.442	A
GATA3	2625	genome.wustl.edu	37	10	8111433	8111434	+	Splice_Site	DEL	CA	CA	-	rs111853237		TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr10:8111433_8111434delCA	ENST00000346208.3	+	5	1376		c.e5-1		GATA3_ENST00000461472.1_Splice_Site|GATA3_ENST00000379328.3_Splice_Site			P23771	GATA3_HUMAN	GATA binding protein 3						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(7)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCCCCACTCTCAGTCTGCAGCC	0.48			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	7	Unknown(7)	breast(7)																																								-	-	-	SO:0001630	splice_region_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.922-1CA>-	10.37:g.8111433_8111434delCA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Splice_Site	DEL	-	e4-2	ENST00000346208.3	37	c.925-3_925-2	CCDS7083.1	10																																																																																			GATA3	-	-	ENSG00000107485		0.480	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	38	0	0	CA	NM_001002295	Intron	8111433	8111434	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	splice_site_del	26	16.13	5	DEL	1.000:1.000	-
GPR116	221395	genome.wustl.edu	37	6	46826226	46826226	+	Silent	SNP	G	G	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr6:46826226G>A	ENST00000283296.7	-	17	3702	c.3414C>T	c.(3412-3414)tgC>tgT	p.C1138C	GPR116_ENST00000265417.7_Silent_p.C1138C|GPR116_ENST00000545669.1_Silent_p.C567C|GPR116_ENST00000362015.4_Silent_p.C1138C|GPR116_ENST00000456426.2_Silent_p.C996C	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	1138					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TGGCAAGTGGGCAGCCATAGC	0.552																																					NSCLC(59;410 1274 8751 36715 50546)	dbGAP											0													35.0	36.0	35.0					6																	46826226		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.3414C>T	6.37:g.46826226G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.C1138	ENST00000283296.7	37	c.3414	CCDS4919.1	6																																																																																			GPR116	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000069122		0.552	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	24	0.00	0	G	NM_015234		46826226	46826226	-1	no_errors	ENST00000265417	ensembl	human	known	69_37n	silent	14	33.33	7	SNP	1.000	A
HMGCS1	3157	genome.wustl.edu	37	5	43294939	43294939	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr5:43294939G>T	ENST00000325110.6	-	7	1136	c.930C>A	c.(928-930)taC>taA	p.Y310*	HMGCS1_ENST00000433297.2_Nonsense_Mutation_p.Y310*	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	310					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						CTCTATCAAAGTAGGTGTCTT	0.333																																						dbGAP											0													150.0	146.0	147.0					5																	43294939		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.930C>A	5.37:g.43294939G>T	ENSP00000322706:p.Tyr310*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDL8	Nonsense_Mutation	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.Y310*	ENST00000325110.6	37	c.930	CCDS34154.1	5	.	.	.	.	.	.	.	.	.	.	G	38	6.715734	0.97784	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275	.	.	.	5.76	3.01	0.34805	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.8238	9.5118	0.39082	0.3399:0.0:0.6601:0.0	.	.	.	.	X	310;310;299	.	ENSP00000322706:Y310X	Y	-	3	2	HMGCS1	43330696	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.819000	0.39022	0.356000	0.24157	-0.384000	0.06662	TAC	HMGCS1	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	ENSG00000112972		0.333	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS1	HGNC	protein_coding	OTTHUMT00000368022.1	75	0.00	0	G			43294939	43294939	-1	no_errors	ENST00000325110	ensembl	human	known	69_37n	nonsense	58	13.43	9	SNP	1.000	T
HSCB	150274	genome.wustl.edu	37	22	29141935	29141935	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr22:29141935T>A	ENST00000216027.3	+	4	572	c.507T>A	c.(505-507)aaT>aaA	p.N169K	HSCB_ENST00000495977.1_3'UTR|HSCB_ENST00000398941.2_Intron	NM_172002.3	NP_741999.3	Q8IWL3	HSC20_HUMAN	HscB mitochondrial iron-sulfur cluster co-chaperone	169					iron-sulfur cluster assembly (GO:0016226)|protein folding (GO:0006457)|protein oligomerization (GO:0051259)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|lung(2)|skin(1)	4						TGGAAATCAATGAAAAACTCG	0.373																																						dbGAP											0													61.0	62.0	62.0					22																	29141935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY191719	CCDS13845.1	22q12.1	2013-09-12	2013-09-12		ENSG00000100209	ENSG00000100209		"""Heat shock proteins / DNAJ (HSP40)"""	28913	protein-coding gene	gene with protein product	"""DnaJ (Hsp40) homolog, subfamily C, member 20"""	608142	"""HscB iron-sulfur cluster co-chaperone homolog (E. coli)"""			12938016, 16952052	Standard	NM_172002		Approved	HSC20, DNAJC20, Jac1	uc003aea.3	Q8IWL3	OTTHUMG00000151092	ENST00000216027.3:c.507T>A	22.37:g.29141935T>A	ENSP00000216027:p.Asn169Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWS7	Missense_Mutation	SNP	pfam_Heat_shock_cognate_B_oligo_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_Heat_shock_cognate_B_oligo_C,tigrfam_HscB	p.N169K	ENST00000216027.3	37	c.507	CCDS13845.1	22	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076277	0.76415	.	.	ENSG00000100209	ENST00000216027	T	0.44083	0.93	5.79	4.76	0.60689	Heat shock cognate protein B, C-terminal oligomerisation (3);	0.000000	0.85682	D	0.000000	T	0.64724	0.2624	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66693	-0.5859	10	0.56958	D	0.05	-20.3024	8.6682	0.34134	0.0:0.0859:0.0:0.9141	.	169	Q8IWL3	HSC20_HUMAN	K	169	ENSP00000216027:N169K	ENSP00000216027:N169K	N	+	3	2	HSCB	27471935	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.794000	0.26958	1.026000	0.39733	0.455000	0.32223	AAT	HSCB	-	pfam_Heat_shock_cognate_B_oligo_C,superfamily_Heat_shock_cognate_B_oligo_C,tigrfam_HscB	ENSG00000100209		0.373	HSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSCB	HGNC	protein_coding	OTTHUMT00000321263.1	44	0.00	0	T	NM_172002		29141935	29141935	+1	no_errors	ENST00000216027	ensembl	human	known	69_37n	missense	13	53.57	15	SNP	1.000	A
IQSEC2	23096	genome.wustl.edu	37	X	53264131	53264133	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chrX:53264131_53264133delTGG	ENST00000375368.5	-	14	3905_3907	c.3705_3707delCCA	c.(3703-3708)caccat>cat	p.1235_1236HH>H	IQSEC2_ENST00000396435.3_In_Frame_Del_p.1245_1246HH>H|IQSEC2_ENST00000375365.2_3'UTR			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1235	His-rich.|Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ATGGCCAtgatggtggtggtggt	0.665																																						dbGAP											0									,	106,2327		14,58,20,1011,247					,	1.7	1.0			37	227,3988		17,90,103,1472,954	no	utr-3,coding	IQSEC2	NM_015075.1,NM_001111125.2	,	31,148,123,2483,1201	A1A1,A1R,A1,RR,R		5.3855,4.3568,5.009	,	,		333,6315				-	-	-	SO:0001651	inframe_deletion	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3705_3707delCCA	X.37:g.53264140_53264142delTGG	ENSP00000364517:p.His1237del	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	In_Frame_Del	DEL	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.H1247in_frame_del	ENST00000375368.5	37	c.3737_3735		X																																																																																			IQSEC2	-	NULL	ENSG00000124313		0.665	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		36	0.00	0	TGG	XM_291345		53264131	53264133	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	in_frame_del	34	15.00	6	DEL	0.997:0.991:0.967	-
KIAA0754	643314	genome.wustl.edu	37	1	39878515	39878515	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr1:39878515A>G	ENST00000530275.1	+	1	2365	c.2170A>G	c.(2170-2172)Att>Gtt	p.I724V	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	724										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGGTACCTCAATTGCTGCAGT	0.547																																						dbGAP											0													43.0	44.0	44.0					1																	39878515		2017	4172	6189	-	-	-	SO:0001583	missense	0					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2170A>G	1.37:g.39878515A>G	ENSP00000431179:p.Ile724Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.I724V	ENST00000530275.1	37	c.2170		1	.	.	.	.	.	.	.	.	.	.	A	1.345	-0.592944	0.03771	.	.	ENSG00000255103	ENST00000530275	T	0.23754	1.89	3.51	-0.697	0.11284	.	.	.	.	.	T	0.11965	0.0291	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.36261	-0.9755	9	0.14252	T	0.57	.	4.1097	0.10053	0.4906:0.187:0.3224:0.0	.	724	O94854	K0754_HUMAN	V	724	ENSP00000431179:I724V	ENSP00000431179:I724V	I	+	1	0	RP4-562N20.1	39651102	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	0.196000	0.17176	-0.018000	0.14079	-0.366000	0.07423	ATT	KIAA0754	-	NULL	ENSG00000255103		0.547	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	34	0.00	0	A	NM_015038		39878515	39878515	+1	no_errors	ENST00000530275	ensembl	human	known	69_37n	missense	25	34.21	13	SNP	0.000	G
KIAA1210	57481	genome.wustl.edu	37	X	118222466	118222466	+	Silent	SNP	C	C	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chrX:118222466C>A	ENST00000402510.2	-	11	2726	c.2727G>T	c.(2725-2727)ctG>ctT	p.L909L		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	909										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ATCTGGAAGGCAGCTGCTGCA	0.483																																						dbGAP											0													50.0	47.0	48.0					X																	118222466		1930	4127	6057	-	-	-	SO:0001819	synonymous_variant	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.2727G>T	X.37:g.118222466C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZCI8|Q5JPN4	Silent	SNP	NULL	p.L909	ENST00000402510.2	37	c.2727	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	2.352	-0.348638	0.05208	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.39	-2.51	0.06365	.	.	.	.	.	T	0.21022	0.0506	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27262	-1.0079	4	.	.	.	.	3.7543	0.08579	0.5751:0.204:0.1284:0.0926	.	.	.	.	S	316	.	.	A	-	1	0	KIAA1210	118106494	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.887000	0.04152	-0.731000	0.04862	0.600000	0.82982	GCC	KIAA1210	-	NULL	ENSG00000250423		0.483	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	43	0.00	0	C	NM_020721		118222466	118222466	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	silent	26	39.53	17	SNP	0.000	A
MEGF8	1954	genome.wustl.edu	37	19	42875614	42875614	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr19:42875614C>T	ENST00000251268.6	+	41	7249	c.7249C>T	c.(7249-7251)Cga>Tga	p.R2417*	MEGF8_ENST00000378073.4_Intron|MEGF8_ENST00000334370.4_Nonsense_Mutation_p.R2350*	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2417	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CAGTGACCGTCGAGACTGCTA	0.622																																						dbGAP											0													80.0	67.0	71.0					19																	42875614		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7249C>T	19.37:g.42875614C>T	ENSP00000251268:p.Arg2417*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Nonsense_Mutation	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.R2417*	ENST00000251268.6	37	c.7249		19	.	.	.	.	.	.	.	.	.	.	C	52	19.083793	0.99914	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	.	.	.	4.91	3.86	0.44501	.	0.085177	0.47852	D	0.000213	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.7633	11.7629	0.51914	0.4259:0.5741:0.0:0.0	.	.	.	.	X	2350;2417	.	ENSP00000251268:R2417X	R	+	1	2	MEGF8	47567454	0.993000	0.37304	1.000000	0.80357	0.971000	0.66376	2.119000	0.41958	1.382000	0.46385	-0.268000	0.10319	CGA	MEGF8	-	smart_EGF-like	ENSG00000105429		0.622	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	24	0.00	0	C	NM_001410		42875614	42875614	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	nonsense	14	39.13	9	SNP	1.000	T
LRRC4B	94030	genome.wustl.edu	37	19	51021711	51021711	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr19:51021711G>A	ENST00000599957.1	-	3	1456	c.1259C>T	c.(1258-1260)aCg>aTg	p.T420M	LRRC4B_ENST00000389201.3_Missense_Mutation_p.T420M			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	420	Ig-like C2-type.				positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GAAGTTAAGCGTGCCGTCATG	0.642																																						dbGAP											0													64.0	73.0	70.0					19																	51021711		2198	4277	6475	-	-	-	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1259C>T	19.37:g.51021711G>A	ENSP00000471502:p.Thr420Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T420M	ENST00000599957.1	37	c.1259	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570349	0.65765	.	.	ENSG00000131409	ENST00000389201	T	0.70986	-0.53	3.56	3.56	0.40772	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000001	D	0.83202	0.5203	M	0.79805	2.47	0.54753	D	0.999985	D	0.89917	1.0	D	0.97110	1.0	D	0.85779	0.1360	10	0.72032	D	0.01	.	13.0396	0.58891	0.0:0.0:1.0:0.0	.	420	Q9NT99	LRC4B_HUMAN	M	420	ENSP00000373853:T420M	ENSP00000373853:T420M	T	-	2	0	LRRC4B	55713523	1.000000	0.71417	0.998000	0.56505	0.894000	0.52154	9.638000	0.98445	2.001000	0.58596	0.462000	0.41574	ACG	LRRC4B	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000131409		0.642	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	19	0.00	0	G	NM_001080457		51021711	51021711	-1	no_errors	ENST00000389201	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	1.000	A
MUC5B	727897	genome.wustl.edu	37	11	1251759	1251759	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr11:1251759C>T	ENST00000529681.1	+	12	1457	c.1399C>T	c.(1399-1401)Cgg>Tgg	p.R467W	MUC5B_ENST00000447027.1_Missense_Mutation_p.R470W	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	467	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.			RK -> GR (in Ref. 2; AAC67545). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCTGAGCTGCGGAAGTGCGG	0.667																																						dbGAP											0													39.0	47.0	44.0					11																	1251759		2101	4221	6322	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1399C>T	11.37:g.1251759C>T	ENSP00000436812:p.Arg467Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.R470W	ENST00000529681.1	37	c.1408	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	7.178	0.589086	0.13812	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.60920	0.15;0.15	4.13	3.2	0.36748	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.77054	0.4074	M	0.86178	2.8	0.27404	N	0.95477	D;D;D	0.89917	0.997;1.0;1.0	P;D;D	0.73708	0.765;0.981;0.981	T	0.70048	-0.4979	9	0.87932	D	0	.	12.873	0.57975	0.1638:0.8362:0.0:0.0	.	467;1126;470	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	W	467;470;468;503	ENSP00000436812:R467W;ENSP00000415793:R470W	ENSP00000343037:R468W	R	+	1	2	MUC5B	1208335	0.009000	0.17119	0.859000	0.33776	0.014000	0.08584	1.609000	0.36858	0.702000	0.31825	0.305000	0.20034	CGG	MUC5B	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000117983		0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	12	0.00	0	C	XM_001126093		1251759	1251759	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.980	T
POLR2J	5439	genome.wustl.edu	37	7	102116678	102116678	+	Silent	SNP	A	A	G			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr7:102116678A>G	ENST00000292614.5	-	2	139	c.93T>C	c.(91-93)tgT>tgC	p.C31C	POLR2J_ENST00000393794.3_Silent_p.C31C	NM_006234.4	NP_006225.1	P52435	RPB11_HUMAN	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa	31					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|LRR domain binding (GO:0030275)			pancreas(2)	2						TGGTGAATAAACAGGCATTGG	0.517																																						dbGAP											0													15.0	10.0	12.0					7																	102116678		1988	3792	5780	-	-	-	SO:0001819	synonymous_variant	0			X98433	CCDS5724.1	7q11.2	2013-01-21	2002-08-29		ENSG00000005075	ENSG00000005075		"""RNA polymerase subunits"""	9197	protein-coding gene	gene with protein product		604150	"""polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)"""				Standard	XM_005250452		Approved	RPB11, hRPB14, RPB11A, RPB11m, POLR2J1	uc003uzp.1	P52435	OTTHUMG00000150387	ENST00000292614.5:c.93T>C	7.37:g.102116678A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6V8|O43375	Silent	SNP	pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like	p.C31	ENST00000292614.5	37	c.93	CCDS5724.1	7																																																																																			POLR2J	-	superfamily_DNA-dir_RNA_pol_RBP11-like	ENSG00000005075		0.517	POLR2J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2J	HGNC	protein_coding	OTTHUMT00000317913.1	51	0.00	0	A	NM_006234		102116678	102116678	-1	no_errors	ENST00000393794	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.723	G
PRMT7	54496	genome.wustl.edu	37	16	68379634	68379634	+	Silent	SNP	G	G	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr16:68379634G>T	ENST00000339507.5	+	10	1814	c.984G>T	c.(982-984)gtG>gtT	p.V328V	PRMT7_ENST00000441236.1_Silent_p.V278V|PRMT7_ENST00000449359.3_Silent_p.V278V|PRMT7_ENST00000348497.4_Silent_p.V254V			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	328	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		AGCCTGTGGTGCAGGGCTCAG	0.582																																						dbGAP											0													127.0	124.0	125.0					16																	68379634		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.984G>T	16.37:g.68379634G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Silent	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pirsf_Arg_MeTrfase_PRMT7	p.V328	ENST00000339507.5	37	c.984	CCDS10866.1	16																																																																																			PRMT7	-	pirsf_Arg_MeTrfase_PRMT7	ENSG00000132600		0.582	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT7	HGNC	protein_coding	OTTHUMT00000268892.3	21	0.00	0	G	NM_019023		68379634	68379634	+1	no_errors	ENST00000339507	ensembl	human	known	69_37n	silent	7	50.00	7	SNP	0.000	T
RBM19	9904	genome.wustl.edu	37	12	114395756	114395756	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr12:114395756G>A	ENST00000545145.2	-	6	749	c.671C>T	c.(670-672)tCg>tTg	p.S224L	RBM19_ENST00000261741.5_Missense_Mutation_p.S224L|RBM19_ENST00000392561.3_Missense_Mutation_p.S224L	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	224					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CTCTTCCTCCGAGGAAGAGGA	0.557																																						dbGAP											0													123.0	111.0	115.0					12																	114395756		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.671C>T	12.37:g.114395756G>A	ENSP00000442053:p.Ser224Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.S224L	ENST00000545145.2	37	c.671	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	G	1.211	-0.629638	0.03610	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.06449	3.3;3.3;3.3	3.15	-0.578	0.11724	Nucleotide-binding, alpha-beta plait (1);	3.106880	0.01201	N	0.007575	T	0.05364	0.0142	N	0.24115	0.695	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.38373	-0.9664	10	0.26408	T	0.33	8.4015	6.6366	0.22887	0.0:0.1648:0.2669:0.5682	.	224	Q9Y4C8	RBM19_HUMAN	L	224	ENSP00000442053:S224L;ENSP00000376344:S224L;ENSP00000261741:S224L	ENSP00000261741:S224L	S	-	2	0	RBM19	112880139	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.362000	0.20284	-0.114000	0.11936	-1.028000	0.02416	TCG	RBM19	-	NULL	ENSG00000122965		0.557	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	41	0.00	0	G	NM_016196		114395756	114395756	-1	no_errors	ENST00000261741	ensembl	human	known	69_37n	missense	33	29.79	14	SNP	0.000	A
RPGR	6103	genome.wustl.edu	37	X	38146402	38146402	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chrX:38146402C>A	ENST00000339363.3	-	14	2632	c.2465G>T	c.(2464-2466)gGa>gTa	p.G822V	RPGR_ENST00000318842.7_Missense_Mutation_p.G617V|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Missense_Mutation_p.G555V|RPGR_ENST00000338898.3_3'UTR|RPGR_ENST00000378505.2_Missense_Mutation_p.G617V|RPGR_ENST00000342811.3_Missense_Mutation_p.G617V			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	822	Glu-rich.				cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						ctttcttcctccatgcacctt	0.463																																						dbGAP											0													184.0	119.0	141.0					X																	38146402		2202	4300	6502	-	-	-	SO:0001583	missense	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2465G>T	X.37:g.38146402C>A	ENSP00000343671:p.Gly822Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.G617V	ENST00000339363.3	37	c.1850		X	.	.	.	.	.	.	.	.	.	.	c	2.657	-0.280564	0.05642	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000318842;ENST00000342811;ENST00000378505	T;T;T;T;T	0.66280	2.32;3.72;2.23;-0.2;0.83	3.17	-0.613	0.11594	.	.	.	.	.	T	0.41811	0.1175	L	0.27053	0.805	0.20563	N	0.999889	P;P	0.47762	0.9;0.825	B;B	0.41691	0.359;0.364	T	0.27123	-1.0083	9	0.30078	T	0.28	.	3.811	0.08796	0.0:0.2113:0.392:0.3967	.	617;617	E9PE28;Q92834-2	.;.	V	822;555;617;617;617	ENSP00000343671:G822V;ENSP00000308783:G555V;ENSP00000322219:G617V;ENSP00000339531:G617V;ENSP00000367766:G617V	ENSP00000308783:G555V	G	-	2	0	RPGR	38031346	0.000000	0.05858	0.003000	0.11579	0.103000	0.19146	-0.867000	0.04241	-0.036000	0.13669	0.484000	0.47621	GGA	RPGR	-	NULL	ENSG00000156313		0.463	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		64	0.00	0	C	NM_000328		38146402	38146402	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	0.002	A
SERHL2	253190	genome.wustl.edu	37	22	42972614	42972614	+	IGR	SNP	T	T	C	rs201120470		TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr22:42972614T>C	ENST00000327678.5	+	0	1374				RRP7B_ENST00000357802.2_RNA	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						CACTGATCCATTCTGAGGAAA	0.597																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892		22.37:g.42972614T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ95|Q9UH21	RNA	SNP	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			RRP7B	-	-	ENSG00000182841		0.597	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	HGNC	protein_coding	OTTHUMT00000320454.1	16	0.00	0	T	NM_014509		42972614	42972614	-1	no_errors	ENST00000357802	ensembl	human	known	69_37n	rna	7	50.00	7	SNP	1.000	C
SAMD4A	23034	genome.wustl.edu	37	14	55251070	55251070	+	Intron	SNP	A	A	G			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr14:55251070A>G	ENST00000554335.1	+	12	2707				SAMD4A_ENST00000251091.5_Intron|SAMD4A_ENST00000357634.3_Intron|SAMD4A_ENST00000392067.3_Intron|SAMD4A_ENST00000555192.1_Missense_Mutation_p.H277R			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A						negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						TCCCAAGTTCACAGTGGACTG	0.542																																						dbGAP											0													153.0	130.0	137.0					14																	55251070		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.2045-185A>G	14.37:g.55251070A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	NULL	p.H277R	ENST00000554335.1	37	c.830	CCDS32084.2	14	.	.	.	.	.	.	.	.	.	.	A	3.466	-0.108890	0.06924	.	.	ENSG00000020577	ENST00000555192	.	.	.	3.88	1.44	0.22558	.	.	.	.	.	T	0.15652	0.0377	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29458	-1.0011	8	0.18710	T	0.47	.	5.1454	0.14981	0.7242:0.0:0.2758:0.0	.	277	G3V2R1	.	R	277	.	ENSP00000251091:H315R	H	+	2	0	SAMD4A	54320820	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.108000	0.10857	0.182000	0.20032	0.379000	0.24179	CAC	SAMD4A	-	NULL	ENSG00000020577		0.542	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4A	HGNC	protein_coding	OTTHUMT00000411186.1	49	0.00	0	A	NM_015589		55251070	55251070	+1	no_errors	ENST00000555192	ensembl	human	novel	69_37n	missense	46	32.35	22	SNP	0.000	G
SDHAP1	255812	genome.wustl.edu	37	3	195701310	195701311	+	RNA	INS	-	-	AA	rs369138533		TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr3:195701310_195701311insAA	ENST00000427841.1	-	0	1513_1514					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		CATGCCTGACCAGACAACCAGG	0.574																																					Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195701310_195701311insAA		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	INS	-	NULL	ENST00000427841.1	37	c.NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.574	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	47	0.00	0	-			195701310	195701311	-1	no_coding_region:pseudogene	ENST00000354937	ensembl	human	known	69_37n	splice_site_ins	36	12.20	5	INS	1.000:0.999	AA
TMEM132C	92293	genome.wustl.edu	37	12	129180412	129180412	+	Silent	SNP	C	C	A			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr12:129180412C>A	ENST00000435159.2	+	7	1693	c.1693C>A	c.(1693-1695)Cgg>Agg	p.R565R	TMEM132C_ENST00000537538.1_5'UTR|TMEM132C_ENST00000315208.8_Silent_p.R181R	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	565						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CGAGGAGGAGCGGCGGGGCCG	0.632																																						dbGAP											0													9.0	18.0	15.0					12																	129180412		689	1587	2276	-	-	-	SO:0001819	synonymous_variant	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1693C>A	12.37:g.129180412C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX8	Silent	SNP	NULL	p.R565	ENST00000435159.2	37	c.1693		12																																																																																			TMEM132C	-	NULL	ENSG00000181234		0.632	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		17	0.00	0	C	XM_044062		129180412	129180412	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.828	A
TRBV5-1	28614	genome.wustl.edu	37	7	142021145	142021145	+	RNA	SNP	G	G	T			TCGA-AR-A24X-01A-11D-A167-09	TCGA-AR-A24X-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	53d55f5a-df86-44d7-a3a2-2dccc2557b7b	68357e67-adff-4cd3-a458-c6ed719032d2	g.chr7:142021145G>T	ENST00000390381.3	+	0	434									T cell receptor beta variable 5-1																		ACACTGAGCTGCTCCCCTATC	0.498																																						dbGAP											0													58.0	57.0	57.0					7																	142021145		1964	4163	6127	-	-	-			0			L36092		7q34	2012-02-07			ENSG00000211734	ENSG00000211734		"""T cell receptors / TRB locus"""	12218	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV51, TCRBV5S1, TCRBV5S1A1T			OTTHUMG00000158520		7.37:g.142021145G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.C42F	ENST00000390381.3	37	c.125		7																																																																																			TRBV5-1	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211734		0.498	TRBV5-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV5-1	HGNC	TR_V_gene	OTTHUMT00000351226.1	49	0.00	0	G	NG_001333		142021145	142021145	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390381	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.003	T
