#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2ML1	144568	genome.wustl.edu	37	12	8988187	8988187	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr12:8988187G>A	ENST00000299698.7	+	6	748	c.568G>A	c.(568-570)Gag>Aag	p.E190K		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						ACTGGCACCAGAGGCAATGCT	0.517																																						dbGAP											0													114.0	118.0	117.0					12																	8988187		2074	4195	6269	-	-	-	SO:0001583	missense	0			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.568G>A	12.37:g.8988187G>A	ENSP00000299698:p.Glu190Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.E190K	ENST00000299698.7	37	c.568	CCDS8596.2	12	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020811	0.75275	.	.	ENSG00000166535	ENST00000299698;ENST00000539161	T	0.74421	-0.84	3.75	3.75	0.43078	Alpha-2-macroglobulin, N-terminal (1);	0.000000	0.40908	D	0.000983	D	0.84822	0.5557	M	0.82716	2.605	0.80722	D	1	D	0.59767	0.986	D	0.68192	0.956	D	0.86596	0.1863	10	0.87932	D	0	.	11.3645	0.49664	0.0:0.0:1.0:0.0	.	190	A8K2U0	A2ML1_HUMAN	K	190	ENSP00000299698:E190K	ENSP00000299698:E190K	E	+	1	0	A2ML1	8879454	1.000000	0.71417	0.994000	0.49952	0.888000	0.51559	5.270000	0.65547	2.382000	0.81193	0.462000	0.41574	GAG	A2ML1	-	pfam_A2M_N	ENSG00000166535		0.517	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	HGNC	protein_coding	OTTHUMT00000250304.3	53	0.00	0	G	NM_144670		8988187	8988187	+1	no_errors	ENST00000299698	ensembl	human	known	69_37n	missense	28	30.00	12	SNP	0.996	A
ABCA3	21	genome.wustl.edu	37	16	2354098	2354098	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:2354098A>G	ENST00000301732.5	-	12	2039	c.1339T>C	c.(1339-1341)Ttc>Ctc	p.F447L	ABCA3_ENST00000382381.3_Missense_Mutation_p.F389L	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	447					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CCGAAGCAGAAGTCGTCGTCC	0.627																																						dbGAP											0													179.0	158.0	165.0					16																	2354098		2198	4300	6498	-	-	-	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1339T>C	16.37:g.2354098A>G	ENSP00000301732:p.Phe447Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F447L	ENST00000301732.5	37	c.1339	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	A	15.15	2.749194	0.49257	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.88896	-2.44	5.64	5.64	0.86602	.	0.096342	0.64402	N	0.000001	D	0.84165	0.5412	L	0.27975	0.815	0.80722	D	1	B;B;B	0.26708	0.106;0.041;0.157	B;B;B	0.38803	0.173;0.042;0.282	T	0.78196	-0.2298	10	0.10377	T	0.69	.	13.8576	0.63537	1.0:0.0:0.0:0.0	.	447;451;447	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	L	447;451	ENSP00000301732:F447L	ENSP00000301732:F447L	F	-	1	0	ABCA3	2294099	1.000000	0.71417	0.824000	0.32777	0.966000	0.64601	5.946000	0.70234	2.367000	0.80283	0.528000	0.53228	TTC	ABCA3	-	NULL	ENSG00000167972		0.627	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	30	0.00	0	A	NM_001089		2354098	2354098	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	missense	4	80.95	17	SNP	1.000	G
ABCC1	4363	genome.wustl.edu	37	16	16150074	16150074	+	Silent	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:16150074G>A	ENST00000399410.3	+	12	1774	c.1599G>A	c.(1597-1599)caG>caA	p.Q533Q	ABCC1_ENST00000349029.5_Silent_p.Q533Q|ABCC1_ENST00000351154.5_Silent_p.Q533Q|ABCC1_ENST00000345148.5_Silent_p.Q533Q|ABCC1_ENST00000399408.2_Silent_p.Q533Q|ABCC1_ENST00000346370.5_Silent_p.Q533Q	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	533	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CCATCAGGCAGGAGGAGCTGA	0.527																																						dbGAP											0													83.0	87.0	85.0					16																	16150074		2074	4212	6286	-	-	-	SO:0001819	synonymous_variant	0			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1599G>A	16.37:g.16150074G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.G432R	ENST00000399410.3	37	c.1294	CCDS42122.1	16																																																																																			ABCC1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000103222		0.527	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	HGNC	protein_coding	OTTHUMT00000109701.1	44	0.00	0	G	NM_004996		16150074	16150074	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000572882	ensembl	human	novel	69_37n	missense	31	22.50	9	SNP	1.000	A
ACOX2	8309	genome.wustl.edu	37	3	58508254	58508254	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:58508254T>C	ENST00000302819.5	-	12	1892	c.1601A>G	c.(1600-1602)cAg>cGg	p.Q534R	ACOX2_ENST00000459701.2_Missense_Mutation_p.Q520R|ACOX2_ENST00000481527.1_5'UTR	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	534					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		GACAGTGGTCTGGTTCCAAGC	0.537																																						dbGAP											0													131.0	112.0	118.0					3																	58508254		2203	4300	6503	-	-	-	SO:0001583	missense	0			X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.1601A>G	3.37:g.58508254T>C	ENSP00000307697:p.Gln534Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF16|B2R8U5	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	p.Q534R	ENST00000302819.5	37	c.1601	CCDS33775.1	3	.	.	.	.	.	.	.	.	.	.	T	8.455	0.854021	0.17106	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	T;T	0.43688	0.94;0.94	4.81	-0.46	0.12175	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.485807	0.19936	N	0.102746	T	0.26955	0.0660	L	0.35593	1.075	0.29406	N	0.861579	B	0.06786	0.001	B	0.12837	0.008	T	0.25813	-1.0121	10	0.17369	T	0.5	-3.6034	10.5074	0.44842	0.0:0.4341:0.0:0.5659	.	534	Q99424	ACOX2_HUMAN	R	520;534	ENSP00000418562:Q520R;ENSP00000307697:Q534R	ENSP00000307697:Q534R	Q	-	2	0	ACOX2	58483294	0.991000	0.36638	0.976000	0.42696	0.998000	0.95712	0.229000	0.17833	-0.142000	0.11354	0.533000	0.62120	CAG	ACOX2	-	pfam_Acyl-CoA_oxidase_C,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	ENSG00000168306		0.537	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOX2	HGNC	protein_coding	OTTHUMT00000353541.1	57	0.00	0	T			58508254	58508254	-1	no_errors	ENST00000302819	ensembl	human	known	69_37n	missense	21	43.24	16	SNP	0.922	C
ADAMTS19	171019	genome.wustl.edu	37	5	128977608	128977608	+	Silent	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:128977608C>T	ENST00000274487.4	+	11	1954	c.1809C>T	c.(1807-1809)acC>acT	p.T603T	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	603	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AATGCAGAACCAAGCTAGACC	0.393																																						dbGAP											0													235.0	192.0	207.0					5																	128977608		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1809C>T	5.37:g.128977608C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T603	ENST00000274487.4	37	c.1809	CCDS4146.1	5																																																																																			ADAMTS19	-	smart_ADAM_Cys-rich	ENSG00000145808		0.393	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	83	0.00	0	C	NM_133638		128977608	128977608	+1	no_errors	ENST00000274487	ensembl	human	known	69_37n	silent	19	50.00	19	SNP	1.000	T
ADCY10	55811	genome.wustl.edu	37	1	167815281	167815281	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:167815281A>C	ENST00000367851.4	-	20	2842	c.2658T>G	c.(2656-2658)aaT>aaG	p.N886K	ADCY10_ENST00000367848.1_Missense_Mutation_p.N794K|ADCY10_ENST00000545172.1_Missense_Mutation_p.N733K	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	886					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						ATGAGGGATCATTCTGTTTCA	0.463																																						dbGAP											0													96.0	95.0	96.0					1																	167815281		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.2658T>G	1.37:g.167815281A>C	ENSP00000356825:p.Asn886Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.N886K	ENST00000367851.4	37	c.2658	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	A	1.781	-0.481923	0.04383	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.28454	1.61;1.61;1.61	5.96	-6.58	0.01836	.	0.521305	0.19006	N	0.125218	T	0.04003	0.0112	L	0.41027	1.25	0.29423	N	0.860394	B;B;B	0.14438	0.01;0.01;0.003	B;B;B	0.12156	0.007;0.007;0.003	T	0.40534	-0.9558	9	0.05833	T	0.94	-24.8797	3.9437	0.09339	0.4648:0.1034:0.336:0.0958	.	733;794;886	F5GWS5;Q96PN6-2;Q96PN6	.;.;ADCYA_HUMAN	K	733;886;794	ENSP00000441992:N733K;ENSP00000356825:N886K;ENSP00000356822:N794K	ENSP00000356822:N794K	N	-	3	2	ADCY10	166081905	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.469000	0.00460	-0.932000	0.03742	-0.132000	0.14878	AAT	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.463	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	36	0.00	0	A	NM_018417		167815281	167815281	-1	no_errors	ENST00000367851	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	0.000	C
AGXT	189	genome.wustl.edu	37	2	241810813	241810813	+	Silent	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:241810813G>A	ENST00000307503.3	+	4	858	c.471G>A	c.(469-471)gaG>gaA	p.E157E		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	157					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	CCCACGGGGAGTCGTCCACCG	0.672																																						dbGAP											0													30.0	28.0	29.0					2																	241810813		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0			D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.471G>A	2.37:g.241810813G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QU6	Silent	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.E157	ENST00000307503.3	37	c.471	CCDS2543.1	2																																																																																			AGXT	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000172482		0.672	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT	HGNC	protein_coding	OTTHUMT00000257186.1	17	0.00	0	G	NM_000030		241810813	241810813	+1	no_errors	ENST00000307503	ensembl	human	known	69_37n	silent	5	44.44	4	SNP	1.000	A
AHNAK	79026	genome.wustl.edu	37	11	62287791	62287791	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:62287791G>C	ENST00000378024.4	-	5	14372	c.14098C>G	c.(14098-14100)Cca>Gca	p.P4700A	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4700					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTCGCATCTGGACCTTCGATA	0.498																																						dbGAP											0													204.0	209.0	207.0					11																	62287791		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.14098C>G	11.37:g.62287791G>C	ENSP00000367263:p.Pro4700Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P4700A	ENST00000378024.4	37	c.14098	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838615	0.32513	.	.	ENSG00000124942	ENST00000378024	T	0.02085	4.46	5.16	5.16	0.70880	.	0.063739	0.64402	D	0.000004	T	0.13927	0.0337	M	0.88640	2.97	0.44447	D	0.997375	D	0.76494	0.999	D	0.85130	0.997	T	0.00400	-1.1763	10	0.39692	T	0.17	-4.547	11.7399	0.51786	0.0818:0.0:0.9182:0.0	.	4700	Q09666	AHNK_HUMAN	A	4700	ENSP00000367263:P4700A	ENSP00000367263:P4700A	P	-	1	0	AHNAK	62044367	1.000000	0.71417	0.408000	0.26446	0.003000	0.03518	3.403000	0.52615	2.397000	0.81536	0.549000	0.68633	CCA	AHNAK	-	NULL	ENSG00000124942		0.498	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	70	0.00	0	G	NM_024060		62287791	62287791	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	85	18.27	19	SNP	0.995	C
ALDH1L1	10840	genome.wustl.edu	37	3	125854388	125854388	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:125854388G>C	ENST00000393434.2	-	12	1811	c.1462C>G	c.(1462-1464)Ctg>Gtg	p.L488V	ALDH1L1_ENST00000452905.2_Missense_Mutation_p.L387V|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.L488V|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.L498V|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.L488V	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	488	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CTGTACATCAGCCGGCCCCGG	0.637																																						dbGAP											0													99.0	76.0	84.0					3																	125854388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1462C>G	3.37:g.125854388G>C	ENSP00000377083:p.Leu488Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.L488V	ENST00000393434.2	37	c.1462	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	G	9.715	1.158056	0.21454	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	3.74	3.74	0.42951	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.349225	0.25729	N	0.028690	T	0.71787	0.3381	L	0.37466	1.105	0.80722	D	1	B;P;P	0.35050	0.223;0.482;0.482	B;B;B	0.42827	0.127;0.399;0.196	T	0.73591	-0.3934	10	0.62326	D	0.03	.	8.7867	0.34825	0.0:0.0:0.7748:0.2252	.	387;540;488	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	V	498;488;387;488;488	ENSP00000273450:L498V;ENSP00000420293:L488V;ENSP00000395881:L387V;ENSP00000377083:L488V;ENSP00000377081:L488V	ENSP00000273450:L498V	L	-	1	2	ALDH1L1	127337078	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	4.279000	0.58953	2.110000	0.64415	0.460000	0.39030	CTG	ALDH1L1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH	ENSG00000144908		0.637	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	31	0.00	0	G	NM_012190		125854388	125854388	-1	no_errors	ENST00000393434	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	1.000	C
ANKRD30BL	554226	genome.wustl.edu	37	2	133015302	133015302	+	5'UTR	SNP	T	T	G	rs75692539		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:133015302T>G	ENST00000470729.1	-	0	240				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCAGAGGCGCTCAGGGACGCC	0.677																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1185A>C	2.37:g.133015302T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.677	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	25	0.00	0	T	NR_027019		133015302	133015302	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	11	42.11	8	SNP	0.013	G
AP3D1	8943	genome.wustl.edu	37	19	2127191	2127191	+	Silent	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr19:2127191G>C	ENST00000345016.5	-	9	1047	c.816C>G	c.(814-816)gcC>gcG	p.A272A	AP3D1_ENST00000356926.4_Silent_p.A181A|AP3D1_ENST00000590683.1_Intron|AP3D1_ENST00000355272.6_Silent_p.A272A|AP3D1_ENST00000350812.6_Intron	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	272					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGAGACATGGCAGACGTGC	0.597																																						dbGAP											0													84.0	94.0	91.0					19																	2127191		2103	4224	6327	-	-	-	SO:0001819	synonymous_variant	0			U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.816C>G	19.37:g.2127191G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.A272	ENST00000345016.5	37	c.816	CCDS42459.1	19																																																																																			AP3D1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	ENSG00000065000		0.597	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	HGNC	protein_coding	OTTHUMT00000450912.1	30	0.00	0	G			2127191	2127191	-1	no_errors	ENST00000355272	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	1.000	C
APP	351	genome.wustl.edu	37	21	27284272	27284272	+	Missense_Mutation	SNP	C	C	G	rs200521782		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr21:27284272C>G	ENST00000346798.3	-	14	1723	c.1690G>C	c.(1690-1692)Gag>Cag	p.E564Q	APP_ENST00000358918.3_Missense_Mutation_p.E564Q|APP_ENST00000448388.2_Missense_Mutation_p.E454Q|APP_ENST00000354192.3_Missense_Mutation_p.E433Q|APP_ENST00000359726.3_Missense_Mutation_p.E508Q|APP_ENST00000357903.3_Missense_Mutation_p.E545Q|APP_ENST00000440126.3_Missense_Mutation_p.E540Q|APP_ENST00000439274.2_Missense_Mutation_p.E508Q|APP_ENST00000348990.5_Missense_Mutation_p.E489Q	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	564					adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				TGAAGCAGCTCATCTAAACCA	0.438																																						dbGAP											0													124.0	85.0	98.0					21																	27284272		2203	4300	6503	-	-	-	SO:0001583	missense	0			M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1690G>C	21.37:g.27284272C>G	ENSP00000284981:p.Glu564Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Amyloid_glyco_Abeta,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Amyloid_glyco_Abeta,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.E564Q	ENST00000346798.3	37	c.1690	CCDS13576.1	21	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255915	0.80135	.	.	ENSG00000142192	ENST00000346798;ENST00000354192;ENST00000348990;ENST00000357903;ENST00000358918;ENST00000359726;ENST00000448388;ENST00000440126;ENST00000439274;ENST00000456209	T;T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	4.76	4.76	0.60689	Amyloidogenic glycoprotein, E2 domain (1);	0.049078	0.85682	D	0.000000	T	0.63522	0.2518	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D;D;D	0.63046	0.965;0.992;0.969;0.979;0.982;0.982;0.992	B;P;P;P;P;P;P	0.61477	0.376;0.6;0.777;0.58;0.889;0.889;0.665	T	0.67019	-0.5776	10	0.87932	D	0	-28.7694	17.9136	0.88942	0.0:1.0:0.0:0.0	.	454;508;540;433;489;545;564	E9PEV0;E9PG40;B4DII8;P05067-10;P05067-4;P05067-8;P05067	.;.;.;.;.;.;A4_HUMAN	Q	564;433;489;545;564;508;454;540;508;151	ENSP00000284981:E564Q;ENSP00000346129:E433Q;ENSP00000345463:E489Q;ENSP00000350578:E545Q;ENSP00000351796:E564Q;ENSP00000352760:E508Q;ENSP00000388538:E454Q;ENSP00000387483:E540Q;ENSP00000398879:E508Q;ENSP00000397795:E151Q	ENSP00000284981:E564Q	E	-	1	0	APP	26206143	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.187000	0.65087	2.640000	0.89533	0.561000	0.74099	GAG	APP	-	superfamily_Amyloid_glyco_E2_domain	ENSG00000142192		0.438	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APP	HGNC	protein_coding	OTTHUMT00000171340.1	41	0.00	0	C	NM_000484		27284272	27284272	-1	no_errors	ENST00000346798	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	1.000	G
ARAP3	64411	genome.wustl.edu	37	5	141051164	141051164	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:141051164C>A	ENST00000239440.4	-	12	1892	c.1827G>T	c.(1825-1827)caG>caT	p.Q609H	ARAP3_ENST00000508305.1_Missense_Mutation_p.Q531H|ARAP3_ENST00000513878.1_Missense_Mutation_p.Q271H	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	609	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GATCTGGGTACTGAGGGTGGG	0.607																																						dbGAP											0													35.0	36.0	36.0					5																	141051164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1827G>T	5.37:g.141051164C>A	ENSP00000239440:p.Gln609His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIT1|D3DQE3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.Q609H	ENST00000239440.4	37	c.1827	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942760	0.34283	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.14391	2.51;2.71;2.71	3.44	3.44	0.39384	.	0.628580	0.14999	U	0.286254	T	0.10165	0.0249	L	0.32530	0.975	0.23277	N	0.997998	B;B;B	0.18310	0.001;0.027;0.001	B;B;B	0.15052	0.002;0.012;0.001	T	0.21930	-1.0231	10	0.23891	T	0.37	.	9.2209	0.37375	0.0:0.6959:0.3041:0.0	.	271;531;609	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	H	531;609;271	ENSP00000421826:Q531H;ENSP00000239440:Q609H;ENSP00000421468:Q271H	ENSP00000239440:Q609H	Q	-	3	2	ARAP3	141031348	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.825000	0.48096	1.754000	0.51921	0.563000	0.77884	CAG	ARAP3	-	smart_ArfGAP,pfscan_ArfGAP	ENSG00000120318		0.607	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	19	0.00	0	C	NM_022481		141051164	141051164	-1	no_errors	ENST00000239440	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	1.000	A
ARHGAP42	143872	genome.wustl.edu	37	11	100814496	100814496	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:100814496C>T	ENST00000298815.8	+	10	943	c.940C>T	c.(940-942)Ctt>Ttt	p.L314F	ARHGAP42_ENST00000524892.2_Missense_Mutation_p.L280F	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	314	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						TCAGAATGGCCTTGTTACTAG	0.333																																						dbGAP											0													129.0	103.0	111.0					11																	100814496		692	1591	2283	-	-	-	SO:0001583	missense	0					11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.940C>T	11.37:g.100814496C>T	ENSP00000298815:p.Leu314Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96M56	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L314F	ENST00000298815.8	37	c.940		11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957454	0.73902	.	.	ENSG00000165895	ENST00000524892;ENST00000298815;ENST00000531183	T;T;T	0.47869	3.09;3.17;0.83	5.33	5.33	0.75918	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.33792	U	0.004545	T	0.53367	0.1792	L	0.47716	1.5	0.58432	D	0.99999	P	0.52316	0.952	P	0.49752	0.621	T	0.54463	-0.8290	10	0.51188	T	0.08	.	18.6336	0.91369	0.0:1.0:0.0:0.0	.	314	A6NI28	RHG42_HUMAN	F	280;314;170	ENSP00000431776:L280F;ENSP00000298815:L314F;ENSP00000434304:L170F	ENSP00000298815:L314F	L	+	1	0	ARHGAP42	100319706	0.999000	0.42202	1.000000	0.80357	0.968000	0.65278	2.888000	0.48594	2.470000	0.83445	0.563000	0.77884	CTT	ARHGAP42	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000165895		0.333	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP42	HGNC	protein_coding		90	0.00	0	C	NM_152432		100814496	100814496	+1	no_errors	ENST00000298815	ensembl	human	known	69_37n	missense	56	28.21	22	SNP	1.000	T
ARL13B	200894	genome.wustl.edu	37	3	93755594	93755594	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:93755594G>C	ENST00000394222.3	+	5	960	c.685G>C	c.(685-687)Gaa>Caa	p.E229Q	ARL13B_ENST00000486562.1_3'UTR|ARL13B_ENST00000471138.1_Missense_Mutation_p.E229Q|ARL13B_ENST00000539730.1_5'UTR|ARL13B_ENST00000303097.7_Missense_Mutation_p.E122Q|ARL13B_ENST00000535334.1_Missense_Mutation_p.E126Q	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	229					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						ATTACGAGAAGAAAGGTAAGT	0.358																																						dbGAP											0													47.0	45.0	46.0					3																	93755594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.685G>C	3.37:g.93755594G>C	ENSP00000377769:p.Glu229Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN29|G3V1S8|Q504W8|Q8TCL5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.E229Q	ENST00000394222.3	37	c.685	CCDS2925.1	3	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203957	0.58234	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138	T;T;T;T	0.69685	1.41;-0.42;-0.06;-0.06	5.67	5.67	0.87782	.	0.161882	0.53938	D	0.000052	T	0.72011	0.3408	M	0.72894	2.215	0.80722	D	1	P;P;P;P	0.52463	0.953;0.83;0.951;0.485	B;B;P;B	0.46796	0.409;0.22;0.527;0.169	T	0.75977	-0.3127	10	0.62326	D	0.03	-0.0172	16.7402	0.85457	0.0:0.1289:0.8711:0.0	.	126;229;122;229	G3V1S8;B4DLH1;Q3SXY8-2;Q3SXY8	.;.;.;AR13B_HUMAN	Q	126;122;229;229	ENSP00000445145:E126Q;ENSP00000306225:E122Q;ENSP00000377769:E229Q;ENSP00000420780:E229Q	ENSP00000306225:E122Q	E	+	1	0	ARL13B	95238284	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.535000	0.60629	2.672000	0.90937	0.585000	0.79938	GAA	ARL13B	-	NULL	ENSG00000169379		0.358	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ARL13B	HGNC	protein_coding	OTTHUMT00000352904.1	27	0.00	0	G	NM_182896		93755594	93755594	+1	no_errors	ENST00000394222	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	C
ATG2A	23130	genome.wustl.edu	37	11	64674273	64674273	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:64674273C>A	ENST00000377264.3	-	20	2959	c.2847G>T	c.(2845-2847)aaG>aaT	p.K949N	ATG2A_ENST00000421419.2_Missense_Mutation_p.K949N	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	949					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CCTCCAGCCGCTTCCCACCCT	0.642																																						dbGAP											0													54.0	47.0	50.0					11																	64674273		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.2847G>T	11.37:g.64674273C>A	ENSP00000366475:p.Lys949Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.K949N	ENST00000377264.3	37	c.2847	CCDS31602.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.703|3.703	-0.061164|-0.061164	0.07317|0.07317	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000418259|ENST00000421419;ENST00000377264	.|T;T	.|0.49720	.|0.77;0.77	5.39|5.39	2.52|2.52	0.30459|0.30459	.|.	.|1.273060	.|0.05307	.|N	.|0.524062	T|T	0.34483|0.34483	0.0899|0.0899	N|N	0.26042|0.26042	0.785|0.785	0.33636|0.33636	D|D	0.606619|0.606619	.|B	.|0.23058	.|0.079	.|B	.|0.16289	.|0.015	T|T	0.29058|0.29058	-1.0024|-1.0024	5|10	.|0.15066	.|T	.|0.55	.|.	9.2446|9.2446	0.37518|0.37518	0.0:0.7609:0.0:0.2391|0.0:0.7609:0.0:0.2391	.|.	.|949	.|Q2TAZ0	.|ATG2A_HUMAN	S|N	751|949	.|ENSP00000410522:K949N;ENSP00000366475:K949N	.|ENSP00000366475:K949N	A|K	-|-	1|3	0|2	ATG2A|ATG2A	64430849|64430849	0.851000|0.851000	0.29673|0.29673	0.457000|0.457000	0.27056|0.27056	0.059000|0.059000	0.15707|0.15707	2.773000|2.773000	0.47686|0.47686	0.358000|0.358000	0.24211|0.24211	0.655000|0.655000	0.94253|0.94253	GCG|AAG	ATG2A	-	NULL	ENSG00000110046		0.642	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	26	0.00	0	C	NM_015104		64674273	64674273	-1	no_errors	ENST00000421419	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	0.915	A
BCKDK	10295	genome.wustl.edu	37	16	31120644	31120644	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:31120644G>T	ENST00000394951.1	+	3	723	c.100G>T	c.(100-102)Gcc>Tcc	p.A34S	BCKDK_ENST00000394950.3_Missense_Mutation_p.A34S|AC135050.1_ENST00000517000.2_RNA|BCKDK_ENST00000219794.6_Missense_Mutation_p.A34S|BCKDK_ENST00000287507.3_Missense_Mutation_p.A34S			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	34					branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						CTCGACGTCGGCCACCGACAC	0.706																																						dbGAP											0													16.0	18.0	17.0					16																	31120644		2193	4292	6485	-	-	-	SO:0001583	missense	0			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.100G>T	16.37:g.31120644G>T	ENSP00000378405:p.Ala34Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY43|Q6FGL4|Q96G95|Q96IN5	Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core,prints_Sig_transdc_His_kin-like_C	p.A34S	ENST00000394951.1	37	c.100	CCDS10705.1	16	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334906	0.24253	.	.	ENSG00000103507	ENST00000394951;ENST00000219794;ENST00000394950;ENST00000287507	T;T;T;T	0.55760	0.52;0.52;0.51;0.5	5.61	3.67	0.42095	.	0.103040	0.64402	D	0.000003	T	0.33702	0.0872	N	0.20530	0.585	0.39627	D	0.970117	B;B	0.14438	0.01;0.01	B;B	0.13407	0.009;0.003	T	0.09975	-1.0650	10	0.12103	T	0.63	-19.8968	11.4397	0.50090	0.1492:0.0:0.8508:0.0	.	34;34	Q96G95;O14874	.;BCKD_HUMAN	S	34	ENSP00000378405:A34S;ENSP00000219794:A34S;ENSP00000378404:A34S;ENSP00000287507:A34S	ENSP00000219794:A34S	A	+	1	0	BCKDK	31028145	.	.	0.807000	0.32361	0.021000	0.10359	.	.	0.734000	0.32515	-0.137000	0.14449	GCC	BCKDK	-	NULL	ENSG00000103507		0.706	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCKDK	HGNC	protein_coding	OTTHUMT00000108514.1	12	0.00	0	G	NM_005881		31120644	31120644	+1	no_errors	ENST00000219794	ensembl	human	known	69_37n	missense	6	57.14	8	SNP	0.998	T
BLM	641	genome.wustl.edu	37	15	91306223	91306224	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G|A	G|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr15:91306223_91306224GA>TG	ENST00000355112.3	+	8	2028_2029	c.1910_1911GA>TG	c.(1909-1911)aGA>aTG	p.R637M	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Missense_Mutation_p.R637M	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	637					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TTAGCATCCAGAAATCTGAAAC	0.322			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													dbGAP	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0																																										-	-	-	SO:0001583	missense	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	Exception_encountered	15.37:g.91306223_91306224delinsTG	ENSP00000347232:p.Arg637Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M96	Missense_Mutation|Silent	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/RNaseD_C,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.R637I|p.R637	ENST00000355112.3	37	c.1910|c.1911	CCDS10363.1	15																																																																																			BLM	-	NULL	ENSG00000197299		0.322	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	55|56	0.00	0	G|A			91306223|91306224	91306223|91306224	+1	no_errors	ENST00000355112	ensembl	human	known	69_37n	missense|silent	51|49	32.89|33.78	25	SNP	0.998|1.000	T|G
BLVRB	645	genome.wustl.edu	37	19	40957355	40957355	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr19:40957355C>A	ENST00000263368.4	-	4	530	c.379G>T	c.(379-381)Gct>Tct	p.A127S	BLVRB_ENST00000595483.1_Intron	NM_000713.2	NP_000704.1	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase (NADPH))	127					heme catabolic process (GO:0042167)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	biliverdin reductase activity (GO:0004074)|riboflavin reductase (NADPH) activity (GO:0042602)			large_intestine(3)|lung(3)	6			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		Riboflavin(DB00140)	TCAGTCACAGCCTGCAGTCGT	0.562																																						dbGAP											0													81.0	55.0	64.0					19																	40957355		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26308	CCDS33029.1	19q13.1-q13.2	2011-09-14				ENSG00000090013	1.3.1.24, 1.5.1.30	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	1063	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 43U, member 1"""	600941	"""Flavin reductase"""	FLR		7656592, 19027726	Standard	NM_000713		Approved	SDR43U1	uc002onw.2	P30043		ENST00000263368.4:c.379G>T	19.37:g.40957355C>A	ENSP00000263368:p.Ala127Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKD8|B2R5C6|P32078|P53005|Q32LZ2	Missense_Mutation	SNP	pfam_NmrA,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase	p.A127S	ENST00000263368.4	37	c.379	CCDS33029.1	19	.	.	.	.	.	.	.	.	.	.	C	9.842	1.191327	0.21954	.	.	ENSG00000090013	ENST00000263368	T	0.29655	1.56	5.37	5.37	0.77165	NAD(P)-binding domain (1);NmrA-like (1);	0.464262	0.23260	N	0.050149	T	0.24084	0.0583	L	0.41236	1.265	0.30350	N	0.784895	B	0.02656	0.0	B	0.17433	0.018	T	0.13282	-1.0515	10	0.09084	T	0.74	-6.8078	13.1598	0.59538	0.0:0.7305:0.2695:0.0	.	127	P30043	BLVRB_HUMAN	S	127	ENSP00000263368:A127S	ENSP00000263368:A127S	A	-	1	0	BLVRB	45649195	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	3.574000	0.53863	2.682000	0.91365	0.467000	0.42956	GCT	BLVRB	-	pfam_NmrA	ENSG00000090013		0.562	BLVRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLVRB	HGNC	protein_coding	OTTHUMT00000462563.1	30	0.00	0	C			40957355	40957355	-1	no_errors	ENST00000263368	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.995	A
BTBD11	121551	genome.wustl.edu	37	12	108006618	108006618	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr12:108006618T>G	ENST00000280758.5	+	6	2399	c.1871T>G	c.(1870-1872)cTg>cGg	p.L624R	BTBD11_ENST00000420571.2_Missense_Mutation_p.L624R|BTBD11_ENST00000357167.4_Missense_Mutation_p.L161R|BTBD11_ENST00000490090.2_Missense_Mutation_p.L624R|RP11-128P10.1_ENST00000548473.1_RNA	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	624						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CAGATGCTGCTGGATGCCGGA	0.607																																						dbGAP											0													77.0	60.0	66.0					12																	108006618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1871T>G	12.37:g.108006618T>G	ENSP00000280758:p.Leu624Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.L624R	ENST00000280758.5	37	c.1871	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	T	27.9	4.876589	0.91664	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000357167	T;T;T;T	0.72505	-0.66;-0.65;-0.66;-0.66	5.31	5.31	0.75309	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.86818	0.6024	M	0.90650	3.135	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.997;0.99;0.999;0.988	D	0.89711	0.3912	10	0.87932	D	0	.	15.558	0.76216	0.0:0.0:0.0:1.0	.	624;161;624;624	A6QL63-2;E9PHS4;A6QL63;A6QL63-3	.;.;BTBDB_HUMAN;.	R	624;624;624;161	ENSP00000280758:L624R;ENSP00000413889:L624R;ENSP00000447319:L624R;ENSP00000349690:L161R	ENSP00000280758:L624R	L	+	2	0	BTBD11	106530748	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.997000	0.88414	2.147000	0.66899	0.528000	0.53228	CTG	BTBD11	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151136		0.607	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	42	0.00	0	T	NM_152322		108006618	108006618	+1	no_errors	ENST00000280758	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	1.000	G
C10orf12	26148	genome.wustl.edu	37	10	98741410	98741410	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr10:98741410C>G	ENST00000286067.2	+	1	370	c.263C>G	c.(262-264)tCt>tGt	p.S88C		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	88										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CATCTTCACTCTCTGGGAAGA	0.458																																						dbGAP											0													85.0	85.0	85.0					10																	98741410		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.263C>G	10.37:g.98741410C>G	ENSP00000286067:p.Ser88Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.S88C	ENST00000286067.2	37	c.263	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525371	0.27299	.	.	ENSG00000155640	ENST00000286067	T	0.08634	3.07	5.95	4.86	0.63082	.	0.337998	0.21041	N	0.081178	T	0.14227	0.0344	L	0.27053	0.805	0.28584	N	0.909968	D	0.63880	0.993	P	0.56514	0.8	T	0.01238	-1.1409	10	0.59425	D	0.04	-2.4225	15.7352	0.77837	0.0:0.9231:0.0:0.0769	.	88	Q8N655	CJ012_HUMAN	C	88	ENSP00000286067:S88C	ENSP00000286067:S88C	S	+	2	0	C10orf12	98731400	0.004000	0.15560	1.000000	0.80357	0.090000	0.18270	1.414000	0.34736	2.822000	0.97130	0.655000	0.94253	TCT	C10orf12	-	NULL	ENSG00000155640		0.458	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	51	0.00	0	C	NM_015652		98741410	98741410	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	10	72.97	27	SNP	0.834	G
RTFDC1	51507	genome.wustl.edu	37	20	55093254	55093254	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr20:55093254A>G	ENST00000023939.4	+	9	961	c.854A>G	c.(853-855)cAc>cGc	p.H285R	GCNT7_ENST00000243913.4_Intron|RTFDC1_ENST00000357348.5_Missense_Mutation_p.H315R|RTFDC1_ENST00000395881.3_3'UTR|FAM209A_ENST00000481560.1_3'UTR	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1	285																	TTTACCACTCACAGCTCCGCC	0.597																																						dbGAP											0													77.0	81.0	80.0					20																	55093254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.854A>G	20.37:g.55093254A>G	ENSP00000023939:p.His285Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Missense_Mutation	SNP	NULL	p.H315R	ENST00000023939.4	37	c.944	CCDS13453.1	20	.	.	.	.	.	.	.	.	.	.	A	21.4	4.143750	0.77888	.	.	ENSG00000022277	ENST00000023939;ENST00000357348	T;T	0.30448	1.53;1.53	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.42517	0.1206	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.32640	-0.9899	10	0.44086	T	0.13	-15.1531	15.8102	0.78557	1.0:0.0:0.0:0.0	.	315;285;285	A8MSH5;B2RB99;Q9BY42	.;.;CT043_HUMAN	R	285;315	ENSP00000023939:H285R;ENSP00000349906:H315R	ENSP00000023939:H285R	H	+	2	0	C20orf43	54526661	1.000000	0.71417	0.996000	0.52242	0.495000	0.33615	8.103000	0.89550	2.213000	0.71641	0.533000	0.62120	CAC	C20orf43	-	NULL	ENSG00000022277		0.597	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf43	HGNC	protein_coding	OTTHUMT00000079817.2	24	0.00	0	A	NM_016407		55093254	55093254	+1	no_errors	ENST00000357348	ensembl	human	known	69_37n	missense	11	57.69	15	SNP	1.000	G
C5AR1	728	genome.wustl.edu	37	19	47823226	47823226	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr19:47823226C>G	ENST00000355085.3	+	2	214	c.192C>G	c.(190-192)ttC>ttG	p.F64L		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	64					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		TGACGGCATTCGAGGCCAAGC	0.587																																						dbGAP											0													186.0	150.0	162.0					19																	47823226		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.192C>G	19.37:g.47823226C>G	ENSP00000347197:p.Phe64Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_C5A_anaphtx_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_Brdyknn_rcpt,prints_Frt_met_rcpt	p.F64L	ENST00000355085.3	37	c.192	CCDS33063.1	19	.	.	.	.	.	.	.	.	.	.	C	1.530	-0.544530	0.04024	.	.	ENSG00000197405	ENST00000355085	T	0.36340	1.26	4.67	-6.35	0.01975	GPCR, rhodopsin-like superfamily (1);	0.607756	0.16386	U	0.216668	T	0.19967	0.0480	L	0.41079	1.255	0.09310	N	1	B	0.09022	0.002	B	0.19391	0.025	T	0.21042	-1.0257	10	0.21014	T	0.42	.	5.9908	0.19460	0.0:0.2921:0.3461:0.3618	.	64	P21730	C5AR_HUMAN	L	64	ENSP00000347197:F64L	ENSP00000347197:F64L	F	+	3	2	C5AR1	52515066	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.296000	0.08287	-0.916000	0.03818	-0.701000	0.03672	TTC	C5AR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_C5A_anaphtx_rcpt,prints_Frt_met_rcpt	ENSG00000197405		0.587	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C5AR1	HGNC	protein_coding	OTTHUMT00000466925.1	69	0.00	0	C	NM_001736		47823226	47823226	+1	no_errors	ENST00000355085	ensembl	human	known	69_37n	missense	21	48.78	20	SNP	0.001	G
CARD9	64170	genome.wustl.edu	37	9	139264848	139264848	+	Silent	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr9:139264848C>A	ENST00000371732.5	-	6	1014	c.849G>T	c.(847-849)ctG>ctT	p.L283L	CARD9_ENST00000460290.1_5'Flank|CARD9_ENST00000371734.3_Silent_p.L283L|CARD9_ENST00000315908.7_Silent_p.L283L	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	283					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		AGTCCTCCTCCAGTACCTGGA	0.687																																						dbGAP											0													33.0	35.0	34.0					9																	139264848		2193	4298	6491	-	-	-	SO:0001819	synonymous_variant	0			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.849G>T	9.37:g.139264848C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SXM5|Q5SXM6|Q9H854	Silent	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.L283	ENST00000371732.5	37	c.849	CCDS6997.1	9																																																																																			CARD9	-	NULL	ENSG00000187796		0.687	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	27	0.00	0	C	NM_052813		139264848	139264848	-1	no_errors	ENST00000371732	ensembl	human	known	69_37n	silent	19	17.39	4	SNP	1.000	A
CBLB	868	genome.wustl.edu	37	3	105464837	105464837	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:105464837G>A	ENST00000264122.4	-	6	1090	c.769C>T	c.(769-771)Cat>Tat	p.H257Y	CBLB_ENST00000394027.3_Missense_Mutation_p.H279Y|CBLB_ENST00000405772.1_Missense_Mutation_p.H257Y|CBLB_ENST00000403724.1_Missense_Mutation_p.H257Y|CBLB_ENST00000545639.1_3'UTR	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	257	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TAACCTGGATGTGTCACAGCT	0.333			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	dbGAP		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													120.0	126.0	124.0					3																	105464837		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.769C>T	3.37:g.105464837G>A	ENSP00000264122:p.His257Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.H257Y	ENST00000264122.4	37	c.769	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.072376	0.93950	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52	6.08	6.08	0.98989	Adaptor protein Cbl, PTB domain (1);SH2 motif (2);Adaptor protein Cbl, SH2-like (1);	0.000000	0.85682	D	0.000000	D	0.91202	0.7228	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.995;1.0	D	0.91150	0.4952	10	0.87932	D	0	-25.9733	20.6634	0.99662	0.0:0.0:1.0:0.0	.	279;257;257	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	Y	257;279;257;257	ENSP00000264122:H257Y;ENSP00000377595:H279Y;ENSP00000384816:H257Y;ENSP00000384938:H257Y	ENSP00000264122:H257Y	H	-	1	0	CBLB	106947527	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.773000	0.98989	2.894000	0.99253	0.655000	0.94253	CAT	CBLB	-	pfam_Adaptor_Cbl_SH2-like	ENSG00000114423		0.333	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2	67	0.00	0	G	NM_170662		105464837	105464837	-1	no_errors	ENST00000264122	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	1.000	A
CLCA1	1179	genome.wustl.edu	37	1	86952406	86952406	+	Silent	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:86952406C>T	ENST00000234701.3	+	8	1503	c.1152C>T	c.(1150-1152)tcC>tcT	p.S384S	CLCA1_ENST00000394711.1_Silent_p.S384S			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	384	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GAGGGACGTCCATCTGCAGCG	0.443																																						dbGAP											0													112.0	107.0	108.0					1																	86952406		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1152C>T	1.37:g.86952406C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Silent	SNP	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,superfamily_Fibronectin_type3,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.S384	ENST00000234701.3	37	c.1152	CCDS709.1	1																																																																																			CLCA1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	ENSG00000016490		0.443	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA1	HGNC	protein_coding	OTTHUMT00000028277.1	40	0.00	0	C	NM_001285		86952406	86952406	+1	no_errors	ENST00000234701	ensembl	human	known	69_37n	silent	37	19.57	9	SNP	0.955	T
CELSR2	1952	genome.wustl.edu	37	1	109804509	109804509	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:109804509C>G	ENST00000271332.3	+	5	4438	c.4377C>G	c.(4375-4377)taC>taG	p.Y1459*		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1459	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		AGCTGAAATACTACAATAAGG	0.597																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													83.0	64.0	71.0					1																	109804509		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.4377C>G	1.37:g.109804509C>G	ENSP00000271332:p.Tyr1459*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.Y1459*	ENST00000271332.3	37	c.4377	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	C	44	10.622675	0.99439	.	.	ENSG00000143126	ENST00000271332	.	.	.	5.01	2.17	0.27698	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1834	0.37156	0.0:0.7071:0.0:0.2929	.	.	.	.	X	1459	.	ENSP00000271332:Y1459X	Y	+	3	2	CELSR2	109606032	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	1.082000	0.30803	0.314000	0.23086	-0.355000	0.07637	TAC	CELSR2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000143126		0.597	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	34	0.00	0	C	NM_001408		109804509	109804509	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	nonsense	21	40.00	14	SNP	1.000	G
CMKLR1	1240	genome.wustl.edu	37	12	108685751	108685751	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr12:108685751A>T	ENST00000312143.7	-	3	1352	c.989T>A	c.(988-990)cTc>cAc	p.L330H	CMKLR1_ENST00000550402.1_Missense_Mutation_p.L330H|CMKLR1_ENST00000397688.2_Missense_Mutation_p.L328H|CMKLR1_ENST00000552995.1_Missense_Mutation_p.L328H|CMKLR1_ENST00000412676.1_Missense_Mutation_p.L330H	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	330					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						GCGAGAGAAGAGGGCCACCTT	0.502																																						dbGAP											0													94.0	95.0	94.0					12																	108685751		1951	4153	6104	-	-	-	SO:0001583	missense	0			U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.989T>A	12.37:g.108685751A>T	ENSP00000311733:p.Leu330His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_DEZorph_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Frt_met_rcpt,prints_Anphylx_rcpt,prints_ATII_rcpt	p.L330H	ENST00000312143.7	37	c.989	CCDS44965.1	12	.	.	.	.	.	.	.	.	.	.	a	22.7	4.323181	0.81580	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.36	5.36	0.76844	.	0.523903	0.19030	N	0.124568	T	0.54711	0.1875	L	0.45352	1.415	0.41139	D	0.985944	D	0.56287	0.975	P	0.54372	0.75	T	0.58763	-0.7579	10	0.87932	D	0	.	14.5435	0.68013	1.0:0.0:0.0:0.0	.	330	Q99788	CML1_HUMAN	H	330;330;328;328;330	ENSP00000311733:L330H;ENSP00000401293:L330H;ENSP00000380803:L328H;ENSP00000447579:L328H;ENSP00000449716:L330H	ENSP00000311733:L330H	L	-	2	0	CMKLR1	107209881	1.000000	0.71417	0.999000	0.59377	0.908000	0.53690	9.328000	0.96403	2.022000	0.59522	0.454000	0.30748	CTC	CMKLR1	-	prints_DEZorph_rcpt,prints_Anphylx_rcpt	ENSG00000174600		0.502	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CMKLR1	HGNC	protein_coding	OTTHUMT00000404867.1	61	0.00	0	A			108685751	108685751	-1	no_errors	ENST00000312143	ensembl	human	known	69_37n	missense	9	73.53	25	SNP	1.000	T
CNGB3	54714	genome.wustl.edu	37	8	87680252	87680252	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr8:87680252T>G	ENST00000320005.5	-	5	685	c.638A>C	c.(637-639)tAc>tCc	p.Y213S		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	213					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						AATACCTGTGTATGAATCTAT	0.388																																						dbGAP											0													232.0	223.0	226.0					8																	87680252		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.638A>C	8.37:g.87680252T>G	ENSP00000316605:p.Tyr213Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.Y213S	ENST00000320005.5	37	c.638	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	T	12.40	1.927123	0.34002	.	.	ENSG00000170289	ENST00000320005	D	0.97138	-4.26	6.1	4.95	0.65309	.	0.211714	0.41605	D	0.000847	D	0.96574	0.8882	M	0.66506	2.035	0.44807	D	0.997813	P;P	0.44521	0.837;0.749	P;B	0.49637	0.617;0.412	D	0.94612	0.7805	10	0.25106	T	0.35	.	11.4846	0.50346	0.0:0.0696:0.0:0.9304	.	213;213	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	S	213	ENSP00000316605:Y213S	ENSP00000316605:Y213S	Y	-	2	0	CNGB3	87749368	0.999000	0.42202	0.832000	0.32986	0.476000	0.33039	2.178000	0.42519	1.129000	0.42072	0.528000	0.53228	TAC	CNGB3	-	NULL	ENSG00000170289		0.388	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	105	0.00	0	T	NM_019098		87680252	87680252	-1	no_errors	ENST00000320005	ensembl	human	known	69_37n	missense	147	25.00	49	SNP	0.944	G
COL19A1	1310	genome.wustl.edu	37	6	70646698	70646698	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:70646698G>C	ENST00000322773.4	+	8	871	c.769G>C	c.(769-771)Gga>Cga	p.G257R		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	257					cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GGATGGCTTTGGAAATATTGC	0.433																																						dbGAP											0													167.0	161.0	163.0					6																	70646698		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.769G>C	6.37:g.70646698G>C	ENSP00000316030:p.Gly257Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.G257R	ENST00000322773.4	37	c.769	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	1.281	-0.610301	0.03690	.	.	ENSG00000082293	ENST00000322773	D	0.91180	-2.8	5.37	4.5	0.54988	.	0.632771	0.15711	N	0.248393	T	0.75788	0.3897	L	0.51422	1.61	0.18873	N	0.999988	P	0.39576	0.679	B	0.36719	0.231	T	0.65010	-0.6272	10	0.23302	T	0.38	.	6.5988	0.22689	0.1608:0.1596:0.6797:0.0	.	257	Q14993	COJA1_HUMAN	R	257	ENSP00000316030:G257R	ENSP00000316030:G257R	G	+	1	0	COL19A1	70703419	1.000000	0.71417	0.141000	0.22245	0.055000	0.15305	2.328000	0.43867	1.415000	0.47037	-0.126000	0.14955	GGA	COL19A1	-	NULL	ENSG00000082293		0.433	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	61	0.00	0	G			70646698	70646698	+1	no_errors	ENST00000322773	ensembl	human	known	69_37n	missense	32	43.86	25	SNP	0.035	C
CST1	1469	genome.wustl.edu	37	20	23731390	23731390	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr20:23731390G>T	ENST00000304749.2	-	1	184	c.114C>A	c.(112-114)gaC>gaA	p.D38E	CST1_ENST00000398402.1_Missense_Mutation_p.D38E	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	38					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CATCATTGAGGTCTGCGTTAT	0.567																																						dbGAP											0													161.0	135.0	144.0					20																	23731390		2203	4300	6503	-	-	-	SO:0001583	missense	0			M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.114C>A	20.37:g.23731390G>T	ENSP00000305731:p.Asp38Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LE6|Q9UCQ6	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.D38E	ENST00000304749.2	37	c.114	CCDS13160.1	20	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600075	0.28534	.	.	ENSG00000170373	ENST00000304749;ENST00000398402	T;T	0.15952	2.38;2.38	2.13	1.12	0.20585	Proteinase inhibitor I25, cystatin (2);	0.059984	0.64402	D	0.000004	T	0.22742	0.0549	M	0.76170	2.325	0.09310	N	1	P	0.41366	0.747	P	0.46885	0.53	T	0.07731	-1.0757	10	0.52906	T	0.07	.	4.5115	0.11914	0.211:0.0:0.789:0.0	.	38	P01037	CYTN_HUMAN	E	38	ENSP00000305731:D38E;ENSP00000381439:D38E	ENSP00000305731:D38E	D	-	3	2	CST1	23679390	0.000000	0.05858	0.004000	0.12327	0.054000	0.15201	-0.687000	0.05156	0.204000	0.20548	0.184000	0.17185	GAC	CST1	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	ENSG00000170373		0.567	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST1	HGNC	protein_coding	OTTHUMT00000078351.2	58	0.00	0	G	NM_001898		23731390	23731390	-1	no_errors	ENST00000304749	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	0.005	T
CTCFL	140690	genome.wustl.edu	37	20	56099035	56099035	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr20:56099035T>A	ENST00000608263.1	-	1	888	c.227A>T	c.(226-228)gAg>gTg	p.E76V	CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000422869.2_Missense_Mutation_p.E76V|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000433949.3_Intron|CTCFL_ENST00000481655.2_Missense_Mutation_p.E76V|CTCFL_ENST00000608440.1_Missense_Mutation_p.E76V|CTCFL_ENST00000429804.3_Missense_Mutation_p.E76V|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000243914.3_Missense_Mutation_p.E76V|CTCFL_ENST00000608158.1_Missense_Mutation_p.E76V|CTCFL_ENST00000539382.1_Intron|CTCFL_ENST00000423479.3_Missense_Mutation_p.E76V|CTCFL_ENST00000432255.2_Missense_Mutation_p.E76V|CTCFL_ENST00000608425.1_Missense_Mutation_p.E76V|CTCFL_ENST00000609232.1_Missense_Mutation_p.E76V|CTCFL_ENST00000371196.2_Missense_Mutation_p.E76V	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	76					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GATGTACTTCTCGCTCTCCTC	0.592																																						dbGAP											0													89.0	85.0	86.0					20																	56099035		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.227A>T	20.37:g.56099035T>A	ENSP00000476783:p.Glu76Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E76V	ENST00000608263.1	37	c.227	CCDS13459.1	20	.	.	.	.	.	.	.	.	.	.	T	16.78	3.218306	0.58560	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000422109;ENST00000426658;ENST00000432255;ENST00000422869	T;T;T;T;T;T;T;T;T	0.12774	2.65;2.69;2.69;2.84;2.74;3.01;2.71;3.29;2.73	4.91	2.5	0.30297	.	1.165440	0.06482	N	0.733052	T	0.27419	0.0673	L	0.60455	1.87	0.09310	N	1	P;P;P;D;P;P;P;P	0.69078	0.94;0.94;0.937;0.997;0.675;0.845;0.845;0.845	P;P;P;P;B;B;B;B	0.60789	0.483;0.483;0.585;0.879;0.116;0.231;0.231;0.231	T	0.10590	-1.0623	10	0.59425	D	0.04	-10.5022	4.4199	0.11476	0.1736:0.0958:0.0:0.7306	.	76;76;76;76;76;76;76;76	A6XGM3;A6XGM0;A6XGM9;A6XGM8;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;.;.;.;CTCFL_HUMAN	V	76	ENSP00000415579:E76V;ENSP00000243914:E76V;ENSP00000360239:E76V;ENSP00000415329:E76V;ENSP00000392034:E76V;ENSP00000413713:E76V;ENSP00000403369:E76V;ENSP00000409344:E76V;ENSP00000399061:E76V	ENSP00000243914:E76V	E	-	2	0	CTCFL	55532441	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.438000	0.21559	0.728000	0.32382	0.528000	0.53228	GAG	CTCFL	-	NULL	ENSG00000124092		0.592	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CTCFL	HGNC	protein_coding	OTTHUMT00000472040.1	34	0.00	0	T	NM_080618		56099035	56099035	-1	no_errors	ENST00000423479	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	0.002	A
CTNNA3	29119	genome.wustl.edu	37	10	68979558	68979558	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr10:68979558A>T	ENST00000433211.2	-	6	824	c.650T>A	c.(649-651)cTc>cAc	p.L217H	CTNNA3_ENST00000373744.4_Missense_Mutation_p.L217H|CTNNA3_ENST00000545309.1_Missense_Mutation_p.L217H	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TGAATGCAAGAGGGGAGAGTT	0.413																																						dbGAP											0													91.0	92.0	92.0					10																	68979558		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.650T>A	10.37:g.68979558A>T	ENSP00000389714:p.Leu217His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.L217H	ENST00000433211.2	37	c.650	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158893	0.78226	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309	T;T;T	0.42131	0.98;0.98;0.98	5.57	5.57	0.84162	.	0.095913	0.41097	D	0.000958	T	0.51024	0.1650	L	0.34521	1.04	0.40870	D	0.983906	P;D;D;D	0.60575	0.9;0.988;0.984;0.97	P;P;P;P	0.61533	0.746;0.89;0.873;0.608	T	0.56001	-0.8051	10	0.87932	D	0	-2.951	14.7066	0.69194	1.0:0.0:0.0:0.0	.	217;217;217;217	A8K141;F2Z2R0;Q9UI47-2;Q9UI47	.;.;.;CTNA3_HUMAN	H	217	ENSP00000389714:L217H;ENSP00000362849:L217H;ENSP00000441444:L217H	ENSP00000362849:L217H	L	-	2	0	CTNNA3	68649564	1.000000	0.71417	0.904000	0.35570	0.987000	0.75469	7.139000	0.77314	2.114000	0.64651	0.482000	0.46254	CTC	CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000183230		0.413	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	40	0.00	0	A	NM_013266		68979558	68979558	-1	no_errors	ENST00000373744	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	0.982	T
CXCR1	3577	genome.wustl.edu	37	2	219029617	219029617	+	Silent	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:219029617G>C	ENST00000295683.2	-	2	438	c.318C>G	c.(316-318)ggC>ggG	p.G106G		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	106					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)			endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	ACAGGAATGTGCCAAAAATCC	0.552																																						dbGAP											0													97.0	88.0	91.0					2																	219029617		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.318C>G	2.37:g.219029617G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CXC/IL8_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CXCR1/IL8RA,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.G106	ENST00000295683.2	37	c.318	CCDS2409.1	2																																																																																			CXCR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CXCR4	ENSG00000163464		0.552	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR1	HGNC	protein_coding	OTTHUMT00000256773.2	61	0.00	0	G	NM_000634		219029617	219029617	-1	no_errors	ENST00000295683	ensembl	human	known	69_37n	silent	70	19.54	17	SNP	1.000	C
DCHS2	54798	genome.wustl.edu	37	4	155157392	155157392	+	Silent	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr4:155157392C>T	ENST00000357232.4	-	25	7046	c.7047G>A	c.(7045-7047)ttG>ttA	p.L2349L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2349	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TAGAATAGGTCAATTCTCCAT	0.403																																						dbGAP											0													105.0	99.0	101.0					4																	155157392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7047G>A	4.37:g.155157392C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L2349	ENST00000357232.4	37	c.7047	CCDS3785.1	4																																																																																			DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	41	0.00	0	C	NM_001142552		155157392	155157392	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	silent	37	22.92	11	SNP	0.992	T
DDX43	55510	genome.wustl.edu	37	6	74125920	74125920	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:74125920C>T	ENST00000370336.4	+	16	2076	c.1918C>T	c.(1918-1920)Cct>Tct	p.P640S	MB21D1_ENST00000370318.1_Intron	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	640					ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						AATGGAAAGACCTCAAGGAAG	0.378																																						dbGAP											0													110.0	110.0	110.0					6																	74125920		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.1918C>T	6.37:g.74125920C>T	ENSP00000359361:p.Pro640Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0C8|Q6NXR1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_KH_dom_type_1,smart_KH_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_KH_dom_type_1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.P640S	ENST00000370336.4	37	c.1918	CCDS4977.1	6	.	.	.	.	.	.	.	.	.	.	C	12.10	1.838093	0.32513	.	.	ENSG00000080007	ENST00000370336	T	0.14640	2.49	5.26	4.33	0.51752	.	0.636057	0.15655	N	0.251196	T	0.07234	0.0183	L	0.50919	1.6	0.80722	D	1	B	0.15719	0.014	B	0.15484	0.013	T	0.10019	-1.0648	10	0.19147	T	0.46	-19.295	16.1549	0.81657	0.1422:0.8577:0.0:0.0	.	640	Q9NXZ2	DDX43_HUMAN	S	640	ENSP00000359361:P640S	ENSP00000359361:P640S	P	+	1	0	DDX43	74182641	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	1.381000	0.34362	2.729000	0.93468	0.591000	0.81541	CCT	DDX43	-	NULL	ENSG00000080007		0.378	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX43	HGNC	protein_coding	OTTHUMT00000041219.3	58	0.00	0	C	NM_018665		74125920	74125920	+1	no_errors	ENST00000370336	ensembl	human	known	69_37n	missense	32	46.67	28	SNP	1.000	T
DHCR24	1718	genome.wustl.edu	37	1	55319845	55319845	+	Silent	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:55319845G>C	ENST00000371269.3	-	7	1181	c.1083C>G	c.(1081-1083)ccC>ccG	p.P361P	DHCR24_ENST00000537443.1_Silent_p.P145P|DHCR24_ENST00000535035.1_Silent_p.P320P	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase	361					amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						GGGAGATCTTGGGAGGCACCA	0.547																																					Pancreas(39;516 1021 24601 30715 32780)	dbGAP											0													84.0	90.0	88.0					1																	55319845		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.1083C>G	1.37:g.55319845G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z817|D3DQ51|Q9HBA8	Silent	SNP	pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2	p.P361	ENST00000371269.3	37	c.1083	CCDS600.1	1																																																																																			DHCR24	-	NULL	ENSG00000116133		0.547	DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHCR24	HGNC	protein_coding	OTTHUMT00000027680.1	49	0.00	0	G	NM_014762		55319845	55319845	-1	no_errors	ENST00000371269	ensembl	human	known	69_37n	silent	35	22.22	10	SNP	0.994	C
DIP2A	23181	genome.wustl.edu	37	21	47974547	47974547	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr21:47974547G>A	ENST00000417564.2	+	27	3235	c.3214G>A	c.(3214-3216)Gtg>Atg	p.V1072M	DIP2A_ENST00000427143.2_Missense_Mutation_p.V1008M|DIP2A_ENST00000318711.7_Missense_Mutation_p.V1073M|DIP2A_ENST00000400274.1_Missense_Mutation_p.V1068M			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1072					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GCCTGTCACCGTGCGGCCCCC	0.652																																						dbGAP											0													37.0	46.0	43.0					21																	47974547		2164	4261	6425	-	-	-	SO:0001583	missense	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3214G>A	21.37:g.47974547G>A	ENSP00000392066:p.Val1072Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.V1073M	ENST00000417564.2	37	c.3217	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	G	19.57	3.851704	0.71719	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000417564	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.45	5.45	0.79879	AMP-dependent synthetase/ligase (1);	0.071344	0.56097	D	0.000033	T	0.65554	0.2702	L	0.58583	1.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.97110	1.0;0.977;0.964	T	0.60115	-0.7326	10	0.29301	T	0.29	-22.9218	18.2782	0.90089	0.0:0.0:1.0:0.0	.	1073;1008;1072	E9PER1;E7EMA5;Q14689	.;.;DIP2A_HUMAN	M	1068;1008;1073;1072	ENSP00000383133:V1068M;ENSP00000400528:V1008M;ENSP00000323633:V1073M;ENSP00000392066:V1072M	ENSP00000323633:V1073M	V	+	1	0	DIP2A	46798975	1.000000	0.71417	0.955000	0.39395	0.709000	0.40893	7.755000	0.85180	2.569000	0.86673	0.563000	0.77884	GTG	DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.652	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	26	0.00	0	G	NM_015151		47974547	47974547	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	missense	16	60.98	25	SNP	0.999	A
DNAH8	1769	genome.wustl.edu	37	6	38854684	38854684	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:38854684G>T	ENST00000359357.3	+	55	7980	c.7726G>T	c.(7726-7728)Gga>Tga	p.G2576*	DNAH8_ENST00000449981.2_Nonsense_Mutation_p.G2793*|DNAH8_ENST00000441566.1_Nonsense_Mutation_p.G2540*			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2576	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GATCCACCCTGGAGGTGGTCG	0.393																																						dbGAP											0													147.0	134.0	139.0					6																	38854684		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7726G>T	6.37:g.38854684G>T	ENSP00000352312:p.Gly2576*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Nonsense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.G2576*	ENST00000359357.3	37	c.7726		6	.	.	.	.	.	.	.	.	.	.	G	51	17.836417	0.99894	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3374	0.94324	0.0:0.0:1.0:0.0	.	.	.	.	X	2781;2781;2576;2540	.	ENSP00000333363:G2781X	G	+	1	0	DNAH8	38962662	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.750000	0.98875	2.571000	0.86741	0.561000	0.74099	GGA	DNAH8	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	ENSG00000124721		0.393	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	54	0.00	0	G	NM_001206927		38854684	38854684	+1	no_errors	ENST00000359357	ensembl	human	known	69_37n	nonsense	41	21.15	11	SNP	1.000	T
DNMT1	1786	genome.wustl.edu	37	19	10260544	10260544	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr19:10260544G>A	ENST00000340748.4	-	24	2553	c.2318C>T	c.(2317-2319)cCg>cTg	p.P773L	DNMT1_ENST00000359526.4_Missense_Mutation_p.P789L|DNMT1_ENST00000540357.1_Missense_Mutation_p.P773L			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	773	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	TAGATACAGCGGTTTTGAGGA	0.443																																						dbGAP											0													166.0	144.0	151.0					19																	10260544		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2318C>T	19.37:g.10260544G>A	ENSP00000345739:p.Pro773Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.P789L	ENST00000340748.4	37	c.2366	CCDS12228.1	19	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926850	0.73327	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	D;D;D	0.87729	-2.29;-2.29;-2.29	6.03	5.0	0.66597	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	D	0.91526	0.7324	M	0.78456	2.415	0.80722	D	1	D;D;D	0.69078	0.994;0.997;0.995	P;P;P	0.59487	0.778;0.778;0.858	D	0.91502	0.5220	10	0.48119	T	0.1	.	12.5125	0.56013	0.0777:0.0:0.9223:0.0	.	773;789;773	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	L	789;773;773;641	ENSP00000352516:P789L;ENSP00000440457:P773L;ENSP00000345739:P773L	ENSP00000345739:P773L	P	-	2	0	DNMT1	10121544	1.000000	0.71417	0.316000	0.25252	0.902000	0.53008	7.407000	0.80029	1.563000	0.49615	0.655000	0.94253	CCG	DNMT1	-	pirsf_DNA_C5-MeTrfase_1_euk,pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000130816		0.443	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1	49	0.00	0	G	NM_001379		10260544	10260544	-1	no_errors	ENST00000359526	ensembl	human	known	69_37n	missense	22	65.08	41	SNP	1.000	A
DOCK5	80005	genome.wustl.edu	37	8	25240200	25240200	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr8:25240200C>G	ENST00000276440.7	+	40	4081	c.4037C>G	c.(4036-4038)gCc>gGc	p.A1346G		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1346	DHR-2.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AAAAAAAGGGCCTCATTTTAT	0.408																																					Pancreas(145;34 1887 3271 10937 30165)	dbGAP											0													92.0	86.0	88.0					8																	25240200		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.4037C>G	8.37:g.25240200C>G	ENSP00000276440:p.Ala1346Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.A1346G	ENST00000276440.7	37	c.4037	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	C	30	5.056392	0.93793	.	.	ENSG00000147459	ENST00000276440	T	0.01887	4.58	5.69	5.69	0.88448	.	0.110528	0.64402	D	0.000009	T	0.14743	0.0356	M	0.83692	2.655	0.80722	D	1	D;D;D	0.64830	0.994;0.962;0.992	D;P;P	0.65233	0.933;0.712;0.853	T	0.00057	-1.2172	10	0.72032	D	0.01	.	19.8263	0.96618	0.0:1.0:0.0:0.0	.	135;1336;1346	Q6ZP32;D3DSS6;Q9H7D0	.;.;DOCK5_HUMAN	G	1346	ENSP00000276440:A1346G	ENSP00000276440:A1346G	A	+	2	0	DOCK5	25296117	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.818000	0.86416	2.676000	0.91093	0.655000	0.94253	GCC	DOCK5	-	NULL	ENSG00000147459		0.408	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	87	0.00	0	C	NM_024940		25240200	25240200	+1	no_errors	ENST00000276440	ensembl	human	known	69_37n	missense	41	28.81	17	SNP	1.000	G
DYNC2H1	79659	genome.wustl.edu	37	11	103128341	103128341	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:103128341G>A	ENST00000375735.2	+	69	10610	c.10466G>A	c.(10465-10467)cGg>cAg	p.R3489Q	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R3496Q|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3489					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCATAGGAACGGGATGCCTAT	0.428																																						dbGAP											0													121.0	112.0	115.0					11																	103128341		1888	4111	5999	-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10466G>A	11.37:g.103128341G>A	ENSP00000364887:p.Arg3489Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R3496Q	ENST00000375735.2	37	c.10487	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618562	0.87460	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.54279	0.58;0.58	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.82195	0.4984	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.971;0.994	D	0.85413	0.1138	10	0.56958	D	0.05	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	3489;3496	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	Q	3489;3496	ENSP00000364887:R3489Q;ENSP00000381167:R3496Q	ENSP00000364887:R3489Q	R	+	2	0	DYNC2H1	102633551	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	CGG	DYNC2H1	-	NULL	ENSG00000187240		0.428	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	76	0.00	0	G	XM_370652		103128341	103128341	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	missense	33	54.17	39	SNP	1.000	A
DZIP1	22873	genome.wustl.edu	37	13	96234512	96234512	+	Silent	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr13:96234512A>G	ENST00000376829.2	-	23	3431	c.2580T>C	c.(2578-2580)gaT>gaC	p.D860D	DZIP1_ENST00000361396.2_Silent_p.D841D|DZIP1_ENST00000347108.3_Silent_p.D860D|DZIP1_ENST00000361156.3_Silent_p.D841D	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	860					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TGTCGCTCCAATCAGTCACAG	0.408																																						dbGAP											0													243.0	203.0	217.0					13																	96234512		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.2580T>C	13.37:g.96234512A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D860	ENST00000376829.2	37	c.2580	CCDS9478.1	13																																																																																			DZIP1	-	NULL	ENSG00000134874		0.408	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	94	0.00	0	A	NM_014934		96234512	96234512	-1	no_errors	ENST00000347108	ensembl	human	known	69_37n	silent	40	56.99	53	SNP	0.065	G
FAIM3	9214	genome.wustl.edu	37	1	207087275	207087275	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:207087275T>G	ENST00000367091.3	-	2	345	c.202A>C	c.(202-204)Atc>Ctc	p.I68L	FAIM3_ENST00000420007.2_Missense_Mutation_p.I68L|FAIM3_ENST00000442471.2_Intron|FAIM3_ENST00000528654.1_Intron	NM_005449.4	NP_005440.1	O60667	FAIM3_HUMAN	Fas apoptotic inhibitory molecule 3	68	Ig-like.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|negative regulation of apoptotic process (GO:0043066)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(84;0.201)					TCTGCCTTGATGAAGTTGGTG	0.498																																						dbGAP											0													172.0	153.0	159.0					1																	207087275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057557	CCDS1473.1, CCDS44304.1	1q32.1	2013-01-11			ENSG00000162894	ENSG00000162894		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14315	protein-coding gene	gene with protein product		606015				9586636, 1563211	Standard	NM_005449		Approved	TOSO	uc001hey.3	O60667	OTTHUMG00000036457	ENST00000367091.3:c.202A>C	1.37:g.207087275T>G	ENSP00000356058:p.Ile68Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7J2|B7Z6Z0|D9MWM3	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub	p.I68L	ENST00000367091.3	37	c.202	CCDS1473.1	1	.	.	.	.	.	.	.	.	.	.	T	12.31	1.898305	0.33535	.	.	ENSG00000162894	ENST00000367091;ENST00000420007;ENST00000525793;ENST00000529560;ENST00000530505	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02	5.28	-0.285	0.12866	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.053130	0.07498	N	0.906772	T	0.14570	0.0352	N	0.25890	0.77	0.09310	N	1	B	0.26002	0.139	B	0.28305	0.088	T	0.38478	-0.9659	10	0.30078	T	0.28	-5.4284	7.1859	0.25799	0.15:0.7205:0.0:0.1295	.	68	O60667	FAIM3_HUMAN	L	68;68;68;68;99	ENSP00000356058:I68L;ENSP00000403356:I68L;ENSP00000432936:I68L;ENSP00000437331:I68L;ENSP00000436316:I99L	ENSP00000356058:I68L	I	-	1	0	FAIM3	205153898	0.008000	0.16893	0.001000	0.08648	0.009000	0.06853	-0.239000	0.08965	-0.359000	0.08150	-0.250000	0.11733	ATC	FAIM3	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub	ENSG00000162894		0.498	FAIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAIM3	HGNC	protein_coding	OTTHUMT00000088677.1	42	0.00	0	T	NM_005449		207087275	207087275	-1	no_errors	ENST00000367091	ensembl	human	known	69_37n	missense	23	47.73	21	SNP	0.001	G
FAM172A	83989	genome.wustl.edu	37	5	93294552	93294552	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:93294552G>A	ENST00000395965.3	-	6	639	c.497C>T	c.(496-498)gCt>gTt	p.A166V	FAM172A_ENST00000505869.1_Intron|FAM172A_ENST00000509739.1_Intron|FAM172A_ENST00000509163.1_Missense_Mutation_p.A120V|FAM172A_ENST00000504768.2_5'UTR	NM_032042.5	NP_114431.2	Q8WUF8	F172A_HUMAN	family with sequence similarity 172, member A	166						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9						AAGTCTTCTAGCCCACTGCCC	0.388																																						dbGAP											0													131.0	126.0	128.0					5																	93294552		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4069.1, CCDS54879.1, CCDS54880.1	5q15	2008-06-16	2008-06-16	2008-06-16	ENSG00000113391	ENSG00000113391			25365	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 21"""	C5orf21		11230166	Standard	NM_032042		Approved	DKFZP564D172	uc010jbd.3	Q8WUF8	OTTHUMG00000131329	ENST00000395965.3:c.497C>T	5.37:g.93294552G>A	ENSP00000379294:p.Ala166Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7C6|B4DJ14|B4DLG5|Q9H0U8	Missense_Mutation	SNP	pfam_Arb2_domain	p.A166V	ENST00000395965.3	37	c.497	CCDS4069.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.323337	0.95708	.	.	ENSG00000113391	ENST00000395965;ENST00000509163	T;T	0.59502	0.26;0.26	5.56	5.56	0.83823	Arb2 domain (1);	0.000000	0.85682	D	0.000000	T	0.81336	0.4801	M	0.88181	2.935	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.85130	0.946;0.997	D	0.84113	0.0402	10	0.87932	D	0	-18.6806	19.8772	0.96880	0.0:0.0:1.0:0.0	.	166;166	Q8WUF8;Q8WUF8-2	F172A_HUMAN;.	V	166;120	ENSP00000379294:A166V;ENSP00000423841:A120V	ENSP00000379294:A166V	A	-	2	0	FAM172A	93320308	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.597000	0.90847	2.774000	0.95407	0.585000	0.79938	GCT	FAM172A	-	pfam_Arb2_domain	ENSG00000113391		0.388	FAM172A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM172A	HGNC	protein_coding	OTTHUMT00000254100.3	70	0.00	0	G	NM_032042		93294552	93294552	-1	no_errors	ENST00000395965	ensembl	human	known	69_37n	missense	18	50.00	18	SNP	1.000	A
FAM65A	79567	genome.wustl.edu	37	16	67575419	67575419	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:67575419G>T	ENST00000379312.3	+	11	1021	c.900G>T	c.(898-900)caG>caT	p.Q300H	FAM65A_ENST00000422602.2_Missense_Mutation_p.Q316H|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.Q316H|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.Q296H|FAM65A_ENST00000428437.2_Missense_Mutation_p.Q310H	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	300						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CCCTGCCCCAGGTTGTGGCTG	0.582																																						dbGAP											0													162.0	144.0	150.0					16																	67575419		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.900G>T	16.37:g.67575419G>T	ENSP00000368614:p.Gln300His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.Q316H	ENST00000379312.3	37	c.948	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.42|15.42	2.828633|2.828633	0.50845|0.50845	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|T;T;T	.|0.02631	.|4.22;4.22;4.22	4.86|4.86	1.8|1.8	0.24995|0.24995	.|.	.|0.268410	.|0.38837	.|N	.|0.001547	T|T	0.11750|0.11750	0.0286|0.0286	M|M	0.81802|0.81802	2.56|2.56	0.53688|0.53688	D|D	0.999971|0.999971	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.68192	.|0.956;0.956;0.956;0.956	T|T	0.00904|0.00904	-1.1520|-1.1520	5|10	.|0.87932	.|D	.|0	-14.9243|-14.9243	8.1288|8.1288	0.31014|0.31014	0.3759:0.0:0.6241:0.0|0.3759:0.0:0.6241:0.0	.|.	.|310;316;300;316	.|B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.|.;.;FA65A_HUMAN;.	C|H	291|300;296;316;310	.|ENSP00000368614:Q300H;ENSP00000042381:Q296H;ENSP00000400099:Q316H	.|ENSP00000042381:Q296H	G|Q	+|+	1|3	0|2	FAM65A|FAM65A	66132920|66132920	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	1.878000|1.878000	0.39608|0.39608	1.053000|1.053000	0.40415|0.40415	0.561000|0.561000	0.74099|0.74099	GGT|CAG	FAM65A	-	NULL	ENSG00000039523		0.582	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3	41	0.00	0	G	NM_024519		67575419	67575419	+1	no_errors	ENST00000422602	ensembl	human	known	69_37n	missense	7	61.11	11	SNP	1.000	T
FANCM	57697	genome.wustl.edu	37	14	45606394	45606394	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr14:45606394T>A	ENST00000267430.5	+	2	716	c.631T>A	c.(631-633)Tta>Ata	p.L211I	FKBP3_ENST00000216330.3_5'Flank|FKBP3_ENST00000396062.3_5'Flank|FANCM_ENST00000556036.1_Missense_Mutation_p.L211I|FANCM_ENST00000542564.2_Missense_Mutation_p.L211I	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	211	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AATAAAGTGTTTAGTTATTGA	0.368								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													87.0	84.0	85.0					14																	45606394		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.631T>A	14.37:g.45606394T>A	ENSP00000267430:p.Leu211Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L211I	ENST00000267430.5	37	c.631	CCDS32070.1	14	.	.	.	.	.	.	.	.	.	.	T	14.84	2.655260	0.47467	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.20200	2.09;2.09;2.09	5.39	0.148	0.14843	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.229199	0.37577	N	0.002026	T	0.26159	0.0638	L	0.43701	1.375	0.35727	D	0.817622	P;P;P	0.41232	0.722;0.699;0.743	P;P;B	0.54706	0.627;0.759;0.386	T	0.17531	-1.0366	10	0.45353	T	0.12	.	6.1941	0.20540	0.0:0.5844:0.1236:0.292	.	211;211;211	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	I	211	ENSP00000450596:L211I;ENSP00000267430:L211I;ENSP00000442493:L211I	ENSP00000267430:L211I	L	+	1	2	FANCM	44676144	0.996000	0.38824	0.942000	0.38095	0.853000	0.48598	0.551000	0.23361	-0.218000	0.10018	-0.973000	0.02599	TTA	FANCM	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000187790		0.368	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	53	0.00	0	T	XM_048128		45606394	45606394	+1	no_errors	ENST00000267430	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.993	A
FGG	2266	genome.wustl.edu	37	4	155533009	155533009	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr4:155533009C>G	ENST00000336098.3	-	4	387	c.349G>C	c.(349-351)Gaa>Caa	p.E117Q	FGG_ENST00000404648.3_Missense_Mutation_p.E117Q|FGG_ENST00000407946.1_Missense_Mutation_p.E117Q|FGG_ENST00000405164.1_Missense_Mutation_p.E117Q	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	117					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	ATAATTTCTTCTAACATTTTC	0.303																																						dbGAP											0													84.0	86.0	85.0					4																	155533009		2203	4296	6499	-	-	-	SO:0001583	missense	0				CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.349G>C	4.37:g.155533009C>G	ENSP00000336829:p.Glu117Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E117Q	ENST00000336098.3	37	c.349	CCDS3788.1	4	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694432	0.68386	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946;ENST00000443553;ENST00000393846	T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	5.75	5.75	0.90469	Fibrinogen, alpha/beta/gamma chain, coiled coil domain (2);	0.140149	0.64402	D	0.000006	T	0.75302	0.3831	M	0.62723	1.935	0.46725	D	0.999173	P;P;P;P	0.40553	0.534;0.721;0.721;0.674	B;B;B;B	0.39217	0.216;0.294;0.231;0.106	T	0.77854	-0.2433	10	0.62326	D	0.03	.	19.9564	0.97221	0.0:1.0:0.0:0.0	.	117;117;117;117	C9JC84;P02679;C9JEU5;P02679-2	.;FIBG_HUMAN;.;.	Q	117;117;117;117;14;14	ENSP00000384860:E117Q;ENSP00000384101:E117Q;ENSP00000336829:E117Q;ENSP00000384552:E117Q;ENSP00000407562:E14Q;ENSP00000377429:E14Q	ENSP00000336829:E117Q	E	-	1	0	FGG	155752459	1.000000	0.71417	0.993000	0.49108	0.756000	0.42949	5.114000	0.64648	2.708000	0.92522	0.650000	0.86243	GAA	FGG	-	pfam_Fibrinogen_a/b/g_coil_dom	ENSG00000171557		0.303	FGG-002	KNOWN	basic|CCDS	protein_coding	FGG	HGNC	protein_coding	OTTHUMT00000317581.1	93	0.00	0	C	NM_021870		155533009	155533009	-1	no_errors	ENST00000336098	ensembl	human	known	69_37n	missense	104	24.09	33	SNP	0.999	G
FREM1	158326	genome.wustl.edu	37	9	14792819	14792819	+	Silent	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr9:14792819G>T	ENST00000380880.3	-	22	4686	c.3903C>A	c.(3901-3903)gcC>gcA	p.A1301A	FREM1_ENST00000422223.2_Silent_p.A1301A|FREM1_ENST00000380881.4_Silent_p.A1302A			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1301					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CTTCATCTATGGCTGAAAGAA	0.358																																						dbGAP											0													65.0	61.0	62.0					9																	14792819		1824	4071	5895	-	-	-	SO:0001819	synonymous_variant	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3903C>A	9.37:g.14792819G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.A1302	ENST00000380880.3	37	c.3906	CCDS47952.1	9																																																																																			FREM1	-	NULL	ENSG00000164946		0.358	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	48	0.00	0	G	NM_144966		14792819	14792819	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	silent	36	40.98	25	SNP	0.003	T
GABRG3	2567	genome.wustl.edu	37	15	27777986	27777986	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr15:27777986delC	ENST00000333743.6	+	10	1617	c.1363delC	c.(1363-1365)ctcfs	p.L455fs	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	455					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTCCTTCCTGCTCTTTAACCT	0.483																																					NSCLC(114;800 1656 7410 37729 45293)	dbGAP											0													60.0	60.0	60.0					15																	27777986		1946	4136	6082	-	-	-	SO:0001589	frameshift_variant	0				CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1363delC	15.37:g.27777986delC	ENSP00000331912:p.Leu455fs	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V594|Q9HD46|Q9NYT2	Frame_Shift_Del	DEL	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.L455fs	ENST00000333743.6	37	c.1363	CCDS45195.1	15																																																																																			GABRG3	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000182256		0.483	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	HGNC	protein_coding	OTTHUMT00000103584.2	33	0.00	0	C			27777986	27777986	+1	no_errors	ENST00000333743	ensembl	human	known	69_37n	frame_shift_del	7	63.16	12	DEL	1.000	-
GALNTL5	168391	genome.wustl.edu	37	7	151664434	151664434	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr7:151664434T>A	ENST00000392800.2	+	2	357	c.103T>A	c.(103-105)Tgg>Agg	p.W35R	GALNTL5_ENST00000431418.2_Missense_Mutation_p.W35R	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	35					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TGTGAGCAGCTGGCAGAAGAA	0.423																																						dbGAP											0													57.0	57.0	57.0					7																	151664434		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.103T>A	7.37:g.151664434T>A	ENSP00000376548:p.Trp35Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.W35R	ENST00000392800.2	37	c.103	CCDS5929.1	7	.	.	.	.	.	.	.	.	.	.	T	2.855	-0.237398	0.05944	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.58060	0.36;0.36	4.33	-8.67	0.00863	.	5.910290	0.00166	N	0.000002	T	0.23532	0.0569	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18777	-1.0326	10	0.24483	T	0.36	.	0.601	0.00744	0.2049:0.3017:0.186:0.3073	.	35	Q7Z4T8	GLTL5_HUMAN	R	35	ENSP00000392582:W35R;ENSP00000376548:W35R	ENSP00000376548:W35R	W	+	1	0	GALNTL5	151295367	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.252000	0.01185	-2.642000	0.00428	-1.969000	0.00466	TGG	GALNTL5	-	NULL	ENSG00000106648		0.423	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL5	HGNC	protein_coding	OTTHUMT00000348395.1	54	0.00	0	T	NM_145292		151664434	151664434	+1	no_errors	ENST00000392800	ensembl	human	known	69_37n	missense	33	29.79	14	SNP	0.000	A
GBP5	115362	genome.wustl.edu	37	1	89732107	89732107	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:89732107delC	ENST00000370459.3	-	6	917	c.790delG	c.(790-792)gtgfs	p.V264fs	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Frame_Shift_Del_p.V264fs			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	264	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		AATTCTGTCACTTGTTGCACA	0.398																																						dbGAP											0													163.0	157.0	159.0					1																	89732107		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.790delG	1.37:g.89732107delC	ENSP00000359488:p.Val264fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCE1|Q86TM5	Frame_Shift_Del	DEL	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.V264fs	ENST00000370459.3	37	c.790	CCDS722.1	1																																																																																			GBP5	-	pfam_Guanylate-bd_N	ENSG00000154451		0.398	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP5	HGNC	protein_coding	OTTHUMT00000027700.1	88	0.00	0	C	NM_052942		89732107	89732107	-1	no_errors	ENST00000343435	ensembl	human	known	69_37n	frame_shift_del	55	41.84	41	DEL	0.002	-
GBP5	115362	genome.wustl.edu	37	1	89732236	89732236	+	Frame_Shift_Del	DEL	G	G	-	rs377547796	byFrequency	TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:89732236delG	ENST00000370459.3	-	6	788	c.661delC	c.(661-663)cgtfs	p.R221fs	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Frame_Shift_Del_p.R221fs			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	221	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		ATACACAGACGGGGCAAATTG	0.343																																						dbGAP											0													98.0	101.0	100.0					1																	89732236		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.661delC	1.37:g.89732236delG	ENSP00000359488:p.Arg221fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCE1|Q86TM5	Frame_Shift_Del	DEL	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.R221fs	ENST00000370459.3	37	c.661	CCDS722.1	1																																																																																			GBP5	-	pfam_Guanylate-bd_N	ENSG00000154451		0.343	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP5	HGNC	protein_coding	OTTHUMT00000027700.1	72	0.00	0	G	NM_052942		89732236	89732236	-1	no_errors	ENST00000343435	ensembl	human	known	69_37n	frame_shift_del	37	44.78	30	DEL	0.954	-
GCN1L1	10985	genome.wustl.edu	37	12	120602277	120602277	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr12:120602277C>T	ENST00000300648.6	-	18	1723	c.1711G>A	c.(1711-1713)Gcg>Acg	p.A571T		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	571					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGAGCACCGCCACCAGAGCC	0.642																																						dbGAP											0													43.0	48.0	46.0					12																	120602277		1990	4149	6139	-	-	-	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.1711G>A	12.37:g.120602277C>T	ENSP00000300648:p.Ala571Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A571T	ENST00000300648.6	37	c.1711	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665015	0.47572	.	.	ENSG00000089154	ENST00000300648	T	0.04706	3.57	5.83	5.83	0.93111	Armadillo-like helical (1);Domain of unknown function DUF3554 (1);Armadillo-type fold (1);	0.372393	0.30781	N	0.008892	T	0.06781	0.0173	L	0.54323	1.7	0.43317	D	0.99533	B	0.31351	0.32	B	0.30716	0.119	T	0.36261	-0.9755	10	0.23891	T	0.37	.	13.3273	0.60467	0.0:0.9283:0.0:0.0717	.	571	Q92616	GCN1L_HUMAN	T	571	ENSP00000300648:A571T	ENSP00000300648:A571T	A	-	1	0	GCN1L1	119086660	0.998000	0.40836	0.997000	0.53966	0.880000	0.50808	2.852000	0.48310	2.769000	0.95229	0.655000	0.94253	GCG	GCN1L1	-	pfam_DUF3554,superfamily_ARM-type_fold	ENSG00000089154		0.642	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	26	0.00	0	C			120602277	120602277	-1	no_errors	ENST00000300648	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.880	T
GPATCH8	23131	genome.wustl.edu	37	17	42483296	42483296	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:42483296C>A	ENST00000591680.1	-	7	646	c.616G>T	c.(616-618)Gct>Tct	p.A206S	GPATCH8_ENST00000434000.1_Missense_Mutation_p.A128S	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	206							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CACCATTCAGCTTGTTTTCTT	0.338																																						dbGAP											0													78.0	81.0	80.0					17																	42483296		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.616G>T	17.37:g.42483296C>A	ENSP00000467556:p.Ala206Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_Znf_C2H2_jaz,smart_G_patch_dom,pfscan_Znf_C2H2,pfscan_G_patch_dom	p.A206S	ENST00000591680.1	37	c.616	CCDS32666.1	17	.	.	.	.	.	.	.	.	.	.	C	4.919	0.170825	0.09391	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.19938	2.11	5.49	5.49	0.81192	.	0.390912	0.25247	N	0.032041	T	0.11495	0.0280	N	0.17082	0.46	0.33526	D	0.593029	B	0.34015	0.435	B	0.29598	0.104	T	0.05886	-1.0858	10	0.06099	T	0.92	-11.5809	15.2448	0.73499	0.0:0.8192:0.1808:0.0	.	206	Q9UKJ3	GPTC8_HUMAN	S	206;128	ENSP00000395016:A128S	ENSP00000335486:A206S	A	-	1	0	GPATCH8	39838822	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.028000	0.30128	2.582000	0.87167	0.655000	0.94253	GCT	GPATCH8	-	NULL	ENSG00000186566		0.338	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH8	HGNC	protein_coding	OTTHUMT00000457797.1	54	0.00	0	C	NM_001002909		42483296	42483296	-1	no_errors	ENST00000591680	ensembl	human	known	69_37n	missense	13	75.47	40	SNP	0.993	A
GPR158	57512	genome.wustl.edu	37	10	25887795	25887795	+	Silent	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr10:25887795C>G	ENST00000376351.3	+	11	3599	c.3240C>G	c.(3238-3240)tcC>tcG	p.S1080S	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1080					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AAGGCCAGTCCATTTTGGAAG	0.498																																						dbGAP											0													93.0	96.0	95.0					10																	25887795		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3240C>G	10.37:g.25887795C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6QR81|Q9ULT3	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.S1080	ENST00000376351.3	37	c.3240	CCDS31166.1	10																																																																																			GPR158	-	NULL	ENSG00000151025		0.498	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	27	0.00	0	C	XM_166110		25887795	25887795	+1	no_errors	ENST00000376351	ensembl	human	known	69_37n	silent	48	14.29	8	SNP	0.000	G
GRAMD1B	57476	genome.wustl.edu	37	11	123489814	123489814	+	Splice_Site	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:123489814G>A	ENST00000529750.1	+	19	2336		c.e19-1		GRAMD1B_ENST00000456860.2_Splice_Site|GRAMD1B_ENST00000450171.2_Splice_Site|GRAMD1B_ENST00000322282.7_Splice_Site	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B							integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CTACCCCACAGGTTACCCCAG	0.522																																						dbGAP											0													40.0	37.0	38.0					11																	123489814		1879	4082	5961	-	-	-	SO:0001630	splice_region_variant	0			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.2010-1G>A	11.37:g.123489814G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW85|Q9ULL9	Splice_Site	SNP	-	e19-1	ENST00000529750.1	37	c.2010-1	CCDS53720.1	11	.	.	.	.	.	.	.	.	.	.	G	18.31	3.596312	0.66332	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000450171	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3972	0.83613	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRAMD1B	122995024	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.716000	0.74702	2.363000	0.80096	0.561000	0.74099	.	GRAMD1B	-	-	ENSG00000023171		0.522	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	27	0.00	0	G	XM_370660	Intron	123489814	123489814	+1	no_errors	ENST00000322282	ensembl	human	known	69_37n	splice_site	3	89.66	26	SNP	1.000	A
GRHL1	29841	genome.wustl.edu	37	2	10130840	10130840	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:10130840T>C	ENST00000324907.9	+	10	1422	c.1286T>C	c.(1285-1287)aTc>aCc	p.I429T	GRHL1_ENST00000324883.5_Missense_Mutation_p.I240T|GRHL1_ENST00000405379.2_Missense_Mutation_p.I429T	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	429					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GAGCGGAAAATCAGGGATGAA	0.418																																						dbGAP											0													102.0	87.0	92.0					2																	10130840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1286T>C	2.37:g.10130840T>C	ENSP00000324693:p.Ile429Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	pfam_CP2	p.I429T	ENST00000324907.9	37	c.1286	CCDS33144.2	2	.	.	.	.	.	.	.	.	.	.	T	9.640	1.138834	0.21123	.	.	ENSG00000134317	ENST00000405379;ENST00000324883;ENST00000324907	T;T;T	0.17054	2.3;2.3;2.3	5.76	4.6	0.57074	CP2 transcription factor (1);	0.097319	0.64402	D	0.000002	T	0.29749	0.0743	L	0.41492	1.28	0.58432	D	0.999992	D;D	0.89917	0.992;1.0	D;D	0.79108	0.951;0.992	T	0.01382	-1.1369	10	0.27785	T	0.31	-10.2173	11.8166	0.52214	0.0:0.0686:0.0:0.9314	.	240;429	Q9NZI5-2;Q9NZI5	.;GRHL1_HUMAN	T	429;240;429	ENSP00000384209:I429T;ENSP00000324494:I240T;ENSP00000324693:I429T	ENSP00000324494:I240T	I	+	2	0	GRHL1	10048291	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	7.244000	0.78228	0.999000	0.39023	-0.441000	0.05720	ATC	GRHL1	-	pfam_CP2	ENSG00000134317		0.418	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL1	HGNC	protein_coding	OTTHUMT00000323543.2	55	0.00	0	T	NM_014552		10130840	10130840	+1	no_errors	ENST00000324907	ensembl	human	known	69_37n	missense	8	70.37	19	SNP	1.000	C
GRIA1	2890	genome.wustl.edu	37	5	153149761	153149761	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:153149761A>G	ENST00000285900.5	+	13	2399	c.2056A>G	c.(2056-2058)Aca>Gca	p.T686A	GRIA1_ENST00000518142.1_Missense_Mutation_p.T606A|GRIA1_ENST00000521843.2_Missense_Mutation_p.T617A|GRIA1_ENST00000340592.5_Missense_Mutation_p.T686A|GRIA1_ENST00000448073.4_Missense_Mutation_p.T696A|GRIA1_ENST00000518783.1_Missense_Mutation_p.T696A	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	686					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GAAGATGTGGACATACATGAA	0.468																																						dbGAP											0													155.0	147.0	150.0					5																	153149761		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2056A>G	5.37:g.153149761A>G	ENSP00000285900:p.Thr686Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T696A	ENST00000285900.5	37	c.2086	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	A	6.931	0.541479	0.13250	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.41	5.41	0.78517	Ionotropic glutamate receptor (2);	0.098063	0.64402	D	0.000001	T	0.20251	0.0487	N	0.03903	-0.33	0.47511	D	0.999446	B;B;B;B;B	0.31256	0.316;0.316;0.0;0.27;0.004	B;B;B;B;B	0.39419	0.299;0.299;0.003;0.198;0.015	T	0.11792	-1.0573	10	0.06757	T	0.87	.	14.6134	0.68531	1.0:0.0:0.0:0.0	.	696;696;606;686;686	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	A	686;686;606;640;686;619;617;696;696	ENSP00000285900:T686A;ENSP00000427920:T606A;ENSP00000339343:T686A;ENSP00000427864:T619A;ENSP00000442108:T617A;ENSP00000428994:T696A;ENSP00000415569:T696A	ENSP00000285900:T686A	T	+	1	0	GRIA1	153129954	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.871000	0.56077	2.042000	0.60477	0.533000	0.62120	ACA	GRIA1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000155511		0.468	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	66	0.00	0	A			153149761	153149761	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	G
GRIA4	2893	genome.wustl.edu	37	11	105845179	105845179	+	Intron	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:105845179A>G	ENST00000530497.1	+	15	2544				GRIA4_ENST00000525187.1_Missense_Mutation_p.K851R|GRIA4_ENST00000533094.1_3'UTR|RNU6-277P_ENST00000516272.1_RNA|GRIA4_ENST00000282499.5_Intron|GRIA4_ENST00000393127.2_Missense_Mutation_p.K851R			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		AAGGTGGCAAAGAGTGCACAG	0.438																																						dbGAP											0													141.0	131.0	134.0					11																	105845179		2201	4299	6500	-	-	-	SO:0001627	intron_variant	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2544+8A>G	11.37:g.105845179A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XE8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K851R	ENST00000530497.1	37	c.2552	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	A	14.33	2.503791	0.44558	.	.	ENSG00000152578	ENST00000393127;ENST00000525187	T;T	0.12465	2.68;2.68	5.83	5.83	0.93111	.	.	.	.	.	T	0.17704	0.0425	L	0.37630	1.12	0.09310	N	0.999999	B	0.32101	0.356	B	0.39562	0.303	T	0.19192	-1.0313	9	0.38643	T	0.18	.	16.1968	0.82036	1.0:0.0:0.0:0.0	.	851	G3V164	.	R	851	ENSP00000376835:K851R;ENSP00000432180:K851R	ENSP00000376835:K851R	K	+	2	0	GRIA4	105350389	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	2.734000	0.47368	2.225000	0.72522	0.533000	0.62120	AAG	GRIA4	-	NULL	ENSG00000152578		0.438	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	86	0.00	0	A			105845179	105845179	+1	no_errors	ENST00000393127	ensembl	human	known	69_37n	missense	31	56.34	40	SNP	0.999	G
GYS2	2998	genome.wustl.edu	37	12	21693464	21693464	+	Silent	SNP	A	A	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr12:21693464A>C	ENST00000261195.2	-	14	1943	c.1689T>G	c.(1687-1689)tcT>tcG	p.S563S		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	563					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GCTGATTGCAAGAATCATCTG	0.428																																					Colon(149;9 1820 3690 10544 50424)	dbGAP											0													118.0	119.0	119.0					12																	21693464		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1689T>G	12.37:g.21693464A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVD8	Silent	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1	p.S563	ENST00000261195.2	37	c.1689	CCDS8690.1	12																																																																																			GYS2	-	pfam_Glycogen_synth,pfam_Glyco_trans_1	ENSG00000111713		0.428	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS2	HGNC	protein_coding	OTTHUMT00000402396.1	51	0.00	0	A	NM_021957		21693464	21693464	-1	no_errors	ENST00000261195	ensembl	human	known	69_37n	silent	32	20.00	8	SNP	0.892	C
HDAC9	9734	genome.wustl.edu	37	7	18767317	18767317	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr7:18767317C>T	ENST00000432645.2	+	12	1837	c.1837C>T	c.(1837-1839)Cct>Tct	p.P613S	HDAC9_ENST00000401921.1_Missense_Mutation_p.P572S|HDAC9_ENST00000406451.4_Missense_Mutation_p.P613S|HDAC9_ENST00000441542.2_Missense_Mutation_p.P616S	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	613					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	TCACTCTTCCCCTGCTGCCTC	0.582																																						dbGAP											0													53.0	59.0	57.0					7																	18767317		2021	4179	6200	-	-	-	SO:0001583	missense	0			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1837C>T	7.37:g.18767317C>T	ENSP00000410337:p.Pro613Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.P616S	ENST00000432645.2	37	c.1846	CCDS47555.1	7	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072560	0.76415	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.68903	-0.33;-0.36;-0.36;-0.34	5.64	4.74	0.60224	.	0.000000	0.56097	D	0.000035	T	0.80088	0.4559	M	0.82823	2.61	0.80722	D	1	D;D;D;D;P;D;P	0.61697	0.978;0.99;0.971;0.971;0.952;0.971;0.952	P;P;P;P;P;P;P	0.59487	0.844;0.858;0.696;0.696;0.5;0.696;0.5	T	0.82934	-0.0211	10	0.87932	D	0	-33.6907	14.3372	0.66600	0.0:0.9287:0.0:0.0713	.	613;525;572;616;613;613;591	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	S	613;572;613;616;525	ENSP00000384657:P613S;ENSP00000383912:P572S;ENSP00000410337:P613S;ENSP00000408617:P616S	ENSP00000339165:P525S	P	+	1	0	HDAC9	18733842	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.040000	0.57333	2.812000	0.96745	0.557000	0.71058	CCT	HDAC9	-	pirsf_Histone_deAcase_II_euk	ENSG00000048052		0.582	HDAC9-023	KNOWN	basic|CCDS	protein_coding	HDAC9	HGNC	protein_coding	OTTHUMT00000376176.1	39	0.00	0	C			18767317	18767317	+1	no_errors	ENST00000441542	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	T
HIST1H2BH	8345	genome.wustl.edu	37	6	26252226	26252226	+	Silent	SNP	T	T	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:26252226T>G	ENST00000356350.2	+	1	348	c.348T>G	c.(346-348)acT>acG	p.T116T	HIST1H3F_ENST00000446824.2_5'Flank	NM_003524.2	NP_003515.1	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	116					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(3)|breast(2)|large_intestine(1)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	17						CCGAGGGCACTAAGGCCGTCA	0.512																																						dbGAP											0													63.0	67.0	65.0					6																	26252226		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z80781	CCDS4601.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000197459	ENSG00000275713		"""Histones / Replication-dependent"""	4755	protein-coding gene	gene with protein product		602806	"""H2B histone family, member J"", ""histone 1, H2bh"""	H2BFJ		9119399, 12408966	Standard	NM_003524		Approved	H2B/j	uc003nhh.3	Q93079	OTTHUMG00000014447	ENST00000356350.2:c.348T>G	6.37:g.26252226T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R541|Q4VB74	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.T116	ENST00000356350.2	37	c.348	CCDS4601.1	6																																																																																			HIST1H2BH	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000197459		0.512	HIST1H2BH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BH	HGNC	protein_coding	OTTHUMT00000040110.1	36	0.00	0	T	NM_003524		26252226	26252226	+1	no_errors	ENST00000356350	ensembl	human	known	69_37n	silent	43	21.82	12	SNP	1.000	G
HMGCS1	3157	genome.wustl.edu	37	5	43297126	43297126	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:43297126C>A	ENST00000325110.6	-	5	923	c.717G>T	c.(715-717)aaG>aaT	p.K239N	HMGCS1_ENST00000433297.2_Missense_Mutation_p.K239N	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	239					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						GGGCATGGATCTTTTTGCAGT	0.418																																						dbGAP											0													157.0	156.0	157.0					5																	43297126		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.717G>T	5.37:g.43297126C>A	ENSP00000322706:p.Lys239Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDL8	Missense_Mutation	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.K239N	ENST00000325110.6	37	c.717	CCDS34154.1	5	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301588	0.81136	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275	D;D	0.82711	-1.64;-1.64	5.96	5.1	0.69264	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.90885	0.7136	M	0.88377	2.95	0.80722	D	1	D	0.76494	0.999	D	0.69654	0.965	D	0.91536	0.5246	10	0.72032	D	0.01	-27.5824	9.3538	0.38153	0.0:0.7753:0.0:0.2247	.	239	Q01581	HMCS1_HUMAN	N	239;239;228	ENSP00000322706:K239N;ENSP00000399402:K239N	ENSP00000322706:K239N	K	-	3	2	HMGCS1	43332883	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.341000	0.33907	1.526000	0.49068	0.655000	0.94253	AAG	HMGCS1	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	ENSG00000112972		0.418	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS1	HGNC	protein_coding	OTTHUMT00000368022.1	87	0.00	0	C			43297126	43297126	-1	no_errors	ENST00000325110	ensembl	human	known	69_37n	missense	28	30.00	12	SNP	1.000	A
IGSF10	285313	genome.wustl.edu	37	3	151166527	151166527	+	Silent	SNP	A	A	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:151166527A>T	ENST00000282466.3	-	4	1241	c.1242T>A	c.(1240-1242)atT>atA	p.I414I		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	414					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGTTGGTAAAAATGTCTTCAG	0.433																																						dbGAP											0													96.0	90.0	92.0					3																	151166527		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.1242T>A	3.37:g.151166527A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.I414	ENST00000282466.3	37	c.1242	CCDS3160.1	3																																																																																			IGSF10	-	NULL	ENSG00000152580		0.433	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	81	0.00	0	A	NM_178822		151166527	151166527	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	silent	130	13.33	20	SNP	0.979	T
IL6ST	3572	genome.wustl.edu	37	5	55264182	55264182	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:55264182T>G	ENST00000381298.2	-	5	725	c.413A>C	c.(412-414)gAg>gCg	p.E138A	IL6ST_ENST00000577363.1_Intron|IL6ST_ENST00000396816.1_Intron|IL6ST_ENST00000522633.2_Missense_Mutation_p.E138A|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000381294.3_Missense_Mutation_p.E138A|IL6ST_ENST00000536319.1_Missense_Mutation_p.E138A|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000381287.4_Missense_Mutation_p.E138A|IL6ST_ENST00000502326.3_Missense_Mutation_p.E138A|IL6ST_ENST00000336909.5_Missense_Mutation_p.E138A	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	138	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TTTCTTCCCCTCGTTCACAAT	0.348			O		hepatocellular ca																																	dbGAP		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													135.0	132.0	133.0					5																	55264182		2202	4300	6502	-	-	-	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.413A>C	5.37:g.55264182T>G	ENSP00000370698:p.Glu138Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E138A	ENST00000381298.2	37	c.413	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	T	15.67	2.902402	0.52227	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294;ENST00000381287;ENST00000536319;ENST00000522633;ENST00000542298	T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08	5.76	3.37	0.38596	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.348037	0.34411	N	0.003994	T	0.47340	0.1440	M	0.65498	2.005	0.26963	N	0.965758	B;P;P	0.40197	0.451;0.653;0.706	B;P;P	0.49301	0.429;0.535;0.606	T	0.33033	-0.9884	10	0.35671	T	0.21	.	6.8741	0.24137	0.1146:0.1319:0.0:0.7534	.	138;138;138	Q5FC04;P40189-2;P40189	.;.;IL6RB_HUMAN	A	138	ENSP00000370698:E138A;ENSP00000338799:E138A;ENSP00000370694:E138A;ENSP00000370687:E138A;ENSP00000444456:E138A;ENSP00000435399:E138A	ENSP00000338799:E138A	E	-	2	0	IL6ST	55299939	0.990000	0.36364	0.664000	0.29753	0.873000	0.50193	2.586000	0.46119	1.120000	0.41904	0.528000	0.53228	GAG	IL6ST	-	pfam_IL6_recept-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000134352		0.348	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	107	0.00	0	T	NM_002184		55264182	55264182	-1	no_errors	ENST00000336909	ensembl	human	known	69_37n	missense	30	55.22	37	SNP	0.311	G
INSR	3643	genome.wustl.edu	37	19	7152746	7152746	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr19:7152746delA	ENST00000302850.5	-	10	2364	c.2222delT	c.(2221-2223)ttcfs	p.F741fs	INSR_ENST00000341500.5_Frame_Shift_Del_p.F741fs	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	741	Insulin-binding.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CCTGGGGACGAAAACCACGTT	0.537																																						dbGAP											0													187.0	168.0	174.0					19																	7152746		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2222delT	19.37:g.7152746delA	ENSP00000303830:p.Phe741fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.F741fs	ENST00000302850.5	37	c.2222	CCDS12176.1	19																																																																																			INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000171105		0.537	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	42	0.00	0	A			7152746	7152746	-1	no_errors	ENST00000302850	ensembl	human	known	69_37n	frame_shift_del	20	16.67	4	DEL	0.988	-
IVNS1ABP	10625	genome.wustl.edu	37	1	185276629	185276629	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:185276629T>A	ENST00000367498.3	-	6	1145	c.523A>T	c.(523-525)Agg>Tgg	p.R175W	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_De_novo_Start_OutOfFrame	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	175	BACK.|Sufficient for AHR interaction and signaling.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						ACCTTTAGCCTTGGAAGCTTA	0.373																																						dbGAP											0													62.0	65.0	64.0					1																	185276629		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.523A>T	1.37:g.185276629T>A	ENSP00000356468:p.Arg175Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R175W	ENST00000367498.3	37	c.523	CCDS1368.1	1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271474	0.80469	.	.	ENSG00000116679	ENST00000367498;ENST00000422754	T;T	0.68903	-0.36;-0.36	5.61	1.25	0.21368	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.77671	0.4165	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75093	-0.3439	10	0.37606	T	0.19	.	15.6472	0.77063	0.0:0.0:0.3239:0.6761	.	175	Q9Y6Y0	NS1BP_HUMAN	W	175;56	ENSP00000356468:R175W;ENSP00000401826:R56W	ENSP00000356468:R175W	R	-	1	2	IVNS1ABP	183543252	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	3.668000	0.54554	-0.032000	0.13758	0.477000	0.44152	AGG	IVNS1ABP	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000116679		0.373	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	53	0.00	0	T	NM_006469		185276629	185276629	-1	no_errors	ENST00000367498	ensembl	human	known	69_37n	missense	33	36.54	19	SNP	1.000	A
KANK1	23189	genome.wustl.edu	37	9	742357	742357	+	Silent	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr9:742357C>T	ENST00000382303.1	+	14	4501	c.3849C>T	c.(3847-3849)gtC>gtT	p.V1283V	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Silent_p.V1283V|KANK1_ENST00000382293.3_Silent_p.V1125V	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1283	Interaction with KIF21A.				negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TGGAGATTGTCAAGCTGCTGC	0.632																																						dbGAP											0													63.0	62.0	62.0					9																	742357		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3849C>T	9.37:g.742357C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V1283	ENST00000382303.1	37	c.3849	CCDS34976.1	9																																																																																			KANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000107104		0.632	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	23	0.00	0	C	NM_015158		742357	742357	+1	no_errors	ENST00000382297	ensembl	human	known	69_37n	silent	20	23.08	6	SNP	0.997	T
KCNA7	3743	genome.wustl.edu	37	19	49573516	49573516	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr19:49573516A>C	ENST00000221444.1	-	2	1530	c.1175T>G	c.(1174-1176)gTc>gGc	p.V392G		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	392					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GGAGACAATGACGGGCACTGG	0.567																																					Colon(74;686 1235 3793 23366 48562)	dbGAP											0													72.0	65.0	68.0					19																	49573516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.1175T>G	19.37:g.49573516A>C	ENSP00000221444:p.Val392Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KYX7|Q9BYS4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1	p.V392G	ENST00000221444.1	37	c.1175	CCDS12755.1	19	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155440	0.78114	.	.	ENSG00000104848	ENST00000221444	D	0.99113	-5.44	4.65	4.65	0.58169	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99459	0.9808	H	0.95950	3.745	0.80722	D	1	D	0.64830	0.994	D	0.69479	0.964	D	0.98308	1.0522	10	0.87932	D	0	.	13.3495	0.60593	1.0:0.0:0.0:0.0	.	392	Q96RP8	KCNA7_HUMAN	G	392	ENSP00000221444:V392G	ENSP00000221444:V392G	V	-	2	0	KCNA7	54265328	1.000000	0.71417	0.989000	0.46669	0.953000	0.61014	9.332000	0.96446	1.880000	0.54463	0.402000	0.26972	GTC	KCNA7	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl,prints_K_chnl_volt-dep_Kv	ENSG00000104848		0.567	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA7	HGNC	protein_coding	OTTHUMT00000466263.1	24	0.00	0	A	NM_031886		49573516	49573516	-1	no_errors	ENST00000221444	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	C
KCNG3	170850	genome.wustl.edu	37	2	42671481	42671481	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:42671481G>A	ENST00000306078.1	-	2	1499	c.904C>T	c.(904-906)Ctt>Ttt	p.L302F	KCNG3_ENST00000394973.4_Missense_Mutation_p.L291F	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	302					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						TGACGGGCAAGCTTAATCACC	0.458																																						dbGAP											0													107.0	100.0	102.0					2																	42671481		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.904C>T	2.37:g.42671481G>A	ENSP00000304127:p.Leu302Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.L302F	ENST00000306078.1	37	c.904	CCDS1809.1	2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259990	0.80246	.	.	ENSG00000171126	ENST00000306078;ENST00000394973	D;D	0.99005	-5.32;-5.32	5.22	5.22	0.72569	Ion transport (1);	0.072325	0.64402	D	0.000020	D	0.99348	0.9771	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	D	0.99164	1.0862	10	0.87932	D	0	.	18.8074	0.92043	0.0:0.0:1.0:0.0	.	302;291	Q8TAE7;Q8TAE7-2	KCNG3_HUMAN;.	F	302;291	ENSP00000304127:L302F;ENSP00000378424:L291F	ENSP00000304127:L302F	L	-	1	0	KCNG3	42524985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.611000	0.98342	2.434000	0.82447	0.563000	0.77884	CTT	KCNG3	-	pfam_Ion_trans_dom,prints_K_chnl,prints_K_chnl_volt-dep_Kv	ENSG00000171126		0.458	KCNG3-001	KNOWN	basic|CCDS	protein_coding	KCNG3	HGNC	protein_coding	OTTHUMT00000250464.2	33	0.00	0	G	NM_172344		42671481	42671481	-1	no_errors	ENST00000306078	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	1.000	A
KCNJ11	3767	genome.wustl.edu	37	11	17408655	17408655	+	Silent	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:17408655C>T	ENST00000339994.4	-	1	1551	c.984G>A	c.(982-984)gtG>gtA	p.V328V	KCNJ11_ENST00000526747.1_5'Flank|KCNJ11_ENST00000528731.1_Silent_p.V241V	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	328					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	TGGAGTAGTCCACAGAGTAAC	0.607											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													178.0	154.0	162.0					11																	17408655		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.984G>A	11.37:g.17408655C>T		Somatic	717	WXS	Illumina GAIIx	Phase_IV	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Silent	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir6.2	p.V328	ENST00000339994.4	37	c.984	CCDS31436.1	11																																																																																			KCNJ11	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000187486		0.607	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ11	HGNC	protein_coding	OTTHUMT00000387037.1	53	0.00	0	C	NM_000525		17408655	17408655	-1	no_errors	ENST00000339994	ensembl	human	known	69_37n	silent	24	42.86	18	SNP	1.000	T
KCNJ16	3773	genome.wustl.edu	37	17	68128271	68128271	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:68128271G>T	ENST00000589377.1	+	2	206	c.43G>T	c.(43-45)Gca>Tca	p.A15S	KCNJ16_ENST00000283936.1_Missense_Mutation_p.A15S|KCNJ16_ENST00000586462.1_Missense_Mutation_p.A54S|KCNJ16_ENST00000392671.1_Missense_Mutation_p.A15S|KCNJ16_ENST00000392670.1_Missense_Mutation_p.A15S|KCNJ16_ENST00000585558.1_Missense_Mutation_p.A50S	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	15					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					CAATGCGGACGCAAAATACCC	0.433																																						dbGAP											0													84.0	79.0	80.0					17																	68128271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.43G>T	17.37:g.68128271G>T	ENSP00000465967:p.Ala15Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir5,prints_K_chnl_inward-rec_Kir_Cr2	p.A15S	ENST00000589377.1	37	c.43	CCDS11687.1	17	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.865300	0.00547	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.88354	-2.37;-2.37;-2.37	5.99	-11.4	0.00090	.	1.333100	0.04443	N	0.371284	T	0.64681	0.2620	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.57888	-0.7733	9	.	.	.	.	1.3728	0.02214	0.2023:0.3428:0.1497:0.3052	.	15;15	A8K434;Q9NPI9	.;IRK16_HUMAN	S	15	ENSP00000283936:A15S;ENSP00000376439:A15S;ENSP00000376438:A15S	.	A	+	1	0	KCNJ16	65639866	0.000000	0.05858	0.010000	0.14722	0.000000	0.00434	-1.345000	0.02637	-2.190000	0.00757	-3.711000	0.00023	GCA	KCNJ16	-	pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir5	ENSG00000153822		0.433	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ16	HGNC	protein_coding	OTTHUMT00000450880.1	48	0.00	0	G	NM_018658		68128271	68128271	+1	no_errors	ENST00000283936	ensembl	human	known	69_37n	missense	8	77.78	28	SNP	0.024	T
KHDC3L	154288	genome.wustl.edu	37	6	74073327	74073327	+	Missense_Mutation	SNP	C	C	A	rs151102141		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:74073327C>A	ENST00000370367.3	+	3	451	c.398C>A	c.(397-399)aCc>aAc	p.T133N		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	133							RNA binding (GO:0003723)										AAGGCCGAGACCCAGCGGTCT	0.642																																						dbGAP											0													32.0	38.0	36.0					6																	74073327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.398C>A	6.37:g.74073327C>A	ENSP00000359392:p.Thr133Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNW7	Missense_Mutation	SNP	NULL	p.T133N	ENST00000370367.3	37	c.398	CCDS34484.1	6	.	.	.	.	.	.	.	.	.	.	C	10.77	1.445308	0.25987	.	.	ENSG00000203908	ENST00000370367	T	0.55588	0.51	2.58	-0.42	0.12336	.	0.786356	0.10782	N	0.634755	T	0.26484	0.0647	L	0.52573	1.65	0.09310	N	1	P	0.36909	0.573	B	0.41894	0.369	T	0.30794	-0.9966	10	0.56958	D	0.05	.	3.1563	0.06505	0.0:0.4883:0.2276:0.2841	.	133	Q587J8	ECAT1_HUMAN	N	133	ENSP00000359392:T133N	ENSP00000359392:T133N	T	+	2	0	C6orf221	74130048	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.115000	0.10741	-0.097000	0.12307	-0.122000	0.15005	ACC	KHDC3L	-	NULL	ENSG00000203908		0.642	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDC3L	HGNC	protein_coding	OTTHUMT00000041202.3	22	0.00	0	C	NM_001017361		74073327	74073327	+1	no_errors	ENST00000370367	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.000	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46047942	46047942	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr21:46047942C>G	ENST00000397911.3	+	1	903	c.854C>G	c.(853-855)tCc>tGc	p.S285C	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	285						keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						TACAGCTTCTCCTCAGGCCAG	0.701																																						dbGAP											0													55.0	69.0	64.0					21																	46047942		2175	4282	6457	-	-	-	SO:0001583	missense	0			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.854C>G	21.37:g.46047942C>G	ENSP00000381009:p.Ser285Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	NULL	p.S285C	ENST00000397911.3	37	c.854	CCDS42961.1	21	.	.	.	.	.	.	.	.	.	.	c	7.582	0.668964	0.14776	.	.	ENSG00000221837	ENST00000397911	T	0.00776	5.71	2.29	2.29	0.28610	.	.	.	.	.	T	0.01592	0.0051	N	0.19112	0.55	0.09310	N	0.999997	D	0.76494	0.999	D	0.70227	0.968	T	0.61019	-0.7147	8	.	.	.	.	10.657	0.45680	0.0:1.0:0.0:0.0	.	285	P60411	KR109_HUMAN	C	285	ENSP00000381009:S285C	.	S	+	2	0	KRTAP10-9	44872370	0.009000	0.17119	0.028000	0.17463	0.026000	0.11368	0.890000	0.28295	1.197000	0.43143	0.462000	0.41574	TCC	KRTAP10-9	-	NULL	ENSG00000221837		0.701	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	37	0.00	0	C			46047942	46047942	+1	no_errors	ENST00000397911	ensembl	human	known	69_37n	missense	23	45.24	19	SNP	0.455	G
L3MBTL3	84456	genome.wustl.edu	37	6	130381217	130381217	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:130381217G>T	ENST00000529410.1	+	12	1275	c.796G>T	c.(796-798)Gtt>Ttt	p.V266F	L3MBTL3_ENST00000533560.1_Missense_Mutation_p.V241F|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.V241F|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.V266F|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.V266F|L3MBTL3_ENST00000526019.1_Missense_Mutation_p.V241F			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	266					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		TGGATTCAAAGTTGGCATGAA	0.388																																						dbGAP											0													118.0	106.0	110.0					6																	130381217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.796G>T	6.37:g.130381217G>T	ENSP00000431962:p.Val266Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.V266F	ENST00000529410.1	37	c.796	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352897	0.61293	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	5.27	5.27	0.74061	.	0.120055	0.56097	D	0.000030	T	0.80909	0.4714	M	0.62723	1.935	0.53005	D	0.999963	P;B	0.43024	0.798;0.451	B;B	0.35931	0.168;0.214	T	0.82396	-0.0478	10	0.38643	T	0.18	.	19.2567	0.93948	0.0:0.0:1.0:0.0	.	241;266	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	F	266;241;266;241;241;266	ENSP00000431962:V266F;ENSP00000437185:V241F;ENSP00000354526:V266F;ENSP00000357121:V241F;ENSP00000436706:V241F;ENSP00000357118:V266F	ENSP00000354526:V266F	V	+	1	0	L3MBTL3	130422910	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.672000	0.61597	2.625000	0.88918	0.455000	0.32223	GTT	L3MBTL3	-	smart_Mbt,pfscan_Mbt	ENSG00000198945		0.388	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	73	0.00	0	G	XM_027074		130381217	130381217	+1	no_errors	ENST00000361794	ensembl	human	known	69_37n	missense	66	19.51	16	SNP	1.000	T
LIMK2	3985	genome.wustl.edu	37	22	31658194	31658194	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr22:31658194G>T	ENST00000331728.4	+	6	740	c.626G>T	c.(625-627)gGg>gTg	p.G209V	LIMK2_ENST00000333611.4_Missense_Mutation_p.G188V|LIMK2_ENST00000406516.1_Missense_Mutation_p.G131V|LIMK2_ENST00000340552.4_Missense_Mutation_p.G188V|LIMK2_ENST00000444929.2_Intron	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	209	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						GAGATCAATGGGACCCCCGTC	0.562																																						dbGAP											0													137.0	132.0	133.0					22																	31658194		2203	4300	6503	-	-	-	SO:0001583	missense	0			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.626G>T	22.37:g.31658194G>T	ENSP00000332687:p.Gly209Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Znf_LIM,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.G209V	ENST00000331728.4	37	c.626	CCDS13891.1	22	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824087	0.71143	.	.	ENSG00000182541	ENST00000406516;ENST00000331728;ENST00000436394;ENST00000333611;ENST00000340552	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.51	4.49	0.54785	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.67163	0.2864	M	0.83483	2.645	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;1.0;0.785	D;D;D;B	0.97110	1.0;1.0;1.0;0.349	T	0.73607	-0.3929	10	0.87932	D	0	-23.6448	14.8871	0.70579	0.0:0.0:0.8557:0.1443	.	241;188;209;131	F5GY29;Q7L3H5;P53671;B5MC51	.;.;LIMK2_HUMAN;.	V	131;209;241;188;188	ENSP00000384602:G131V;ENSP00000332687:G209V;ENSP00000330470:G188V;ENSP00000339916:G188V	ENSP00000332687:G209V	G	+	2	0	LIMK2	29988194	1.000000	0.71417	0.973000	0.42090	0.583000	0.36354	9.476000	0.97823	1.314000	0.45095	0.655000	0.94253	GGG	LIMK2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000182541		0.562	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK2	HGNC	protein_coding	OTTHUMT00000321911.1	40	0.00	0	G	NM_016733		31658194	31658194	+1	no_errors	ENST00000331728	ensembl	human	known	69_37n	missense	29	30.23	13	SNP	1.000	T
LMAN2L	81562	genome.wustl.edu	37	2	97405748	97405748	+	Silent	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:97405748C>G	ENST00000264963.4	-	1	52	c.30G>C	c.(28-30)tcG>tcC	p.S10S	LMAN2L_ENST00000426463.2_5'UTR|LMAN2L_ENST00000377079.4_Silent_p.S10S|LMAN2L_ENST00000534882.1_5'UTR|LMAN2L_ENST00000537039.1_5'UTR	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	10					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						ACTGCTGCCACGACCCAAGGG	0.627																																						dbGAP											0													53.0	60.0	57.0					2																	97405748		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.30G>C	2.37:g.97405748C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Silent	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	p.S10	ENST00000264963.4	37	c.30	CCDS2023.1	2																																																																																			LMAN2L	-	NULL	ENSG00000114988		0.627	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LMAN2L	HGNC	protein_coding	OTTHUMT00000252844.1	29	0.00	0	C	NM_030805		97405748	97405748	-1	no_errors	ENST00000377079	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	1.000	G
LSM14B	149986	genome.wustl.edu	37	20	60699699	60699699	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr20:60699699C>T	ENST00000279068.6	+	2	314	c.154C>T	c.(154-156)Ccc>Tcc	p.P52S	LSM14B_ENST00000370915.1_Missense_Mutation_p.P52S|LSM14B_ENST00000253001.4_Missense_Mutation_p.P52S	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	52					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			TGAAGACCGTCCCACAGATAG	0.498											OREG0026104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													78.0	83.0	81.0					20																	60699699		1981	4162	6143	-	-	-	SO:0001583	missense	0			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.154C>T	20.37:g.60699699C>T	ENSP00000279068:p.Pro52Ser	Somatic	1048	WXS	Illumina GAIIx	Phase_IV	Q6PFW8|Q96LH8	Missense_Mutation	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.P52S	ENST00000279068.6	37	c.154	CCDS46626.1	20	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283547	0.80803	.	.	ENSG00000149657	ENST00000370915;ENST00000279068;ENST00000253001;ENST00000400318;ENST00000279069	T;T;T	0.47528	0.84;0.84;0.89	4.7	3.76	0.43208	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.114136	0.64402	D	0.000012	T	0.66157	0.2761	M	0.72894	2.215	0.58432	D	0.999999	D;D;B	0.89917	1.0;1.0;0.369	D;D;B	0.97110	0.999;1.0;0.268	T	0.69254	-0.5193	10	0.72032	D	0.01	.	12.9717	0.58515	0.0:0.9205:0.0:0.0795	.	52;52;52	Q9BX40;Q5TBQ0;Q9BX40-2	LS14B_HUMAN;.;.	S	52	ENSP00000279068:P52S;ENSP00000253001:P52S;ENSP00000383172:P52S	ENSP00000253001:P52S	P	+	1	0	LSM14B	60133094	1.000000	0.71417	0.981000	0.43875	0.942000	0.58702	5.915000	0.69973	0.935000	0.37341	0.563000	0.77884	CCC	LSM14B	-	superfamily_LSM_dom	ENSG00000149657		0.498	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM14B	HGNC	protein_coding	OTTHUMT00000079996.4	35	0.00	0	C	NM_144703		60699699	60699699	+1	no_errors	ENST00000253001	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	0.998	T
MAGEB6	158809	genome.wustl.edu	37	X	26212565	26212565	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chrX:26212565C>T	ENST00000379034.1	+	2	751	c.602C>T	c.(601-603)aCg>aTg	p.T201M		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	201	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.T201M(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						AAGGCGTGCACGTTGGCGCAA	0.483																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											83.0	70.0	75.0					X																	26212565		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.602C>T	X.37:g.26212565C>T	ENSP00000368320:p.Thr201Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GS19|Q9H219	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.T201M	ENST00000379034.1	37	c.602	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	c	0.001	-4.099939	0.00002	.	.	ENSG00000176746	ENST00000379034	T	0.01804	4.63	2.88	-5.76	0.02376	.	0.624921	0.14149	N	0.338154	T	0.00496	0.0016	N	0.00252	-1.77	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.52034	-0.8629	10	0.38643	T	0.18	.	3.784	0.08692	0.6019:0.174:0.0996:0.1246	.	201	Q8N7X4	MAGB6_HUMAN	M	201	ENSP00000368320:T201M	ENSP00000368320:T201M	T	+	2	0	MAGEB6	26122486	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.470000	0.00065	-5.416000	0.00015	-4.040000	0.00012	ACG	MAGEB6	-	pfscan_MAGE	ENSG00000176746		0.483	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	33	0.00	0	C	NM_173523		26212565	26212565	+1	no_errors	ENST00000379034	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.000	T
MARCH6	10299	genome.wustl.edu	37	5	10394874	10394874	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:10394874C>G	ENST00000274140.5	+	9	970	c.838C>G	c.(838-840)Ctt>Gtt	p.L280V	MARCH6_ENST00000503788.1_Missense_Mutation_p.L175V|MARCH6_ENST00000449913.2_Missense_Mutation_p.L232V	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	280					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						GATGCTAGGACTTGATGGATC	0.328																																						dbGAP											0													124.0	118.0	120.0					5																	10394874		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.838C>G	5.37:g.10394874C>G	ENSP00000274140:p.Leu280Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.L280V	ENST00000274140.5	37	c.838	CCDS34135.1	5	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287938	0.80803	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140	T;T;T	0.62788	1.0;-0.0;1.08	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.83229	0.5209	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.981;0.999;0.999	D	0.84882	0.0831	10	0.72032	D	0.01	-25.855	20.2441	0.98394	0.0:1.0:0.0:0.0	.	175;232;280	B4DKJ2;B4DT33;O60337	.;.;MARH6_HUMAN	V	232;175;280	ENSP00000414643:L232V;ENSP00000425930:L175V;ENSP00000274140:L280V	ENSP00000274140:L280V	L	+	1	0	MARCH6	10447874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.264000	0.58859	2.774000	0.95407	0.655000	0.94253	CTT	MARCH6	-	NULL	ENSG00000145495		0.328	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	HGNC	protein_coding	OTTHUMT00000366919.2	127	0.00	0	C	NM_005885		10394874	10394874	+1	no_errors	ENST00000274140	ensembl	human	known	69_37n	missense	107	24.65	35	SNP	1.000	G
MASP1	5648	genome.wustl.edu	37	3	186969491	186969491	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:186969491delG	ENST00000337774.5	-	7	1331	c.942delC	c.(940-942)cccfs	p.P314fs	MASP1_ENST00000296280.6_Frame_Shift_Del_p.P314fs|MASP1_ENST00000169293.6_Frame_Shift_Del_p.P314fs|MASP1_ENST00000392472.2_Frame_Shift_Del_p.P201fs|MASP1_ENST00000392470.2_Frame_Shift_Del_p.P288fs|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	314	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGGCTTGGGAGGGCTCGATTT	0.512																																						dbGAP											0													136.0	126.0	130.0					3																	186969491		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.942delC	3.37:g.186969491delG	ENSP00000336792:p.Pro314fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Frame_Shift_Del	DEL	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.S315fs	ENST00000337774.5	37	c.942	CCDS33907.1	3																																																																																			MASP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000127241		0.512	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	54	0.00	0	G	NM_001879		186969491	186969491	-1	no_errors	ENST00000296280	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.073	-
METTL3	56339	genome.wustl.edu	37	14	21968764	21968764	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr14:21968764T>C	ENST00000298717.4	-	6	1328	c.1177A>G	c.(1177-1179)Atg>Gtg	p.M393V		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	393					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		GGGTCAGCCATCACAACTGCA	0.488																																						dbGAP											0													164.0	133.0	143.0					14																	21968764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1177A>G	14.37:g.21968764T>C	ENSP00000298717:p.Met393Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.M393V	ENST00000298717.4	37	c.1177	CCDS32044.1	14	.	.	.	.	.	.	.	.	.	.	T	22.6	4.306932	0.81247	.	.	ENSG00000165819	ENST00000298717	T	0.36699	1.24	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.52092	0.1713	L	0.58969	1.84	0.80722	D	1	P	0.41597	0.756	P	0.55615	0.78	T	0.52480	-0.8570	10	0.59425	D	0.04	-15.3772	14.2804	0.66208	0.0:0.0:0.0:1.0	.	393	Q86U44	MTA70_HUMAN	V	393	ENSP00000298717:M393V	ENSP00000298717:M393V	M	-	1	0	METTL3	21038604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.341000	0.79300	2.210000	0.71456	0.482000	0.46254	ATG	METTL3	-	pfam_MT-A70-like,pfscan_MT-A70-like	ENSG00000165819		0.488	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL3	HGNC	protein_coding	OTTHUMT00000401227.1	43	0.00	0	T	NM_019852		21968764	21968764	-1	no_errors	ENST00000298717	ensembl	human	known	69_37n	missense	26	35.00	14	SNP	1.000	C
MFF	56947	genome.wustl.edu	37	2	228217280	228217280	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:228217280A>G	ENST00000353339.3	+	9	1244	c.803A>G	c.(802-804)gAc>gGc	p.D268G	MFF_ENST00000304593.9_Missense_Mutation_p.D217G|MFF_ENST00000349901.7_Missense_Mutation_p.D164G|MFF_ENST00000409616.1_Missense_Mutation_p.D164G|MFF_ENST00000392059.1_Missense_Mutation_p.D268G|MFF_ENST00000409565.1_Intron|MFF_ENST00000524634.1_Intron|MFF_ENST00000476924.1_Intron|MFF_ENST00000354503.6_Intron|MFF_ENST00000337110.7_Intron	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	268					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						CCTCATCATGACAACGTCAGG	0.488																																						dbGAP											0													127.0	111.0	116.0					2																	228217280		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.803A>G	2.37:g.228217280A>G	ENSP00000302037:p.Asp268Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.D268G	ENST00000353339.3	37	c.803	CCDS2465.1	2	.	.	.	.	.	.	.	.	.	.	A	26.4	4.738259	0.89573	.	.	ENSG00000168958	ENST00000304593;ENST00000353339;ENST00000409616;ENST00000349901;ENST00000392059	T;T	0.36157	1.27;1.27	6.16	6.16	0.99307	.	0.049018	0.85682	D	0.000000	T	0.52256	0.1723	L	0.59436	1.845	0.51482	D	0.999922	P;P;P	0.49783	0.493;0.787;0.928	B;B;P	0.56916	0.203;0.42;0.809	T	0.47699	-0.9097	10	0.45353	T	0.12	-17.7827	15.9872	0.80168	1.0:0.0:0.0:0.0	.	164;217;268	Q9GZY8-5;Q9GZY8-2;Q9GZY8	.;.;MFF_HUMAN	G	217;268;164;164;268	ENSP00000302037:D268G;ENSP00000375912:D268G	ENSP00000304898:D217G	D	+	2	0	MFF	227925524	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.125000	0.71627	2.367000	0.80283	0.528000	0.53228	GAC	MFF	-	pfam_FATE/Miff/Tango-11	ENSG00000168958		0.488	MFF-001	KNOWN	basic|CCDS	protein_coding	MFF	HGNC	protein_coding	OTTHUMT00000256887.2	77	0.00	0	A	NM_020194		228217280	228217280	+1	no_errors	ENST00000353339	ensembl	human	known	69_37n	missense	86	16.35	17	SNP	1.000	G
MTMR11	10903	genome.wustl.edu	37	1	149905591	149905591	+	Splice_Site	SNP	G	G	A	rs587625914		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:149905591G>A	ENST00000439741.2	-	9	1022	c.772C>T	c.(772-774)Cgc>Tgc	p.R258C	MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000369140.3_Splice_Site_p.R186C|MTMR11_ENST00000406732.3_Splice_Site_p.R230C|MTMR11_ENST00000361405.6_Intron	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	258	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CAGGACAAGCGCTTCACATGG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		21277	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													75.0	69.0	71.0					1																	149905591		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.772-1C>T	1.37:g.149905591G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	pfam_Myotubularin_assoc,pfam_Myotub-related	p.R258C	ENST00000439741.2	37	c.772	CCDS53360.1	1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331837	0.60853	.	.	ENSG00000014914	ENST00000369140;ENST00000439741;ENST00000406732;ENST00000405710	D;D;D	0.90004	-2.6;-2.6;-2.6	5.29	5.29	0.74685	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.87900	0.6294	L	0.27053	0.805	0.80722	D	1	D;D;P;P	0.89917	1.0;1.0;0.645;0.694	D;D;B;B	0.91635	0.999;0.998;0.277;0.398	D	0.89148	0.3521	10	0.66056	D	0.02	.	11.3657	0.49671	0.0:0.0:0.8194:0.1806	.	100;230;186;258	F8W8W0;A4FU01-6;A4FU01-4;A4FU01	.;.;.;MTMRB_HUMAN	C	186;258;230;100	ENSP00000358136:R186C;ENSP00000391668:R258C;ENSP00000383948:R230C	ENSP00000358136:R186C	R	-	1	0	MTMR11	148172215	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	3.767000	0.55288	2.761000	0.94854	0.655000	0.94253	CGC	MTMR11	-	pfam_Myotub-related	ENSG00000014914		0.577	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	HGNC	protein_coding		16	0.00	0	G	NM_181873	Missense_Mutation	149905591	149905591	-1	no_errors	ENST00000439741	ensembl	human	known	69_37n	missense	16	48.39	15	SNP	1.000	A
MYCBP2	23077	genome.wustl.edu	37	13	77671823	77671823	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr13:77671823G>C	ENST00000544440.2	-	56	9369	c.9352C>G	c.(9352-9354)Ctt>Gtt	p.L3118V	MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.L3118V|MYCBP2_ENST00000482517.1_5'Flank|MYCBP2_ENST00000407578.2_Missense_Mutation_p.L3156V					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTTAAGGGAAGAGGAGACTTA	0.403																																						dbGAP											0													116.0	103.0	107.0					13																	77671823		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.9352C>G	13.37:g.77671823G>C	ENSP00000444596:p.Leu3118Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,prints_Reg_chr_condens,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens	p.L3156V	ENST00000544440.2	37	c.9466		13	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049622	0.36181	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.61040	0.15;0.14;0.15	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000002	T	0.75961	0.3921	M	0.66297	2.02	0.51233	D	0.999919	D;D;P	0.76494	0.999;0.996;0.956	D;D;D	0.75484	0.986;0.986;0.931	T	0.77405	-0.2600	10	0.72032	D	0.01	.	19.5416	0.95277	0.0:0.0:1.0:0.0	.	504;3118;3118	Q9UG08;O75592-2;O75592	.;.;MYCB2_HUMAN	V	3118;3156;3118	ENSP00000349892:L3118V;ENSP00000384288:L3156V;ENSP00000444596:L3118V	ENSP00000349892:L3118V	L	-	1	0	MYCBP2	76569824	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.561000	0.60809	2.614000	0.88457	0.655000	0.94253	CTT	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.403	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	54	0.00	0	G	NM_015057		77671823	77671823	-1	no_errors	ENST00000407578	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	C
MYO1D	4642	genome.wustl.edu	37	17	30981576	30981576	+	Silent	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:30981576C>T	ENST00000318217.5	-	18	2713	c.2409G>A	c.(2407-2409)aaG>aaA	p.K803K	RP11-220C2.1_ENST00000582272.1_RNA|MYO1D_ENST00000579584.1_Silent_p.K803K|MYO1D_ENST00000394649.4_Silent_p.K715K	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	803	Myosin tail. {ECO:0000255}.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CGGCTGCAACCTTTGCCCTGA	0.512																																						dbGAP											0													70.0	69.0	69.0					17																	30981576		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.2409G>A	17.37:g.30981576C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V3|Q8NHP9	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K803	ENST00000318217.5	37	c.2409	CCDS32615.1	17																																																																																			MYO1D	-	pfam_Myosin_tail_2	ENSG00000176658		0.512	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1D	HGNC	protein_coding	OTTHUMT00000447457.1	35	0.00	0	C			30981576	30981576	-1	no_errors	ENST00000318217	ensembl	human	known	69_37n	silent	17	59.52	25	SNP	1.000	T
MYOM2	9172	genome.wustl.edu	37	8	2054293	2054293	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr8:2054293C>G	ENST00000262113.4	+	23	3045	c.2904C>G	c.(2902-2904)taC>taG	p.Y968*	MYOM2_ENST00000523438.1_Nonsense_Mutation_p.Y393*	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	968	Ig-like C2-type 3.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCAAGCTGTACTTAAAGAATC	0.433																																						dbGAP											0													118.0	117.0	118.0					8																	2054293		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2904C>G	8.37:g.2054293C>G	ENSP00000262113:p.Tyr968*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3Y2	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Y968*	ENST00000262113.4	37	c.2904	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831217	0.71258	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	.	.	.	5.43	4.55	0.56014	.	0.188700	0.48767	D	0.000178	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	11.2528	0.49037	0.0:0.8534:0.0:0.1466	.	.	.	.	X	968;393	.	ENSP00000262113:Y968X	Y	+	3	2	MYOM2	2041700	1.000000	0.71417	0.999000	0.59377	0.047000	0.14425	0.745000	0.26259	1.291000	0.44653	-0.148000	0.13756	TAC	MYOM2	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000036448		0.433	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	80	0.00	0	C	NM_003970		2054293	2054293	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	nonsense	41	22.64	12	SNP	1.000	G
NCOR1	9611	genome.wustl.edu	37	17	15978996	15978996	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:15978996C>G	ENST00000268712.3	-	27	3779	c.3522G>C	c.(3520-3522)caG>caC	p.Q1174H	NCOR1_ENST00000395851.1_Missense_Mutation_p.Q1190H|NCOR1_ENST00000395857.3_Intron	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1174	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTATGCCAGTCTGGGGCAGAG	0.493																																						dbGAP											0													80.0	77.0	78.0					17																	15978996		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.3522G>C	17.37:g.15978996C>G	ENSP00000268712:p.Gln1174His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q1174H	ENST00000268712.3	37	c.3522	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833060	0.50951	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849	D;D	0.83673	-1.75;-1.75	5.73	2.65	0.31530	.	0.000000	0.85682	D	0.000000	D	0.84929	0.5581	L	0.36672	1.1	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.998	D;D;D	0.80764	0.993;0.986;0.994	D	0.84288	0.0498	10	0.62326	D	0.03	-9.2428	10.4745	0.44657	0.0:0.7866:0.0:0.2134	.	1081;1174;1190	E7EVK1;O75376;O75376-2	.;NCOR1_HUMAN;.	H	1174;1190;1081	ENSP00000268712:Q1174H;ENSP00000379192:Q1190H	ENSP00000268712:Q1174H	Q	-	3	2	NCOR1	15919721	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	2.960000	0.49161	0.769000	0.33313	-0.136000	0.14681	CAG	NCOR1	-	NULL	ENSG00000141027		0.493	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	45	0.00	0	C	NM_006311		15978996	15978996	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	10	82.76	48	SNP	1.000	G
NR1I2	8856	genome.wustl.edu	37	3	119533827	119533827	+	Splice_Site	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:119533827G>A	ENST00000337940.4	+	6	961	c.913G>A	c.(913-915)Gac>Aac	p.D305N	NR1I2_ENST00000393716.2_Splice_Site_p.D266N|NR1I2_ENST00000466380.1_Splice_Site_p.D229N	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	266	Ligand-binding.				drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	TGCTGCCAGGGACTTGCCCAT	0.607																																						dbGAP											0													45.0	41.0	42.0					3																	119533827		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	ENST00000337940.4:c.912-1G>A	3.37:g.119533827G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.D305N	ENST00000337940.4	37	c.913	CCDS2995.1	3	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893156	0.52121	.	.	ENSG00000144852	ENST00000393716;ENST00000466380;ENST00000337940	D;D;D	0.95412	-3.7;-3.7;-3.7	4.31	3.43	0.39272	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.686838	0.14646	N	0.306886	D	0.92381	0.7582	L	0.37897	1.145	0.33018	D	0.528442	B;B;B	0.30281	0.124;0.275;0.034	B;B;B	0.38562	0.049;0.276;0.043	D	0.92399	0.5928	10	0.62326	D	0.03	.	6.4977	0.22152	0.2148:0.0:0.7852:0.0	.	266;305;252	O75469;F1D8P9;O75469-6	NR1I2_HUMAN;.;.	N	266;229;305	ENSP00000377319:D266N;ENSP00000420297:D229N;ENSP00000336528:D305N	ENSP00000336528:D305N	D	+	1	0	NR1I2	121016517	0.898000	0.30612	1.000000	0.80357	0.950000	0.60333	1.273000	0.33121	1.165000	0.42670	0.655000	0.94253	GAC	NR1I2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000144852		0.607	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1I2	HGNC	protein_coding	OTTHUMT00000355126.1	12	0.00	0	G		Missense_Mutation	119533827	119533827	+1	no_errors	ENST00000337940	ensembl	human	known	69_37n	missense	8	55.56	10	SNP	0.983	A
NSUN2	54888	genome.wustl.edu	37	5	6600147	6600147	+	Silent	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:6600147C>G	ENST00000264670.6	-	19	2507	c.2196G>C	c.(2194-2196)gtG>gtC	p.V732V	NSUN2_ENST00000539938.1_Silent_p.V496V|NSUN2_ENST00000506139.1_Silent_p.V697V	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	732					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						GTCCCTCAGTCACGTCATTGT	0.577																																						dbGAP											0													181.0	143.0	156.0					5																	6600147		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.2196G>C	5.37:g.6600147C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT,prints_RCMT_NCL1	p.V732	ENST00000264670.6	37	c.2196	CCDS3869.1	5																																																																																			NSUN2	-	NULL	ENSG00000037474		0.577	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NSUN2	HGNC	protein_coding	OTTHUMT00000206902.1	69	0.00	0	C	NM_017755		6600147	6600147	-1	no_errors	ENST00000264670	ensembl	human	known	69_37n	silent	60	25.93	21	SNP	0.004	G
OR2M5	127059	genome.wustl.edu	37	1	248309314	248309314	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:248309314A>G	ENST00000366476.1	+	1	865	c.865A>G	c.(865-867)Atc>Gtc	p.I289V		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GAATCCCCTCATCTACAGCCT	0.488																																						dbGAP											0													91.0	84.0	86.0					1																	248309314		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.865A>G	1.37:g.248309314A>G	ENSP00000355432:p.Ile289Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I289V	ENST00000366476.1	37	c.865	CCDS31105.1	1	.	.	.	.	.	.	.	.	.	.	a	11.49	1.653445	0.29425	.	.	ENSG00000162727	ENST00000366476	T	0.52057	0.68	3.01	3.01	0.34805	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.44095	0.1277	M	0.62266	1.93	0.23602	N	0.997315	B	0.19200	0.034	B	0.23852	0.049	T	0.45086	-0.9285	9	0.72032	D	0.01	.	6.4674	0.21990	0.8789:0.0:0.1211:0.0	.	289	A3KFT3	OR2M5_HUMAN	V	289	ENSP00000355432:I289V	ENSP00000355432:I289V	I	+	1	0	OR2M5	246375937	1.000000	0.71417	0.957000	0.39632	0.787000	0.44495	3.033000	0.49743	1.113000	0.41760	0.317000	0.21355	ATC	OR2M5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000162727		0.488	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M5	HGNC	protein_coding	OTTHUMT00000097343.1	32	0.00	0	A	NM_001004690		248309314	248309314	+1	no_errors	ENST00000366476	ensembl	human	known	69_37n	missense	58	18.31	13	SNP	0.996	G
OR4A47	403253	genome.wustl.edu	37	11	48511007	48511007	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:48511007C>A	ENST00000446524.1	+	1	739	c.663C>A	c.(661-663)caC>caA	p.H221Q		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TCATCTTGCACTCTTTAAAGA	0.448																																						dbGAP											0													111.0	106.0	108.0					11																	48511007		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.663C>A	11.37:g.48511007C>A	ENSP00000412752:p.His221Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H221Q	ENST00000446524.1	37	c.663	CCDS31490.1	11	.	.	.	.	.	.	.	.	.	.	N	4.125	0.021497	0.08006	.	.	ENSG00000237388	ENST00000446524	T	0.36699	1.24	4.59	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	1.149410	0.06429	N	0.723649	T	0.31765	0.0807	L	0.39566	1.225	0.09310	N	1	B	0.19331	0.035	B	0.23150	0.044	T	0.30880	-0.9963	10	0.32370	T	0.25	.	8.69	0.34260	0.0:0.8074:0.0:0.1926	.	221	Q6IF82	O4A47_HUMAN	Q	221	ENSP00000412752:H221Q	ENSP00000412752:H221Q	H	+	3	2	OR4A47	48467583	0.000000	0.05858	0.114000	0.21550	0.275000	0.26752	-2.440000	0.01016	0.360000	0.24265	0.205000	0.17691	CAC	OR4A47	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000237388		0.448	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A47	HGNC	protein_coding	OTTHUMT00000390559.1	48	0.00	0	C	NM_001005512		48511007	48511007	+1	no_errors	ENST00000446524	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	0.109	A
OR4C15	81309	genome.wustl.edu	37	11	55322321	55322321	+	Missense_Mutation	SNP	G	G	C	rs555404830		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:55322321G>C	ENST00000314644.2	+	1	539	c.539G>C	c.(538-540)tGc>tCc	p.C180S		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						GTGGCCATTTGCAAGCCCTTG	0.498										HNSCC(20;0.049)																												dbGAP											0													117.0	107.0	111.0					11																	55322321		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.539G>C	11.37:g.55322321G>C	ENSP00000324958:p.Cys180Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFE2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C180S	ENST00000314644.2	37	c.539	CCDS31501.1	11	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208851	0.79240	.	.	ENSG00000181939	ENST00000314644	T	0.07021	3.23	5.12	5.12	0.69794	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.32971	0.0847	M	0.88570	2.965	0.44289	D	0.997152	D	0.67145	0.996	D	0.63113	0.911	T	0.19418	-1.0306	9	0.72032	D	0.01	.	16.0842	0.81025	0.0:0.0:1.0:0.0	.	126	Q8NGM1	OR4CF_HUMAN	S	180	ENSP00000324958:C180S	ENSP00000324958:C180S	C	+	2	0	OR4C15	55078897	0.999000	0.42202	1.000000	0.80357	0.854000	0.48673	3.062000	0.49971	2.665000	0.90641	0.385000	0.25706	TGC	OR4C15	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181939		0.498	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	46	0.00	0	G	NM_001001920		55322321	55322321	+1	no_errors	ENST00000314644	ensembl	human	known	69_37n	missense	50	25.37	17	SNP	1.000	C
OR51D1	390038	genome.wustl.edu	37	11	4661473	4661473	+	Silent	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:4661473G>T	ENST00000357605.2	+	1	529	c.453G>T	c.(451-453)ggG>ggT	p.G151G		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCTGACAGGGTGTACTGTGG	0.547																																						dbGAP											0													196.0	167.0	177.0					11																	4661473		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.453G>T	11.37:g.4661473G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIK4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G151	ENST00000357605.2	37	c.453	CCDS31357.1	11																																																																																			OR51D1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197428		0.547	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	HGNC	protein_coding	OTTHUMT00000385956.1	73	0.00	0	G	NM_001004751		4661473	4661473	+1	no_errors	ENST00000357605	ensembl	human	known	69_37n	silent	17	55.26	21	SNP	0.000	T
OR51F1	256892	genome.wustl.edu	37	11	4790519	4790519	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:4790519C>A	ENST00000380383.1	-	1	649	c.650G>T	c.(649-651)gGa>gTa	p.G217V	OR51F1_ENST00000343430.3_Missense_Mutation_p.G210V|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		TGTATCTATTCCAGTGGTCAG	0.418																																						dbGAP											0													150.0	145.0	146.0					11																	4790519		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.650G>T	11.37:g.4790519C>A	ENSP00000369744:p.Gly217Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G217V	ENST00000380383.1	37	c.650		11	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750269	0.49257	.	.	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.34275	1.37;1.37	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000032	T	0.59390	0.2190	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.57039	-0.7879	10	0.45353	T	0.12	.	17.5439	0.87856	0.0:1.0:0.0:0.0	.	217	A6NGY5	O51F1_HUMAN	V	210;217	ENSP00000345163:G210V;ENSP00000369744:G217V	ENSP00000345163:G210V	G	-	2	0	OR51F1	4747095	0.000000	0.05858	0.953000	0.39169	0.176000	0.22953	0.921000	0.28718	2.728000	0.93425	0.655000	0.94253	GGA	OR51F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000188069		0.418	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	OR51F1	HGNC	protein_coding		63	0.00	0	C	NM_001004752		4790519	4790519	-1	no_errors	ENST00000380383	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	1.000	A
OR5A2	219981	genome.wustl.edu	37	11	59190015	59190015	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:59190015A>T	ENST00000302040.4	-	1	434	c.412T>A	c.(412-414)Tcc>Acc	p.S138T		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						AGTGTATGGGATATGAGGACT	0.468																																						dbGAP											0													82.0	76.0	78.0					11																	59190015		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.412T>A	11.37:g.59190015A>T	ENSP00000303834:p.Ser138Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S138T	ENST00000302040.4	37	c.412	CCDS31560.1	11	.	.	.	.	.	.	.	.	.	.	A	10.47	1.358467	0.24598	.	.	ENSG00000172324	ENST00000302040	T	0.02032	4.49	5.47	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34932	U	0.003565	T	0.02119	0.0066	L	0.41710	1.295	0.22684	N	0.99886	B	0.06786	0.001	B	0.09377	0.004	T	0.46638	-0.9177	10	0.26408	T	0.33	.	6.0148	0.19596	0.5649:0.149:0.0:0.2861	.	138	Q8NGI9	OR5A2_HUMAN	T	138	ENSP00000303834:S138T	ENSP00000303834:S138T	S	-	1	0	OR5A2	58946591	0.000000	0.05858	0.007000	0.13788	0.005000	0.04900	-0.625000	0.05534	0.432000	0.26286	-0.414000	0.06135	TCC	OR5A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000172324		0.468	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A2	HGNC	protein_coding	OTTHUMT00000394552.1	35	0.00	0	A	NM_001001954		59190015	59190015	-1	no_errors	ENST00000302040	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	0.749	T
OR4D9	390199	genome.wustl.edu	37	11	59283150	59283150	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:59283150C>G	ENST00000329328.3	+	1	765	c.765C>G	c.(763-765)atC>atG	p.I255M		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						TGCCCTGCATCTATGTCTATG	0.552																																						dbGAP											0													253.0	224.0	234.0					11																	59283150		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.765C>G	11.37:g.59283150C>G	ENSP00000328563:p.Ile255Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFF3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I255M	ENST00000329328.3	37	c.765	CCDS31564.1	11	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367585	0.61513	.	.	ENSG00000172742	ENST00000329328	T	0.40756	1.02	4.26	4.26	0.50523	GPCR, rhodopsin-like superfamily (1);	0.170089	0.27826	U	0.017684	T	0.59252	0.2180	L	0.53561	1.675	0.24997	N	0.991492	D	0.76494	0.999	D	0.74348	0.983	T	0.54702	-0.8254	10	0.87932	D	0	-16.0512	15.6085	0.76696	0.0:1.0:0.0:0.0	.	255	Q8NGE8	OR4D9_HUMAN	M	255	ENSP00000328563:I255M	ENSP00000328563:I255M	I	+	3	3	OR4D9	59039726	0.002000	0.14202	1.000000	0.80357	0.987000	0.75469	0.073000	0.14640	2.062000	0.61559	0.563000	0.77884	ATC	OR4D9	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172742		0.552	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D9	HGNC	protein_coding	OTTHUMT00000394237.1	79	0.00	0	C	NM_001004711		59283150	59283150	+1	no_errors	ENST00000329328	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	1.000	G
OR8B8	26493	genome.wustl.edu	37	11	124310048	124310048	+	Nonstop_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:124310048A>G	ENST00000328064.2	-	1	1006	c.934T>C	c.(934-936)Tga>Cga	p.*312R		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	0					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CCCTTTTCTCAGGAGAATGCA	0.393																																						dbGAP											0													97.0	87.0	90.0					11																	124310048		2201	4299	6500	-	-	-	SO:0001578	stop_lost	0			AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.934T>C	11.37:g.124310048A>G	ENSP00000330280:p.*312Glyext*?	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L446|Q96RC8	Nonstop_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.*312R	ENST00000328064.2	37	c.934	CCDS8446.1	11	.	.	.	.	.	.	.	.	.	.	a	3.083	-0.188563	0.06299	.	.	ENSG00000197125	ENST00000328064	.	.	.	4.17	1.83	0.25207	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8098	0.13339	0.7393:0.0:0.0944:0.1663	.	.	.	.	R	312	.	.	X	-	1	0	OR8B8	123815258	0.011000	0.17503	0.964000	0.40570	0.162000	0.22319	0.492000	0.22435	0.384000	0.24942	-0.336000	0.08194	TGA	OR8B8	-	NULL	ENSG00000197125		0.393	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B8	HGNC	protein_coding	OTTHUMT00000387056.1	74	0.00	0	A	NM_012378		124310048	124310048	-1	no_errors	ENST00000328064	ensembl	human	putative	69_37n	nonstop	53	19.70	13	SNP	0.946	G
OTOA	146183	genome.wustl.edu	37	16	21716582	21716582	+	Missense_Mutation	SNP	A	A	T	rs548486726		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:21716582A>T	ENST00000286149.4	+	11	1116	c.1115A>T	c.(1114-1116)cAc>cTc	p.H372L	OTOA_ENST00000388957.3_Missense_Mutation_p.H34L|OTOA_ENST00000388958.3_Missense_Mutation_p.H358L|OTOA_ENST00000569064.1_3'UTR|OTOA_ENST00000388956.4_Missense_Mutation_p.H279L			Q7RTW8	OTOAN_HUMAN	otoancorin	372					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		AAGTGCAGCCACCTGAGGGGC	0.567																																						dbGAP											0													84.0	79.0	81.0					16																	21716582		2199	4300	6499	-	-	-	SO:0001583	missense	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1115A>T	16.37:g.21716582A>T	ENSP00000286149:p.His372Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	NULL	p.H372L	ENST00000286149.4	37	c.1115		16	.	.	.	.	.	.	.	.	.	.	A	14.59	2.581973	0.46006	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.3	-3.79	0.04320	.	0.742908	0.13335	N	0.395597	T	0.59074	0.2167	L	0.29908	0.895	0.20307	N	0.999915	P;P;B;B	0.35348	0.496;0.496;0.288;0.355	B;B;B;B	0.27380	0.079;0.079;0.079;0.079	T	0.42716	-0.9435	10	0.25751	T	0.34	-0.4404	12.9256	0.58258	0.4066:0.0:0.5934:0.0	.	372;279;34;358	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	L	358;372;279;34	ENSP00000373610:H358L;ENSP00000286149:H372L;ENSP00000373608:H279L;ENSP00000373609:H34L	ENSP00000286149:H372L	H	+	2	0	OTOA	21624083	0.002000	0.14202	0.437000	0.26809	0.969000	0.65631	-0.063000	0.11655	-0.798000	0.04444	0.459000	0.35465	CAC	OTOA	-	NULL	ENSG00000155719		0.567	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	39	0.00	0	A			21716582	21716582	+1	no_errors	ENST00000286149	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	0.200	T
PAGE3	139793	genome.wustl.edu	37	X	55287030	55287030	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chrX:55287030C>G	ENST00000374951.1	-	4	564	c.256G>C	c.(256-258)Gat>Cat	p.D86H	PAGE3_ENST00000519203.1_Missense_Mutation_p.D86H			Q5JUK9	PAGE3_HUMAN	P antigen family, member 3 (prostate associated)	86										endometrium(1)|kidney(1)|lung(1)	3						TTAGGACCATCTCCACGTTCA	0.398																																						dbGAP											0													59.0	52.0	54.0					X																	55287030		2203	4299	6502	-	-	-	SO:0001583	missense	0					Xp11	2009-06-17	2005-01-26	2005-01-27	ENSG00000204279	ENSG00000204279			4110	protein-coding gene	gene with protein product		300739	"""G antigen, family D, 1"""	GAGED1		9724777	Standard	NR_033460		Approved	PAGE-3, CT16.6	uc022bxs.2	Q5JUK9	OTTHUMG00000021654	ENST00000374951.1:c.256G>C	X.37:g.55287030C>G	ENSP00000364089:p.Asp86His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6Y1	Missense_Mutation	SNP	pfam_GAGE	p.D86H	ENST00000374951.1	37	c.256		X	.	.	.	.	.	.	.	.	.	.	.	9.556	1.117209	0.20795	.	.	ENSG00000204279	ENST00000374951;ENST00000519203	T;T	0.16597	2.33;2.33	1.01	-0.123	0.13527	.	.	.	.	.	T	0.32763	0.0840	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.11616	-1.0580	8	0.87932	D	0	.	4.4348	0.11545	0.0:0.5772:0.4228:0.0	.	86	Q5JUK9	GGED1_HUMAN	H	86	ENSP00000364089:D86H;ENSP00000429571:D86H	ENSP00000364089:D86H	D	-	1	0	PAGE3	55303755	0.090000	0.21635	0.003000	0.11579	0.046000	0.14306	1.131000	0.31406	-0.080000	0.12685	0.284000	0.19432	GAT	PAGE3	-	pfam_GAGE	ENSG00000204279		0.398	PAGE3-001	KNOWN	basic|appris_principal	protein_coding	PAGE3	HGNC	protein_coding	OTTHUMT00000056867.2	100	0.00	0	C	XM_060054		55287030	55287030	-1	no_errors	ENST00000374951	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	0.003	G
PATL1	219988	genome.wustl.edu	37	11	59434423	59434423	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:59434423A>C	ENST00000300146.9	-	2	114	c.30T>G	c.(28-30)tgT>tgG	p.C10W	AP000640.2_ENST00000534120.1_RNA	NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	10	Involved in nuclear foci localization.|Region A; interaction with DDX6/RCK.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						CATCCAGAGGACAATCCTCCA	0.348																																						dbGAP											0													141.0	102.0	114.0					11																	59434423		692	1591	2283	-	-	-	SO:0001583	missense	0			AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.30T>G	11.37:g.59434423A>C	ENSP00000300146:p.Cys10Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Missense_Mutation	SNP	pfam_Topo_II-assoc_PAT1	p.C10W	ENST00000300146.9	37	c.30	CCDS44613.1	11	.	.	.	.	.	.	.	.	.	.	A	14.72	2.620343	0.46736	.	.	ENSG00000166889	ENST00000300146;ENST00000428532	T	0.54479	0.57	5.52	2.01	0.26516	.	.	.	.	.	T	0.59101	0.2169	L	0.46157	1.445	0.58432	D	0.999995	D;D	0.76494	0.998;0.999	D;D	0.70716	0.926;0.97	T	0.53244	-0.8466	9	0.38643	T	0.18	-7.1141	7.7018	0.28627	0.6421:0.0:0.3579:0.0	.	10;10	Q86TB9-4;Q86TB9	.;PATL1_HUMAN	W	10	ENSP00000300146:C10W	ENSP00000300146:C10W	C	-	3	2	PATL1	59190999	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.768000	0.26590	0.408000	0.25621	-0.290000	0.09829	TGT	PATL1	-	NULL	ENSG00000166889		0.348	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL1	HGNC	protein_coding	OTTHUMT00000394559.1	63	0.00	0	A	NM_152716		59434423	59434423	-1	no_errors	ENST00000300146	ensembl	human	known	69_37n	missense	60	23.08	18	SNP	1.000	C
PDE7B	27115	genome.wustl.edu	37	6	136512854	136512854	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:136512854A>T	ENST00000308191.6	+	13	1532	c.1229A>T	c.(1228-1230)aAg>aTg	p.K410M	RP13-143G15.4_ENST00000417643.1_RNA|RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000591521.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	410	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	GCACACAACAAGGCCCAGTGG	0.627																																						dbGAP											0													45.0	39.0	41.0					6																	136512854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.1229A>T	6.37:g.136512854A>T	ENSP00000310661:p.Lys410Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W154	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.K410M	ENST00000308191.6	37	c.1229	CCDS5175.1	6	.	.	.	.	.	.	.	.	.	.	A	15.19	2.759607	0.49468	.	.	ENSG00000171408	ENST00000308191;ENST00000367787	T	0.77877	-1.13	5.17	5.17	0.71159	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.047923	0.85682	D	0.000000	D	0.83663	0.5303	M	0.74881	2.28	0.80722	D	1	D;D	0.62365	0.98;0.991	P;D	0.65773	0.835;0.938	D	0.86396	0.1739	10	0.87932	D	0	.	13.8698	0.63612	1.0:0.0:0.0:0.0	.	462;410	A1E5M1;Q9NP56	.;PDE7B_HUMAN	M	410;546	ENSP00000310661:K410M	ENSP00000310661:K410M	K	+	2	0	PDE7B	136554547	1.000000	0.71417	1.000000	0.80357	0.196000	0.23810	6.234000	0.72326	2.076000	0.62316	0.533000	0.62120	AAG	PDE7B	-	NULL	ENSG00000171408		0.627	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7B	HGNC	protein_coding	OTTHUMT00000042371.1	24	0.00	0	A			136512854	136512854	+1	no_errors	ENST00000308191	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	T
POTEH	23784	genome.wustl.edu	37	22	16287713	16287713	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr22:16287713C>G	ENST00000343518.6	-	1	224	c.173G>C	c.(172-174)aGg>aCg	p.R58T		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	58										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CATCTTGCTCCTGAGTGTCTT	0.612																																						dbGAP											0													74.0	86.0	82.0					22																	16287713		2070	3843	5913	-	-	-	SO:0001583	missense	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.173G>C	22.37:g.16287713C>G	ENSP00000340610:p.Arg58Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R58T	ENST00000343518.6	37	c.173	CCDS46658.1	22	.	.	.	.	.	.	.	.	.	.	.	8.591	0.884542	0.17467	.	.	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.51574	0.7	.	.	.	.	.	.	.	.	T	0.53126	0.1777	L	0.52573	1.65	0.09310	N	1	D	0.65815	0.995	D	0.71184	0.972	T	0.47169	-0.9138	7	0.15499	T	0.54	.	.	.	.	.	58	Q6S545	POTEH_HUMAN	T	58	ENSP00000340610:R58T	ENSP00000340610:R58T	R	-	2	0	POTEH	14667713	0.008000	0.16893	0.001000	0.08648	0.001000	0.01503	0.287000	0.18920	0.073000	0.16731	0.074000	0.15403	AGG	POTEH	-	NULL	ENSG00000198062		0.612	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	62	0.00	0	C	NM_001136213		16287713	16287713	-1	no_errors	ENST00000343518	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	0.000	G
PPFIA1	8500	genome.wustl.edu	37	11	70171060	70171060	+	Silent	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:70171060G>T	ENST00000253925.7	+	4	689	c.474G>T	c.(472-474)gtG>gtT	p.V158V	PPFIA1_ENST00000389547.3_Silent_p.V158V|CTA-797E19.2_ENST00000526017.1_RNA|AP000487.6_ENST00000528607.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	158					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CCAGCGAAGTGGAAGTGCTGA	0.502																																						dbGAP											0													93.0	93.0	93.0					11																	70171060		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.474G>T	11.37:g.70171060G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.V158	ENST00000253925.7	37	c.474	CCDS31627.1	11																																																																																			PPFIA1	-	NULL	ENSG00000131626		0.502	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	HGNC	protein_coding	OTTHUMT00000393905.1	35	0.00	0	G	NM_003626		70171060	70171060	+1	no_errors	ENST00000253925	ensembl	human	known	69_37n	silent	19	20.83	5	SNP	0.884	T
PRDM15	63977	genome.wustl.edu	37	21	43279763	43279763	+	Silent	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr21:43279763G>A	ENST00000269844.3	-	9	1079	c.969C>T	c.(967-969)tcC>tcT	p.S323S	PRDM15_ENST00000422911.1_Silent_p.S60S|PRDM15_ENST00000538201.1_Silent_p.S23S|PRDM15_ENST00000447207.2_Silent_p.S23S|PRDM15_ENST00000398548.1_Silent_p.S60S	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CGGGACATTCGGAGTCGTGGT	0.572																																						dbGAP											0													79.0	62.0	68.0					21																	43279763		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.969C>T	21.37:g.43279763G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.S323	ENST00000269844.3	37	c.969	CCDS13676.1	21																																																																																			PRDM15	-	NULL	ENSG00000141956		0.572	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		32	0.00	0	G	NM_022115		43279763	43279763	-1	no_errors	ENST00000269844	ensembl	human	known	69_37n	silent	24	27.27	9	SNP	0.027	A
PREPL	9581	genome.wustl.edu	37	2	44569611	44569611	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:44569611C>G	ENST00000409936.1	-	6	1134	c.697G>C	c.(697-699)Gcc>Ccc	p.A233P	PREPL_ENST00000378520.3_Missense_Mutation_p.A233P|PREPL_ENST00000410081.1_Missense_Mutation_p.A233P|PREPL_ENST00000540817.1_5'Flank|PREPL_ENST00000409957.1_Missense_Mutation_p.A144P|PREPL_ENST00000541738.1_Missense_Mutation_p.A144P|PREPL_ENST00000260648.6_Missense_Mutation_p.A233P|PREPL_ENST00000409272.1_Missense_Mutation_p.A233P|PREPL_ENST00000378511.3_Missense_Mutation_p.A233P|PREPL_ENST00000409411.1_Missense_Mutation_p.A144P	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	233						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCAAAAGTGGCTCGATATACG	0.373																																						dbGAP											0													119.0	127.0	124.0					2																	44569611		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.697G>C	2.37:g.44569611C>G	ENSP00000386543:p.Ala233Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	pfam_Peptidase_S9,pfam_Peptidase_S9A_B_C_N,superfamily_Peptidase_S9A_B_C_N,prints_Peptidase_S9A	p.A233P	ENST00000409936.1	37	c.697	CCDS33190.1	2	.	.	.	.	.	.	.	.	.	.	C	17.79	3.474950	0.63737	.	.	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511	T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.61	4.63	0.57726	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.250835	0.41194	D	0.000929	T	0.36799	0.0980	N	0.08118	0	0.28324	N	0.922127	D;D;D	0.89917	1.0;0.998;0.983	D;P;P	0.83275	0.996;0.862;0.805	T	0.31420	-0.9944	10	0.66056	D	0.02	-12.3738	3.0256	0.06090	0.2779:0.5588:0.0:0.1633	.	233;233;233	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	P	144;144;144;233;233;233;233;233;233	ENSP00000439626:A144P;ENSP00000387095:A144P;ENSP00000387241:A144P;ENSP00000386543:A233P;ENSP00000260648:A233P;ENSP00000386909:A233P;ENSP00000386509:A233P;ENSP00000367781:A233P;ENSP00000367772:A233P	ENSP00000260648:A233P	A	-	1	0	PREPL	44423115	0.993000	0.37304	0.999000	0.59377	0.988000	0.76386	1.290000	0.33319	2.629000	0.89072	0.655000	0.94253	GCC	PREPL	-	pfam_Peptidase_S9A_B_C_N,superfamily_Peptidase_S9A_B_C_N	ENSG00000138078		0.373	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	HGNC	protein_coding	OTTHUMT00000327900.1	82	0.00	0	C	NM_006036		44569611	44569611	-1	no_errors	ENST00000260648	ensembl	human	known	69_37n	missense	107	20.15	27	SNP	0.944	G
PTCHD4	442213	genome.wustl.edu	37	6	48036082	48036082	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr6:48036082C>G	ENST00000339488.4	-	1	343	c.310G>C	c.(310-312)Gac>Cac	p.D104H	PTCHD4_ENST00000543600.1_Missense_Mutation_p.D87H	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	104						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GTGTGTAAGTCCGAATAGAGC	0.627																																						dbGAP											0													81.0	87.0	85.0					6																	48036082		1917	4124	6041	-	-	-	SO:0001583	missense	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.310G>C	6.37:g.48036082C>G	ENSP00000341914:p.Asp104His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.D104H	ENST00000339488.4	37	c.310	CCDS34473.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.34|17.34	3.364424|3.364424	0.61513|0.61513	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000339488;ENST00000543600|ENST00000398738	D;T|.	0.92647|.	-3.08;0.57|.	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67951|0.67951	0.2948|0.2948	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.989;0.999|.	D;D|.	0.81914|.	0.949;0.995|.	T|T	0.67409|0.67409	-0.5678|-0.5678	10|5	0.46703|.	T|.	0.11|.	.|.	18.3469|18.3469	0.90325|0.90325	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	104;87|.	Q6ZW05;B0QZ29|.	CF138_HUMAN;.|.	H|A	104;87|103	ENSP00000341914:D104H;ENSP00000439864:D87H|.	ENSP00000341914:D104H|.	D|G	-|-	1|2	0|0	C6orf138|C6orf138	48144041|48144041	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.394000|7.394000	0.79862|0.79862	2.314000|2.314000	0.78098|0.78098	0.563000|0.563000	0.77884|0.77884	GAC|GGA	PTCHD4	-	NULL	ENSG00000244694		0.627	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	22	0.00	0	C	NM_001013732		48036082	48036082	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	missense	11	50.00	11	SNP	1.000	G
PYGM	5837	genome.wustl.edu	37	11	64517909	64517909	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:64517909C>G	ENST00000164139.3	-	17	2514	c.2116G>C	c.(2116-2118)Gag>Cag	p.E706Q	PYGM_ENST00000377432.3_Missense_Mutation_p.E618Q|PYGM_ENST00000462303.1_5'Flank	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	706					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AAGTTTTCCTCTCCCGCCTCT	0.557																																						dbGAP											0													202.0	185.0	191.0					11																	64517909		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.2116G>C	11.37:g.64517909C>G	ENSP00000164139:p.Glu706Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK1|A6NDY6	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.E706Q	ENST00000164139.3	37	c.2116	CCDS8079.1	11	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284644	0.59867	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.93488	-3.23;-3.23	4.79	4.79	0.61399	.	0.000000	0.51477	D	0.000097	D	0.92564	0.7638	L	0.61387	1.9	0.80722	D	1	B;B	0.27997	0.13;0.197	B;B	0.34779	0.189;0.142	D	0.91278	0.5049	10	0.46703	T	0.11	-32.8275	15.3673	0.74531	0.0:1.0:0.0:0.0	.	618;706	A6NDY6;P11217	.;PYGM_HUMAN	Q	618;706;687	ENSP00000366650:E618Q;ENSP00000164139:E706Q	ENSP00000164139:E706Q	E	-	1	0	PYGM	64274485	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.879000	0.69690	2.511000	0.84671	0.561000	0.74099	GAG	PYGM	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000068976		0.557	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	HGNC	protein_coding	OTTHUMT00000143254.2	61	0.00	0	C	NM_005609		64517909	64517909	-1	no_errors	ENST00000164139	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	G
RAD54B	25788	genome.wustl.edu	37	8	95470589	95470589	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr8:95470589C>G	ENST00000336148.5	-	3	335	c.211G>C	c.(211-213)Gaa>Caa	p.E71Q	RAD54B_ENST00000297592.5_Missense_Mutation_p.E71Q	NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	71					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			CTAGTACTTTCTTCACTAGGC	0.333								Direct reversal of damage;Homologous recombination																														dbGAP											0													131.0	123.0	126.0					8																	95470589		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.211G>C	8.37:g.95470589C>G	ENSP00000336606:p.Glu71Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	F6WBS8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E71Q	ENST00000336148.5	37	c.211	CCDS6262.1	8	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745241	0.49151	.	.	ENSG00000197275	ENST00000336148;ENST00000523839;ENST00000297592	D;T;T	0.89196	-2.48;1.36;1.3	5.34	4.46	0.54185	.	0.832999	0.10798	N	0.632958	D	0.84995	0.5596	N	0.22421	0.69	0.09310	N	1	P;B	0.48016	0.904;0.18	P;B	0.48227	0.571;0.055	T	0.74231	-0.3732	10	0.33141	T	0.24	-17.7556	10.6669	0.45736	0.0:0.91:0.0:0.09	.	71;71	F6WBS8;Q9Y620	.;RA54B_HUMAN	Q	71	ENSP00000336606:E71Q;ENSP00000428554:E71Q;ENSP00000430153:E71Q	ENSP00000430153:E71Q	E	-	1	0	RAD54B	95539765	0.005000	0.15991	0.010000	0.14722	0.133000	0.20885	1.433000	0.34947	1.579000	0.49836	-0.145000	0.13849	GAA	RAD54B	-	NULL	ENSG00000197275		0.333	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	HGNC	protein_coding	OTTHUMT00000257806.3	64	0.00	0	C	NM_012415		95470589	95470589	-1	no_errors	ENST00000336148	ensembl	human	known	69_37n	missense	139	15.24	25	SNP	0.019	G
RBMX	27316	genome.wustl.edu	37	X	135960146	135960147	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chrX:135960146_135960147insAA	ENST00000320676.7	-	4	469_470	c.315_316insTT	c.(313-318)cctccafs	p.P106fs	SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000562646.1_Frame_Shift_Ins_p.P106fs|RBMX_ENST00000570135.1_Intron|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000565438.1_5'UTR	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	106					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P106fs*32(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AGACCTCTTGGAGGGCCTCTAC	0.535																																						dbGAP											1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.315_316insTT	X.37:g.135960146_135960147insAA	ENSP00000359645:p.Pro106fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.P105fs	ENST00000320676.7	37	c.316_315	CCDS14661.1	X																																																																																			RBMX	-	NULL	ENSG00000147274		0.535	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	HGNC	protein_coding	OTTHUMT00000058507.1	40	0.00	0	-	NM_002139		135960146	135960147	-1	no_errors	ENST00000320676	ensembl	human	known	69_37n	frame_shift_ins	25	34.21	13	INS	1.000:1.000	AA
RCC2	55920	genome.wustl.edu	37	1	17736479	17736479	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:17736479G>C	ENST00000375436.4	-	12	1642	c.1455C>G	c.(1453-1455)ttC>ttG	p.F485L	RP1-20B21.4_ENST00000439577.1_RNA|RCC2_ENST00000375433.3_Missense_Mutation_p.F485L|RCC2_ENST00000474892.1_5'Flank	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	485					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)			breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		CCTGCTCTGAGAAAATGCCAT	0.557																																						dbGAP											0													116.0	105.0	109.0					1																	17736479		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.1455C>G	1.37:g.17736479G>C	ENSP00000364585:p.Phe485Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVL9|Q9BSN6|Q9NPV8	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.F485L	ENST00000375436.4	37	c.1455	CCDS181.1	1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630057	0.28978	.	.	ENSG00000179051	ENST00000375436;ENST00000375433	T;T	0.79845	-1.31;-1.31	4.75	3.82	0.43975	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.059260	0.64402	D	0.000001	T	0.67951	0.2948	L	0.36672	1.1	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.59804	-0.7385	10	0.13470	T	0.59	-23.9073	9.6796	0.40061	0.099:0.0:0.901:0.0	.	485	Q9P258	RCC2_HUMAN	L	485	ENSP00000364585:F485L;ENSP00000364582:F485L	ENSP00000364582:F485L	F	-	3	2	RCC2	17609066	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.115000	0.41921	2.348000	0.79779	0.655000	0.94253	TTC	RCC2	-	superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000179051		0.557	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCC2	HGNC	protein_coding	OTTHUMT00000007144.1	44	0.00	0	G	NM_018715		17736479	17736479	-1	no_errors	ENST00000375433	ensembl	human	known	69_37n	missense	49	30.99	22	SNP	1.000	C
RFX3	5991	genome.wustl.edu	37	9	3346722	3346722	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr9:3346722G>A	ENST00000382004.3	-	4	471	c.160C>T	c.(160-162)Ccc>Tcc	p.P54S	RFX3_ENST00000358730.2_Missense_Mutation_p.P54S|RFX3_ENST00000381984.2_Missense_Mutation_p.P54S|RFX3_ENST00000302303.1_Missense_Mutation_p.P54S	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	54					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		ACCTGAGCGGGATAGACATGT	0.428																																						dbGAP											0													149.0	123.0	132.0					9																	3346722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.160C>T	9.37:g.3346722G>A	ENSP00000371434:p.Pro54Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.P54S	ENST00000382004.3	37	c.160	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577973	0.65878	.	.	ENSG00000080298	ENST00000382004;ENST00000381992;ENST00000358730;ENST00000302303;ENST00000457373;ENST00000451859;ENST00000442560;ENST00000420720;ENST00000381985;ENST00000449190;ENST00000381984	T;T;T;T;T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62;1.62;1.62;1.62;1.62	5.58	5.58	0.84498	RFX1 transcription activation region (1);	0.058037	0.64402	D	0.000001	T	0.36413	0.0966	N	0.25485	0.75	0.48571	D	0.999671	B;P;B;P	0.36010	0.344;0.532;0.128;0.529	B;B;B;P	0.49387	0.163;0.175;0.106;0.609	T	0.05037	-1.0910	10	0.21014	T	0.42	-11.9692	18.3614	0.90375	0.0:0.0:1.0:0.0	.	54;54;54;54	B1ANP5;P48380-3;P48380-2;P48380	.;.;.;RFX3_HUMAN	S	54;54;54;54;54;54;15;15;54;54;54	ENSP00000371434:P54S;ENSP00000351574:P54S;ENSP00000303847:P54S;ENSP00000405664:P54S;ENSP00000411756:P54S;ENSP00000410988:P15S;ENSP00000416189:P15S;ENSP00000399352:P54S;ENSP00000371414:P54S	ENSP00000303847:P54S	P	-	1	0	RFX3	3336722	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.481000	0.73608	2.612000	0.88384	0.655000	0.94253	CCC	RFX3	-	pfam_RFX1_trans_act	ENSG00000080298		0.428	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	48	0.00	0	G	NM_002919		3346722	3346722	-1	no_errors	ENST00000382004	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	A
RGAG1	57529	genome.wustl.edu	37	X	109694662	109694662	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chrX:109694662A>G	ENST00000465301.2	+	3	1063	c.817A>G	c.(817-819)Atg>Gtg	p.M273V	RGAG1_ENST00000540313.1_Missense_Mutation_p.M273V	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	273										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CTCACTGATAATGTCAGCTGT	0.493																																						dbGAP											0													148.0	125.0	133.0					X																	109694662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.817A>G	X.37:g.109694662A>G	ENSP00000419786:p.Met273Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.M273V	ENST00000465301.2	37	c.817	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	A	11.95	1.790138	0.31685	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.55234	0.53;0.53	3.91	2.7	0.31948	.	0.165870	0.28809	N	0.014064	T	0.48314	0.1493	N	0.19112	0.55	0.25658	N	0.986037	D	0.58268	0.982	D	0.68943	0.961	T	0.25950	-1.0117	9	.	.	.	-6.3747	3.389	0.07282	0.6384:0.2372:0.1243:0.0	.	273	Q8NET4	RGAG1_HUMAN	V	273	ENSP00000419786:M273V;ENSP00000441452:M273V	.	M	+	1	0	RGAG1	109581318	0.990000	0.36364	0.989000	0.46669	0.589000	0.36550	2.098000	0.41757	0.629000	0.30376	0.486000	0.48141	ATG	RGAG1	-	NULL	ENSG00000243978		0.493	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	58	0.00	0	A	NM_020769		109694662	109694662	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.984	G
RHBDF2	79651	genome.wustl.edu	37	17	74474958	74474958	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:74474958G>T	ENST00000313080.4	-	6	962	c.689C>A	c.(688-690)tCc>tAc	p.S230Y	RHBDF2_ENST00000591885.1_Missense_Mutation_p.S201Y|RHBDF2_ENST00000389760.4_Missense_Mutation_p.S201Y|RHBDF2_ENST00000592378.1_5'Flank	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	230					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						TGGCAGGTGGGAGTAGCCAGA	0.687																																						dbGAP											0													56.0	46.0	50.0					17																	74474958		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.689C>A	17.37:g.74474958G>T	ENSP00000322775:p.Ser230Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.S230Y	ENST00000313080.4	37	c.689	CCDS32743.1	17	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925911	0.52759	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	T;T	0.65916	-0.18;-0.18	5.13	5.13	0.70059	.	0.270348	0.35677	N	0.003045	T	0.70657	0.3249	L	0.50333	1.59	0.30890	N	0.730499	D;P;D;P	0.67145	0.996;0.91;0.958;0.948	D;P;P;P	0.65573	0.936;0.873;0.835;0.745	T	0.68254	-0.5457	10	0.22706	T	0.39	-45.3805	14.2372	0.65934	0.0:0.2675:0.7325:0.0	.	201;176;230;201	B7Z8H4;Q6ZWP8;Q6PJF5;Q6PJF5-2	.;.;RHDF2_HUMAN;.	Y	230;201;176	ENSP00000322775:S230Y;ENSP00000374410:S201Y	ENSP00000322775:S230Y	S	-	2	0	RHBDF2	71986553	1.000000	0.71417	0.991000	0.47740	0.753000	0.42808	1.526000	0.35964	2.379000	0.81126	0.455000	0.32223	TCC	RHBDF2	-	pfam_Rhomboid_SP	ENSG00000129667		0.687	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	RHBDF2	HGNC	protein_coding	OTTHUMT00000450134.1	37	0.00	0	G	NM_024599		74474958	74474958	-1	no_errors	ENST00000313080	ensembl	human	known	69_37n	missense	45	33.82	23	SNP	0.540	T
RSL1D1	26156	genome.wustl.edu	37	16	11935823	11935823	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:11935823C>T	ENST00000571133.1	-	6	742	c.670G>A	c.(670-672)Gag>Aag	p.E224K	RSL1D1_ENST00000542106.1_Missense_Mutation_p.E4K	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	224					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						ATGATGTGCTCAATTTGCATT	0.323																																						dbGAP											0													69.0	63.0	65.0					16																	11935823		2197	4300	6497	-	-	-	SO:0001583	missense	0			AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.670G>A	16.37:g.11935823C>T	ENSP00000460871:p.Glu224Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF	p.E224K	ENST00000571133.1	37	c.670	CCDS10551.1	16	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166559	0.57476	.	.	ENSG00000171490	ENST00000355674;ENST00000396503;ENST00000542106	T	0.48836	0.8	4.91	-1.32	0.09201	Ribosomal protein L1, 2-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);	0.601209	0.17553	N	0.170109	T	0.36110	0.0955	L	0.33189	0.99	0.20764	N	0.999857	B;B	0.33448	0.412;0.277	B;B	0.35607	0.179;0.206	T	0.35748	-0.9776	10	0.42905	T	0.14	-13.4624	13.7809	0.63081	0.0:0.6887:0.2054:0.1058	.	224;224	Q32Q62;O76021	.;RL1D1_HUMAN	K	224;224;4	ENSP00000347897:E224K	ENSP00000347897:E224K	E	-	1	0	RSL1D1	11843324	0.242000	0.23868	0.128000	0.21923	0.561000	0.35649	0.529000	0.23019	0.157000	0.19338	0.484000	0.47621	GAG	RSL1D1	-	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF	ENSG00000171490		0.323	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSL1D1	HGNC	protein_coding	OTTHUMT00000252059.2	60	0.00	0	C	NM_015659		11935823	11935823	-1	no_errors	ENST00000571133	ensembl	human	known	69_37n	missense	51	19.05	12	SNP	0.220	T
SACS	26278	genome.wustl.edu	37	13	23907783	23907783	+	Missense_Mutation	SNP	G	G	A	rs555451426		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr13:23907783G>A	ENST00000382292.3	-	9	10505	c.10232C>T	c.(10231-10233)cCg>cTg	p.P3411L	SACS_ENST00000402364.1_Missense_Mutation_p.P2661L|SACS_ENST00000382298.3_Missense_Mutation_p.P3411L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3411					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTTATAGCACGGAAGTGACTT	0.348																																						dbGAP											0													88.0	91.0	90.0					13																	23907783		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10232C>T	13.37:g.23907783G>A	ENSP00000371729:p.Pro3411Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin,superfamily_ATPase-like_ATP-bd,superfamily_DnaJ_N,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_N,pfscan_Ubiquitin_supergroup	p.P3411L	ENST00000382292.3	37	c.10232	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383296	0.82792	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.99691	-6.15;-6.42;-6.15	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.99435	0.9800	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99470	1.0945	10	0.87932	D	0	.	20.3632	0.98871	0.0:0.0:1.0:0.0	.	3411	Q9NZJ4	SACS_HUMAN	L	3411;2661;3411	ENSP00000371729:P3411L;ENSP00000385844:P2661L;ENSP00000371735:P3411L	ENSP00000371729:P3411L	P	-	2	0	SACS	22805783	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.869000	0.99810	2.826000	0.97356	0.561000	0.74099	CCG	SACS	-	NULL	ENSG00000151835		0.348	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	44	0.00	0	G	NM_014363		23907783	23907783	-1	no_errors	ENST00000382292	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	A
SCRN2	90507	genome.wustl.edu	37	17	45916933	45916933	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:45916933C>T	ENST00000290216.9	-	4	558	c.433G>A	c.(433-435)Ggg>Agg	p.G145R	SCRN2_ENST00000584123.1_Missense_Mutation_p.G153R|SCRN2_ENST00000407215.3_Missense_Mutation_p.G145R	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	145						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						CAGTTGCCCCCCTGCCCATAG	0.617																																						dbGAP											0													133.0	128.0	129.0					17																	45916933		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.433G>A	17.37:g.45916933C>T	ENSP00000290216:p.Gly145Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	pfam_Peptidase_C69,pfam_Pept_C45_AAT	p.G145R	ENST00000290216.9	37	c.433	CCDS11519.1	17	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934363	0.92458	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.22945	1.93;1.93	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.57504	0.2058	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.64377	-0.6422	10	0.87932	D	0	-33.1081	17.8079	0.88607	0.0:1.0:0.0:0.0	.	145;145;145	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	R	145	ENSP00000290216:G145R;ENSP00000383935:G145R	ENSP00000290216:G145R	G	-	1	0	SCRN2	43271932	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	7.731000	0.84895	2.504000	0.84457	0.561000	0.74099	GGG	SCRN2	-	pfam_Peptidase_C69,pfam_Pept_C45_AAT	ENSG00000141295		0.617	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN2	HGNC	protein_coding	OTTHUMT00000441383.1	26	0.00	0	C	NM_138355		45916933	45916933	-1	no_errors	ENST00000290216	ensembl	human	known	69_37n	missense	7	76.67	23	SNP	1.000	T
SEC24A	10802	genome.wustl.edu	37	5	134032874	134032874	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:134032874G>T	ENST00000398844.2	+	14	2333	c.2045G>T	c.(2044-2046)gGt>gTt	p.G682V		NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	682					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GACTGTTCTGGTCAGCAAGTT	0.328																																						dbGAP											0													183.0	169.0	173.0					5																	134032874		1851	4105	5956	-	-	-	SO:0001583	missense	0			AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.2045G>T	5.37:g.134032874G>T	ENSP00000381823:p.Gly682Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.G682V	ENST00000398844.2	37	c.2045	CCDS43363.1	5	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315216	0.81358	.	.	ENSG00000113615	ENST00000398844	T	0.45276	0.9	5.59	5.59	0.84812	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	T	0.66458	0.2791	M	0.76838	2.35	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.66196	0.926;0.942	T	0.68213	-0.5468	10	0.56958	D	0.05	-12.9345	19.5944	0.95530	0.0:0.0:1.0:0.0	.	446;682	B4E205;O95486	.;SC24A_HUMAN	V	682	ENSP00000381823:G682V	ENSP00000381823:G682V	G	+	2	0	SEC24A	134060773	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.876000	0.87215	2.627000	0.88993	0.563000	0.77884	GGT	SEC24A	-	pfam_Sec23/24_trunk_dom	ENSG00000113615		0.328	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24A	HGNC	protein_coding	OTTHUMT00000371563.1	117	0.00	0	G			134032874	134032874	+1	no_errors	ENST00000398844	ensembl	human	known	69_37n	missense	24	68.83	53	SNP	1.000	T
SEPT3	55964	genome.wustl.edu	37	22	42388724	42388724	+	Silent	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr22:42388724C>G	ENST00000396426.3	+	8	1077	c.822C>G	c.(820-822)ggC>ggG	p.G274G	SEPT3_ENST00000328414.8_3'UTR|SEPT3_ENST00000396425.3_Silent_p.G274G|SEPT3_ENST00000406029.1_Silent_p.G210G|SEPT3_ENST00000291236.11_Silent_p.G210G	NM_145733.2	NP_663786.2	Q9UH03	SEPT3_HUMAN	septin 3	274	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cell junction (GO:0030054)|septin complex (GO:0031105)|synapse (GO:0045202)	GTP binding (GO:0005525)			breast(1)|kidney(3)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17						AAGTGAATGGCAAGAGGGTCC	0.507																																						dbGAP											0													156.0	121.0	133.0					22																	42388724		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF285107	CCDS14026.2, CCDS14027.2	22q13.2	2013-01-21			ENSG00000100167	ENSG00000100167		"""Septins"""	10750	protein-coding gene	gene with protein product		608314		SEP3			Standard	NM_019106		Approved		uc003bbr.4	Q9UH03	OTTHUMG00000030494	ENST00000396426.3:c.822C>G	22.37:g.42388724C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AHR0|Q2NKJ7|Q59GF7|Q6IBZ6|Q8N3P3|Q9HD35	Silent	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pfam_AIG1,pirsf_Septin,prints_Septin3	p.G274	ENST00000396426.3	37	c.822	CCDS14026.2	22																																																																																			SEPT3	-	pfam_Cell_div_GTP-bd,pirsf_Septin	ENSG00000100167		0.507	SEPT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT3	HGNC	protein_coding	OTTHUMT00000322051.1	66	0.00	0	C	NM_145734		42388724	42388724	+1	no_errors	ENST00000396426	ensembl	human	known	69_37n	silent	60	22.08	17	SNP	1.000	G
SIGLEC7	27036	genome.wustl.edu	37	19	51645628	51645630	+	Start_Codon_Del	DEL	TGC	TGC	-			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr19:51645628_51645630delTGC	ENST00000317643.6	+	0	71_73				SIGLEC7_ENST00000305628.7_Start_Codon_Del|SIGLEC7_ENST00000600577.1_Start_Codon_Del	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7						cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		ACCCCAGATAtgctgctgctgct	0.596																																						dbGAP											0																																										-	-	-	SO:0001582	initiator_codon_variant	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895		19.37:g.51645637_51645639delTGC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	In_Frame_Del	DEL	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L5in_frame_del	ENST00000317643.6	37	c.2_4	CCDS12826.1	19																																																																																			SIGLEC7	-	NULL	ENSG00000168995		0.596	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	16	0.00	0	TGC	NM_016543		51645628	51645630	+1	no_errors	ENST00000317643	ensembl	human	known	69_37n	in_frame_del	17	10.00	2	DEL	0.564:0.611:0.635	-
SIRPA	140885	genome.wustl.edu	37	20	1918063	1918063	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr20:1918063G>C	ENST00000358771.4	+	8	1516	c.1364G>C	c.(1363-1365)aGc>aCc	p.S455T	SIRPA_ENST00000356025.3_Missense_Mutation_p.S455T|SIRPA_ENST00000400068.3_Missense_Mutation_p.S459T	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	455					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GAGTATGCCAGCATTCAGACC	0.617																																					GBM(155;1668 1920 5945 42733 48121)	dbGAP											0													102.0	101.0	101.0					20																	1918063		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.1364G>C	20.37:g.1918063G>C	ENSP00000351621:p.Ser455Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like	p.S459T	ENST00000358771.4	37	c.1376	CCDS13022.1	20	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855437	0.51376	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.19669	2.13;2.13;2.13	4.65	4.65	0.58169	.	0.000000	0.50627	D	0.000103	T	0.32852	0.0843	L	0.29908	0.895	0.33132	D	0.543193	D;D;D	0.69078	0.997;0.996;0.997	D;D;D	0.77557	0.985;0.99;0.985	T	0.39840	-0.9594	10	0.62326	D	0.03	.	12.8788	0.58006	0.0:0.0:1.0:0.0	.	435;459;455	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	T	459;455;455	ENSP00000382941:S459T;ENSP00000348307:S455T;ENSP00000351621:S455T	ENSP00000348307:S455T	S	+	2	0	SIRPA	1866063	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	4.062000	0.57492	2.395000	0.81488	0.585000	0.79938	AGC	SIRPA	-	NULL	ENSG00000198053		0.617	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIRPA	HGNC	protein_coding	OTTHUMT00000077568.2	34	0.00	0	G	NM_080792		1918063	1918063	+1	no_errors	ENST00000400068	ensembl	human	known	69_37n	missense	16	33.33	8	SNP	1.000	C
SLC16A14	151473	genome.wustl.edu	37	2	230924032	230924032	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:230924032C>T	ENST00000295190.4	-	2	495	c.37G>A	c.(37-39)Gaa>Aaa	p.E13K	RNY4P19_ENST00000362530.1_RNA	NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		GGGCCATCTTCAAAATCATAC	0.378																																						dbGAP											0													72.0	68.0	69.0					2																	230924032		2203	4300	6503	-	-	-	SO:0001583	missense	0			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.37G>A	2.37:g.230924032C>T	ENSP00000295190:p.Glu13Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.E13K	ENST00000295190.4	37	c.37	CCDS2473.1	2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931891	0.73442	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034;ENST00000425822;ENST00000436869	T;T;T	0.08984	3.03;3.03;3.03	5.5	5.5	0.81552	.	0.204978	0.34110	N	0.004255	T	0.06554	0.0168	N	0.14661	0.345	0.38855	D	0.956369	B;P	0.47106	0.231;0.89	B;B	0.38378	0.035;0.272	T	0.44345	-0.9334	10	0.33940	T	0.23	.	19.5916	0.95514	0.0:1.0:0.0:0.0	.	13;13	E7EMG7;Q7RTX9	.;MOT14_HUMAN	K	13	ENSP00000295190:E13K;ENSP00000400352:E13K;ENSP00000395775:E13K	ENSP00000295190:E13K	E	-	1	0	SLC16A14	230632276	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.481000	0.66826	2.861000	0.98227	0.655000	0.94253	GAA	SLC16A14	-	NULL	ENSG00000163053		0.378	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A14	HGNC	protein_coding	OTTHUMT00000256918.2	63	0.00	0	C	NM_152527		230924032	230924032	-1	no_errors	ENST00000295190	ensembl	human	known	69_37n	missense	12	71.43	30	SNP	1.000	T
SLC4A7	9497	genome.wustl.edu	37	3	27493965	27493965	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:27493965C>T	ENST00000295736.5	-	2	128	c.58G>A	c.(58-60)Gat>Aat	p.D20N	SLC4A7_ENST00000388777.4_5'UTR|SLC4A7_ENST00000440156.1_Missense_Mutation_p.D29N|SLC4A7_ENST00000437179.1_Missense_Mutation_p.D25N|SLC4A7_ENST00000455077.1_Missense_Mutation_p.D25N|SLC4A7_ENST00000446700.1_Missense_Mutation_p.D25N|SLC4A7_ENST00000454389.1_Missense_Mutation_p.D29N|SLC4A7_ENST00000445684.1_Missense_Mutation_p.D29N|SLC4A7_ENST00000425128.2_Missense_Mutation_p.D25N|SLC4A7_ENST00000428386.1_Missense_Mutation_p.D20N|SLC4A7_ENST00000435667.2_Missense_Mutation_p.D29N	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	20					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	TTGCCAAGATCCACAACAGCT	0.343																																						dbGAP											0													106.0	98.0	101.0					3																	27493965		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.58G>A	3.37:g.27493965C>T	ENSP00000295736:p.Asp20Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.D29N	ENST00000295736.5	37	c.85	CCDS33721.1	3	.	.	.	.	.	.	.	.	.	.	C	29.9	5.049010	0.93740	.	.	ENSG00000033867	ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000425128;ENST00000428179	D;D;D;D;D;D;D;D;D;T;D	0.86865	-2.18;-1.82;-1.69;-1.9;-1.55;-1.84;-1.56;-1.88;-1.6;-0.4;-1.87	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.94561	0.8248	M	0.88570	2.965	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.998;0.993;1.0;1.0;0.993;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.991;0.999;0.991;0.995;0.984;1.0;0.999;0.984;0.999	D	0.94417	0.7637	10	0.48119	T	0.1	.	18.2701	0.90065	0.0:1.0:0.0:0.0	.	29;25;25;29;29;25;20;20;25	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;B6DY53;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	N	20;20;29;29;25;25;25;29;29;25;20	ENSP00000295736:D20N;ENSP00000416368:D20N;ENSP00000390394:D29N;ENSP00000414797:D29N;ENSP00000394252:D25N;ENSP00000406605:D25N;ENSP00000407382:D25N;ENSP00000406804:D29N;ENSP00000395336:D29N;ENSP00000401949:D25N;ENSP00000388703:D20N	ENSP00000295736:D20N	D	-	1	0	SLC4A7	27468969	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.688000	0.74557	2.603000	0.88011	0.591000	0.81541	GAT	SLC4A7	-	NULL	ENSG00000033867		0.343	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2	94	0.00	0	C	NM_003615		27493965	27493965	-1	no_errors	ENST00000454389	ensembl	human	known	69_37n	missense	40	38.46	25	SNP	1.000	T
SLC8A1	6546	genome.wustl.edu	37	2	40655750	40655750	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:40655750C>A	ENST00000403092.1	-	2	1704	c.1671G>T	c.(1669-1671)gaG>gaT	p.E557D	SLC8A1_ENST00000408028.2_Missense_Mutation_p.E557D|SLC8A1_ENST00000405901.3_Missense_Mutation_p.E557D|SLC8A1_ENST00000406785.2_Missense_Mutation_p.E557D|SLC8A1_ENST00000542756.1_Missense_Mutation_p.E557D|SLC8A1_ENST00000332839.4_Missense_Mutation_p.E557D|SLC8A1_ENST00000402441.1_Missense_Mutation_p.E557D|SLC8A1_ENST00000542024.1_Missense_Mutation_p.E557D|SLC8A1_ENST00000405269.1_Missense_Mutation_p.E557D|SLC8A1_ENST00000406391.2_Missense_Mutation_p.E557D			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	557	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ATACTTTCACCTCCATGATGC	0.458																																						dbGAP											0													143.0	146.0	145.0					2																	40655750		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1671G>T	2.37:g.40655750C>A	ENSP00000384763:p.Glu557Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_N,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.E557D	ENST00000403092.1	37	c.1671	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	C	9.631	1.136408	0.21123	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49	6.17	3.43	0.39272	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	L	0.56199	1.76	0.80722	D	1	B;P;B;B;B	0.36412	0.219;0.552;0.074;0.096;0.03	B;P;B;B;B	0.51016	0.085;0.656;0.034;0.118;0.039	T	0.10965	-1.0607	10	0.35671	T	0.21	.	10.144	0.42751	0.0:0.7821:0.0:0.2179	.	557;557;557;557;557	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	D	557	ENSP00000383886:E557D;ENSP00000440727:E557D;ENSP00000384763:E557D;ENSP00000385678:E557D;ENSP00000385188:E557D;ENSP00000385535:E557D;ENSP00000332931:E557D;ENSP00000384908:E557D;ENSP00000385811:E557D;ENSP00000443515:E557D	ENSP00000332931:E557D	E	-	3	2	SLC8A1	40509254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.142000	0.31540	0.487000	0.27698	0.655000	0.94253	GAG	SLC8A1	-	pfam_Calx_beta,smart_Calx_beta,tigrfam_Na_Ca_Ex	ENSG00000183023		0.458	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1	46	0.00	0	C	NM_021097		40655750	40655750	-1	no_errors	ENST00000332839	ensembl	human	known	69_37n	missense	43	27.12	16	SNP	1.000	A
SMC1A	8243	genome.wustl.edu	37	X	53423213	53423214	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chrX:53423213_53423214GG>AT	ENST00000322213.4	-	18	2922_2923	c.2795_2796CC>AT	c.(2794-2796)gCC>gAT	p.A932D		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	932					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GCATCTTACAGGCCTGTAGCAA	0.485																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2795_2796delinsAT	X.37:g.53423213_53423214delinsAT	ENSP00000323421:p.Ala932Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O14995|Q16351|Q2M228	Silent|Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge,prints_Tropomyosin	p.A932|p.A932D	ENST00000322213.4	37	c.2796|c.2795	CCDS14352.1	X																																																																																			SMC1A	-	pfam_RecF/RecN/SMC	ENSG00000072501		0.485	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	69|71	0.00	0	G	NM_006306		53423213|53423214	53423213|53423214	-1	no_errors	ENST00000322213	ensembl	human	known	69_37n	silent|missense	104|106	21.80|21.48	29	SNP	1.000	A|T
SMG1	23049	genome.wustl.edu	37	16	18828730	18828730	+	Silent	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:18828730G>A	ENST00000446231.2	-	57	10369	c.9957C>T	c.(9955-9957)gcC>gcT	p.A3319A	SMG1_ENST00000389467.3_Silent_p.A3320A			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3319					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CCAGGTTTAAGGCTTCTGCAG	0.413																																						dbGAP											0													71.0	63.0	65.0					16																	18828730		1873	4119	5992	-	-	-	SO:0001819	synonymous_variant	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9957C>T	16.37:g.18828730G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.A3320	ENST00000446231.2	37	c.9960	CCDS45430.1	16																																																																																			SMG1	-	NULL	ENSG00000157106		0.413	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	47	0.00	0	G	NM_015092		18828730	18828730	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	silent	36	34.55	19	SNP	1.000	A
SPAG16	79582	genome.wustl.edu	37	2	214160797	214160797	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr2:214160797T>C	ENST00000331683.5	+	2	241	c.146T>C	c.(145-147)aTa>aCa	p.I49T	SPAG16_ENST00000414961.2_3'UTR|SPAG16_ENST00000272898.7_Missense_Mutation_p.I49T|SPAG16_ENST00000447990.1_Missense_Mutation_p.I49T|SPAG16_ENST00000413312.1_Intron|SPAG16_ENST00000374309.3_5'Flank|SPAG16_ENST00000432529.2_Missense_Mutation_p.I49T	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	49				I -> T (in Ref. 4; CAG33640). {ECO:0000305}.	cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GAGGTCACCATAACTGAAGCA	0.284																																						dbGAP											0													91.0	98.0	96.0					2																	214160797		2202	4291	6493	-	-	-	SO:0001583	missense	0			AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.146T>C	2.37:g.214160797T>C	ENSP00000332592:p.Ile49Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I49T	ENST00000331683.5	37	c.146	CCDS2396.1	2	.	.	.	.	.	.	.	.	.	.	T	16.95	3.264094	0.59431	.	.	ENSG00000144451	ENST00000331683;ENST00000432529;ENST00000272898;ENST00000447990	T	0.60040	0.22	5.27	5.27	0.74061	.	0.265245	0.31922	N	0.006844	T	0.69006	0.3063	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.80764	0.987;0.994;0.994	T	0.70890	-0.4749	10	0.59425	D	0.04	.	11.8581	0.52451	0.0:0.0:0.0:1.0	.	49;49;49	Q8N0X2;E7EWV3;Q8N0X2-4	SPG16_HUMAN;.;.	T	49	ENSP00000332592:I49T	ENSP00000272898:I49T	I	+	2	0	SPAG16	213869042	0.998000	0.40836	1.000000	0.80357	0.842000	0.47809	3.237000	0.51344	2.099000	0.63709	0.477000	0.44152	ATA	SPAG16	-	NULL	ENSG00000144451		0.284	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG16	HGNC	protein_coding	OTTHUMT00000256601.2	46	0.00	0	T	NM_024532		214160797	214160797	+1	no_errors	ENST00000331683	ensembl	human	known	69_37n	missense	44	31.25	20	SNP	1.000	C
SPAG17	200162	genome.wustl.edu	37	1	118574321	118574321	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:118574321C>A	ENST00000336338.5	-	25	3668	c.3603G>T	c.(3601-3603)gaG>gaT	p.E1201D		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1201						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTACCTTTTTCTCTTCTTCTT	0.338																																						dbGAP											0													214.0	223.0	220.0					1																	118574321		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3603G>T	1.37:g.118574321C>A	ENSP00000337804:p.Glu1201Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.E1201D	ENST00000336338.5	37	c.3603	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812313	0.50527	.	.	ENSG00000155761	ENST00000336338	T	0.35421	1.31	5.52	3.53	0.40419	.	0.518522	0.20367	N	0.093730	T	0.32255	0.0823	L	0.47716	1.5	0.26382	N	0.976722	D	0.76494	0.999	D	0.80764	0.994	T	0.10543	-1.0625	10	0.37606	T	0.19	.	8.5626	0.33520	0.0:0.8043:0.0:0.1957	.	1201	Q6Q759	SPG17_HUMAN	D	1201	ENSP00000337804:E1201D	ENSP00000337804:E1201D	E	-	3	2	SPAG17	118375844	0.998000	0.40836	1.000000	0.80357	0.580000	0.36256	0.205000	0.17356	0.592000	0.29728	0.655000	0.94253	GAG	SPAG17	-	NULL	ENSG00000155761		0.338	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	137	0.00	0	C	NM_206996		118574321	118574321	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	missense	72	66.04	140	SNP	1.000	A
SPAG5	10615	genome.wustl.edu	37	17	26905075	26905075	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:26905075C>G	ENST00000321765.5	-	23	3795	c.3463G>C	c.(3463-3465)Gac>Cac	p.D1155H	ALDOC_ENST00000226253.4_5'Flank|ALDOC_ENST00000395319.3_5'Flank|ALDOC_ENST00000395321.2_5'Flank	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	1155					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					AACTCCTTGTCAGAGCGCCGA	0.418																																						dbGAP											0													114.0	110.0	111.0					17																	26905075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.3463G>C	17.37:g.26905075C>G	ENSP00000323300:p.Asp1155His	Somatic		WXS	Illumina GAIIx	Phase_IV	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	NULL	p.D1155H	ENST00000321765.5	37	c.3463	CCDS32594.1	17	.	.	.	.	.	.	.	.	.	.	c	17.81	3.479650	0.63849	.	.	ENSG00000076382	ENST00000321765	.	.	.	5.74	5.74	0.90152	.	0.299988	0.29002	N	0.013456	T	0.66858	0.2832	L	0.32530	0.975	0.39289	D	0.964707	D	0.89917	1.0	D	0.76575	0.988	T	0.69176	-0.5214	9	0.56958	D	0.05	-3.214	15.4374	0.75157	0.0:1.0:0.0:0.0	.	1155	Q96R06	SPAG5_HUMAN	H	1155	.	ENSP00000323300:D1155H	D	-	1	0	SPAG5	23929202	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.374000	0.44274	2.721000	0.93114	0.651000	0.88453	GAC	SPAG5	-	NULL	ENSG00000076382		0.418	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG5	HGNC	protein_coding	OTTHUMT00000390564.2	62	0.00	0	C	NM_006461		26905075	26905075	-1	no_errors	ENST00000321765	ensembl	human	known	69_37n	missense	53	23.19	16	SNP	1.000	G
SPTA1	6708	genome.wustl.edu	37	1	158619688	158619688	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:158619688C>T	ENST00000368147.4	-	25	3707	c.3527G>A	c.(3526-3528)cGg>cAg	p.R1176Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1176					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CAGCAGCTGCCGCTGTTCATC	0.443																																						dbGAP											0													29.0	29.0	29.0					1																	158619688		1836	4088	5924	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3527G>A	1.37:g.158619688C>T	ENSP00000357129:p.Arg1176Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.R1176Q	ENST00000368147.4	37	c.3527	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.367337	0.41902	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51325	0.71;0.71	5.08	3.08	0.35506	.	0.659654	0.11731	N	0.534923	T	0.14013	0.0339	N	0.17838	0.53	0.25405	N	0.988405	B	0.24920	0.114	B	0.25291	0.059	T	0.24657	-1.0154	10	0.39692	T	0.17	.	7.8067	0.29206	0.0:0.771:0.0:0.229	.	1176	P02549	SPTA1_HUMAN	Q	1176	ENSP00000357130:R1176Q;ENSP00000357129:R1176Q	ENSP00000357129:R1176Q	R	-	2	0	SPTA1	156886312	1.000000	0.71417	0.773000	0.31616	0.963000	0.63663	4.041000	0.57339	0.579000	0.29504	0.650000	0.86243	CGG	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.443	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	23	0.00	0	C	NM_003126		158619688	158619688	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	T
SPTB	6710	genome.wustl.edu	37	14	65253616	65253616	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr14:65253616C>T	ENST00000389721.5	-	15	3099	c.3067G>A	c.(3067-3069)Gac>Aac	p.D1023N	SPTB_ENST00000556626.1_Missense_Mutation_p.D1023N|SPTB_ENST00000389722.3_Missense_Mutation_p.D1023N|SPTB_ENST00000542895.1_Missense_Mutation_p.D1023N|SPTB_ENST00000389720.3_Missense_Mutation_p.D1023N	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1023					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GGGTGCGAGTCCATCAGCTGC	0.612																																						dbGAP											0													83.0	82.0	82.0					14																	65253616		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3067G>A	14.37:g.65253616C>T	ENSP00000374371:p.Asp1023Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.D1023N	ENST00000389721.5	37	c.3067	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	C	9.726	1.160958	0.21538	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	4.89	2.85	0.33270	.	0.604283	0.17018	N	0.190228	T	0.26521	0.0648	N	0.04636	-0.2	0.09310	N	0.999998	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.15407	-1.0438	10	0.30078	T	0.28	.	14.2243	0.65848	0.0:0.7183:0.2817:0.0	.	1023;1027	P11277;Q59FP5	SPTB1_HUMAN;.	N	1027;1023;1023;1023;1023;1023	ENSP00000374372:D1023N;ENSP00000451752:D1023N;ENSP00000374371:D1023N;ENSP00000443882:D1023N;ENSP00000374370:D1023N	ENSP00000374370:D1023N	D	-	1	0	SPTB	64323369	0.000000	0.05858	0.994000	0.49952	0.794000	0.44872	-0.754000	0.04787	1.125000	0.41998	0.549000	0.68633	GAC	SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000070182		0.612	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	38	0.00	0	C			65253616	65253616	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	missense	5	83.87	26	SNP	0.866	T
ST6GALNAC6	30815	genome.wustl.edu	37	9	130648843	130648843	+	3'UTR	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr9:130648843C>G	ENST00000373146.1	-	0	1216				ST6GALNAC6_ENST00000291839.5_3'UTR|ST6GALNAC6_ENST00000542456.1_3'UTR|ST6GALNAC6_ENST00000373142.1_Missense_Mutation_p.G345R|ST6GALNAC6_ENST00000373141.1_3'UTR|ST6GALNAC6_ENST00000373144.3_3'UTR|ST6GALNAC6_ENST00000485320.1_5'UTR|RP11-203J24.9_ENST00000476274.2_RNA			Q969X2	SIA7F_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6						cell-cell recognition (GO:0009988)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GCTGCTTCTCCTCTGACCCTC	0.617																																						dbGAP											0													67.0	56.0	60.0					9																	130648843		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC006564	CCDS6882.1, CCDS69668.1, CCDS69669.1, CCDS75908.1	9q34.13	2013-03-01		2005-02-07	ENSG00000160408	ENSG00000160408		"""Sialyltransferases"""	23364	protein-coding gene	gene with protein product		610135	"""sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F"""	SIAT7F		12668675	Standard	XM_005251952		Approved	ST6GALNACVI	uc004bso.1	Q969X2	OTTHUMG00000020718	ENST00000373146.1:c.*35G>C	9.37:g.130648843C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ01|Q5T9C4|Q5T9C5|Q9H8A2|Q9ULB8	Missense_Mutation	SNP	pfam_Glyco_trans_29	p.G345R	ENST00000373146.1	37	c.1033	CCDS6882.1	9	.	.	.	.	.	.	.	.	.	.	C	11.63	1.697355	0.30142	.	.	ENSG00000160408	ENST00000373142	T	0.32515	1.45	4.89	2.87	0.33458	.	7739.210000	0.00166	N	0.000000	T	0.33498	0.0865	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.27088	-1.0084	7	0.72032	D	0.01	.	6.5427	0.22388	0.0:0.7481:0.0:0.2519	.	.	.	.	R	345	ENSP00000362235:G345R	ENSP00000362235:G345R	G	-	1	0	ST6GALNAC6	129688664	0.000000	0.05858	0.005000	0.12908	0.026000	0.11368	0.383000	0.20651	0.372000	0.24591	0.655000	0.94253	GGA	ST6GALNAC6	-	NULL	ENSG00000160408		0.617	ST6GALNAC6-007	KNOWN	basic|CCDS	protein_coding	ST6GALNAC6	HGNC	protein_coding	OTTHUMT00000054278.1	29	0.00	0	C	NM_013443		130648843	130648843	-1	no_errors	ENST00000373142	ensembl	human	putative	69_37n	missense	14	44.00	11	SNP	0.050	G
SULT1B1	27284	genome.wustl.edu	37	4	70599960	70599960	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr4:70599960G>A	ENST00000310613.3	-	5	695	c.398C>T	c.(397-399)gCc>gTc	p.A133V		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	133					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						AACATCCTTGGCATTACGAGC	0.363																																						dbGAP											0													29.0	30.0	29.0					4																	70599960		2201	4298	6499	-	-	-	SO:0001583	missense	0			D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.398C>T	4.37:g.70599960G>A	ENSP00000308770:p.Ala133Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.A133V	ENST00000310613.3	37	c.398	CCDS3530.1	4	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247403	0.59103	.	.	ENSG00000173597	ENST00000310613;ENST00000510821	T;T	0.01745	4.66;4.66	4.67	3.8	0.43715	Sulfotransferase domain (1);	0.242394	0.28989	N	0.013492	T	0.02727	0.0082	M	0.62154	1.92	0.43047	D	0.994643	P	0.44478	0.836	B	0.36766	0.232	T	0.54689	-0.8256	10	0.56958	D	0.05	.	12.4872	0.55879	0.0:0.1776:0.8224:0.0	.	133	O43704	ST1B1_HUMAN	V	133	ENSP00000308770:A133V;ENSP00000425464:A133V	ENSP00000308770:A133V	A	-	2	0	SULT1B1	70634549	1.000000	0.71417	1.000000	0.80357	0.120000	0.20174	5.619000	0.67729	1.052000	0.40392	0.460000	0.39030	GCC	SULT1B1	-	pfam_Sulfotransferase_dom	ENSG00000173597		0.363	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1B1	HGNC	protein_coding	OTTHUMT00000251563.2	40	0.00	0	G	NM_014465		70599960	70599960	-1	no_errors	ENST00000310613	ensembl	human	known	69_37n	missense	16	51.52	17	SNP	1.000	A
SVIL	6840	genome.wustl.edu	37	10	29812859	29812859	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr10:29812859C>T	ENST00000355867.4	-	15	3436	c.2684G>A	c.(2683-2685)cGc>cAc	p.R895H	SVIL_ENST00000535393.1_5'Flank|SVIL_ENST00000375398.2_Missense_Mutation_p.R895H|SVIL_ENST00000375400.3_Missense_Mutation_p.R469H	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	895					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TGGCTTTGTGCGAAGATCTCC	0.468																																						dbGAP											0													73.0	74.0	73.0					10																	29812859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2684G>A	10.37:g.29812859C>T	ENSP00000348128:p.Arg895His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.R895H	ENST00000355867.4	37	c.2684	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	C	5.767	0.325816	0.10900	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.10860	2.83;2.85;2.85	5.57	5.57	0.84162	.	0.052944	0.64402	D	0.000001	T	0.08179	0.0204	L	0.38953	1.18	0.58432	D	0.999998	B;B	0.18610	0.029;0.017	B;B	0.13407	0.009;0.004	T	0.29366	-1.0014	9	.	.	.	-23.2978	6.6806	0.23117	0.0:0.7085:0.1688:0.1227	.	469;895	O95425-2;O95425	.;SVIL_HUMAN	H	469;895;895	ENSP00000364549:R469H;ENSP00000364547:R895H;ENSP00000348128:R895H	.	R	-	2	0	SVIL	29852865	0.388000	0.25197	0.565000	0.28409	0.015000	0.08874	1.148000	0.31614	2.622000	0.88805	0.655000	0.94253	CGC	SVIL	-	NULL	ENSG00000197321		0.468	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	51	0.00	0	C			29812859	29812859	-1	no_errors	ENST00000355867	ensembl	human	known	69_37n	missense	9	83.93	47	SNP	0.424	T
SYNE2	23224	genome.wustl.edu	37	14	64469831	64469831	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr14:64469831G>T	ENST00000344113.4	+	30	4392	c.4180G>T	c.(4180-4182)Ggt>Tgt	p.G1394C	SYNE2_ENST00000554584.1_Missense_Mutation_p.G1394C|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Missense_Mutation_p.G1394C	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1394					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGCTGAACGGGGTGATGACAC	0.388																																						dbGAP											0													101.0	93.0	96.0					14																	64469831		1854	4103	5957	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.4180G>T	14.37:g.64469831G>T	ENSP00000341781:p.Gly1394Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.G1394C	ENST00000344113.4	37	c.4180	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537054	0.27475	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.64618	0.21;0.22;-0.11	5.51	5.51	0.81932	.	0.117483	0.37857	N	0.001914	T	0.76891	0.4051	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.77397	-0.2603	10	0.56958	D	0.05	.	17.6018	0.88027	0.0:0.0:1.0:0.0	.	1394;1394	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	C	1394	ENSP00000350719:G1394C;ENSP00000341781:G1394C;ENSP00000452570:G1394C	ENSP00000261678:G1394C	G	+	1	0	SYNE2	63539584	0.995000	0.38212	0.056000	0.19401	0.270000	0.26580	3.723000	0.54955	2.589000	0.87451	0.655000	0.94253	GGT	SYNE2	-	NULL	ENSG00000054654		0.388	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	37	0.00	0	G	NM_182914		64469831	64469831	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	4	80.00	16	SNP	0.639	T
TLN1	7094	genome.wustl.edu	37	9	35713254	35713254	+	Silent	SNP	G	G	C	rs372788337		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr9:35713254G>C	ENST00000314888.9	-	26	3644	c.3291C>G	c.(3289-3291)gcC>gcG	p.A1097A	TLN1_ENST00000540444.1_Silent_p.A1097A	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1097					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGAGCTCACGGCTTTGGTGC	0.547																																						dbGAP											0													59.0	49.0	52.0					9																	35713254		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.3291C>G	9.37:g.35713254G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.A1097	ENST00000314888.9	37	c.3291	CCDS35009.1	9																																																																																			TLN1	-	superfamily_Vinculin/catenin	ENSG00000137076		0.547	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	35	0.00	0	G	NM_006289		35713254	35713254	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	silent	11	42.11	8	SNP	0.002	C
TP53	7157	genome.wustl.edu	37	17	7577085	7577085	+	Missense_Mutation	SNP	C	C	T	rs112431538		TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:7577085C>T	ENST00000269305.4	-	8	1042	c.853G>A	c.(853-855)Gag>Aag	p.E285K	TP53_ENST00000420246.2_Missense_Mutation_p.E285K|TP53_ENST00000445888.2_Missense_Mutation_p.E285K|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.E285K|TP53_ENST00000455263.2_Missense_Mutation_p.E285K|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	285	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726, ECO:0000269|PubMed:1694291}.|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E285K(111)|p.E285*(24)|p.0?(8)|p.E285Q(4)|p.?(2)|p.R283fs*16(2)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.E285fs*20(1)|p.E285fs*13(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTCTTCCTCTGTGCGCCGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	165	Substitution - Missense(115)|Substitution - Nonsense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	urinary_tract(53)|breast(18)|large_intestine(15)|lung(11)|upper_aerodigestive_tract(10)|stomach(8)|haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(6)|oesophagus(6)|liver(6)|skin(5)|prostate(4)|bone(4)|biliary_tract(3)|ovary(3)|adrenal_gland(1)|soft_tissue(1)|eye(1)|pancreas(1)|thyroid(1)	GRCh37	CM995136	TP53	M	rs112431538						91.0	78.0	82.0					17																	7577085		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.853G>A	17.37:g.7577085C>T	ENSP00000269305:p.Glu285Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E285K	ENST00000269305.4	37	c.853	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703759	0.88924	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99816	-6.91;-6.91;-6.91;-6.91;-6.91;-6.91	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.89904	3.07	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.994;0.983;0.994;0.998	D	0.96661	0.9489	10	0.87932	D	0	-38.0538	15.807	0.78520	0.0:1.0:0.0:0.0	.	285;285;285;285	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	285;285;285;285;285;274;153	ENSP00000352610:E285K;ENSP00000269305:E285K;ENSP00000398846:E285K;ENSP00000391127:E285K;ENSP00000391478:E285K;ENSP00000425104:E153K	ENSP00000269305:E285K	E	-	1	0	TP53	7517810	1.000000	0.71417	0.900000	0.35374	0.716000	0.41182	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	53	0.00	0	C	NM_000546		7577085	7577085	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	15	78.26	54	SNP	0.995	T
TRAPPC8	22878	genome.wustl.edu	37	18	29480942	29480942	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr18:29480942G>C	ENST00000283351.4	-	10	1771	c.1436C>G	c.(1435-1437)cCa>cGa	p.P479R	TRAPPC8_ENST00000582513.1_Missense_Mutation_p.P479R|TRAPPC8_ENST00000582539.1_Missense_Mutation_p.P425R	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	479					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AGCAGGATATGGCCTAGGTGC	0.358																																						dbGAP											0													95.0	91.0	92.0					18																	29480942		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1436C>G	18.37:g.29480942G>C	ENSP00000283351:p.Pro479Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	NULL	p.P479R	ENST00000283351.4	37	c.1436	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664150	0.47572	.	.	ENSG00000153339	ENST00000283351	T	0.15834	2.39	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.22399	0.0540	L	0.31420	0.93	0.80722	D	1	B;P	0.46706	0.137;0.883	B;P	0.49887	0.115;0.625	T	0.00761	-1.1577	10	0.25106	T	0.35	.	19.8192	0.96586	0.0:0.0:1.0:0.0	.	479;479	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	R	479	ENSP00000283351:P479R	ENSP00000283351:P479R	P	-	2	0	TRAPPC8	27734940	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.334000	0.96470	2.751000	0.94390	0.644000	0.83932	CCA	TRAPPC8	-	NULL	ENSG00000153339		0.358	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	66	0.00	0	G	NM_014939		29480942	29480942	-1	no_errors	ENST00000283351	ensembl	human	known	69_37n	missense	30	31.82	14	SNP	1.000	C
TRIM64C	646754	genome.wustl.edu	37	11	49075726	49075726	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:49075726C>T	ENST00000530230.1	-	7	883	c.884G>A	c.(883-885)tGc>tAc	p.C295Y		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	295	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GCTTATATAGCAAGGAGTCAT	0.453																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.884G>A	11.37:g.49075726C>T	ENSP00000431987:p.Cys295Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.C295Y	ENST00000530230.1	37	c.884		11	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.199148	0.00299	.	.	ENSG00000214891	ENST00000530230	T	0.06068	3.35	1.31	0.21	0.15231	.	.	.	.	.	T	0.04407	0.0121	L	0.35487	1.065	0.09310	N	1	.	.	.	.	.	.	T	0.45716	-0.9242	7	0.14252	T	0.57	.	3.1058	0.06341	0.0:0.5963:0.0:0.4037	.	.	.	.	Y	295	ENSP00000431987:C295Y	ENSP00000431987:C295Y	C	-	2	0	TRIM64C	49032302	0.000000	0.05858	0.000000	0.03702	0.287000	0.27160	-0.761000	0.04751	0.070000	0.16634	0.184000	0.17185	TGC	TRIM64C	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY	ENSG00000214891		0.453	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	17	0.00	0	C			49075726	49075726	-1	no_errors	ENST00000530230	ensembl	human	known	69_37n	missense	2	85.71	12	SNP	0.001	T
TRIO	7204	genome.wustl.edu	37	5	14498736	14498736	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:14498736C>A	ENST00000344204.4	+	53	8343	c.8319C>A	c.(8317-8319)agC>agA	p.S2773R	TRIO_ENST00000344135.5_Missense_Mutation_p.S272R|TRIO_ENST00000537187.1_Missense_Mutation_p.S2597R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2773	Ig-like C2-type.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CGTCGGCCAGCCTGAGGGTCC	0.567																																						dbGAP											0													187.0	159.0	168.0					5																	14498736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8319C>A	5.37:g.14498736C>A	ENSP00000339299:p.Ser2773Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S2773R	ENST00000344204.4	37	c.8319	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025901	0.75390	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000344135	T;T;T	0.68479	-0.33;-0.33;-0.33	5.3	-4.86	0.03132	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.044446	0.85682	D	0.000000	T	0.63733	0.2536	L	0.27053	0.805	0.21553	N	0.999642	D	0.76494	0.999	D	0.72625	0.978	T	0.62718	-0.6795	10	0.17832	T	0.49	.	14.535	0.67953	0.0:0.1704:0.0:0.8296	.	2773	O75962	TRIO_HUMAN	R	2773;2597;2460;272	ENSP00000339299:S2773R;ENSP00000446348:S2597R;ENSP00000339291:S272R	ENSP00000339291:S272R	S	+	3	2	TRIO	14551736	0.719000	0.27986	0.959000	0.39883	0.800000	0.45204	-0.177000	0.09796	-0.839000	0.04212	0.643000	0.83706	AGC	TRIO	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000038382		0.567	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	48	0.00	0	C	NM_007118		14498736	14498736	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.966	A
TTC17	55761	genome.wustl.edu	37	11	43427136	43427136	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr11:43427136G>A	ENST00000039989.4	+	12	1566	c.1552G>A	c.(1552-1554)Gaa>Aaa	p.E518K	TTC17_ENST00000526774.1_3'UTR|TTC17_ENST00000299240.6_Missense_Mutation_p.E518K	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	518					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						TGTTGGTGGGGAATTGCCAAC	0.428																																						dbGAP											0													137.0	146.0	143.0					11																	43427136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.1552G>A	11.37:g.43427136G>A	ENSP00000039989:p.Glu518Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XAB3|Q8NEC0	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E518K	ENST00000039989.4	37	c.1552	CCDS31466.1	11	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030273	0.54790	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.33438	1.41;1.43	5.64	5.64	0.86602	.	0.158923	0.56097	D	0.000027	T	0.40909	0.1136	L	0.43152	1.355	0.31561	N	0.657536	P;P;D	0.53745	0.947;0.704;0.962	P;B;P	0.52481	0.585;0.106;0.7	T	0.26608	-1.0098	10	0.28530	T	0.3	-21.5055	19.6932	0.96010	0.0:0.0:1.0:0.0	.	518;518;518	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	K	518	ENSP00000299240:E518K;ENSP00000039989:E518K	ENSP00000039989:E518K	E	+	1	0	TTC17	43383712	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.669000	0.61575	2.664000	0.90586	0.655000	0.94253	GAA	TTC17	-	NULL	ENSG00000052841		0.428	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	HGNC	protein_coding	OTTHUMT00000389577.2	48	0.00	0	G	NM_018259		43427136	43427136	+1	no_errors	ENST00000039989	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.998	A
UHRF1BP1L	23074	genome.wustl.edu	37	12	100451948	100451948	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr12:100451948G>T	ENST00000279907.7	-	14	3319	c.3107C>A	c.(3106-3108)aCt>aAt	p.T1036N	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.T686N	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1036										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						TCCTTTACTAGTTAAAGTACT	0.323																																						dbGAP											0													68.0	74.0	72.0					12																	100451948		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3107C>A	12.37:g.100451948G>T	ENSP00000279907:p.Thr1036Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.T1036N	ENST00000279907.7	37	c.3107	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	G	2.756	-0.258990	0.05791	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.09350	2.99;2.99	6.02	0.327	0.15913	.	1.008370	0.07947	N	0.980237	T	0.05686	0.0149	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43360	-0.9396	10	0.30078	T	0.28	-0.6113	3.4225	0.07398	0.1301:0.2735:0.395:0.2014	.	1036	A0JNW5	UH1BL_HUMAN	N	1036;686	ENSP00000279907:T1036N;ENSP00000444824:T686N	ENSP00000279907:T1036N	T	-	2	0	UHRF1BP1L	98976079	0.037000	0.19845	0.001000	0.08648	0.647000	0.38526	-0.361000	0.07612	0.116000	0.18110	0.650000	0.86243	ACT	UHRF1BP1L	-	NULL	ENSG00000111647		0.323	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	43	0.00	0	G	NM_001006947		100451948	100451948	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	missense	17	58.54	24	SNP	0.000	T
VCAN	1462	genome.wustl.edu	37	5	82807965	82807965	+	Silent	SNP	G	G	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr5:82807965G>A	ENST00000265077.3	+	6	1357	c.792G>A	c.(790-792)gaG>gaA	p.E264E	VCAN_ENST00000513984.1_Silent_p.E264E|VCAN_ENST00000343200.5_Silent_p.E264E|VCAN_ENST00000502527.2_Silent_p.E264E|VCAN_ENST00000342785.4_Silent_p.E264E|VCAN_ENST00000512590.2_Silent_p.E216E	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	264	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TCACCTTCGAGGAGGCTGCAA	0.488																																						dbGAP											0													62.0	58.0	59.0					5																	82807965		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.792G>A	5.37:g.82807965G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.E264	ENST00000265077.3	37	c.792	CCDS4060.1	5																																																																																			VCAN	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link	ENSG00000038427		0.488	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	35	0.00	0	G	NM_004385		82807965	82807965	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	silent	3	70.00	7	SNP	1.000	A
VPS13C	54832	genome.wustl.edu	37	15	62219354	62219354	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr15:62219354A>C	ENST00000261517.5	-	52	6525	c.6452T>G	c.(6451-6453)gTg>gGg	p.V2151G	VPS13C_ENST00000395898.3_Missense_Mutation_p.V2108G|VPS13C_ENST00000249837.3_Missense_Mutation_p.V2108G|VPS13C_ENST00000395896.4_Missense_Mutation_p.V2151G	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CAGATCTCTCACAGAAGCTTC	0.463																																						dbGAP											0													152.0	147.0	149.0					15																	62219354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6452T>G	15.37:g.62219354A>C	ENSP00000261517:p.Val2151Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.V2151G	ENST00000261517.5	37	c.6452	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	A	26.6	4.756877	0.89843	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.52754	0.65;0.65;0.65	5.41	5.41	0.78517	.	0.144833	0.48286	D	0.000197	T	0.65964	0.2742	M	0.72894	2.215	0.80722	D	1	P;D;D;P	0.56746	0.917;0.977;0.959;0.932	P;P;P;P	0.62298	0.697;0.9;0.857;0.677	T	0.70256	-0.4922	10	0.87932	D	0	.	15.7411	0.77899	1.0:0.0:0.0:0.0	.	2108;2151;2108;2151	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	G	2108;2151;2151;2151	ENSP00000249837:V2108G;ENSP00000261517:V2151G;ENSP00000379233:V2151G	ENSP00000249837:V2108G	V	-	2	0	VPS13C	60006646	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.678000	0.91211	2.171000	0.68590	0.533000	0.62120	GTG	VPS13C	-	NULL	ENSG00000129003		0.463	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	41	0.00	0	A	NM_017684		62219354	62219354	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	C
VPS13D	55187	genome.wustl.edu	37	1	12446242	12446242	+	Splice_Site	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:12446242A>G	ENST00000358136.3	+	60	11614		c.e60-1		VPS13D_ENST00000356315.4_Splice_Site|VPS13D_ENST00000496628.1_Splice_Site	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GTTTCCTTTCAGGTGCTTGTG	0.393																																						dbGAP											0													169.0	171.0	170.0					1																	12446242		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.11485-1A>G	1.37:g.12446242A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e59-2	ENST00000358136.3	37	c.11485-2	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.195544	0.78902	.	.	ENSG00000048707	ENST00000356315;ENST00000358136;ENST00000011700	.	.	.	6.17	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9648	0.58478	0.8787:0.0:0.0:0.1213	.	.	.	.	.	-1	.	.	.	+	.	.	VPS13D	12368829	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.391000	0.90177	1.130000	0.42092	0.533000	0.62120	.	VPS13D	-	-	ENSG00000048707		0.393	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	98	0	0	A	NM_015378	Intron	12446242	12446242	+1	no_errors	ENST00000358136	ensembl	human	known	69_37n	splice_site	102	16.39	20	SNP	1.000	G
VWA3A	146177	genome.wustl.edu	37	16	22128179	22128179	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:22128179G>T	ENST00000389398.5	+	10	1011	c.915G>T	c.(913-915)caG>caT	p.Q305H	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	305						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GCGATGATCAGATGCCCCCTG	0.567																																						dbGAP											0													94.0	88.0	90.0					16																	22128179		2029	4178	6207	-	-	-	SO:0001583	missense	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.915G>T	16.37:g.22128179G>T	ENSP00000374049:p.Gln305His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.Q305H	ENST00000389398.5	37	c.915	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.302674	0.01353	.	.	ENSG00000175267	ENST00000310694;ENST00000389398	T	0.08546	3.08	5.54	2.26	0.28386	.	0.730235	0.12694	N	0.446964	T	0.03783	0.0107	N	0.20610	0.595	0.18873	N	0.999982	B	0.06786	0.001	B	0.09377	0.004	T	0.45891	-0.9230	10	0.02654	T	1	.	3.0051	0.06026	0.1018:0.2148:0.5228:0.1607	.	305	A6NCI4	VWA3A_HUMAN	H	205;305	ENSP00000374049:Q305H	ENSP00000308827:Q205H	Q	+	3	2	VWA3A	22035680	0.057000	0.20700	0.472000	0.27241	0.031000	0.12232	0.005000	0.13129	0.631000	0.30412	0.655000	0.94253	CAG	VWA3A	-	NULL	ENSG00000175267		0.567	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	62	0.00	0	G			22128179	22128179	+1	no_errors	ENST00000389398	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.086	T
WDR49	151790	genome.wustl.edu	37	3	167217996	167217996	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr3:167217996delC	ENST00000308378.3	-	14	2225	c.1920delG	c.(1918-1920)aggfs	p.R640fs	WDR49_ENST00000453925.2_Frame_Shift_Del_p.R605fs|WDR49_ENST00000476376.1_Frame_Shift_Del_p.R465fs|WDR49_ENST00000479765.1_Intron	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	640										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						CTGGTTCTTTCCTAAAGTATT	0.438																																						dbGAP											0													146.0	163.0	157.0					3																	167217996		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.1920delG	3.37:g.167217996delC	ENSP00000311343:p.Arg640fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N297	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E642fs	ENST00000308378.3	37	c.1920	CCDS3201.1	3																																																																																			WDR49	-	NULL	ENSG00000174776		0.438	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3	51	0.00	0	C	NM_178824		167217996	167217996	-1	no_errors	ENST00000308378	ensembl	human	known	69_37n	frame_shift_del	71	11.25	9	DEL	0.034	-
WLS	79971	genome.wustl.edu	37	1	68624831	68624831	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr1:68624831A>G	ENST00000262348.4	-	3	732	c.479T>C	c.(478-480)cTc>cCc	p.L160P	WLS_ENST00000354777.2_Missense_Mutation_p.L158P|GNG12-AS1_ENST00000420587.1_RNA|WLS_ENST00000540432.1_Missense_Mutation_p.L160P|GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000370976.3_Missense_Mutation_p.L69P	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	160	Interacts with Wnt proteins. {ECO:0000250}.				anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						GGTGCATTTGAGTTTCCGTGG	0.458																																						dbGAP											0													184.0	148.0	160.0					1																	68624831		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.479T>C	1.37:g.68624831A>G	ENSP00000262348:p.Leu160Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	NULL	p.L160P	ENST00000262348.4	37	c.479	CCDS642.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.92|19.92	3.916222|3.916222	0.73098|0.73098	.|.	.|.	ENSG00000116729|ENSG00000116729	ENST00000540432;ENST00000354777;ENST00000262348;ENST00000370976;ENST00000533537;ENST00000530486;ENST00000370973;ENST00000471243|ENST00000534713	T;T;T;T|.	0.60171|.	0.23;0.21;0.28;0.29|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73791|0.73791	0.3632|0.3632	M|M	0.83603|0.83603	2.65|2.65	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.994;1.0;1.0|.	D;D;D;D|.	0.73380|.	0.98;0.917;0.98;0.98|.	T|T	0.76523|0.76523	-0.2928|-0.2928	10|5	0.87932|.	D|.	0|.	-14.2087|-14.2087	16.4075|16.4075	0.83691|0.83691	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	160;69;160;158|.	F5H4K0;Q5JRS7;Q5T9L3;Q5T9L3-2|.	.;.;WLS_HUMAN;.|.	P|P	160;158;160;69;27;115;27;115|63	ENSP00000446112:L160P;ENSP00000346829:L158P;ENSP00000262348:L160P;ENSP00000360015:L69P|.	ENSP00000262348:L160P|.	L|S	-|-	2|1	0|0	WLS|WLS	68397419|68397419	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.450000|0.450000	0.32258|0.32258	8.619000|8.619000	0.90938|0.90938	2.275000|2.275000	0.75901|0.75901	0.528000|0.528000	0.53228|0.53228	CTC|TCA	WLS	-	NULL	ENSG00000116729		0.458	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WLS	HGNC	protein_coding	OTTHUMT00000025368.1	41	0.00	0	A	NM_024911		68624831	68624831	-1	no_errors	ENST00000540432	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	1.000	G
ZCWPW1	55063	genome.wustl.edu	37	7	100007160	100007160	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr7:100007160A>C	ENST00000398027.2	-	9	1006	c.759T>G	c.(757-759)tgT>tgG	p.C253W	ZCWPW1_ENST00000324725.6_Missense_Mutation_p.C133W|ZCWPW1_ENST00000490721.1_Missense_Mutation_p.C133W|ZCWPW1_ENST00000360951.4_Missense_Mutation_p.C254W	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	253							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCCAGACCAGACATTGACCTG	0.448																																						dbGAP											0													53.0	50.0	51.0					7																	100007160		1834	4094	5928	-	-	-	SO:0001583	missense	0			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.759T>G	7.37:g.100007160A>C	ENSP00000381109:p.Cys253Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,smart_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.C253W	ENST00000398027.2	37	c.759	CCDS43623.1	7	.	.	.	.	.	.	.	.	.	.	A	15.40	2.822325	0.50739	.	.	ENSG00000078487	ENST00000398027;ENST00000490721;ENST00000360951;ENST00000324725;ENST00000471336;ENST00000379559	T;T;T;T;T	0.57107	0.84;0.89;0.86;0.89;0.42	4.72	2.33	0.28932	Zinc finger, CW-type (1);	0.761679	0.11763	N	0.531868	T	0.48352	0.1495	L	0.34521	1.04	0.21355	N	0.999714	D;D;D;D;D	0.63880	0.993;0.957;0.98;0.957;0.989	P;B;P;B;P	0.53313	0.667;0.43;0.533;0.43;0.723	T	0.26985	-1.0087	9	.	.	.	0.6269	5.7282	0.18024	0.7815:0.0:0.2185:0.0	.	254;214;255;253;133	B4DUQ2;B4DXS7;C9J435;Q9H0M4;Q9H0M4-4	.;.;.;ZCPW1_HUMAN;.	W	253;133;254;133;3;255	ENSP00000381109:C253W;ENSP00000419187:C133W;ENSP00000354210:C254W;ENSP00000314880:C133W;ENSP00000418351:C3W	.	C	-	3	2	ZCWPW1	99845096	0.018000	0.18449	0.898000	0.35279	0.949000	0.60115	0.562000	0.23531	0.654000	0.30846	0.528000	0.53228	TGT	ZCWPW1	-	pfscan_Znf_CW	ENSG00000078487		0.448	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZCWPW1	HGNC	protein_coding	OTTHUMT00000356083.1	34	0.00	0	A	NM_017984		100007160	100007160	-1	no_errors	ENST00000398027	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	0.074	C
ZNF286A	57335	genome.wustl.edu	37	17	15619893	15619893	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr17:15619893T>G	ENST00000464847.2	+	5	1408	c.855T>G	c.(853-855)aaT>aaG	p.N285K	ZNF286A_ENST00000593105.1_Missense_Mutation_p.N275K|ZNF286A_ENST00000413242.2_Missense_Mutation_p.N285K|ZNF286A_ENST00000421016.1_Missense_Mutation_p.N285K|ZNF286A_ENST00000395894.2_3'UTR|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000583566.1_Missense_Mutation_p.N285K			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	285					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		ACAGAGCTAATTTAACTAAAC	0.408																																						dbGAP											0													42.0	44.0	43.0					17																	15619893		2202	4295	6497	-	-	-	SO:0001583	missense	0			AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.855T>G	17.37:g.15619893T>G	ENSP00000464218:p.Asn285Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKF9|Q96JF3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N285K	ENST00000464847.2	37	c.855	CCDS11172.1	17	.	.	.	.	.	.	.	.	.	.	t	15.10	2.732858	0.48939	.	.	ENSG00000187607	ENST00000421016;ENST00000412988;ENST00000395894	T;T	0.15834	2.39;2.39	4.53	-0.308	0.12773	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43110	D	0.000615	T	0.12944	0.0314	L	0.47190	1.495	0.09310	N	1	D	0.54207	0.965	B	0.40782	0.34	T	0.19811	-1.0294	10	0.46703	T	0.11	-28.9857	8.727	0.34476	0.0:0.4736:0.0:0.5264	.	285	Q9HBT8	Z286A_HUMAN	K	285;275;285	ENSP00000397163:N285K;ENSP00000408168:N275K	ENSP00000435872:N285K	N	+	3	2	ZNF286A	15560618	0.000000	0.05858	0.995000	0.50966	0.997000	0.91878	-1.556000	0.02168	-0.005000	0.14395	0.528000	0.53228	AAT	AC005324.8-001	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000255104		0.408	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF286A	Clone_based_vega_gene	protein_coding	OTTHUMT00000130696.4	38	0.00	0	T	NM_020652		15619893	15619893	+1	no_errors	ENST00000413242	ensembl	human	known	69_37n	missense	13	80.00	52	SNP	0.071	G
ZNF423	23090	genome.wustl.edu	37	16	49671283	49671283	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr16:49671283C>A	ENST00000561648.1	-	4	1833	c.1780G>T	c.(1780-1782)Gcc>Tcc	p.A594S	ZNF423_ENST00000562871.1_Missense_Mutation_p.A534S|ZNF423_ENST00000262383.2_Missense_Mutation_p.A594S|ZNF423_ENST00000562520.1_Missense_Mutation_p.A534S|ZNF423_ENST00000535559.1_Missense_Mutation_p.A477S|ZNF423_ENST00000563137.2_Missense_Mutation_p.A534S|ZNF423_ENST00000567169.1_Missense_Mutation_p.A477S	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	594					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TTGCTGTGGGCCAGTGGAATG	0.577																																						dbGAP											0													131.0	104.0	113.0					16																	49671283		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1780G>T	16.37:g.49671283C>A	ENSP00000455426:p.Ala594Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A594S	ENST00000561648.1	37	c.1780	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302024	0.60195	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09911	2.93;2.97	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.22704	0.0548	L	0.32530	0.975	0.58432	D	0.999998	D	0.76494	0.999	D	0.70716	0.97	T	0.02047	-1.1223	9	.	.	.	.	17.8389	0.88709	0.0:1.0:0.0:0.0	.	594	Q2M1K9	ZN423_HUMAN	S	594;477	ENSP00000262383:A594S;ENSP00000442321:A477S	.	A	-	1	0	ZNF423	48228784	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.487000	0.81328	2.208000	0.71279	0.561000	0.74099	GCC	ZNF423	-	NULL	ENSG00000102935		0.577	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	76	0.00	0	C	NM_015069		49671283	49671283	-1	no_errors	ENST00000262383	ensembl	human	known	69_37n	missense	14	56.25	18	SNP	1.000	A
ZNF462	58499	genome.wustl.edu	37	9	109688792	109688792	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A251-01A-12D-A167-09	TCGA-AR-A251-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68b4de6d-352d-44e8-911a-f4541f28fc78	59a8266d-0a43-4abf-bfe8-2c90002cf0bd	g.chr9:109688792C>G	ENST00000277225.5	+	3	2888	c.2599C>G	c.(2599-2601)Cca>Gca	p.P867A	ZNF462_ENST00000457913.1_Missense_Mutation_p.P867A|ZNF462_ENST00000441147.2_5'Flank			Q96JM2	ZN462_HUMAN	zinc finger protein 462	867					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						ACGAATGCACCCATACATTAA	0.443																																						dbGAP											0													178.0	160.0	166.0					9																	109688792		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.2599C>G	9.37:g.109688792C>G	ENSP00000277225:p.Pro867Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P867A	ENST00000277225.5	37	c.2599	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	17.79	3.476483	0.63737	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.15952	2.38;2.75	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.24851	0.0603	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.991	T	0.27536	-1.0071	9	.	.	.	.	20.2227	0.98327	0.0:1.0:0.0:0.0	.	867;867	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	A	867	ENSP00000277225:P867A;ENSP00000414570:P867A	.	P	+	1	0	ZNF462	108728613	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.411000	0.80078	2.778000	0.95560	0.650000	0.86243	CCA	ZNF462	-	NULL	ENSG00000148143		0.443	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	33	0.00	0	C	NM_021224		109688792	109688792	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	21	44.74	17	SNP	1.000	G
