#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA8	10351	genome.wustl.edu	37	17	66899538	66899538	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr17:66899538G>T	ENST00000269080.2	-	18	2518	c.2381C>A	c.(2380-2382)aCa>aAa	p.T794K	ABCA8_ENST00000586539.1_Missense_Mutation_p.T834K|ABCA8_ENST00000430352.2_Missense_Mutation_p.T834K	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	794					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					ACCACCTATTGTCTTTCTCAT	0.423																																						dbGAP											0													143.0	134.0	137.0					17																	66899538		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.2381C>A	17.37:g.66899538G>T	ENSP00000269080:p.Thr794Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T834K	ENST00000269080.2	37	c.2501	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341090	0.41498	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	T;T	0.75704	-0.96;-0.96	4.82	-0.938	0.10412	.	0.724008	0.12430	N	0.469674	T	0.54398	0.1856	L	0.39692	1.235	0.09310	N	1	B;B;B;B;B	0.23058	0.079;0.01;0.04;0.008;0.047	B;B;B;B;B	0.30105	0.111;0.019;0.022;0.028;0.03	T	0.41484	-0.9506	10	0.05833	T	0.94	.	0.9161	0.01304	0.2774:0.1592:0.3996:0.1637	.	773;834;834;834;794	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	K	794;834;773	ENSP00000269080:T794K;ENSP00000402814:T834K	ENSP00000269080:T794K	T	-	2	0	ABCA8	64411133	0.000000	0.05858	0.000000	0.03702	0.528000	0.34623	-0.244000	0.08903	-0.183000	0.10585	0.655000	0.94253	ACA	ABCA8	-	NULL	ENSG00000141338		0.423	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	128	0.78	1	G	NM_007168		66899538	66899538	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	missense	72	48.57	68	SNP	0.000	T
ADAM17	6868	genome.wustl.edu	37	2	9634772	9634772	+	Silent	SNP	G	G	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr2:9634772G>A	ENST00000310823.3	-	15	2090	c.1908C>T	c.(1906-1908)gaC>gaT	p.D636D	IAH1_ENST00000545602.1_Intron	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	636	Crambin-like.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TCACATTCATGTCACAAAATC	0.383																																						dbGAP											0													106.0	99.0	101.0					2																	9634772		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.1908C>T	2.37:g.9634772G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60226	Silent	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.D636	ENST00000310823.3	37	c.1908	CCDS1665.1	2																																																																																			ADAM17	-	NULL	ENSG00000151694		0.383	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM17	HGNC	protein_coding	OTTHUMT00000206857.1	113	0.00	0	G			9634772	9634772	-1	no_errors	ENST00000310823	ensembl	human	known	69_37n	silent	47	40.51	32	SNP	1.000	A
APOBR	55911	genome.wustl.edu	37	16	28507445	28507445	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr16:28507445G>C	ENST00000431282.1	+	3	1066	c.1056G>C	c.(1054-1056)gaG>gaC	p.E352D	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.E361D|APOBR_ENST00000328423.5_Missense_Mutation_p.E352D|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	352	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						CAGGAGGGGAGGAGGCCGGGA	0.682																																						dbGAP											0													12.0	15.0	14.0					16																	28507445		1938	4080	6018	-	-	-	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1056G>C	16.37:g.28507445G>C	ENSP00000416094:p.Glu352Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.E361D	ENST00000431282.1	37	c.1083		16	.	.	.	.	.	.	.	.	.	.	G	7.381	0.628786	0.14257	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.59502	0.26;0.26	3.42	-2.0	0.07433	.	.	.	.	.	T	0.37183	0.0994	.	.	.	0.09310	N	0.999998	B	0.06786	0.001	B	0.10450	0.005	T	0.18147	-1.0346	8	0.33940	T	0.23	.	4.5869	0.12287	0.5053:0.1711:0.3237:0.0	.	352	Q9NS13	.	D	352	ENSP00000327669:E352D;ENSP00000416094:E352D	ENSP00000327669:E352D	E	+	3	2	APOBR	28414946	0.040000	0.19996	0.000000	0.03702	0.006000	0.05464	0.236000	0.17967	-0.482000	0.06782	-1.291000	0.01355	GAG	APOBR	-	NULL	ENSG00000184730		0.682	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		14	0.00	0	G	NM_182804		28507445	28507445	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.310	C
BIRC7	79444	genome.wustl.edu	37	20	61867655	61867655	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr20:61867655G>T	ENST00000217169.3	+	1	421	c.207G>T	c.(205-207)gaG>gaT	p.E69D	MIR3196_ENST00000579556.1_RNA|BIRC7_ENST00000342412.6_Missense_Mutation_p.E69D|BIRC7_ENST00000395306.1_5'Flank	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	69	Poly-Glu.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					AAGAGGAGGAGGGCGCCGGGG	0.682																																						dbGAP											0													21.0	23.0	22.0					20																	61867655		2197	4297	6494	-	-	-	SO:0001583	missense	0			AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.207G>T	20.37:g.61867655G>T	ENSP00000217169:p.Glu69Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.E69D	ENST00000217169.3	37	c.207	CCDS13513.1	20	.	.	.	.	.	.	.	.	.	.	G	0.078	-1.188584	0.01607	.	.	ENSG00000101197	ENST00000342412;ENST00000217169	T;T	0.54071	0.75;0.59	4.18	-7.85	0.01192	.	0.181808	0.25938	N	0.027329	T	0.16085	0.0387	N	0.04880	-0.145	0.09310	N	0.999999	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.001;0.003;0.004	T	0.25363	-1.0134	10	0.13853	T	0.58	.	0.8941	0.01260	0.3503:0.2755:0.1897:0.1845	.	69;69;69	Q6R308;Q96CA5;Q96CA5-2	.;BIRC7_HUMAN;.	D	69	ENSP00000345213:E69D;ENSP00000217169:E69D	ENSP00000217169:E69D	E	+	3	2	BIRC7	61338100	0.000000	0.05858	0.000000	0.03702	0.178000	0.23041	-0.841000	0.04359	-1.542000	0.01725	-0.268000	0.10319	GAG	BIRC7	-	NULL	ENSG00000101197		0.682	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIRC7	HGNC	protein_coding	OTTHUMT00000080114.2	16	0.00	0	G	NM_139317		61867655	61867655	+1	no_errors	ENST00000217169	ensembl	human	known	69_37n	missense	11	68.57	24	SNP	0.000	T
C19orf35	374872	genome.wustl.edu	37	19	2276415	2276417	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	TTG	TTG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr19:2276415_2276417delTTG	ENST00000342063.3	-	4	777_779	c.684_686delCAA	c.(682-687)ttcaat>ttt	p.N229del		NM_198532.2	NP_940934.1	Q6ZS72	CS035_HUMAN	chromosome 19 open reading frame 35	229										large_intestine(1)|lung(5)|pancreas(1)|prostate(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCTGCAGATTGAAGTGTGGAG	0.719																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK127680	CCDS12087.1	19p13.3	2012-10-26			ENSG00000188305	ENSG00000188305			24793	protein-coding gene	gene with protein product							Standard	NM_198532		Approved	FLJ45778	uc002lvn.2	Q6ZS72	OTTHUMG00000178460	ENST00000342063.3:c.684_686delCAA	19.37:g.2276415_2276417delTTG	ENSP00000345102:p.Asn229del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	NULL	p.N229in_frame_del	ENST00000342063.3	37	c.686_684	CCDS12087.1	19																																																																																			C19orf35	-	NULL	ENSG00000188305		0.719	C19orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf35	HGNC	protein_coding	OTTHUMT00000442080.1	10	0.00	0	TTG	NM_198532		2276415	2276417	-1	no_errors	ENST00000342063	ensembl	human	known	69_37n	in_frame_del	0	100.00	3	DEL	0.704:0.954:0.974	-
MAATS1	89876	genome.wustl.edu	37	3	119434580	119434580	+	Silent	SNP	G	G	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr3:119434580G>A	ENST00000273390.5	+	6	749	c.672G>A	c.(670-672)acG>acA	p.T224T	MAATS1_ENST00000463700.1_Silent_p.T224T	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	224						mitochondrion (GO:0005739)											CCCTGGCTACGCTTACTTGGG	0.473																																						dbGAP											0													116.0	103.0	107.0					3																	119434580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.672G>A	3.37:g.119434580G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Silent	SNP	superfamily_S-AdoMet_deCO2ase_core	p.T224	ENST00000273390.5	37	c.672	CCDS2994.1	3																																																																																			C3orf15	-	NULL	ENSG00000183833		0.473	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf15	HGNC	protein_coding	OTTHUMT00000355222.1	88	0.00	0	G	NM_033364		119434580	119434580	+1	no_errors	ENST00000273390	ensembl	human	known	69_37n	silent	16	83.51	81	SNP	0.998	A
C7orf57	136288	genome.wustl.edu	37	7	48092459	48092459	+	Silent	SNP	T	T	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr7:48092459T>A	ENST00000348904.3	+	7	980	c.768T>A	c.(766-768)ggT>ggA	p.G256G	C7orf57_ENST00000435376.1_Silent_p.G118G|C7orf57_ENST00000420324.1_Silent_p.G285G|C7orf57_ENST00000539619.1_Silent_p.G256G|C7orf57_ENST00000430738.1_Silent_p.G301G	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	256										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						ACCTGGAAGGTCCCCAGGATG	0.582																																						dbGAP											0													41.0	44.0	43.0					7																	48092459		2016	4197	6213	-	-	-	SO:0001819	synonymous_variant	0			BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.768T>A	7.37:g.48092459T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JBJ8	Silent	SNP	NULL	p.G256	ENST00000348904.3	37	c.768	CCDS47583.1	7																																																																																			C7orf57	-	NULL	ENSG00000164746		0.582	C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf57	HGNC	protein_coding	OTTHUMT00000341745.1	35	0.00	0	T	NM_001100159		48092459	48092459	+1	no_errors	ENST00000348904	ensembl	human	known	69_37n	silent	30	23.08	9	SNP	0.000	A
CDH20	28316	genome.wustl.edu	37	18	59166446	59166446	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr18:59166446G>A	ENST00000262717.4	+	3	672	c.274G>A	c.(274-276)Gga>Aga	p.G92R	CDH20_ENST00000536675.2_Missense_Mutation_p.G92R|CDH20_ENST00000538374.1_Missense_Mutation_p.G92R			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	92	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G92R(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				CAGGGGAGACGGATCCATCAA	0.483																																						dbGAP											1	Substitution - Missense(1)	skin(1)											79.0	66.0	70.0					18																	59166446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.274G>A	18.37:g.59166446G>A	ENSP00000262717:p.Gly92Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G92R	ENST00000262717.4	37	c.274	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	G	32	5.148470	0.94603	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.60672	0.17;0.17;0.17	5.91	5.91	0.95273	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.82061	0.4955	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84421	0.0571	10	0.72032	D	0.01	.	20.3011	0.98612	0.0:0.0:1.0:0.0	.	92	Q9HBT6	CAD20_HUMAN	R	92	ENSP00000444767:G92R;ENSP00000442226:G92R;ENSP00000262717:G92R	ENSP00000262717:G92R	G	+	1	0	CDH20	57317426	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.476000	0.97823	2.804000	0.96469	0.650000	0.86243	GGA	CDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000101542		0.483	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	61	0.00	0	G	NM_031891		59166446	59166446	+1	no_errors	ENST00000262717	ensembl	human	known	69_37n	missense	60	10.45	7	SNP	1.000	A
CNTN3	5067	genome.wustl.edu	37	3	74535758	74535758	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr3:74535758A>C	ENST00000263665.6	-	3	234	c.207T>G	c.(205-207)atT>atG	p.I69M		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	69	Ig-like C2-type 1.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TACTCATATCAATATCACTTC	0.348																																						dbGAP											0													105.0	103.0	104.0					3																	74535758		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.207T>G	3.37:g.74535758A>C	ENSP00000263665:p.Ile69Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I69M	ENST00000263665.6	37	c.207	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	A	10.35	1.325043	0.24080	.	.	ENSG00000113805	ENST00000263665	T	0.69926	-0.44	5.83	-1.25	0.09405	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.65312	0.2679	M	0.69823	2.125	0.09310	N	1	P	0.38745	0.645	P	0.46419	0.516	T	0.58831	-0.7567	10	0.41790	T	0.15	.	6.4862	0.22089	0.3407:0.4381:0.2212:0.0	.	69	Q9P232	CNTN3_HUMAN	M	69	ENSP00000263665:I69M	ENSP00000263665:I69M	I	-	3	3	CNTN3	74618448	0.016000	0.18221	0.001000	0.08648	0.692000	0.40212	0.016000	0.13377	-0.457000	0.07033	-0.334000	0.08254	ATT	CNTN3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000113805		0.348	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	83	0.00	0	A	NM_020872		74535758	74535758	-1	no_errors	ENST00000263665	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	0.002	C
CPNE6	9362	genome.wustl.edu	37	14	24546220	24546220	+	Splice_Site	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr14:24546220C>T	ENST00000397016.2	+	15	1609	c.1298C>T	c.(1297-1299)aCg>aTg	p.T433M	CPNE6_ENST00000216775.2_Splice_Site_p.T433M|CPNE6_ENST00000537691.1_Splice_Site_p.T488M	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	433	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GGCCAAGCCACGGTAGGAAGA	0.632																																						dbGAP											0													32.0	31.0	32.0					14																	24546220		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1299+1C>T	14.37:g.24546220C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.T488M	ENST00000397016.2	37	c.1463	CCDS9607.1	14	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938592	0.34189	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.22945	1.93;1.93;1.93	4.95	4.95	0.65309	von Willebrand factor, type A (2);Copine (1);	0.106561	0.41823	D	0.000802	T	0.16727	0.0402	N	0.17474	0.49	0.52099	D	0.999941	B;B;B	0.32829	0.334;0.069;0.386	B;B;B	0.25884	0.063;0.027;0.064	T	0.06826	-1.0805	10	0.62326	D	0.03	-12.886	15.6852	0.77405	0.0:1.0:0.0:0.0	.	488;258;433	F5GXN1;B3KWK1;O95741	.;.;CPNE6_HUMAN	M	488;433;433	ENSP00000440077:T488M;ENSP00000380211:T433M;ENSP00000216775:T433M	ENSP00000216775:T433M	T	+	2	0	CPNE6	23616060	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	2.515000	0.45512	2.289000	0.77006	0.467000	0.42956	ACG	CPNE6	-	pfam_Copine,smart_VWF_A,pfscan_VWF_A	ENSG00000100884		0.632	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE6	HGNC	protein_coding	OTTHUMT00000071869.5	40	0.00	0	C		Missense_Mutation	24546220	24546220	+1	no_errors	ENST00000537691	ensembl	human	known	69_37n	missense	18	47.06	16	SNP	1.000	T
DCPS	28960	genome.wustl.edu	37	11	126174159	126174159	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr11:126174159A>T	ENST00000263579.4	+	1	513	c.184A>T	c.(184-186)Att>Ttt	p.I62F	RP11-712L6.5_ENST00000524964.1_Start_Codon_SNP_p.M1K	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger	62					cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)			endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		GGACAAAATCATTTTCCTACA	0.547																																						dbGAP											0													76.0	74.0	75.0					11																	126174159		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.184A>T	11.37:g.126174159A>T	ENSP00000263579:p.Ile62Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHL8|Q9Y2S5	Missense_Mutation	SNP	pfam_Scavenger_mRNA_decap_enz,superfamily_HIT-like,superfamily_Scavenger_mRNA_decap_enz_N,pirsf_Scavenger_mRNA_decap_enz	p.I62F	ENST00000263579.4	37	c.184	CCDS8473.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.2|22.2	4.255924|4.255924	0.80135|0.80135	.|.	.|.	ENSG00000110063|ENSG00000255062	ENST00000263579|ENST00000524964	T|.	0.53640|.	0.61|.	5.61|5.61	1.73|1.73	0.24493|0.24493	Scavenger mRNA decapping enzyme, N-terminal (1);|.	0.565474|.	0.18416|.	N|.	0.141882|.	T|T	0.64843|0.64843	0.2635|0.2635	M|M	0.76574|0.76574	2.34|2.34	0.35946|0.35946	D|D	0.833561|0.833561	P|.	0.42961|.	0.795|.	B|.	0.38655|.	0.278|.	T|T	0.70153|0.70153	-0.4950|-0.4950	10|6	0.56958|0.87932	D|D	0.05|0	-5.6713|-5.6713	7.3332|7.3332	0.26594|0.26594	0.4139:0.5039:0.0822:0.0|0.4139:0.5039:0.0822:0.0	.|.	62|.	Q96C86|.	DCPS_HUMAN|.	F|K	62|1	ENSP00000263579:I62F|.	ENSP00000263579:I62F|ENSP00000436320:M1K	I|M	+|-	1|2	0|0	DCPS|RP11-712L6.5	125679369|125679369	0.998000|0.998000	0.40836|0.40836	0.977000|0.977000	0.42913|0.42913	0.993000|0.993000	0.82548|0.82548	0.506000|0.506000	0.22658|0.22658	0.384000|0.384000	0.24942|0.24942	0.482000|0.482000	0.46254|0.46254	ATT|ATG	DCPS	-	pfam_Scavenger_mRNA_decap_enz,superfamily_Scavenger_mRNA_decap_enz_N,pirsf_Scavenger_mRNA_decap_enz	ENSG00000110063		0.547	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCPS	HGNC	protein_coding	OTTHUMT00000386455.1	47	0.00	0	A	NM_014026		126174159	126174159	+1	no_errors	ENST00000263579	ensembl	human	known	69_37n	missense	3	89.29	25	SNP	0.637	T
DOK2	9046	genome.wustl.edu	37	8	21769814	21769814	+	Missense_Mutation	SNP	G	G	A	rs546091332		TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr8:21769814G>A	ENST00000276420.4	-	2	529	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C	DOK2_ENST00000544659.1_5'UTR	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	91	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		AGGTACAGGCGCTCCTTGGTC	0.716													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12765	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													11.0	15.0	14.0					8																	21769814		2194	4291	6485	-	-	-	SO:0001583	missense	0			AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.271C>T	8.37:g.21769814G>A	ENSP00000276420:p.Arg91Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5A4	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.R91C	ENST00000276420.4	37	c.271	CCDS6016.1	8	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212919	0.79352	.	.	ENSG00000147443	ENST00000276420;ENST00000523932	T;T	0.49720	1.71;0.77	5.11	5.11	0.69529	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.067305	0.52532	D	0.000068	T	0.62539	0.2436	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.983	T	0.60762	-0.7199	10	0.37606	T	0.19	.	11.6849	0.51481	0.0:0.0:0.7012:0.2988	.	91;91	O60496;A8K7W1	DOK2_HUMAN;.	C	91	ENSP00000276420:R91C;ENSP00000429224:R91C	ENSP00000276420:R91C	R	-	1	0	DOK2	21825760	0.996000	0.38824	1.000000	0.80357	0.923000	0.55619	3.922000	0.56462	2.384000	0.81235	0.655000	0.94253	CGC	DOK2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000147443		0.716	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK2	HGNC	protein_coding	OTTHUMT00000253735.3	27	0.00	0	G	NM_003974		21769814	21769814	-1	no_errors	ENST00000276420	ensembl	human	known	69_37n	missense	5	70.59	12	SNP	0.998	A
DPP4	1803	genome.wustl.edu	37	2	162879282	162879282	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr2:162879282T>C	ENST00000360534.3	-	12	1611	c.1051A>G	c.(1051-1053)Act>Gct	p.T351A		NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	351					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	ACCCAGCCAGTAGTACTCATT	0.398																																						dbGAP											0													155.0	149.0	151.0					2																	162879282		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1051A>G	2.37:g.162879282T>C	ENSP00000353731:p.Thr351Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TN1	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.T351A	ENST00000360534.3	37	c.1051	CCDS2216.1	2	.	.	.	.	.	.	.	.	.	.	T	15.16	2.750505	0.49257	.	.	ENSG00000197635	ENST00000360534	D	0.96168	-3.93	5.17	3.94	0.45596	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.105393	0.64402	D	0.000005	D	0.95156	0.8430	M	0.86420	2.815	0.52501	D	0.999953	B	0.21309	0.054	B	0.26864	0.074	D	0.94102	0.7363	10	0.52906	T	0.07	-23.3717	10.9806	0.47492	0.1396:0.0:0.0:0.8604	.	351	P27487	DPP4_HUMAN	A	351	ENSP00000353731:T351A	ENSP00000353731:T351A	T	-	1	0	DPP4	162587528	0.994000	0.37717	0.331000	0.25455	0.350000	0.29205	2.627000	0.46469	2.071000	0.62044	0.528000	0.53228	ACT	DPP4	-	pfam_Peptidase_S9B	ENSG00000197635		0.398	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP4	HGNC	protein_coding	OTTHUMT00000255079.2	231	0.00	0	T			162879282	162879282	-1	no_errors	ENST00000360534	ensembl	human	known	69_37n	missense	93	38.82	59	SNP	0.790	C
DSG3	1830	genome.wustl.edu	37	18	29036959	29036959	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr18:29036959A>C	ENST00000257189.4	+	3	171	c.88A>C	c.(88-90)Aaa>Caa	p.K30Q		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	30					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ACATAAGACTAAAGGTCAATA	0.363																																						dbGAP											0													165.0	168.0	167.0					18																	29036959		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.88A>C	18.37:g.29036959A>C	ENSP00000257189:p.Lys30Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.K30Q	ENST00000257189.4	37	c.88	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	A	14.30	2.495504	0.44352	.	.	ENSG00000134757	ENST00000257189	T	0.60672	0.17	5.06	3.91	0.45181	.	0.444631	0.18354	N	0.143795	T	0.55353	0.1915	L	0.61218	1.895	0.09310	N	1	P	0.48640	0.913	P	0.47075	0.536	T	0.43523	-0.9386	10	0.20519	T	0.43	.	7.5393	0.27729	0.8282:0.0:0.1718:0.0	.	30	P32926	DSG3_HUMAN	Q	30	ENSP00000257189:K30Q	ENSP00000257189:K30Q	K	+	1	0	DSG3	27290957	0.536000	0.26378	0.008000	0.14137	0.007000	0.05969	1.863000	0.39459	0.890000	0.36211	0.528000	0.53228	AAA	DSG3	-	NULL	ENSG00000134757		0.363	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1	85	0.00	0	A	NM_001944		29036959	29036959	+1	no_errors	ENST00000257189	ensembl	human	known	69_37n	missense	53	34.57	28	SNP	0.067	C
FAM83H	286077	genome.wustl.edu	37	8	144811162	144811162	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr8:144811162C>T	ENST00000388913.3	-	4	837	c.712G>A	c.(712-714)Gcc>Acc	p.A238T		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	238					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ATCACCACGGCACAGTCCACC	0.652																																						dbGAP											0													69.0	82.0	78.0					8																	144811162		2117	4219	6336	-	-	-	SO:0001583	missense	0			AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.712G>A	8.37:g.144811162C>T	ENSP00000373565:p.Ala238Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLS2|Q8N4W0	Missense_Mutation	SNP	pfam_DUF1669	p.A238T	ENST00000388913.3	37	c.712	CCDS6410.2	8	.	.	.	.	.	.	.	.	.	.	c	13.18	2.160947	0.38119	.	.	ENSG00000180921	ENST00000388913	T	0.11063	2.81	4.91	4.02	0.46733	.	0.595718	0.15675	N	0.250167	T	0.03095	0.0091	N	0.01048	-1.04	0.25870	N	0.98372	B	0.30634	0.288	B	0.33196	0.159	T	0.41698	-0.9494	10	0.14252	T	0.57	.	5.5862	0.17275	0.0:0.7324:0.0:0.2676	.	238	Q6ZRV2	FA83H_HUMAN	T	238	ENSP00000373565:A238T	ENSP00000373565:A238T	A	-	1	0	FAM83H	144883150	1.000000	0.71417	0.726000	0.30738	0.965000	0.64279	3.082000	0.50128	2.436000	0.82500	0.555000	0.69702	GCC	FAM83H	-	pfam_DUF1669	ENSG00000180921		0.652	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83H	HGNC	protein_coding	OTTHUMT00000257632.2	39	0.00	0	C	NM_198488		144811162	144811162	-1	no_errors	ENST00000388913	ensembl	human	known	69_37n	missense	24	68.83	53	SNP	0.991	T
FCGBP	8857	genome.wustl.edu	37	19	40419909	40419909	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr19:40419909C>T	ENST00000221347.6	-	6	3092	c.3085G>A	c.(3085-3087)Ggg>Agg	p.G1029R		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1029	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CAGCTGTTCCCAAAGGCCAGT	0.627																																						dbGAP											0													70.0	60.0	64.0					19																	40419909		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3085G>A	19.37:g.40419909C>T	ENSP00000221347:p.Gly1029Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.G1029R	ENST00000221347.6	37	c.3085	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344970	0.61073	.	.	ENSG00000090920	ENST00000221347	T	0.26660	1.72	5.18	4.12	0.48240	von Willebrand factor, type D domain (1);	0.000000	0.64402	U	0.000003	T	0.57286	0.2043	M	0.90198	3.095	0.37603	D	0.920643	D	0.76494	0.999	D	0.75484	0.986	T	0.72017	-0.4417	10	0.87932	D	0	.	13.9482	0.64099	0.1531:0.8469:0.0:0.0	.	1029	Q9Y6R7	FCGBP_HUMAN	R	1029	ENSP00000221347:G1029R	ENSP00000221347:G1029R	G	-	1	0	FCGBP	45111749	0.971000	0.33674	0.061000	0.19648	0.332000	0.28634	4.625000	0.61262	1.361000	0.45981	0.561000	0.74099	GGG	FCGBP	-	NULL	ENSG00000090920		0.627	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	64	0.00	0	C	NM_003890		40419909	40419909	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	30	52.38	33	SNP	0.890	T
GJD2	57369	genome.wustl.edu	37	15	35044895	35044895	+	Silent	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr15:35044895C>T	ENST00000290374.4	-	2	1226	c.750G>A	c.(748-750)aaG>aaA	p.K250K	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	250					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GAAAGACAGTCTTCTCAGTTG	0.488																																						dbGAP											0													145.0	115.0	125.0					15																	35044895		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.750G>A	15.37:g.35044895C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M241|Q9P2R0	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.K250	ENST00000290374.4	37	c.750	CCDS10040.1	15																																																																																			GJD2	-	pfam_Connexin_CCC,prints_Connexin	ENSG00000159248		0.488	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	HGNC	protein_coding	OTTHUMT00000251875.2	109	0.00	0	C			35044895	35044895	-1	no_errors	ENST00000290374	ensembl	human	known	69_37n	silent	51	36.25	29	SNP	1.000	T
HHIPL2	79802	genome.wustl.edu	37	1	222717378	222717378	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr1:222717378C>T	ENST00000343410.6	-	2	533	c.475G>A	c.(475-477)Gag>Aag	p.E159K		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	159					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CCATGAGACTCCTGGAGGCCG	0.557																																						dbGAP											0													67.0	80.0	76.0					1																	222717378		2146	4257	6403	-	-	-	SO:0001583	missense	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.475G>A	1.37:g.222717378C>T	ENSP00000342118:p.Glu159Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.E159K	ENST00000343410.6	37	c.475	CCDS1530.2	1	.	.	.	.	.	.	.	.	.	.	C	1.275	-0.612071	0.03690	.	.	ENSG00000143512	ENST00000343410	T	0.33654	1.4	5.59	2.54	0.30619	Folate receptor-like (1);	0.504809	0.21624	N	0.071598	T	0.28732	0.0712	L	0.59436	1.845	0.09310	N	1	B	0.19200	0.034	B	0.19666	0.026	T	0.30001	-0.9993	10	0.13853	T	0.58	-2.698	6.4868	0.22093	0.1261:0.6426:0.1601:0.0712	.	159	Q6UWX4	HIPL2_HUMAN	K	159	ENSP00000342118:E159K	ENSP00000342118:E159K	E	-	1	0	HHIPL2	220784001	0.000000	0.05858	0.060000	0.19600	0.214000	0.24535	-0.160000	0.10041	0.211000	0.20683	0.591000	0.81541	GAG	HHIPL2	-	pfam_Folate_rcpt-like,superfamily_Saposin-like	ENSG00000143512		0.557	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2	56	0.00	0	C	NM_024746		222717378	222717378	-1	no_errors	ENST00000343410	ensembl	human	known	69_37n	missense	51	51.89	55	SNP	0.022	T
IL12RB1	3594	genome.wustl.edu	37	19	18174806	18174806	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr19:18174806G>T	ENST00000600835.2	-	14	1796	c.1498C>A	c.(1498-1500)Ccc>Acc	p.P500T	IL12RB1_ENST00000593993.2_Missense_Mutation_p.P500T			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	500	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						GTCTCTGTGGGCTGCACGGGA	0.642																																						dbGAP											0													30.0	32.0	31.0					19																	18174806		2000	4180	6180	-	-	-	SO:0001583	missense	0			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1498C>A	19.37:g.18174806G>T	ENSP00000470788:p.Pro500Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P500T	ENST00000600835.2	37	c.1498	CCDS54232.1	19	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134523	0.37630	.	.	ENSG00000096996	ENST00000430026	T	0.58210	0.35	3.21	-0.417	0.12347	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.302373	0.23268	N	0.050055	T	0.51822	0.1697	L	0.37466	1.105	0.25678	N	0.985824	D;D	0.71674	0.997;0.998	P;D	0.64877	0.884;0.93	T	0.42224	-0.9464	10	0.34782	T	0.22	-16.4034	6.3365	0.21298	0.0:0.4465:0.3729:0.1807	.	500;500	P42701-2;P42701	.;I12R1_HUMAN	T	500	ENSP00000403103:P500T	ENSP00000403103:P500T	P	-	1	0	IL12RB1	18035806	0.896000	0.30565	0.106000	0.21319	0.120000	0.20174	1.325000	0.33724	0.028000	0.15324	0.491000	0.48974	CCC	IL12RB1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000096996		0.642	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB1	HGNC	protein_coding	OTTHUMT00000466525.3	46	0.00	0	G			18174806	18174806	-1	no_errors	ENST00000430026	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.125	T
IL22RA2	116379	genome.wustl.edu	37	6	137477933	137477933	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr6:137477933delT	ENST00000296980.2	-	4	556	c.256delA	c.(256-258)attfs	p.I86fs	IL22RA2_ENST00000349184.4_Intron|IL22RA2_ENST00000339602.3_Intron	NM_052962.2	NP_443194.1	Q969J5	I22R2_HUMAN	interleukin 22 receptor, alpha 2	86					cytokine-mediated signaling pathway (GO:0019221)|negative regulation of inflammatory response (GO:0050728)|regulation of tyrosine phosphorylation of Stat3 protein (GO:0042516)	cytosol (GO:0005829)|extracellular space (GO:0005615)	interleukin-22 binding (GO:0042017)|interleukin-22 receptor activity (GO:0042018)			endometrium(1)|large_intestine(1)|lung(3)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000313)|OV - Ovarian serous cystadenocarcinoma(155;0.00407)		ttacaagaaatgtgctgccag	0.448																																						dbGAP											0													139.0	127.0	131.0					6																	137477933		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY044429	CCDS5182.1, CCDS5183.1, CCDS5184.1	6q24.1-q24.2	2008-02-05			ENSG00000164485	ENSG00000164485		"""Interleukins and interleukin receptors"""	14901	protein-coding gene	gene with protein product		606648				11481447, 11390454	Standard	NM_181309		Approved	CRF2-S1, IL-22BP	uc003qhl.3	Q969J5	OTTHUMG00000015655	ENST00000296980.2:c.256delA	6.37:g.137477933delT	ENSP00000296980:p.Ile86fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AH7|Q6UWM1|Q96A41|Q96QR0	Frame_Shift_Del	DEL	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.I86fs	ENST00000296980.2	37	c.256	CCDS5182.1	6																																																																																			IL22RA2	-	superfamily_Fibronectin_type3	ENSG00000164485		0.448	IL22RA2-002	KNOWN	basic|CCDS	protein_coding	IL22RA2	HGNC	protein_coding	OTTHUMT00000042399.1	115	0.00	0	T			137477933	137477933	-1	no_errors	ENST00000296980	ensembl	human	known	69_37n	frame_shift_del	104	19.55	26	DEL	0.002	-
LARP1	23367	genome.wustl.edu	37	5	154172349	154172349	+	Silent	SNP	G	G	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr5:154172349G>A	ENST00000336314.4	+	4	525	c.501G>A	c.(499-501)aaG>aaA	p.K167K		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	244					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCGGGCAGAAGAAGAAAGGTG	0.517																																						dbGAP											0													88.0	90.0	89.0					5																	154172349		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.501G>A	5.37:g.154172349G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	NULL	p.E147K	ENST00000336314.4	37	c.439	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	G	9.671	1.146815	0.21288	.	.	ENSG00000155506	ENST00000517616;ENST00000518194	.	.	.	5.67	1.93	0.25924	.	.	.	.	.	T	0.57373	0.2049	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49925	-0.8887	4	.	.	.	-22.168	8.5956	0.33714	0.357:0.0:0.643:0.0	.	.	.	.	K	147;6	.	.	E	+	1	0	LARP1	154152542	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.667000	0.46808	0.330000	0.23485	-0.150000	0.13652	GAA	LARP1	-	NULL	ENSG00000155506		0.517	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	90	0.00	0	G	NM_033551		154172349	154172349	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000517616	ensembl	human	putative	69_37n	missense	82	41.01	57	SNP	1.000	A
NOX4	50507	genome.wustl.edu	37	11	89075271	89075271	+	Silent	SNP	A	A	G			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr11:89075271A>G	ENST00000263317.4	-	14	1546	c.1308T>C	c.(1306-1308)acT>acC	p.T436T	NOX4_ENST00000527626.1_Silent_p.T270T|NOX4_ENST00000413594.2_Silent_p.T457T|NOX4_ENST00000542487.1_Silent_p.T412T|NOX4_ENST00000343727.5_Silent_p.T412T|NOX4_ENST00000424319.1_Silent_p.T412T|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000534731.1_Intron|NOX4_ENST00000532825.1_Intron|NOX4_ENST00000375979.3_Silent_p.T129T|NOX4_ENST00000528341.1_Silent_p.T411T|NOX4_ENST00000535633.1_Silent_p.T412T|NOX4_ENST00000527956.1_Silent_p.T412T|NOX4_ENST00000531342.1_Intron			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	436	Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ATGCAAATGGAGTTACTCCAA	0.398																																						dbGAP											0													94.0	85.0	88.0					11																	89075271		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1308T>C	11.37:g.89075271A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.T457	ENST00000263317.4	37	c.1371	CCDS8285.1	11																																																																																			NOX4	-	pfam_Fe_red_NAD-bd_6,prints_Cyt_b245_heavy_chain	ENSG00000086991		0.398	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	62	0.00	0	A	NM_016931		89075271	89075271	-1	no_errors	ENST00000413594	ensembl	human	known	69_37n	silent	9	72.73	24	SNP	0.993	G
NTNG2	84628	genome.wustl.edu	37	9	135073544	135073544	+	Silent	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr9:135073544C>T	ENST00000393229.3	+	3	1181	c.405C>T	c.(403-405)gaC>gaT	p.D135D	NTNG2_ENST00000360670.3_Silent_p.D135D|NTNG2_ENST00000372179.3_Silent_p.D135D|NTNG2_ENST00000393228.4_Silent_p.D135D	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	135	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		AGCTGACCGACGACGTGGTGA	0.642																																						dbGAP											0													97.0	73.0	81.0					9																	135073544		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.405C>T	9.37:g.135073544C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_EGF_extracell,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.D135	ENST00000393229.3	37	c.405	CCDS6946.1	9																																																																																			NTNG2	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000196358		0.642	NTNG2-001	KNOWN	basic|CCDS	protein_coding	NTNG2	HGNC	protein_coding	OTTHUMT00000054779.1	31	0.00	0	C	NM_032536		135073544	135073544	+1	no_errors	ENST00000360670	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	0.988	T
OR5AC2	81050	genome.wustl.edu	37	3	97806718	97806718	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr3:97806718G>T	ENST00000358642.2	+	1	702	c.702G>T	c.(700-702)aaG>aaT	p.K234N		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	234					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						AGTCTGAAAAGGGCAGAAGCA	0.398																																						dbGAP											0													52.0	50.0	51.0					3																	97806718		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.702G>T	3.37:g.97806718G>T	ENSP00000351466:p.Lys234Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K234N	ENST00000358642.2	37	c.702	CCDS33796.1	3	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760503	0.31137	.	.	ENSG00000196578	ENST00000358642	T	0.00145	8.67	4.42	-3.32	0.04973	GPCR, rhodopsin-like superfamily (1);	0.190390	0.25391	U	0.031016	T	0.00144	0.0004	L	0.38953	1.18	0.09310	N	1	B	0.17852	0.024	B	0.26693	0.072	T	0.42015	-0.9476	10	0.87932	D	0	-7.0723	10.7864	0.46407	0.5548:0.0:0.4452:0.0	.	234	Q9NZP5	O5AC2_HUMAN	N	234	ENSP00000351466:K234N	ENSP00000351466:K234N	K	+	3	2	OR5AC2	99289408	0.000000	0.05858	0.714000	0.30535	0.950000	0.60333	-1.108000	0.03313	-1.094000	0.03054	-0.399000	0.06403	AAG	OR5AC2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196578		0.398	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AC2	HGNC	protein_coding	OTTHUMT00000359116.1	54	0.00	0	G			97806718	97806718	+1	no_errors	ENST00000358642	ensembl	human	known	69_37n	missense	38	34.48	20	SNP	0.065	T
OTOA	146183	genome.wustl.edu	37	16	21716591	21716591	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr16:21716591G>T	ENST00000286149.4	+	11	1125	c.1124G>T	c.(1123-1125)gGc>gTc	p.G375V	OTOA_ENST00000388956.4_Missense_Mutation_p.G282V|OTOA_ENST00000388957.3_Missense_Mutation_p.G37V|OTOA_ENST00000569064.1_3'UTR|OTOA_ENST00000388958.3_Missense_Mutation_p.G361V			Q7RTW8	OTOAN_HUMAN	otoancorin	375					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		CACCTGAGGGGCTTCCAGGCT	0.562																																						dbGAP											0													77.0	73.0	74.0					16																	21716591		2199	4300	6499	-	-	-	SO:0001583	missense	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1124G>T	16.37:g.21716591G>T	ENSP00000286149:p.Gly375Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	NULL	p.G375V	ENST00000286149.4	37	c.1124		16	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320954	0.81580	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957	T;T;T;T	0.77358	2.65;-1.09;2.65;-1.09	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.86940	0.6054	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	D	0.88033	0.2776	10	0.72032	D	0.01	-22.4241	16.4606	0.84044	0.0:0.0:1.0:0.0	.	375;282;37;361	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	V	361;375;282;37	ENSP00000373610:G361V;ENSP00000286149:G375V;ENSP00000373608:G282V;ENSP00000373609:G37V	ENSP00000286149:G375V	G	+	2	0	OTOA	21624092	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.008000	0.76341	2.480000	0.83734	0.561000	0.74099	GGC	OTOA	-	NULL	ENSG00000155719		0.562	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	71	0.00	0	G			21716591	21716591	+1	no_errors	ENST00000286149	ensembl	human	known	69_37n	missense	59	43.27	45	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	64	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	15	83.15	74	SNP	1.000	G
RHOC	389	genome.wustl.edu	37	1	113244320	113244320	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr1:113244320C>T	ENST00000285735.2	-	6	1633	c.424G>A	c.(424-426)Gag>Aag	p.E142K	RHOC_ENST00000369638.2_Missense_Mutation_p.E142K|RHOC_ENST00000369636.2_Intron|RHOC_ENST00000339083.7_Missense_Mutation_p.E142K|RP11-426L16.10_ENST00000471038.2_5'Flank|RHOC_ENST00000369632.2_Missense_Mutation_p.E142K|RHOC_ENST00000369642.3_Missense_Mutation_p.E142K|RHOC_ENST00000369633.2_Missense_Mutation_p.E142K|RHOC_ENST00000369637.1_Missense_Mutation_p.E142K			P08134	RHOC_HUMAN	ras homolog family member C	142					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGCCTTCCTCAGACCGAACG	0.557																																						dbGAP											0													94.0	85.0	88.0					1																	113244320		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.424G>A	1.37:g.113244320C>T	ENSP00000285735:p.Glu142Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSW1|Q6ICN3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E142K	ENST00000285735.2	37	c.424	CCDS854.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349055	0.82132	.	.	ENSG00000155366	ENST00000339083;ENST00000369633;ENST00000369642;ENST00000285735;ENST00000369638;ENST00000369637;ENST00000369632;ENST00000484054;ENST00000425265;ENST00000534717	T;T;T;T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.13	5.13	0.70059	Small GTP-binding protein domain (1);	.	.	.	.	T	0.73705	0.3621	M	0.73319	2.225	0.80722	D	1	B	0.22909	0.077	B	0.31547	0.132	T	0.75221	-0.3394	9	0.66056	D	0.02	.	18.2015	0.89839	0.0:1.0:0.0:0.0	.	142	P08134	RHOC_HUMAN	K	142;142;142;142;142;142;142;179;142;142	ENSP00000345236:E142K;ENSP00000358647:E142K;ENSP00000358656:E142K;ENSP00000285735:E142K;ENSP00000358652:E142K;ENSP00000358651:E142K;ENSP00000358646:E142K;ENSP00000434877:E179K;ENSP00000390823:E142K;ENSP00000436240:E142K	ENSP00000285735:E142K	E	-	1	0	RHOC	113045843	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.805000	0.86005	2.396000	0.81511	0.563000	0.77884	GAG	RHOC	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000155366		0.557	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RHOC	HGNC	protein_coding	OTTHUMT00000032904.2	58	0.00	0	C	NM_175744		113244320	113244320	-1	no_errors	ENST00000285735	ensembl	human	known	69_37n	missense	21	51.16	22	SNP	1.000	T
SCN4A	6329	genome.wustl.edu	37	17	62019025	62019025	+	Silent	SNP	G	G	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr17:62019025G>A	ENST00000435607.1	-	24	4693	c.4617C>T	c.(4615-4617)gaC>gaT	p.D1539D	SCN4A_ENST00000578147.1_Silent_p.D1539D	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1539					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGAGGAGCCCGTCCCAGCCGG	0.607																																						dbGAP											0													44.0	47.0	46.0					17																	62019025		2165	4281	6446	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4617C>T	17.37:g.62019025G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.D1539	ENST00000435607.1	37	c.4617	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000007314		0.607	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		36	0.00	0	G	NM_000334		62019025	62019025	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	49	33.78	25	SNP	0.662	A
STX17	55014	genome.wustl.edu	37	9	102730740	102730740	+	Silent	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr9:102730740C>T	ENST00000259400.6	+	8	830	c.694C>T	c.(694-696)Ctg>Ttg	p.L232L	STX17_ENST00000525847.1_3'UTR|STX17_ENST00000525640.1_Silent_p.L232L|STX17_ENST00000534052.1_Silent_p.L232L	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	232	Necessary and sufficient for localization to autophagosome.				autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				GCTGGCAGCTCTGCCTGTGGC	0.483																																						dbGAP											0													26.0	30.0	29.0					9																	102730740		2114	4181	6295	-	-	-	SO:0001819	synonymous_variant	0			AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.694C>T	9.37:g.102730740C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXC2	Silent	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.L232	ENST00000259400.6	37	c.694	CCDS6745.1	9																																																																																			STX17	-	NULL	ENSG00000136874		0.483	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	STX17	HGNC	protein_coding	OTTHUMT00000053398.3	60	0.00	0	C	NM_017919		102730740	102730740	+1	no_errors	ENST00000259400	ensembl	human	known	69_37n	silent	37	41.27	26	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152668216	152668216	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr6:152668216G>A	ENST00000367255.5	-	73	12657	c.12056C>T	c.(12055-12057)gCg>gTg	p.A4019V	SYNE1_ENST00000265368.4_Missense_Mutation_p.A4019V|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000423061.1_Missense_Mutation_p.A3948V|SYNE1_ENST00000448038.1_Missense_Mutation_p.A3948V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4019					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCTGCAGATCGCTGAGTAGCT	0.483										HNSCC(10;0.0054)																												dbGAP											0													169.0	139.0	149.0					6																	152668216		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12056C>T	6.37:g.152668216G>A	ENSP00000356224:p.Ala4019Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A4019V	ENST00000367255.5	37	c.12056	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531598	0.64972	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000014	T	0.53126	0.1777	M	0.66939	2.045	0.80722	D	1	D;D;D;B	0.89917	1.0;1.0;1.0;0.005	D;D;D;B	0.85130	0.997;0.997;0.997;0.009	T	0.34378	-0.9831	10	0.32370	T	0.25	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	4019;4019;4019;3948	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	V	4019;3948;4019;3948	ENSP00000356224:A4019V;ENSP00000396024:A3948V;ENSP00000265368:A4019V;ENSP00000390975:A3948V	ENSP00000265368:A4019V	A	-	2	0	SYNE1	152709909	1.000000	0.71417	0.853000	0.33588	0.915000	0.54546	9.415000	0.97375	2.793000	0.96121	0.655000	0.94253	GCG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	159	0.00	0	G	NM_182961		152668216	152668216	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	146	18.44	33	SNP	1.000	A
TLX2	3196	genome.wustl.edu	37	2	74742786	74742786	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr2:74742786C>T	ENST00000233638.7	+	2	750	c.427C>T	c.(427-429)Cgc>Tgc	p.R143C	TLX2_ENST00000497238.1_3'UTR	NM_016170.4	NP_057254.1	O43763	TLX2_HUMAN	T-cell leukemia homeobox 2	143					enteric nervous system development (GO:0048484)|mesoderm formation (GO:0001707)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|ovary(1)	2						CTCTGGGACGCGCCGCATAGG	0.667																																					Esophageal Squamous(7;240 533 18610 24312)	dbGAP											0													57.0	65.0	62.0					2																	74742786		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002607	CCDS1947.1	2p13.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000115297	ENSG00000115297		"""Homeoboxes / ANTP class : NKL subclass"""	5057	protein-coding gene	gene with protein product		604240	"""homeo box 11-like 1"", ""T-cell leukemia, homeobox 2"""	HOX11L1		10343123	Standard	NM_016170		Approved	Enx, Tlx2, NCX	uc002sma.2	O43763	OTTHUMG00000129960	ENST00000233638.7:c.427C>T	2.37:g.74742786C>T	ENSP00000233638:p.Arg143Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UD56|Q9UQ48	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.R143C	ENST00000233638.7	37	c.427	CCDS1947.1	2	.	.	.	.	.	.	.	.	.	.	C	28.5	4.922277	0.92319	.	.	ENSG00000115297	ENST00000497238;ENST00000233638	D	0.95724	-3.79	4.29	4.29	0.51040	Homeodomain-like (1);	0.000000	0.52532	D	0.000063	D	0.97420	0.9156	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97652	1.0155	10	0.56958	D	0.05	.	14.3143	0.66437	0.0:1.0:0.0:0.0	.	143	O43763	TLX2_HUMAN	C	75;143	ENSP00000233638:R143C	ENSP00000233638:R143C	R	+	1	0	TLX2	74596294	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.735000	0.68587	2.216000	0.71823	0.655000	0.94253	CGC	TLX2	-	superfamily_Homeodomain-like	ENSG00000115297		0.667	TLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLX2	HGNC	protein_coding	OTTHUMT00000252224.3	44	0.00	0	C			74742786	74742786	+1	no_errors	ENST00000233638	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	T
TMPRSS6	164656	genome.wustl.edu	37	22	37482346	37482346	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr22:37482346G>A	ENST00000346753.3	-	8	1093	c.977C>T	c.(976-978)tCc>tTc	p.S326F	TMPRSS6_ENST00000406725.1_Missense_Mutation_p.S317F|TMPRSS6_ENST00000442782.2_Missense_Mutation_p.S326F|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.S317F|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.S317F	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	326	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						CGGCTGCACGGAGAGCACGAA	0.667																																						dbGAP											0													40.0	38.0	39.0					22																	37482346		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.977C>T	22.37:g.37482346G>A	ENSP00000334962:p.Ser326Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	pirsf_Pept_S1A_matriptase-2,pfam_Peptidase_S1_S6,pfam_LDrepeatLR_classA_rpt,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6	p.S317F	ENST00000346753.3	37	c.950	CCDS13941.1	22	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355286	0.61293	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000442782	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	4.83	4.83	0.62350	CUB (1);	0.075150	0.56097	D	0.000038	T	0.65523	0.2699	L	0.29908	0.895	0.50813	D	0.99989	D;D;D	0.76494	0.999;0.998;0.996	D;D;P	0.68943	0.961;0.914;0.823	T	0.68918	-0.5282	10	0.56958	D	0.05	.	16.9002	0.86110	0.0:0.0:1.0:0.0	.	326;317;326	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	F	317;326;317;317;326	ENSP00000371211:S317F;ENSP00000334962:S326F;ENSP00000385453:S317F;ENSP00000384964:S317F;ENSP00000397691:S326F	ENSP00000334962:S326F	S	-	2	0	TMPRSS6	35812292	1.000000	0.71417	0.997000	0.53966	0.045000	0.14185	5.643000	0.67895	2.215000	0.71742	0.655000	0.94253	TCC	TMPRSS6	-	pirsf_Pept_S1A_matriptase-2,superfamily_CUB	ENSG00000187045		0.667	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	TMPRSS6	HGNC	protein_coding	OTTHUMT00000318822.1	36	0.00	0	G	NM_153609		37482346	37482346	-1	no_errors	ENST00000381792	ensembl	human	known	69_37n	missense	10	58.33	14	SNP	1.000	A
WDR13	64743	genome.wustl.edu	37	X	48458037	48458037	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chrX:48458037C>T	ENST00000218056.5	+	4	960	c.455C>T	c.(454-456)aCg>aTg	p.T152M	WDR13_ENST00000376729.5_Missense_Mutation_p.T152M|WDR13_ENST00000492715.1_3'UTR	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	152						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GCCGGGGACACGTCACTGAGC	0.612																																						dbGAP											0													103.0	85.0	91.0					X																	48458037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.455C>T	X.37:g.48458037C>T	ENSP00000218056:p.Thr152Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T152M	ENST00000218056.5	37	c.455	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672741	0.67928	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.72051	-0.62;-0.62	5.48	5.48	0.80851	.	0.048580	0.85682	D	0.000000	T	0.66025	0.2748	L	0.47716	1.5	0.80722	D	1	P;D	0.61697	0.941;0.99	B;B	0.42593	0.225;0.392	T	0.69712	-0.5071	10	0.48119	T	0.1	-19.0234	15.6127	0.76740	0.0:1.0:0.0:0.0	.	30;152	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	M	152	ENSP00000365919:T152M;ENSP00000218056:T152M	ENSP00000218056:T152M	T	+	2	0	WDR13	48342981	1.000000	0.71417	0.996000	0.52242	0.928000	0.56348	6.826000	0.75298	2.281000	0.76405	0.529000	0.55759	ACG	WDR13	-	NULL	ENSG00000101940		0.612	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	60	0.00	0	C			48458037	48458037	+1	no_errors	ENST00000218056	ensembl	human	known	69_37n	missense	45	31.82	21	SNP	1.000	T
ZDHHC9	51114	genome.wustl.edu	37	X	128975839	128975839	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chrX:128975839C>T	ENST00000357166.6	-	3	474	c.83G>A	c.(82-84)cGc>cAc	p.R28H	ZDHHC9_ENST00000371064.3_Missense_Mutation_p.R28H	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	28					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						CATCATGACGCGGCCATCACA	0.512																																						dbGAP											0													182.0	142.0	155.0					X																	128975839		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.83G>A	X.37:g.128975839C>T	ENSP00000349689:p.Arg28His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.R28H	ENST00000357166.6	37	c.83	CCDS35395.1	X	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933242	0.92458	.	.	ENSG00000188706	ENST00000357166;ENST00000371064;ENST00000406492	T;T;T	0.69685	0.75;0.75;-0.42	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.82098	0.4963	M	0.91354	3.2	0.80722	D	1	D	0.64830	0.994	P	0.53224	0.721	D	0.86781	0.1979	10	0.72032	D	0.01	-9.0526	18.1206	0.89569	0.0:1.0:0.0:0.0	.	28	Q9Y397	ZDHC9_HUMAN	H	28	ENSP00000349689:R28H;ENSP00000360103:R28H;ENSP00000383991:R28H	ENSP00000349689:R28H	R	-	2	0	ZDHHC9	128803520	1.000000	0.71417	0.927000	0.36925	0.954000	0.61252	7.744000	0.85034	2.315000	0.78130	0.594000	0.82650	CGC	ZDHHC9	-	NULL	ENSG00000188706		0.512	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC9	HGNC	protein_coding	OTTHUMT00000058213.1	118	0.00	0	C	NM_016032		128975839	128975839	-1	no_errors	ENST00000357166	ensembl	human	known	69_37n	missense	107	22.46	31	SNP	1.000	T
ZFAND4	93550	genome.wustl.edu	37	10	46122444	46122444	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr10:46122444C>G	ENST00000344646.5	-	7	1042	c.827G>C	c.(826-828)gGt>gCt	p.G276A	ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374366.3_Missense_Mutation_p.G202A|ZFAND4_ENST00000374371.2_Intron	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	276							zinc ion binding (GO:0008270)										ACAAGATTGACCAATGTTGGG	0.483																																						dbGAP											0													99.0	91.0	94.0					10																	46122444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.827G>C	10.37:g.46122444C>G	ENSP00000339484:p.Gly276Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_Znf_AN1,smart_Ubiquitin,smart_Znf_AN1,prints_Ubiquitin_subgr,pfscan_Znf_AN1,pfscan_Ubiquitin_supergroup	p.G276A	ENST00000344646.5	37	c.827	CCDS7214.1	10	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966591	0.53507	.	.	ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370	T;T	0.25912	1.77;1.78	5.47	4.54	0.55810	.	1.399130	0.04677	N	0.411756	T	0.40448	0.1117	M	0.66939	2.045	0.50632	D	0.999885	P	0.51537	0.946	P	0.46362	0.514	T	0.11131	-1.0600	10	0.54805	T	0.06	-13.7898	13.8293	0.63370	0.0:0.8454:0.1546:0.0	.	276	Q86XD8	ANUB1_HUMAN	A	276;202;158	ENSP00000339484:G276A;ENSP00000363486:G202A	ENSP00000339484:G276A	G	-	2	0	ANUBL1	45442450	1.000000	0.71417	0.997000	0.53966	0.488000	0.33401	4.232000	0.58645	1.271000	0.44313	0.650000	0.86243	GGT	ZFAND4	-	NULL	ENSG00000172671		0.483	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND4	HGNC	protein_coding	OTTHUMT00000047790.1	33	0.00	0	C	NM_174890		46122444	46122444	-1	no_errors	ENST00000344646	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	G
ZNF645	158506	genome.wustl.edu	37	X	22291800	22291800	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chrX:22291800T>A	ENST00000323684.1	+	1	736	c.692T>A	c.(691-693)tTt>tAt	p.F231Y		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	231					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						GTTAGTATTTTTACGAGAAAA	0.423																																						dbGAP											0													90.0	78.0	82.0					X																	22291800		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.692T>A	X.37:g.22291800T>A	ENSP00000323348:p.Phe231Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	pfscan_Znf_RING,pfscan_Znf_C2H2	p.F231Y	ENST00000323684.1	37	c.692	CCDS14205.1	X	.	.	.	.	.	.	.	.	.	.	T	10.92	1.487135	0.26686	.	.	ENSG00000175809	ENST00000323684	T	0.30448	1.53	3.3	1.47	0.22746	.	0.361954	0.25689	U	0.028951	T	0.15565	0.0375	N	0.22421	0.69	0.09310	N	1	P	0.49253	0.921	B	0.43701	0.428	T	0.22208	-1.0223	10	0.02654	T	1	.	6.6969	0.23203	0.0:0.7374:0.0:0.2626	.	231	Q8N7E2	ZN645_HUMAN	Y	231	ENSP00000323348:F231Y	ENSP00000323348:F231Y	F	+	2	0	ZNF645	22201721	0.999000	0.42202	0.003000	0.11579	0.003000	0.03518	4.074000	0.57577	0.262000	0.21774	-1.026000	0.02426	TTT	ZNF645	-	NULL	ENSG00000175809		0.423	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF645	HGNC	protein_coding	OTTHUMT00000056037.1	27	0.00	0	T	NM_152577		22291800	22291800	+1	no_errors	ENST00000323684	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.039	A
ZIC3	7547	genome.wustl.edu	37	X	136649099	136649099	+	Silent	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chrX:136649099C>T	ENST00000287538.5	+	1	799	c.249C>T	c.(247-249)aaC>aaT	p.N83N	RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_Silent_p.N83N	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	83					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					GCTACGCCAACGCCCTGGGCc	0.677																																						dbGAP											0													10.0	7.0	8.0					X																	136649099		1937	3769	5706	-	-	-	SO:0001819	synonymous_variant	0			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.249C>T	X.37:g.136649099C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2CNW4|Q14DE5|Q5JY75	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N83	ENST00000287538.5	37	c.249	CCDS14663.1	X																																																																																			ZIC3	-	NULL	ENSG00000156925		0.677	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC3	HGNC	protein_coding	OTTHUMT00000058526.1	25	0.00	0	C			136649099	136649099	+1	no_errors	ENST00000287538	ensembl	human	known	69_37n	silent	10	61.54	16	SNP	1.000	T
ZSCAN21	7589	genome.wustl.edu	37	7	99654807	99654807	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A2LK-01A-11D-A17W-09	TCGA-AR-A2LK-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b0b60c7-5fa0-440e-937f-8d82119330d6	adfefa9c-2e3e-444d-8018-f364999f5f42	g.chr7:99654807C>T	ENST00000292450.4	+	2	342	c.178C>T	c.(178-180)Cga>Tga	p.R60*	ZSCAN21_ENST00000456748.2_Nonsense_Mutation_p.R60*|ZSCAN21_ENST00000543588.1_Nonsense_Mutation_p.R60*|ZSCAN21_ENST00000477297.1_3'UTR	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	60	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CCCTGGACCCCGAGAGGCCCT	0.577																																						dbGAP											0													67.0	69.0	68.0					7																	99654807		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.178C>T	7.37:g.99654807C>T	ENSP00000292450:p.Arg60*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A6|D6W5T9|Q9H0B5	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R60*	ENST00000292450.4	37	c.178	CCDS5681.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.126050	0.94429	.	.	ENSG00000166529	ENST00000543588;ENST00000292450;ENST00000456748;ENST00000438937;ENST00000379635	.	.	.	4.91	3.06	0.35304	.	0.000000	0.35436	N	0.003206	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9397	0.19186	0.189:0.7149:0.0:0.0962	.	.	.	.	X	60	.	ENSP00000292450:R60X	R	+	1	2	ZSCAN21	99492743	0.350000	0.24878	0.968000	0.41197	0.669000	0.39330	0.544000	0.23253	0.758000	0.33059	0.655000	0.94253	CGA	ZSCAN21	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000166529		0.577	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN21	HGNC	protein_coding	OTTHUMT00000336166.1	36	0.00	0	C	NM_145914		99654807	99654807	+1	no_errors	ENST00000292450	ensembl	human	known	69_37n	nonsense	28	28.21	11	SNP	0.985	T
