#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALX4	60529	genome.wustl.edu	37	11	44296903	44296903	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr11:44296903C>T	ENST00000329255.3	-	2	875	c.772G>A	c.(772-774)Gtg>Atg	p.V258M		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	258					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V258M(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						CTGACCTGCACGCGGGCCTCA	0.627																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											52.0	52.0	52.0					11																	44296903		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.772G>A	11.37:g.44296903C>T	ENSP00000332744:p.Val258Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.V258M	ENST00000329255.3	37	c.772	CCDS31468.1	11	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539763	0.65085	.	.	ENSG00000052850	ENST00000329255	D	0.99023	-5.34	3.74	3.74	0.42951	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.068720	0.64402	D	0.000019	D	0.99684	0.9881	H	0.99916	4.945	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.96708	0.9523	10	0.87932	D	0	.	15.7255	0.77756	0.0:1.0:0.0:0.0	.	258	Q9H161	ALX4_HUMAN	M	258	ENSP00000332744:V258M	ENSP00000332744:V258M	V	-	1	0	ALX4	44253479	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	7.623000	0.83113	1.929000	0.55896	0.455000	0.32223	GTG	ALX4	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000052850		0.627	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX4	HGNC	protein_coding	OTTHUMT00000390399.1	26	0.00	0	C			44296903	44296903	-1	no_errors	ENST00000329255	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	T
ANKRD12	23253	genome.wustl.edu	37	18	9221991	9221992	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr18:9221991_9221992insA	ENST00000262126.4	+	8	1177_1178	c.937_938insA	c.(937-939)tacfs	p.Y313fs	ANKRD12_ENST00000400020.3_Frame_Shift_Ins_p.Y290fs|ANKRD12_ENST00000540578.2_3'UTR|ANKRD12_ENST00000383440.2_Frame_Shift_Ins_p.Y290fs	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	313						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TGATGAAAGTTACACAGGTTTG	0.356																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.938dupA	18.37:g.9221992_9221992dupA	ENSP00000262126:p.Tyr313fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Y313fs	ENST00000262126.4	37	c.937_938	CCDS11843.1	18																																																																																			ANKRD12	-	NULL	ENSG00000101745		0.356	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	42	0.00	0	-	NM_015208		9221991	9221992	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	frame_shift_ins	25	28.57	10	INS	1.000:0.999	A
ARPP21	10777	genome.wustl.edu	37	3	35731564	35731564	+	Intron	SNP	A	A	C			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr3:35731564A>C	ENST00000187397.4	+	8	941				ARPP21_ENST00000417925.1_Intron|ARPP21_ENST00000337271.5_Intron|ARPP21_ENST00000458225.1_Intron|ARPP21_ENST00000444190.1_Intron	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa						cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TTTAACATTTATTTTGCAGGG	0.284																																						dbGAP											0													76.0	77.0	76.0					3																	35731564		2202	4292	6494	-	-	-	SO:0001627	intron_variant	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.486-9A>C	3.37:g.35731564A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.I1L	ENST00000187397.4	37	c.1	CCDS2661.1	3	.	.	.	.	.	.	.	.	.	.	A	12.42	1.931278	0.34096	.	.	ENSG00000172995	ENST00000425289	.	.	.	5.21	-8.72	0.00845	.	.	.	.	.	T	0.31765	0.0807	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40289	-0.9571	4	.	.	.	.	0.4283	0.00467	0.2251:0.2474:0.2555:0.272	.	.	.	.	L	1	.	.	I	+	1	0	ARPP21	35706568	0.592000	0.26832	0.520000	0.27837	0.571000	0.35966	-0.766000	0.04725	-1.651000	0.01504	-1.205000	0.01647	ATT	ARPP21	-	NULL	ENSG00000172995		0.284	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	30	0.00	0	A	NM_198399		35731564	35731564	+1	no_start_codon:pseudogene:bad_bp_length_for_coding_region	ENST00000425289	ensembl	human	putative	69_37n	missense	41	12.77	6	SNP	0.214	C
BRWD1	54014	genome.wustl.edu	37	21	40568403	40568403	+	Intron	SNP	T	T	C			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr21:40568403T>C	ENST00000333229.2	-	41	6899				BRWD1_ENST00000342449.3_Missense_Mutation_p.I2198V|BRWD1_ENST00000380800.3_Intron	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GTTTTAGATATGTTAGCTGTA	0.348																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													171.0	151.0	158.0					21																	40568403		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.6571+20A>G	21.37:g.40568403T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.I2198V	ENST00000333229.2	37	c.6592	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.746957	0.00669	.	.	ENSG00000185658	ENST00000342449	T	0.50813	0.73	5.53	-11.1	0.00147	.	.	.	.	.	T	0.24005	0.0581	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35549	-0.9784	8	0.28530	T	0.3	.	2.5982	0.04859	0.1773:0.1283:0.3469:0.3475	.	2198	Q9NSI6-2	.	V	2198	ENSP00000344333:I2198V	ENSP00000344333:I2198V	I	-	1	0	BRWD1	39490273	0.000000	0.05858	0.000000	0.03702	0.995000	0.86356	-4.919000	0.00170	-5.964000	0.00007	-0.290000	0.09829	ATA	BRWD1	-	NULL	ENSG00000185658		0.348	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	46	0.00	0	T	NM_033656		40568403	40568403	-1	no_errors	ENST00000342449	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	0.000	C
PRR35	146325	genome.wustl.edu	37	16	613320	613320	+	Missense_Mutation	SNP	G	G	A	rs201338708	byFrequency	TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr16:613320G>A	ENST00000409413.3	+	2	305	c.26G>A	c.(25-27)cGc>cAc	p.R9H		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		9										central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						GGCTCATGCCGCGTGGGCACA	0.662													G|||	6	0.00119808	0.0	0.0	5008	,	,		12012	0.001		0.001	False		,,,				2504	0.0041					dbGAP											0													29.0	33.0	32.0					16																	613320		1989	4139	6128	-	-	-	SO:0001583	missense	0																														ENST00000409413.3:c.26G>A	16.37:g.613320G>A	ENSP00000386499:p.Arg9His	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	NULL	p.R9H	ENST00000409413.3	37	c.26	CCDS45365.1	16	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.04	2.417530	0.42918	.	.	ENSG00000161992	ENST00000409413	.	.	.	4.36	2.38	0.29361	.	0.479552	0.16226	N	0.223802	T	0.41213	0.1149	L	0.59436	1.845	0.24271	N	0.995245	B	0.18610	0.029	B	0.16722	0.016	T	0.40646	-0.9552	9	0.72032	D	0.01	.	6.6678	0.23052	0.3091:0.0:0.6909:0.0	.	9	P0CG20	CP011_HUMAN	H	9	.	ENSP00000386499:R9H	R	+	2	0	C16orf11	553321	0.821000	0.29204	0.724000	0.30704	0.063000	0.16089	1.363000	0.34159	0.410000	0.25675	-0.222000	0.12452	CGC	C16orf11	-	NULL	ENSG00000161992		0.662	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C16orf11	HGNC	protein_coding	OTTHUMT00000333913.1	46	0.00	0	G			613320	613320	+1	no_errors	ENST00000409413	ensembl	human	known	69_37n	missense	91	11.65	12	SNP	0.635	A
CDH1	999	genome.wustl.edu	37	16	68835629	68835629	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr16:68835629C>T	ENST00000261769.5	+	3	411	c.220C>T	c.(220-222)Cga>Tga	p.R74*	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Nonsense_Mutation_p.R74*	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	74					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.R74*(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CCTCGACACCCGATTCAAAGT	0.463			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Unknown(2)|Substitution - Nonsense(1)	breast(3)											190.0	172.0	178.0					16																	68835629		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.220C>T	16.37:g.68835629C>T	ENSP00000261769:p.Arg74*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R74*	ENST00000261769.5	37	c.220	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.554030	0.97658	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.43	3.31	0.37934	.	0.214104	0.23710	N	0.045326	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	13.9331	0.64007	0.2954:0.7045:0.0:0.0	.	.	.	.	X	74	.	ENSP00000261769:R74X	R	+	1	2	CDH1	67393130	0.738000	0.28186	0.998000	0.56505	0.868000	0.49771	1.805000	0.38883	1.347000	0.45714	0.561000	0.74099	CGA	CDH1	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like	ENSG00000039068		0.463	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	44	0.00	0	C	NM_004360		68835629	68835629	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	24	38.46	15	SNP	0.998	T
DPF3	8110	genome.wustl.edu	37	14	73137344	73137345	+	Intron	DEL	TC	TC	-	rs71788041		TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr14:73137344_73137345delTC	ENST00000556509.1	-	8	871				DPF3_ENST00000541685.1_3'UTR|DPF3_ENST00000557704.1_5'UTR	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3						chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TGATTTCCCTtctctctctctc	0.396																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.871+3602GA>-	14.37:g.73137354_73137355delTC		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	RNA	DEL	-	NULL	ENST00000556509.1	37	NULL		14																																																																																			DPF3	-	-	ENSG00000205683		0.396	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	DPF3	HGNC	protein_coding	OTTHUMT00000413152.2	32	0.00	0	TC			73137344	73137345	-1	no_errors	ENST00000557704	ensembl	human	known	69_37n	rna	47	14.55	8	DEL	0.959:0.966	-
ERN2	10595	genome.wustl.edu	37	16	23706081	23706081	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr16:23706081C>T	ENST00000457008.2	-	16	1950	c.1912G>A	c.(1912-1914)Gag>Aag	p.E638K	ERN2_ENST00000256797.4_Missense_Mutation_p.E738K					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TGCAGAAGCTCGGGCGCCATC	0.642																																						dbGAP											0													15.0	18.0	17.0					16																	23706081		2196	4300	6496	-	-	-	SO:0001583	missense	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1912G>A	16.37:g.23706081C>T	ENSP00000413812:p.Glu638Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_cat_dom	p.E738K	ENST00000457008.2	37	c.2212		16	.	.	.	.	.	.	.	.	.	.	C	36	5.642965	0.96704	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.79940	-1.32;-1.32	5.32	5.32	0.75619	.	0.114185	0.56097	D	0.000029	D	0.93893	0.8046	H	0.98295	4.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.982;0.987	D	0.95999	0.8992	10	0.87932	D	0	.	16.8479	0.85986	0.0:1.0:0.0:0.0	.	638;690	E7ETG2;A5YM65	.;.	K	738;638	ENSP00000256797:E738K;ENSP00000413812:E638K	ENSP00000256797:E738K	E	-	1	0	ERN2	23613582	1.000000	0.71417	0.956000	0.39512	0.959000	0.62525	7.445000	0.80570	2.640000	0.89533	0.655000	0.94253	GAG	ERN2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000134398		0.642	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1	52	0.00	0	C			23706081	23706081	-1	no_errors	ENST00000256797	ensembl	human	known	69_37n	missense	75	20.21	19	SNP	0.999	T
FAM182B	728882	genome.wustl.edu	37	20	25848605	25848605	+	5'UTR	SNP	C	C	T	rs77436585		TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr20:25848605C>T	ENST00000478164.1	-	0	181				FAM182B_ENST00000376404.2_5'UTR			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						catcaccgtccgggcaggcct	0.672																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000478164.1:c.-811G>A	20.37:g.25848605C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0Q1	RNA	SNP	-	NULL	ENST00000478164.1	37	NULL		20																																																																																			FAM182B	-	-	ENSG00000175170		0.672	FAM182B-005	KNOWN	basic	processed_transcript	FAM182B	HGNC	protein_coding	OTTHUMT00000316665.1	26	0.00	0	C	NR_026714		25848605	25848605	-1	no_errors	ENST00000478164	ensembl	human	known	69_37n	rna	24	25.00	8	SNP	0.028	T
FAM84A	151354	genome.wustl.edu	37	2	14775297	14775297	+	3'UTR	SNP	G	G	A	rs181313863	byFrequency	TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr2:14775297G>A	ENST00000295092.2	+	0	1482				FAM84A_ENST00000331243.4_3'UTR|AC011897.1_ENST00000581929.1_5'UTR|FAM84A_ENST00000497769.1_3'UTR	NM_145175.2	NP_660158.2	Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A											endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			GGGCTGAGGGGAGAAAGGACA	0.637																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ417080, BC026346	CCDS1684.1	2p24.3	2005-08-09			ENSG00000162981	ENSG00000162981			20743	protein-coding gene	gene with protein product	"""neurological/sensory 1"""	611234				14702039	Standard	NM_145175		Approved	NSE1, FLJ35392	uc002rbz.2	Q96KN4	OTTHUMG00000119093	ENST00000295092.2:c.*315G>A	2.37:g.14775297G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP76|Q86UZ2|Q8NAH7|Q8TAM5	RNA	SNP	-	NULL	ENST00000295092.2	37	NULL	CCDS1684.1	2	.	.	.	.	.	.	.	.	.	.	G	13.35	2.212449	0.39102	.	.	ENSG00000162981	ENST00000359969	.	.	.	4.13	1.3	0.21679	.	.	.	.	.	T	0.42381	0.1200	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.36986	-0.9725	5	0.87932	D	0	-0.001	7.9741	0.30145	0.2851:0.0:0.7149:0.0	.	.	.	.	E	343	.	ENSP00000353054:G343E	G	+	2	0	FAM84A	14692748	0.213000	0.23551	0.002000	0.10522	0.369000	0.29798	0.255000	0.18333	0.152000	0.19188	0.561000	0.74099	GGA	FAM84A	-	-	ENSG00000162981		0.637	FAM84A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM84A	HGNC	protein_coding	OTTHUMT00000239308.2	35	0.00	0	G	NM_145175		14775297	14775297	+1	no_errors	ENST00000497769	ensembl	human	known	69_37n	rna	30	34.78	16	SNP	0.002	A
FBXO43	286151	genome.wustl.edu	37	8	101146139	101146139	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr8:101146139C>T	ENST00000428847.2	-	5	2334	c.2018G>A	c.(2017-2019)tGt>tAt	p.C673Y		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	673					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			ATGATAAGCACACAGACATAA	0.463																																						dbGAP											0													142.0	137.0	139.0					8																	101146139		1944	4141	6085	-	-	-	SO:0001583	missense	0			BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.2018G>A	8.37:g.101146139C>T	ENSP00000403293:p.Cys673Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C6HC,superfamily_F-box_dom_cyclin-like,smart_Znf_C6HC	p.C673Y	ENST00000428847.2	37	c.2018	CCDS47904.1	8	.	.	.	.	.	.	.	.	.	.	C	18.43	3.623093	0.66901	.	.	ENSG00000156509	ENST00000428847	T	0.80566	-1.39	5.15	5.15	0.70609	Zinc finger, C6HC-type (2);	0.105372	0.64402	D	0.000003	D	0.87224	0.6124	M	0.62723	1.935	0.49687	D	0.999812	D	0.76494	0.999	D	0.77004	0.989	D	0.87777	0.2609	10	0.66056	D	0.02	-11.9532	12.8388	0.57788	0.0:0.9144:0.0:0.0856	.	673	Q4G163	FBX43_HUMAN	Y	673	ENSP00000403293:C673Y	ENSP00000403293:C673Y	C	-	2	0	FBXO43	101215315	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.575000	0.53870	2.561000	0.86390	0.655000	0.94253	TGT	FBXO43	-	pfam_Znf_C6HC,smart_Znf_C6HC	ENSG00000156509		0.463	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO43	HGNC	protein_coding	OTTHUMT00000380380.1	20	0.00	0	C	XM_209918		101146139	101146139	-1	no_errors	ENST00000428847	ensembl	human	known	69_37n	missense	18	47.06	16	SNP	1.000	T
KIAA0556	23247	genome.wustl.edu	37	16	27709761	27709761	+	Silent	SNP	C	C	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr16:27709761C>T	ENST00000261588.4	+	9	1072	c.1053C>T	c.(1051-1053)aaC>aaT	p.N351N	KIAA0556_ENST00000567894.1_3'UTR|CTD-2049O4.1_ENST00000564893.1_RNA	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	351						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AGGTGGAGAACGCAGCCCTGC	0.647																																						dbGAP											0													43.0	44.0	44.0					16																	27709761		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1053C>T	16.37:g.27709761C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C2	Silent	SNP	superfamily_Thaumatin	p.N351	ENST00000261588.4	37	c.1053	CCDS32415.1	16																																																																																			KIAA0556	-	NULL	ENSG00000047578		0.647	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	HGNC	protein_coding	OTTHUMT00000433724.1	18	0.00	0	C	NM_015202		27709761	27709761	+1	no_errors	ENST00000261588	ensembl	human	known	69_37n	silent	23	36.11	13	SNP	0.111	T
MAGEC3	139081	genome.wustl.edu	37	X	140985322	140985322	+	Intron	SNP	T	T	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chrX:140985322T>A	ENST00000298296.1	+	7	1728				MAGEC3_ENST00000409007.1_Missense_Mutation_p.L295H|MAGEC3_ENST00000443323.2_Missense_Mutation_p.L215H|MAGEC3_ENST00000536088.1_Missense_Mutation_p.L295H|MAGEC3_ENST00000544766.1_Missense_Mutation_p.L295H	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3											NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					AGAAAGCTGCTCACTATACAT	0.532																																						dbGAP											0													74.0	73.0	73.0					X																	140985322		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1728+50T>A	X.37:g.140985322T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.L295H	ENST00000298296.1	37	c.884	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	t	11.09	1.535968	0.27475	.	.	ENSG00000165509	ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T	0.08008	3.14;3.14;3.14;3.14	1.25	1.25	0.21368	.	.	.	.	.	T	0.28962	0.0719	M	0.89601	3.045	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.05733	-1.0867	8	.	.	.	.	4.2608	0.10740	0.0:0.0:0.0:1.0	.	295	Q3SYA7	.	H	295;215;295;295	ENSP00000441107:L295H;ENSP00000438254:L215H;ENSP00000440444:L295H;ENSP00000386566:L295H	.	L	+	2	0	MAGEC3	140812988	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	0.636000	0.24644	0.737000	0.32582	0.235000	0.17854	CTC	MAGEC3	-	pfam_MAGE,pfscan_MAGE	ENSG00000165509		0.532	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	57	0.00	0	T	NM_138702		140985322	140985322	+1	no_errors	ENST00000536088	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	0.003	A
MGAM	8972	genome.wustl.edu	37	7	141767141	141767141	+	Intron	SNP	G	G	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr7:141767141G>A	ENST00000549489.2	+	38	4713				MGAM_ENST00000475668.2_Splice_Site_p.E1640E	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCCTTTCCAGGTTTGTGTCAG	0.562																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4618+1873G>A	7.37:g.141767141G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.E1640	ENST00000549489.2	37	c.4920	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31	ENSG00000257335		0.562	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	89	0.00	0	G			141767141	141767141	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	silent	133	13.55	21	SNP	1.000	A
MRGPRX1	259249	genome.wustl.edu	37	11	18955397	18955397	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr11:18955397A>T	ENST00000302797.3	-	1	1159	c.935T>A	c.(934-936)aTc>aAc	p.I312N	MRGPRX1_ENST00000526914.1_5'Flank|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	312				EEI -> QET (in Ref. 2; AAL86880). {ECO:0000305}.	acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CAGCTCCAGGATTTCCTCAGG	0.562																																						dbGAP											0													72.0	68.0	69.0					11																	18955397		2194	4285	6479	-	-	-	SO:0001583	missense	0				CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.935T>A	11.37:g.18955397A>T	ENSP00000305766:p.Ile312Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.I312N	ENST00000302797.3	37	c.935	CCDS7846.1	11	.	.	.	.	.	.	.	.	.	.	.	6.290	0.421577	0.11928	.	.	ENSG00000170255	ENST00000302797	T	0.19669	2.13	2.14	0.0765	0.14403	.	1.346650	0.04847	N	0.441572	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29119	-1.0022	10	0.41790	T	0.15	.	2.819	0.05467	0.168:0.0:0.563:0.269	.	312	Q96LB2	MRGX1_HUMAN	N	312	ENSP00000305766:I312N	ENSP00000305766:I312N	I	-	2	0	MRGPRX1	18911973	0.000000	0.05858	0.004000	0.12327	0.043000	0.13939	-0.262000	0.08682	0.014000	0.14944	-0.374000	0.07098	ATC	MRGPRX1	-	NULL	ENSG00000170255		0.562	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX1	HGNC	protein_coding	OTTHUMT00000369913.1	47	0.00	0	A	NM_147199		18955397	18955397	-1	no_errors	ENST00000302797	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.285	T
OGDH	4967	genome.wustl.edu	37	7	44736635	44736635	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr7:44736635G>A	ENST00000222673.5	+	15	2065	c.2023G>A	c.(2023-2025)Ggc>Agc	p.G675S	OGDH_ENST00000439616.2_Missense_Mutation_p.G525S|OGDH_ENST00000543843.1_Missense_Mutation_p.G626S|OGDH_ENST00000447398.1_Missense_Mutation_p.G686S|OGDH_ENST00000449767.1_Missense_Mutation_p.G671S|OGDH_ENST00000444676.1_Missense_Mutation_p.G690S	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	675					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	TCGGCTGAGCGGCCAGGACGT	0.562																																						dbGAP											0													100.0	80.0	87.0					7																	44736635		2203	4300	6503	-	-	-	SO:0001583	missense	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2023G>A	7.37:g.44736635G>A	ENSP00000222673:p.Gly675Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.G675S	ENST00000222673.5	37	c.2023	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.718845	0.96839	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27;-3.27	5.13	5.13	0.70059	Transketolase-like, pyrimidine-binding domain (2);	0.048940	0.85682	D	0.000000	D	0.98235	0.9416	H	0.98559	4.265	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.99585	1.0974	10	0.87932	D	0	-27.4201	18.3765	0.90437	0.0:0.0:1.0:0.0	.	470;525;671;686;577;675	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	S	525;671;686;690;675;626	ENSP00000398576:G525S;ENSP00000392878:G671S;ENSP00000388183:G686S;ENSP00000414662:G690S;ENSP00000222673:G675S;ENSP00000443821:G626S	ENSP00000222673:G675S	G	+	1	0	OGDH	44703160	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.548000	0.98103	2.642000	0.89623	0.650000	0.86243	GGC	OGDH	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000105953		0.562	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	59	0.00	0	G			44736635	44736635	+1	no_errors	ENST00000222673	ensembl	human	known	69_37n	missense	60	31.03	27	SNP	1.000	A
PER3	8863	genome.wustl.edu	37	1	7890053	7890053	+	Missense_Mutation	SNP	G	G	A	rs1776342	byFrequency	TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr1:7890053G>A	ENST00000361923.2	+	18	3194	c.3019G>A	c.(3019-3021)Gct>Act	p.A1007T	PER3_ENST00000377532.3_Missense_Mutation_p.A1016T|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1007	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.		A -> T (in dbSNP:rs1776342).|Missing (associated with eveningness and better cognitive performance during sleep deprivation exepriments; dbSNP:rs57875989).		circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A1007T(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGCCAGCGCTCTGTCCAC	0.587																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											87.0	69.0	75.0					1																	7890053		1995	3902	5897	-	-	-	SO:0001583	missense	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3019G>A	1.37:g.7890053G>A	ENSP00000355031:p.Ala1007Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.A1007T	ENST00000361923.2	37	c.3019	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	g	0.668	-0.803078	0.02841	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.14391	2.51;2.51	0.119	0.119	0.14685	Period circadian-like, C-terminal (1);	9.368370	0.00166	N	0.000019	T	0.09158	0.0226	N	0.20685	0.6	0.09310	N	1	B;B;B;B;B	0.25048	0.025;0.007;0.066;0.117;0.007	B;B;B;B;B	0.23018	0.002;0.004;0.004;0.043;0.004	T	0.25676	-1.0125	9	0.18710	T	0.47	.	.	.	.	rs1776342	56;1007;1016;1016;1007	B4DR65;A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;.;PER3_HUMAN	T	1016;1007	ENSP00000366755:A1016T;ENSP00000355031:A1007T	ENSP00000355031:A1007T	A	+	1	0	PER3	7812640	0.000000	0.05858	0.068000	0.19968	0.074000	0.17049	-0.849000	0.04322	0.275000	0.22094	0.280000	0.19369	GCT	PER3	-	pfam_Period_circadian-like_C	ENSG00000049246		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	41	0.00	0	G	NM_016831		7890053	7890053	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	0.080	A
PER3	8863	genome.wustl.edu	37	1	7890055	7890055	+	Silent	SNP	T	T	A	rs11121034	byFrequency	TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr1:7890055T>A	ENST00000361923.2	+	18	3196	c.3021T>A	c.(3019-3021)gcT>gcA	p.A1007A	PER3_ENST00000377532.3_Silent_p.A1016A|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1007	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.		A -> T (in dbSNP:rs1776342).|Missing (associated with eveningness and better cognitive performance during sleep deprivation exepriments; dbSNP:rs57875989).		circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCCAGCGCTCTGTCCACAG	0.587																																						dbGAP											0													90.0	71.0	77.0					1																	7890055		1995	3900	5895	-	-	-	SO:0001819	synonymous_variant	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3021T>A	1.37:g.7890055T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.A1007	ENST00000361923.2	37	c.3021	CCDS89.1	1																																																																																			PER3	-	pfam_Period_circadian-like_C	ENSG00000049246		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	43	0.00	0	T	NM_016831		7890055	7890055	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	silent	35	10.26	4	SNP	0.063	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	17	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	G
PTPRE	5791	genome.wustl.edu	37	10	129883933	129883933	+	3'UTR	SNP	C	C	T	rs6911	byFrequency	TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr10:129883933C>T	ENST00000254667.3	+	0	5145				PTPRE_ENST00000306042.5_3'UTR	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	TTGTGTTTAACTTATGTGCAG	0.279													T|||	2730	0.545128	0.5915	0.6585	5008	,	,		16728	0.4802		0.5318	False		,,,				2504	0.4826				Colon(52;977 1184 20575 41685)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.*2763C>T	10.37:g.129883933C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	RNA	SNP	-	NULL	ENST00000254667.3	37	NULL	CCDS7657.1	10																																																																																			PTPRE	-	-	ENSG00000132334		0.279	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRE	HGNC	protein_coding	OTTHUMT00000050990.1	58	0.00	0	C			129883933	129883933	+1	no_errors	ENST00000479896	ensembl	human	known	69_37n	rna	48	11.11	6	SNP	1.000	T
RASGRP4	115727	genome.wustl.edu	37	19	38903584	38903584	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr19:38903584G>T	ENST00000587738.1	-	12	1592	c.1522C>A	c.(1522-1524)Ccc>Acc	p.P508T	RASGRP4_ENST00000433821.2_Missense_Mutation_p.P416T|RASGRP4_ENST00000587753.1_Missense_Mutation_p.P439T|RASGRP4_ENST00000293062.9_Missense_Mutation_p.P411T|RASGRP4_ENST00000454404.2_Missense_Mutation_p.P474T|RASGRP4_ENST00000586305.1_Missense_Mutation_p.P494T|RASGRP4_ENST00000426920.2_Missense_Mutation_p.P319T			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	508					activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGCGTGGGGGTGGGTGAAGC	0.582																																						dbGAP											0													55.0	60.0	58.0					19																	38903584		1958	4158	6116	-	-	-	SO:0001583	missense	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1522C>A	19.37:g.38903584G>T	ENSP00000465772:p.Pro508Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.P508T	ENST00000587738.1	37	c.1522	CCDS46068.1	19	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069126	0.36470	.	.	ENSG00000171777	ENST00000433821;ENST00000293062;ENST00000426920;ENST00000405332;ENST00000454404	T;T;T	0.75938	-0.98;2.16;2.16	5.58	4.49	0.54785	.	0.154948	0.53938	D	0.000046	T	0.76969	0.4062	L	0.29908	0.895	0.18873	N	0.999989	D;P;B;D;B;P;D	0.89917	0.996;0.643;0.361;1.0;0.361;0.605;0.996	P;P;B;D;B;P;P	0.83275	0.906;0.476;0.107;0.996;0.107;0.503;0.906	T	0.66118	-0.6003	10	0.23891	T	0.37	-12.667	13.6494	0.62301	0.0:0.1562:0.8437:0.0	.	319;411;416;474;439;494;508	C0LTP5;C0LTP7;C0LTP2;C0LTP4;C0LTP3;Q8TDF6-2;Q8TDF6	.;.;.;.;.;.;GRP4_HUMAN	T	416;411;319;508;508	ENSP00000411878:P416T;ENSP00000293062:P411T;ENSP00000445966:P319T	ENSP00000293062:P411T	P	-	1	0	RASGRP4	43595424	0.329000	0.24696	0.874000	0.34290	0.681000	0.39784	1.609000	0.36858	2.642000	0.89623	0.655000	0.94253	CCC	RASGRP4	-	NULL	ENSG00000171777		0.582	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	41	0.00	0	G	NM_170604		38903584	38903584	-1	no_errors	ENST00000587738	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	0.262	T
RNF32	140545	genome.wustl.edu	37	7	156451374	156451374	+	Intron	SNP	G	G	C			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr7:156451374G>C	ENST00000405335.1	+	8	1093				RNF32_ENST00000432459.2_Intron|RNF32_ENST00000311822.8_Intron|RNF32_ENST00000392741.2_Intron|RNF32_ENST00000317955.5_Intron|AC005534.8_ENST00000455709.1_RNA|RNF32_ENST00000343665.4_Intron|RNF32_ENST00000392743.2_Intron			Q9H0A6	RNF32_HUMAN	ring finger protein 32							aggresome (GO:0016235)|endosome (GO:0005768)	zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(2)	15	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		TTCACTTTGAGGGCTTTTTAA	0.403																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5944.1	7q36	2013-08-05			ENSG00000105982	ENSG00000105982		"""RING-type (C3HC4) zinc fingers"""	17118	protein-coding gene	gene with protein product		610241				11890671	Standard	NM_001184996		Approved	FKSG33, HSD15, LMBR2	uc003wmr.3	Q9H0A6	OTTHUMG00000151440	ENST00000405335.1:c.684+110G>C	7.37:g.156451374G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FIB3|Q6X7T4|Q8N6V8|Q8TDG0|Q96BM5|Q9Y6U1	RNA	SNP	-	NULL	ENST00000405335.1	37	NULL	CCDS5944.1	7																																																																																			RNF32	-	-	ENSG00000105982		0.403	RNF32-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF32	HGNC	protein_coding	OTTHUMT00000322660.2	10	0.00	0	G	NM_030936		156451374	156451374	+1	no_errors	ENST00000463028	ensembl	human	known	69_37n	rna	10	28.57	4	SNP	0.002	C
CIB1	10519	genome.wustl.edu	37	15	90771234	90771234	+	IGR	SNP	A	A	C	rs374418194		TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr15:90771234A>C	ENST00000328649.6	-	0	1247				SEMA4B_ENST00000379122.3_Missense_Mutation_p.N620H|SEMA4B_ENST00000332496.6_Missense_Mutation_p.N625H|SEMA4B_ENST00000411539.2_Missense_Mutation_p.N625H	NM_006384.3	NP_006375.2	Q99828	CIB1_HUMAN	calcium and integrin binding 1 (calmyrin)						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to growth factor stimulus (GO:0071363)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to tumor necrosis factor (GO:0071356)|cytoplasmic microtubule organization (GO:0031122)|double-strand break repair (GO:0006302)|endomitotic cell cycle (GO:0007113)|extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|platelet formation (GO:0030220)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of male germ cell proliferation (GO:2000256)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell division (GO:0051302)|regulation of cell proliferation (GO:0042127)|response to ischemia (GO:0002931)|spermatid development (GO:0007286)|thrombopoietin-mediated signaling pathway (GO:0038163)	cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|protein anchor (GO:0043495)|Ras GTPase binding (GO:0017016)			lung(1)|prostate(1)	2	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			CTGGCTACGCAACGGGGCCCC	0.647																																						dbGAP											0													40.0	47.0	45.0					15																	90771234		2098	4199	6297	-	-	-	SO:0001628	intergenic_variant	0			U82226	CCDS10360.1, CCDS73781.1	15q25.3-q26	2013-01-10			ENSG00000185043	ENSG00000185043		"""EF-hand domain containing"""	16920	protein-coding gene	gene with protein product		602293				9030514, 10826701	Standard	NM_006384		Approved	SIP2-28, CALMYRIN, CIB, KIP	uc031qtq.1	Q99828	OTTHUMG00000149808		15.37:g.90771234A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B5BU40|H6WJF3|O00693|O00735|Q6IB49|Q96J54|Q99971	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.N625H	ENST00000328649.6	37	c.1873	CCDS10360.1	15	.	.	.	.	.	.	.	.	.	.	A	12.10	1.835120	0.32421	.	.	ENSG00000185033	ENST00000332496;ENST00000379122;ENST00000411539	T;T;T	0.23552	1.9;2.1;1.9	5.19	-1.45	0.08828	.	0.457717	0.24573	N	0.037367	T	0.33990	0.0882	M	0.70595	2.14	0.26419	N	0.97613	D;P;P	0.57571	0.98;0.939;0.939	P;P;P	0.55161	0.77;0.497;0.497	T	0.20042	-1.0287	10	0.62326	D	0.03	.	5.8483	0.18679	0.5805:0.1295:0.29:0.0	.	620;625;620	Q9NPR2-2;Q2NL81;Q9NPR2	.;.;SEM4B_HUMAN	H	625;620;625	ENSP00000332204:N625H;ENSP00000368417:N620H;ENSP00000394720:N625H	ENSP00000332204:N625H	N	+	1	0	SEMA4B	88572238	0.999000	0.42202	0.011000	0.14972	0.005000	0.04900	0.989000	0.29629	-0.555000	0.06142	-0.488000	0.04728	AAC	SEMA4B	-	NULL	ENSG00000185033		0.647	CIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4B	HGNC	protein_coding	OTTHUMT00000313419.1	80	0.00	0	A			90771234	90771234	+1	no_errors	ENST00000332496	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	0.470	C
SLC4A1	6521	genome.wustl.edu	37	17	42328557	42328557	+	Silent	SNP	C	C	T	rs202243808		TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr17:42328557C>T	ENST00000262418.6	-	19	2780	c.2625G>A	c.(2623-2625)ccG>ccA	p.P875P	AC003102.1_ENST00000399246.2_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	875	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TGAAGATGAGCGGCAGCAGGA	0.662													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17274	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													27.0	29.0	28.0					17																	42328557		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2625G>A	17.37:g.42328557C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_1,tigrfam_HCO3_transpt_euk	p.P875	ENST00000262418.6	37	c.2625	CCDS11481.1	17																																																																																			SLC4A1	-	tigrfam_HCO3_transpt_euk	ENSG00000004939		0.662	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1	HGNC	protein_coding	OTTHUMT00000346194.1	63	0.00	0	C	NM_000342		42328557	42328557	-1	no_errors	ENST00000262418	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	0.004	T
SLITRK2	84631	genome.wustl.edu	37	X	144905276	144905276	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chrX:144905276G>A	ENST00000370490.1	+	1	5588	c.1333G>A	c.(1333-1335)Gga>Aga	p.G445R	SLITRK2_ENST00000413937.2_Missense_Mutation_p.G445R|SLITRK2_ENST00000434188.2_Missense_Mutation_p.G445R|SLITRK2_ENST00000428560.2_Missense_Mutation_p.G445R|SLITRK2_ENST00000447897.2_Missense_Mutation_p.G445R			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	445					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TATGTTTGATGGACTGCAGAG	0.393																																						dbGAP											0													138.0	143.0	141.0					X																	144905276		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1333G>A	X.37:g.144905276G>A	ENSP00000359521:p.Gly445Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G445R	ENST00000370490.1	37	c.1333	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062723	0.76187	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03;0.03	5.38	5.38	0.77491	.	0.057856	0.64402	D	0.000001	T	0.79511	0.4458	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82422	-0.0465	10	0.87932	D	0	-5.6388	15.3685	0.74541	0.0:0.0:1.0:0.0	.	445	Q9H156	SLIK2_HUMAN	R	445	ENSP00000334374:G445R;ENSP00000411681:G445R;ENSP00000359521:G445R;ENSP00000397015:G445R;ENSP00000407347:G445R;ENSP00000412010:G445R	ENSP00000334374:G445R	G	+	1	0	SLITRK2	144712968	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.869000	0.99810	2.220000	0.72140	0.513000	0.50165	GGA	SLITRK2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000185985		0.393	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	57	0.00	0	G	NM_032539		144905276	144905276	+1	no_errors	ENST00000370490	ensembl	human	known	69_37n	missense	71	11.25	9	SNP	1.000	A
SPATA8	145946	genome.wustl.edu	37	15	97328267	97328267	+	Nonsense_Mutation	SNP	C	C	T	rs150122584		TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr15:97328267C>T	ENST00000328504.3	+	3	505	c.238C>T	c.(238-240)Cga>Tga	p.R80*	SPATA8_ENST00000558553.1_Missense_Mutation_p.A39V|SPATA8-AS1_ENST00000558722.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	80										large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			GGTTCAAAGGCGAAGGGTGCC	0.448																																						dbGAP											0													161.0	148.0	152.0					15																	97328267		2197	4298	6495	-	-	-	SO:0001587	stop_gained	0			AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.238C>T	15.37:g.97328267C>T	ENSP00000328149:p.Arg80*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KJ07	Nonsense_Mutation	SNP	NULL	p.R80*	ENST00000328504.3	37	c.238	CCDS10376.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.57	2.277104	0.40294	.	.	ENSG00000185594	ENST00000328504	.	.	.	2.07	-1.07	0.09968	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.9539	0.01382	0.1572:0.2339:0.3842:0.2247	.	.	.	.	X	80	.	ENSP00000328149:R80X	R	+	1	2	SPATA8	95129271	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.310000	0.02725	-0.271000	0.09272	-2.100000	0.00362	CGA	SPATA8	-	NULL	ENSG00000185594		0.448	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA8	HGNC	protein_coding	OTTHUMT00000313533.1	57	0.00	0	C	NM_173499		97328267	97328267	+1	no_errors	ENST00000328504	ensembl	human	known	69_37n	nonsense	41	36.92	24	SNP	0.000	T
TEX15	56154	genome.wustl.edu	37	8	30704914	30704914	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr8:30704914G>T	ENST00000256246.2	-	1	1694	c.1620C>A	c.(1618-1620)aaC>aaA	p.N540K	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	540					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TGCAAATCAAGTTAAATTTAG	0.313																																						dbGAP											0													66.0	67.0	67.0					8																	30704914		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1620C>A	8.37:g.30704914G>T	ENSP00000256246:p.Asn540Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.N540K	ENST00000256246.2	37	c.1620	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	G	8.053	0.766405	0.15983	.	.	ENSG00000133863	ENST00000256246	T	0.13307	2.6	5.61	-0.0341	0.13898	.	0.122764	0.37577	N	0.002040	T	0.06872	0.0175	N	0.19112	0.55	0.09310	N	1	P	0.35242	0.492	B	0.33846	0.171	T	0.24764	-1.0151	10	0.87932	D	0	.	4.3333	0.11075	0.4446:0.3463:0.2091:0.0	.	540	Q9BXT5	TEX15_HUMAN	K	540	ENSP00000256246:N540K	ENSP00000256246:N540K	N	-	3	2	TEX15	30824456	0.009000	0.17119	0.229000	0.23960	0.376000	0.30014	0.271000	0.18626	0.302000	0.22762	0.650000	0.86243	AAC	TEX15	-	NULL	ENSG00000133863		0.313	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	15	0.00	0	G			30704914	30704914	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.017	T
TFAP2D	83741	genome.wustl.edu	37	6	50683206	50683206	+	Silent	SNP	C	C	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr6:50683206C>A	ENST00000008391.3	+	2	645	c.417C>A	c.(415-417)gcC>gcA	p.A139A		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					GCCTCGATGCCTACCGCCGCC	0.647																																						dbGAP											0													52.0	56.0	55.0					6																	50683206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.417C>A	6.37:g.50683206C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_TF_AP2_C,prints_TF_AP2_C	p.A139	ENST00000008391.3	37	c.417	CCDS4933.1	6																																																																																			TFAP2D	-	NULL	ENSG00000008197		0.647	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	HGNC	protein_coding	OTTHUMT00000040881.1	67	0.00	0	C	NM_172238		50683206	50683206	+1	no_errors	ENST00000008391	ensembl	human	known	69_37n	silent	53	14.52	9	SNP	1.000	A
THSD7B	80731	genome.wustl.edu	37	2	138425431	138425431	+	Splice_Site	SNP	G	G	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr2:138425431G>A	ENST00000409968.1	+	27	4917	c.4739G>A	c.(4738-4740)tGc>tAc	p.C1580Y	THSD7B_ENST00000413152.2_Splice_Site_p.C1552Y|THSD7B_ENST00000272643.3_Splice_Site_p.C1583Y			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1582						integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TACCTTGTTTGGTAAGTACTA	0.323																																						dbGAP											0													91.0	83.0	86.0					2																	138425431		1838	4083	5921	-	-	-	SO:0001630	splice_region_variant	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.4739+1G>A	2.37:g.138425431G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.C1583Y	ENST00000409968.1	37	c.4748		2	.	.	.	.	.	.	.	.	.	.	.	23.7	4.449698	0.84101	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.23754	2.41;2.28;1.89	5.38	5.38	0.77491	.	0.044822	0.85682	D	0.000000	T	0.52354	0.1729	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53634	-0.8411	10	0.87932	D	0	.	17.7269	0.88367	0.0:0.0:1.0:0.0	.	1552	C9JKN6	.	Y	1580;1583;1552	ENSP00000387145:C1580Y;ENSP00000272643:C1583Y;ENSP00000413841:C1552Y	ENSP00000272643:C1583Y	C	+	2	0	THSD7B	138141901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.349000	0.90067	2.704000	0.92352	0.650000	0.86243	TGC	THSD7B	-	NULL	ENSG00000144229		0.323	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	85	0.00	0	G	XM_046570.9	Missense_Mutation	138425431	138425431	+1	no_errors	ENST00000272643	ensembl	human	known	69_37n	missense	67	21.84	19	SNP	1.000	A
TMEM132E	124842	genome.wustl.edu	37	17	32961833	32961833	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr17:32961833C>A	ENST00000321639.5	+	8	1762	c.1434C>A	c.(1432-1434)agC>agA	p.S478R		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	478						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		TCCGGGAAAGCGAGGATGAGG	0.632																																						dbGAP											0													38.0	39.0	39.0					17																	32961833		2203	4300	6503	-	-	-	SO:0001583	missense	0			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1434C>A	17.37:g.32961833C>A	ENSP00000316532:p.Ser478Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.S478R	ENST00000321639.5	37	c.1434	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467833	0.63625	.	.	ENSG00000181291	ENST00000321639	T	0.22336	1.96	5.82	-5.23	0.02798	.	0.816509	0.11171	N	0.591983	T	0.45935	0.1367	M	0.80508	2.5	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.62238	-0.6896	10	0.59425	D	0.04	-21.2189	17.1184	0.86695	0.0:0.6685:0.0:0.3315	.	478	Q6IEE7	T132E_HUMAN	R	478	ENSP00000316532:S478R	ENSP00000316532:S478R	S	+	3	2	TMEM132E	29985946	0.000000	0.05858	0.997000	0.53966	0.761000	0.43186	-2.151000	0.01289	-0.903000	0.03881	-0.275000	0.10095	AGC	TMEM132E	-	NULL	ENSG00000181291		0.632	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	46	0.00	0	C	NM_207313		32961833	32961833	+1	no_errors	ENST00000321639	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	1.000	A
TMEM185A	84548	genome.wustl.edu	37	X	148685667	148685667	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chrX:148685667G>T	ENST00000316916.8	-	4	797	c.493C>A	c.(493-495)Cac>Aac	p.H165N	TMEM185A_ENST00000507237.1_Missense_Mutation_p.H165N|TMEM185A_ENST00000536359.1_Missense_Mutation_p.H106N	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	165						dendrite (GO:0030425)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CAGGGCCAGTGGATGATCTTG	0.318																																						dbGAP											0													70.0	64.0	66.0					X																	148685667		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.493C>A	X.37:g.148685667G>T	ENSP00000359449:p.His165Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Missense_Mutation	SNP	pfam_TM_Fragile-X-F-assoc	p.H165N	ENST00000316916.8	37	c.493	CCDS14689.1	X	.	.	.	.	.	.	.	.	.	.	g	4.972	0.180580	0.09443	.	.	ENSG00000155984	ENST00000316916;ENST00000536359;ENST00000507237	T;T;T	0.20200	2.09;2.09;2.09	4.96	4.96	0.65561	.	0.458236	0.24831	N	0.035245	T	0.14227	0.0344	L	0.29908	0.895	0.27461	N	0.95316	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.16897	-1.0387	10	0.16420	T	0.52	-3.9392	10.3404	0.43875	0.0:0.0:0.6726:0.3274	.	165;106;165	Q8NFB2;F5H5U0;E7EMM1	T185A_HUMAN;.;.	N	165;106;165	ENSP00000359449:H165N;ENSP00000443119:H106N;ENSP00000427766:H165N	ENSP00000359449:H165N	H	-	1	0	TMEM185A	148493462	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.306000	0.59117	2.039000	0.60335	0.591000	0.81541	CAC	TMEM185A	-	pfam_TM_Fragile-X-F-assoc	ENSG00000155984		0.318	TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM185A	HGNC	protein_coding	OTTHUMT00000058710.4	58	0.00	0	G	NM_032508		148685667	148685667	-1	no_errors	ENST00000316916	ensembl	human	known	69_37n	missense	72	15.29	13	SNP	1.000	T
TNS4	84951	genome.wustl.edu	37	17	38643348	38643348	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr17:38643348G>A	ENST00000254051.6	-	4	1386	c.1228C>T	c.(1228-1230)Cca>Tca	p.P410S		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	410					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CTGGTGGCTGGACAGGGGTTG	0.567																																						dbGAP											0													202.0	218.0	213.0					17																	38643348		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1228C>T	17.37:g.38643348G>A	ENSP00000254051:p.Pro410Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	pfam_PTB,pfam_SH2,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2	p.P410S	ENST00000254051.6	37	c.1228	CCDS11368.1	17	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.301259	0.01364	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.16324	2.35	5.27	4.27	0.50696	.	2587.420000	0.00166	N	0.000000	T	0.12475	0.0303	L	0.27053	0.805	0.09310	N	1	B	0.18863	0.031	B	0.14023	0.01	T	0.42531	-0.9446	10	0.07030	T	0.85	-0.2781	6.3918	0.21591	0.1042:0.2422:0.6536:0.0	.	410	Q8IZW8	TENS4_HUMAN	S	410	ENSP00000254051:P410S	ENSP00000254051:P410S	P	-	1	0	TNS4	35896874	0.017000	0.18338	0.465000	0.27155	0.031000	0.12232	1.035000	0.30216	2.475000	0.83589	0.655000	0.94253	CCA	TNS4	-	NULL	ENSG00000131746		0.567	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS4	HGNC	protein_coding	OTTHUMT00000257154.3	83	0.00	0	G	NM_032865		38643348	38643348	-1	no_errors	ENST00000254051	ensembl	human	known	69_37n	missense	57	21.92	16	SNP	0.005	A
WDR24	84219	genome.wustl.edu	37	16	740055	740055	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr16:740055C>A	ENST00000248142.6	-	2	105	c.106G>T	c.(106-108)Gac>Tac	p.D36Y	WDR24_ENST00000293883.4_5'UTR|LA16c-313D11.12_ENST00000566927.1_RNA			Q96S15	WDR24_HUMAN	WD repeat domain 24	36										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				CTCCCGCCGTCCACACTGTCA	0.662																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.106G>T	16.37:g.740055C>A	ENSP00000248142:p.Asp36Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D36Y	ENST00000248142.6	37	c.106		16	.	.	.	.	.	.	.	.	.	.	c	9.839	1.190638	0.21954	.	.	ENSG00000127580	ENST00000248142	T	0.78481	-1.18	2.5	0.3	0.15776	.	.	.	.	.	T	0.70885	0.3275	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.62511	-0.6839	6	0.59425	D	0.04	.	3.7151	0.08435	0.2402:0.6089:0.0:0.1508	.	.	.	.	Y	36	ENSP00000248142:D36Y	ENSP00000248142:D36Y	D	-	1	0	WDR24	680056	0.000000	0.05858	0.002000	0.10522	0.023000	0.10783	-0.259000	0.08721	0.094000	0.17404	0.462000	0.41574	GAC	WDR24	-	NULL	ENSG00000127580		0.662	WDR24-201	KNOWN	basic	protein_coding	WDR24	HGNC	protein_coding		20	0.00	0	C	NM_032259		740055	740055	-1	no_errors	ENST00000248142	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	0.002	A
ZNF280C	55609	genome.wustl.edu	37	X	129370196	129370196	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chrX:129370196G>T	ENST00000370978.4	-	8	916	c.763C>A	c.(763-765)Cac>Aac	p.H255N		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						ACCTTCATGTGGTATTTCAAA	0.318																																						dbGAP											0													63.0	60.0	61.0					X																	129370196		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.763C>A	X.37:g.129370196G>T	ENSP00000360017:p.His255Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V8|Q9NXR3	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.H255N	ENST00000370978.4	37	c.763	CCDS14622.1	X	.	.	.	.	.	.	.	.	.	.	G	7.034	0.561275	0.13498	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	T;T	0.11169	3.54;2.8	3.21	3.21	0.36854	Zinc finger, C2H2-like (1);	.	.	.	.	T	0.33089	0.0851	M	0.83312	2.635	0.30744	N	0.745824	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.18935	-1.0321	9	0.38643	T	0.18	.	11.4095	0.49917	0.0:0.0:1.0:0.0	.	255;255	Q9UJJ2;Q8ND82	.;Z280C_HUMAN	N	255	ENSP00000360017:H255N;ENSP00000408521:H255N	ENSP00000066465:H255N	H	-	1	0	ZNF280C	129197877	1.000000	0.71417	0.965000	0.40720	0.152000	0.21847	7.556000	0.82233	1.605000	0.50152	0.292000	0.19580	CAC	ZNF280C	-	smart_Znf_C2H2-like	ENSG00000056277		0.318	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280C	HGNC	protein_coding	OTTHUMT00000058251.1	47	0.00	0	G	NM_017666		129370196	129370196	-1	no_errors	ENST00000370978	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.995	T
ZNF99	7652	genome.wustl.edu	37	19	22940675	22940675	+	Missense_Mutation	SNP	C	C	A	rs377611122		TCGA-AR-A5QM-01A-11D-A27P-09	TCGA-AR-A5QM-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be9c46db-f3c8-46d6-bb9e-b885a4c33e7e	bf63d4f2-a6df-4146-9ef6-5892fc21db95	g.chr19:22940675C>A	ENST00000596209.1	-	4	2126	c.2036G>T	c.(2035-2037)tGt>tTt	p.C679F	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.C588F	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	679					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ACATTCTTCACATTTGTAGGG	0.368																																						dbGAP											0													46.0	49.0	48.0					19																	22940675		2126	4251	6377	-	-	-	SO:0001583	missense	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2036G>T	19.37:g.22940675C>A	ENSP00000472969:p.Cys679Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C588F	ENST00000596209.1	37	c.1763	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	c	13.15	2.152535	0.38021	.	.	ENSG00000213973	ENST00000397104	D	0.85088	-1.94	1.29	1.29	0.21616	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93377	0.7888	H	0.95574	3.69	0.42485	D	0.992875	D	0.89917	1.0	D	0.97110	1.0	D	0.92865	0.6309	9	0.87932	D	0	.	9.5079	0.39058	0.0:1.0:0.0:0.0	.	588	A8MXY4	ZNF99_HUMAN	F	588	ENSP00000380293:C588F	ENSP00000380293:C588F	C	-	2	0	ZNF99	22732515	0.891000	0.30450	0.007000	0.13788	0.119000	0.20118	2.112000	0.41892	0.680000	0.31366	0.400000	0.26472	TGT	ZNF99	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.368	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	26	0.00	0	C	XM_065124		22940675	22940675	-1	no_errors	ENST00000397104	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.781	A
