#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABI3BP	25890	genome.wustl.edu	37	3	100539121	100539121	+	Intron	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr3:100539121G>A	ENST00000284322.5	-	19	1707				ABI3BP_ENST00000495063.1_Missense_Mutation_p.R912C|ABI3BP_ENST00000471714.1_Missense_Mutation_p.R999C|ABI3BP_ENST00000383691.4_Missense_Mutation_p.R276C	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GGACGTGGACGACGAGTTCGT	0.443																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1598-12042C>T	3.37:g.100539121G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.R276C	ENST00000284322.5	37	c.826	CCDS46880.1	3	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623411	0.66901	.	.	ENSG00000154175	ENST00000471714;ENST00000383691;ENST00000495063	T;T;T	0.60040	0.22;0.22;0.22	5.26	5.26	0.73747	.	.	.	.	.	T	0.70133	0.3189	.	.	.	0.24560	N	0.993979	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.59288	0.719;0.855;0.719	T	0.63238	-0.6682	8	0.56958	D	0.05	.	15.0873	0.72165	0.0:0.0:1.0:0.0	.	276;912;999	B4DSV9;Q5JPC9;D3YTG3	.;.;.	C	999;276;912	ENSP00000420524:R999C;ENSP00000373189:R276C;ENSP00000433993:R912C	ENSP00000373189:R276C	R	-	1	0	ABI3BP	102021811	0.997000	0.39634	1.000000	0.80357	0.989000	0.77384	1.804000	0.38873	2.847000	0.97988	0.591000	0.81541	CGT	ABI3BP	-	NULL	ENSG00000154175		0.443	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	16	0.00	0	G			100539121	100539121	-1	no_errors	ENST00000383691	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	A
ADAM21P1	145241	genome.wustl.edu	37	14	70713858	70713858	+	RNA	SNP	T	T	C	rs61979492	byFrequency	TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr14:70713858T>C	ENST00000530196.1	-	0	660					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TCTGTTAAGCTACATCTCATA	0.448																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713858T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.448	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	29	0.00	0	T	NG_002467		70713858	70713858	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	22	18.52	5	SNP	0.649	C
ADAMTS16	170690	genome.wustl.edu	37	5	5209207	5209207	+	Splice_Site	SNP	A	A	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr5:5209207A>T	ENST00000274181.7	+	10	1591	c.1453A>T	c.(1453-1455)Acc>Tcc	p.T485S	ADAMTS16_ENST00000511368.1_Splice_Site_p.T485S	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	485	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TTGTTTCAGCACCGCTCAAGC	0.423																																						dbGAP											0													173.0	171.0	172.0					5																	5209207		1881	4117	5998	-	-	-	SO:0001630	splice_region_variant	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1452-1A>T	5.37:g.5209207A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T485S	ENST00000274181.7	37	c.1453	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	A	0.030	-1.343694	0.01277	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.01887	4.58;4.58	5.62	5.62	0.85841	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.132410	0.49916	D	0.000121	T	0.01387	0.0045	N	0.10809	0.05	0.38600	D	0.950636	B;B;B	0.26672	0.022;0.128;0.156	B;B;B	0.29716	0.012;0.106;0.1	T	0.43523	-0.9386	10	0.02654	T	1	.	8.9016	0.35499	0.734:0.0:0.0:0.266	.	485;485;485	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	S	485	ENSP00000274181:T485S;ENSP00000421631:T485S	ENSP00000274181:T485S	T	+	1	0	ADAMTS16	5262207	0.824000	0.29247	0.996000	0.52242	0.027000	0.11550	1.195000	0.32186	2.141000	0.66446	0.528000	0.53228	ACC	ADAMTS16	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000145536		0.423	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	42	0.00	0	A	NM_139056	Missense_Mutation	5209207	5209207	+1	no_errors	ENST00000274181	ensembl	human	known	69_37n	missense	91	21.55	25	SNP	1.000	T
ANKRD27	84079	genome.wustl.edu	37	19	33098608	33098608	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr19:33098608T>C	ENST00000306065.4	-	23	2464	c.2306A>G	c.(2305-2307)aAc>aGc	p.N769S	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	769					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					GGCACCTGCGTTGGCCCCGTG	0.697																																						dbGAP											0													45.0	39.0	41.0					19																	33098608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2306A>G	19.37:g.33098608T>C	ENSP00000304292:p.Asn769Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.N769S	ENST00000306065.4	37	c.2306	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	T	3.037	-0.198246	0.06219	.	.	ENSG00000105186	ENST00000306065	T	0.63744	-0.06	5.7	-5.1	0.02911	Ankyrin repeat-containing domain (4);	0.834350	0.10768	N	0.636379	T	0.45054	0.1323	N	0.25201	0.72	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.24368	-1.0162	10	0.15952	T	0.53	-0.3882	18.1956	0.89820	0.0:0.6494:0.0:0.3506	.	769	Q96NW4	ANR27_HUMAN	S	769	ENSP00000304292:N769S	ENSP00000304292:N769S	N	-	2	0	ANKRD27	37790448	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.119000	0.10676	-1.656000	0.01495	0.533000	0.62120	AAC	ANKRD27	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000105186		0.697	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	55	0.00	0	T	NM_032139		33098608	33098608	-1	no_errors	ENST00000306065	ensembl	human	known	69_37n	missense	78	22.77	23	SNP	0.000	C
AP5Z1	9907	genome.wustl.edu	37	7	4825183	4825183	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr7:4825183G>A	ENST00000348624.4	+	9	1094	c.1000G>A	c.(1000-1002)Gtg>Atg	p.V334M	AP5Z1_ENST00000401897.1_Missense_Mutation_p.V334M	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	334					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGTGCTGGACGTGCTGTGCCG	0.682																																						dbGAP											0													29.0	35.0	33.0					7																	4825183		2184	4274	6458	-	-	-	SO:0001583	missense	0			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1000G>A	7.37:g.4825183G>A	ENSP00000297562:p.Val334Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3X2|Q96H80	Missense_Mutation	SNP	NULL	p.V334M	ENST00000348624.4	37	c.1000	CCDS47528.1	7	.	.	.	.	.	.	.	.	.	.	G	15.26	2.779714	0.49891	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.64803	-0.12;0.82	5.48	-0.475	0.12104	.	1.131090	0.06329	N	0.705799	T	0.63058	0.2479	L	0.56769	1.78	0.09310	N	1	D	0.60160	0.987	P	0.46362	0.514	T	0.58423	-0.7639	10	0.56958	D	0.05	.	11.3684	0.49686	0.1511:0.5644:0.2845:0.0	.	334	O43299	K0415_HUMAN	M	334	ENSP00000297562:V334M;ENSP00000384980:V334M	ENSP00000297562:V334M	V	+	1	0	KIAA0415	4791709	0.001000	0.12720	0.397000	0.26308	0.862000	0.49288	0.131000	0.15870	-0.271000	0.09272	0.561000	0.74099	GTG	AP5Z1	-	NULL	ENSG00000242802		0.682	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5Z1	HGNC	protein_coding	OTTHUMT00000323771.1	15	0.00	0	G			4825183	4825183	+1	no_errors	ENST00000348624	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	0.027	A
ARHGEF19	128272	genome.wustl.edu	37	1	16525100	16525100	+	Silent	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr1:16525100C>A	ENST00000270747.3	-	16	2527	c.2391G>T	c.(2389-2391)ctG>ctT	p.L797L	ARHGEF19_ENST00000478117.1_5'UTR|ARHGEF19-AS1_ENST00000457809.1_RNA	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	797					regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCCTCCCCCAGTTTGCTGG	0.637																																						dbGAP											0													81.0	79.0	79.0					1																	16525100		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.2391G>T	1.37:g.16525100C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.L797	ENST00000270747.3	37	c.2391	CCDS170.1	1																																																																																			ARHGEF19	-	NULL	ENSG00000142632		0.637	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF19	HGNC	protein_coding	OTTHUMT00000006289.1	27	0.00	0	C	NM_153213		16525100	16525100	-1	no_errors	ENST00000270747	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	1.000	A
ASMTL	8623	genome.wustl.edu	37	X	1531962	1531962	+	Intron	SNP	G	G	C			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chrX:1531962G>C	ENST00000381317.3	-	12	1555				ASMTL-AS1_ENST00000419737.2_RNA|ASMTL-AS1_ENST00000602357.1_RNA|ASMTL-AS1_ENST00000425740.2_RNA|ASMTL-AS1_ENST00000420411.2_RNA|ASMTL_ENST00000416733.2_Intron|ASMTL_ENST00000381333.4_Intron|ASMTL_ENST00000534940.1_Intron	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like							cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGTTTGACTCGGGCTGAGAAA	0.572													g|||	2067	0.41274	0.4418	0.4107	5008	,	,		16483	0.371		0.4354	False		,,,				2504	0.3947					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1523-215C>G	X.37:g.1531962G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	RNA	SNP	-	NULL	ENST00000381317.3	37	NULL	CCDS43917.1	X																																																																																			ASMTL-AS1	-	-	ENSG00000236017		0.572	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL-AS1	HGNC	protein_coding	OTTHUMT00000055595.1	8	0.00	0	G	NM_004192		1531962	1531962	+1	no_errors	ENST00000420411	ensembl	human	known	69_37n	rna	10	68.57	24	SNP	0.009	C
CCDC169	728591	genome.wustl.edu	37	13	36857639	36857639	+	Silent	SNP	T	T	C	rs1998800	byFrequency	TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr13:36857639T>C	ENST00000239859.7	-	4	313	c.282A>G	c.(280-282)ctA>ctG	p.L94L	CCDC169_ENST00000379862.2_5'UTR|CCDC169_ENST00000491049.2_5'UTR|CCDC169_ENST00000239860.6_Intron|CCDC169-SOHLH2_ENST00000511166.1_Intron|CCDC169_ENST00000503173.1_Silent_p.L94L|CCDC169_ENST00000477250.1_5'UTR|SOHLH2_ENST00000554962.1_Intron|CCDC169_ENST00000379864.2_5'UTR|CCDC169_ENST00000510088.1_5'UTR			A6NNP5	CC169_HUMAN	coiled-coil domain containing 169	94										breast(1)|endometrium(1)	2						GAATAGAAGATAGTCTATCTA	0.289													T|||	1459	0.291334	0.1589	0.3588	5008	,	,		18877	0.4911		0.2495	False		,,,				2504	0.2597					dbGAP											0													199.0	177.0	184.0					13																	36857639		692	1589	2281	-	-	-	SO:0001819	synonymous_variant	0				CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000239859.7:c.282A>G	13.37:g.36857639T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	Silent	SNP	NULL	p.L94	ENST00000239859.7	37	c.282	CCDS45028.1	13																																																																																			CCDC169	-	NULL	ENSG00000242715		0.289	CCDC169-014	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169	HGNC	protein_coding	OTTHUMT00000368255.1	36	0.00	0	T	NM_001144981		36857639	36857639	-1	no_errors	ENST00000239859	ensembl	human	known	69_37n	silent	33	10.53	4	SNP	0.379	C
CDH23	64072	genome.wustl.edu	37	10	73326568	73326568	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr10:73326568G>A	ENST00000224721.6	+	6	519	c.514G>A	c.(514-516)Gtc>Atc	p.V172I	CDH23_ENST00000398842.3_Missense_Mutation_p.V167I|CDH23_ENST00000461841.3_Missense_Mutation_p.V212I|CDH23_ENST00000398809.4_Missense_Mutation_p.V167I|CDH23_ENST00000299366.7_Missense_Mutation_p.V212I	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	167	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AGGGGGCAGCGTCCTCTACTC	0.602																																						dbGAP											0													45.0	50.0	49.0					10																	73326568		2046	4189	6235	-	-	-	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.514G>A	10.37:g.73326568G>A	ENSP00000224721:p.Val172Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V172I	ENST00000224721.6	37	c.514		10	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004229	0.93287	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721;ENST00000416060	T;T	0.01705	4.68;4.68	5.28	5.28	0.74379	Cadherin (4);Cadherin-like (1);	0.000000	0.56097	D	0.000026	T	0.04272	0.0118	N	0.17474	0.49	0.80722	D	1	D;P;D;D	0.71674	0.965;0.765;0.998;0.99	P;B;D;D	0.70227	0.532;0.168;0.968;0.967	T	0.68652	-0.5352	10	0.12430	T	0.62	.	18.9153	0.92503	0.0:0.0:1.0:0.0	.	167;167;167;167	A5D6V9;Q9H251;Q9H251-5;E7ESV7	.;CAD23_HUMAN;.;.	I	172;167;167;167;167;172;172;108	ENSP00000381789:V167I;ENSP00000381822:V167I	ENSP00000224721:V172I	V	+	1	0	CDH23	72996574	1.000000	0.71417	0.996000	0.52242	0.615000	0.37417	7.480000	0.81109	2.484000	0.83849	0.561000	0.74099	GTC	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.602	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	39	0.00	0	G	NM_052836		73326568	73326568	+1	no_errors	ENST00000224721	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	A
CELSR1	9620	genome.wustl.edu	37	22	46785190	46785190	+	Silent	SNP	G	G	A	rs529834559		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr22:46785190G>A	ENST00000262738.3	-	18	6551	c.6552C>T	c.(6550-6552)caC>caT	p.H2184H		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2184					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGCCTACCTCGTGAAAGTCGG	0.687													g|||	1	0.000199681	0.0008	0.0	5008	,	,		16100	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													37.0	35.0	36.0					22																	46785190		2202	4294	6496	-	-	-	SO:0001819	synonymous_variant	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6552C>T	22.37:g.46785190G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.H2184	ENST00000262738.3	37	c.6552	CCDS14076.1	22																																																																																			CELSR1	-	pfam_DUF3497	ENSG00000075275		0.687	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	121	0.00	0	G	NM_014246		46785190	46785190	-1	no_errors	ENST00000262738	ensembl	human	known	69_37n	silent	154	33.91	79	SNP	0.678	A
CYP1B1	1545	genome.wustl.edu	37	2	38298207	38298207	+	Missense_Mutation	SNP	G	G	C	rs201181935		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr2:38298207G>C	ENST00000260630.3	-	3	1691	c.1290C>G	c.(1288-1290)gaC>gaG	p.D430E	CYP1B1_ENST00000407341.1_Missense_Mutation_p.D430E|CYP1B1_ENST00000494864.1_5'UTR	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	430					angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	ACTTCACTGGGTCATGATTCA	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		19099	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													72.0	63.0	66.0					2																	38298207		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.1290C>G	2.37:g.38298207G>C	ENSP00000260630:p.Asp430Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.D430E	ENST00000260630.3	37	c.1290	CCDS1793.1	2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	22.6	4.305410	0.81247	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.75260	-0.92;-0.92	5.95	2.21	0.28008	.	0.000000	0.85682	D	0.000000	D	0.85053	0.5609	M	0.90650	3.135	0.39775	D	0.972218	D	0.62365	0.991	D	0.64144	0.922	D	0.84372	0.0544	10	0.87932	D	0	.	8.2055	0.31452	0.3859:0.0:0.6141:0.0	.	430	Q53TK1	.	E	430	ENSP00000260630:D430E;ENSP00000384972:D430E	ENSP00000260630:D430E	D	-	3	2	CYP1B1	38151711	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	1.102000	0.31050	0.137000	0.18759	0.655000	0.94253	GAC	CYP1B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000138061		0.493	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1B1	HGNC	protein_coding	OTTHUMT00000218580.3	26	0.00	0	G	NM_000104		38298207	38298207	-1	no_errors	ENST00000260630	ensembl	human	known	69_37n	missense	51	30.14	22	SNP	1.000	C
DDX25	29118	genome.wustl.edu	37	11	125792932	125792932	+	3'UTR	DEL	T	T	-			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr11:125792932delT	ENST00000263576.6	+	0	1763				DDX25_ENST00000525943.1_3'UTR|RP11-680F20.9_ENST00000526211.1_RNA|RP11-680F20.9_ENST00000533033.2_RNA	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25						mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		ACATGAGGTCTTTTTGAAGCC	0.328											OREG0021479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.*156T>-	11.37:g.125792932delT		Somatic	1544	WXS	Illumina GAIIx	Phase_IV	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	RNA	DEL	-	NULL	ENST00000263576.6	37	NULL	CCDS44766.1	11																																																																																			DDX25	-	-	ENSG00000109832		0.328	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX25	HGNC	protein_coding	OTTHUMT00000386736.3	9	0.00	0	T	NM_013264		125792932	125792932	+1	no_errors	ENST00000525943	ensembl	human	known	69_37n	rna	30	34.04	16	DEL	0.033	-
DGKK	139189	genome.wustl.edu	37	X	50213256	50213256	+	RNA	SNP	A	A	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chrX:50213256A>T	ENST00000376025.2	-	0	481							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					ttctggagtcagctctggggc	0.672																																						dbGAP											0													32.0	36.0	35.0					X																	50213256		1879	4084	5963	-	-	-			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50213256A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.672	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	41	0.00	0	A	NM_001013742		50213256	50213256	-1	no_errors	ENST00000376025	ensembl	human	known	69_37n	rna	145	29.81	62	SNP	0.000	T
DMXL2	23312	genome.wustl.edu	37	15	51751869	51751869	+	Intron	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr15:51751869C>A	ENST00000251076.5	-	34	8211				RP11-707P17.2_ENST00000560727.1_RNA|DMXL2_ENST00000449909.3_Intron|RP11-707P17.2_ENST00000559173.1_RNA|RP11-707P17.1_ENST00000561007.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA|DMXL2_ENST00000543779.2_Intron	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TAAATACCACCACACCGTCAC	0.373																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7924-877G>T	15.37:g.51751869C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR3|B7ZMH3|F5GWF1|O94938	RNA	SNP	-	NULL	ENST00000251076.5	37	NULL	CCDS10141.1	15																																																																																			DMXL2	-	-	ENSG00000104093		0.373	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	34	0.00	0	C	NM_015263		51751869	51751869	-1	no_errors	ENST00000558124	ensembl	human	known	69_37n	rna	24	11.11	3	SNP	1.000	A
EPHA4	2043	genome.wustl.edu	37	2	222283000	222283000	+	3'UTR	SNP	A	A	T	rs9758	byFrequency	TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr2:222283000A>T	ENST00000281821.2	-	0	6094				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TTAATTTCTTATTCAGTATGA	0.299													T|||	2432	0.485623	0.7292	0.4078	5008	,	,		18054	0.2579		0.4513	False		,,,				2504	0.4816					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*3092T>A	2.37:g.222283000A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.299	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	32	0.00	0	A			222283000	222283000	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	41	10.87	5	SNP	1.000	T
FAM131C	348487	genome.wustl.edu	37	1	16386008	16386008	+	Silent	SNP	T	T	C	rs2863452	byFrequency	TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr1:16386008T>C	ENST00000375662.4	-	6	726	c.543A>G	c.(541-543)caA>caG	p.Q181Q	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	181										large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GGACGATGCCTTGGGGGCTGT	0.642													C|||	3614	0.721645	0.5061	0.7709	5008	,	,		13138	0.8343		0.7654	False		,,,				2504	0.817					dbGAP											0													28.0	25.0	26.0					1																	16386008		1930	4122	6052	-	-	-	SO:0001819	synonymous_variant	0				CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.543A>G	1.37:g.16386008T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5Q5|Q8N3X3|Q8N9P9	Silent	SNP	superfamily_Chromodomain-like	p.Q181	ENST00000375662.4	37	c.543	CCDS41270.1	1																																																																																			FAM131C	-	NULL	ENSG00000185519		0.642	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM131C	HGNC	protein_coding	OTTHUMT00000026319.1	40	0.00	0	T	NM_182623		16386008	16386008	-1	no_errors	ENST00000375662	ensembl	human	known	69_37n	silent	40	16.67	8	SNP	0.563	C
FAM210A	125228	genome.wustl.edu	37	18	13671959	13671959	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr18:13671959C>T	ENST00000322247.3	-	4	874	c.487G>A	c.(487-489)Gtt>Att	p.V163I	FAM210A_ENST00000402563.1_Missense_Mutation_p.V163I|FAM210A_ENST00000588475.1_Intron	NM_001098801.1	NP_001092271.1	Q96ND0	F210A_HUMAN	family with sequence similarity 210, member A	163	DUF1279.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											AGAAAAGGAACGACATTCACT	0.338																																						dbGAP											0													99.0	90.0	93.0					18																	13671959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055618	CCDS11866.1	18p11.21	2011-11-24	2011-11-24	2011-11-24	ENSG00000177150	ENSG00000177150			28346	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 19"""	C18orf19		14702039	Standard	NM_152352		Approved	MGC24180, HsT2329	uc010dli.3	Q96ND0	OTTHUMG00000131719	ENST00000322247.3:c.487G>A	18.37:g.13671959C>T	ENSP00000323635:p.Val163Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUJ4	Missense_Mutation	SNP	pfam_DUF1279	p.V163I	ENST00000322247.3	37	c.487	CCDS11866.1	18	.	.	.	.	.	.	.	.	.	.	C	9.532	1.111156	0.20714	.	.	ENSG00000177150	ENST00000322247;ENST00000402563	T;T	0.29397	1.57;1.57	5.87	-1.8	0.07907	Domain of unknown function DUF1279 (1);	0.242278	0.41194	N	0.000933	T	0.17365	0.0417	L	0.33293	1	0.34146	D	0.667003	B	0.27656	0.184	B	0.23574	0.047	T	0.37126	-0.9719	10	0.11182	T	0.66	-2.0489	11.3072	0.49342	0.0:0.5707:0.0:0.4293	.	163	Q96ND0	CR019_HUMAN	I	163	ENSP00000323635:V163I;ENSP00000386115:V163I	ENSP00000323635:V163I	V	-	1	0	C18orf19	13661959	0.156000	0.22821	0.203000	0.23512	0.895000	0.52256	0.289000	0.18957	-0.412000	0.07519	0.650000	0.86243	GTT	FAM210A	-	pfam_DUF1279	ENSG00000177150		0.338	FAM210A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM210A	HGNC	protein_coding	OTTHUMT00000254637.1	10	0.00	0	C	NM_152352		13671959	13671959	-1	no_errors	ENST00000322247	ensembl	human	known	69_37n	missense	19	48.65	18	SNP	0.191	T
FANCD2	2177	genome.wustl.edu	37	3	10114587	10114587	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr3:10114587T>A	ENST00000419585.1	+	27	2688	c.2527T>A	c.(2527-2529)Ttt>Att	p.F843I	FANCD2_ENST00000383806.1_Missense_Mutation_p.F843I|FANCD2_ENST00000383807.1_Missense_Mutation_p.F843I|FANCD2_ENST00000287647.3_Missense_Mutation_p.F843I			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	843					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TCTTGGAAACTTTGATGTGGA	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													119.0	109.0	112.0					3																	10114587		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2527T>A	3.37:g.10114587T>A	ENSP00000398754:p.Phe843Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.F843I	ENST00000419585.1	37	c.2527	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	T	16.92	3.256734	0.59321	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.74	4.56	0.56223	.	0.046329	0.85682	D	0.000000	T	0.53722	0.1814	M	0.80616	2.505	0.37776	D	0.926851	P;P	0.50369	0.934;0.934	B;P	0.45971	0.377;0.499	T	0.63435	-0.6638	10	0.66056	D	0.02	.	9.6774	0.40050	0.0:0.0:0.1831:0.8169	.	843;843	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	I	843	ENSP00000287647:F843I;ENSP00000373318:F843I;ENSP00000373317:F843I;ENSP00000398754:F843I	ENSP00000287647:F843I	F	+	1	0	FANCD2	10089587	1.000000	0.71417	0.995000	0.50966	0.448000	0.32197	4.742000	0.62103	0.996000	0.38943	0.477000	0.44152	TTT	FANCD2	-	NULL	ENSG00000144554		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	41	0.00	0	T			10114587	10114587	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	missense	48	35.14	26	SNP	1.000	A
FBF1	85302	genome.wustl.edu	37	17	73915866	73915866	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr17:73915866G>A	ENST00000586717.1	-	19	2252	c.1979C>T	c.(1978-1980)tCg>tTg	p.S660L	FBF1_ENST00000389570.4_Missense_Mutation_p.S660L|FBF1_ENST00000319129.5_Missense_Mutation_p.S659L			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	660					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						CTGGCACTGCGACAGATACCG	0.622																																						dbGAP											0													73.0	74.0	74.0					17																	73915866		2038	4188	6226	-	-	-	SO:0001583	missense	0			AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1979C>T	17.37:g.73915866G>A	ENSP00000465132:p.Ser660Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	superfamily_HRDC-like	p.S660L	ENST00000586717.1	37	c.1979		17	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239899	0.79912	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.21191	2.02;2.02	5.15	5.15	0.70609	.	.	.	.	.	T	0.48352	0.1495	M	0.71581	2.175	0.25837	N	0.984108	D;D;D	0.89917	0.995;1.0;1.0	P;D;D	0.74674	0.683;0.984;0.954	T	0.40496	-0.9560	9	0.66056	D	0.02	-7.0032	18.2267	0.89920	0.0:0.0:1.0:0.0	.	674;660;659	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	L	660;660;659;673	ENSP00000374221:S660L;ENSP00000324292:S659L	ENSP00000324292:S659L	S	-	2	0	FBF1	71427461	0.834000	0.29399	0.040000	0.18447	0.839000	0.47603	4.320000	0.59203	2.409000	0.81822	0.655000	0.94253	TCG	FBF1	-	NULL	ENSG00000188878		0.622	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	FBF1	HGNC	protein_coding	OTTHUMT00000448945.2	53	0.00	0	G	NM_001080542		73915866	73915866	-1	no_errors	ENST00000389570	ensembl	human	known	69_37n	missense	38	47.95	35	SNP	0.365	A
FBXO32	114907	genome.wustl.edu	37	8	124518725	124518725	+	Silent	SNP	G	G	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr8:124518725G>T	ENST00000517956.1	-	7	932	c.741C>A	c.(739-741)gtC>gtA	p.V247V	FBXO32_ENST00000443022.2_Silent_p.V154V	NM_058229.3|NM_148177.2	NP_478136.1|NP_680482.1	Q969P5	FBX32_HUMAN	F-box protein 32	247	F-box.				cellular response to dexamethasone stimulus (GO:0071549)|protein ubiquitination (GO:0016567)|response to denervation involved in regulation of muscle adaptation (GO:0014894)	nucleolus (GO:0005730)|Z disc (GO:0030018)				autonomic_ganglia(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)|stomach(1)	21	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GGCCCAGGCTGACCAGGTCCC	0.617																																						dbGAP											0													61.0	58.0	59.0					8																	124518725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ420108	CCDS6345.1, CCDS56553.1	8q24.13	2008-01-28	2004-06-15		ENSG00000156804	ENSG00000156804		"""F-boxes /  ""other"""""	16731	protein-coding gene	gene with protein product		606604	"""F-box only protein 32"""			11679633, 11717410	Standard	NM_058229		Approved	MAFbx, ATROGIN1, Fbx32	uc003yqr.3	Q969P5	OTTHUMG00000164981	ENST00000517956.1:c.741C>A	8.37:g.124518725G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4KYM0	Silent	SNP	superfamily_F-box_dom_cyclin-like	p.V247	ENST00000517956.1	37	c.741	CCDS6345.1	8																																																																																			FBXO32	-	superfamily_F-box_dom_cyclin-like	ENSG00000156804		0.617	FBXO32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO32	HGNC	protein_coding	OTTHUMT00000381281.1	32	0.00	0	G			124518725	124518725	-1	no_errors	ENST00000517956	ensembl	human	known	69_37n	silent	131	10.27	15	SNP	1.000	T
FGF23	8074	genome.wustl.edu	37	12	4479578	4479578	+	Silent	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr12:4479578G>A	ENST00000237837.1	-	3	832	c.687C>T	c.(685-687)ggC>ggT	p.G229G		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	229					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			TCACTCGACCGCCCCTGACCA	0.677																																						dbGAP											0													36.0	41.0	39.0					12																	4479578		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.687C>T	12.37:g.4479578G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4V758	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	p.G229	ENST00000237837.1	37	c.687	CCDS8526.1	12																																																																																			FGF23	-	NULL	ENSG00000118972		0.677	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	HGNC	protein_coding	OTTHUMT00000398936.1	101	0.00	0	G			4479578	4479578	-1	no_errors	ENST00000237837	ensembl	human	known	69_37n	silent	77	42.11	56	SNP	0.000	A
AC034110.1	0	genome.wustl.edu	37	18	74402468	74402468	+	lincRNA	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr18:74402468C>T	ENST00000415242.1	+	0	483																											ACACCTGGGCCGTGCTCTGAT	0.473																																						dbGAP											0													149.0	130.0	136.0					18																	74402468		692	1591	2283	-	-	-			0																															18.37:g.74402468C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000415242.1	37	NULL		18																																																																																			AC034110.1	-	-	ENSG00000229055		0.473	AC034110.1-001	KNOWN	basic	lincRNA	FLJ44881	Clone_based_vega_gene	lincRNA	OTTHUMT00000256334.3	16	0.00	0	C			74402468	74402468	+1	no_errors	ENST00000415242	ensembl	human	known	69_37n	rna	12	50.00	12	SNP	0.000	T
FRAS1	80144	genome.wustl.edu	37	4	79396713	79396713	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr4:79396713G>A	ENST00000264895.6	+	54	8244	c.7804G>A	c.(7804-7806)Gtc>Atc	p.V2602I		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2598	Calx-beta 1.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CAGCTCCAGGGTCAGCTCCCA	0.607																																						dbGAP											0													88.0	97.0	94.0					4																	79396713		2058	4202	6260	-	-	-	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7804G>A	4.37:g.79396713G>A	ENSP00000264895:p.Val2602Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EGF-like,smart_Calx_beta,pfscan_VWF_C	p.V2602I	ENST00000264895.6	37	c.7804	CCDS54771.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.865|8.865	0.947852|0.947852	0.18356|0.18356	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.12361	.|2.69	5.15|5.15	-1.62|-1.62	0.08372|0.08372	.|.	.|0.559351	.|0.17588	.|N	.|0.168869	T|T	0.14184|0.14184	0.0343|0.0343	M|M	0.74546|0.74546	2.27|2.27	0.09310|0.09310	N|N	0.999995|0.999995	.|P	.|0.35684	.|0.515	.|B	.|0.37387	.|0.248	T|T	0.15780|0.15780	-1.0425|-1.0425	5|10	.|0.30078	.|T	.|0.28	.|.	6.762|6.762	0.23546|0.23546	0.0765:0.4586:0.3482:0.1167|0.0765:0.4586:0.3482:0.1167	.|.	.|2602	.|E9PHH6	.|.	D|I	830|2602	.|ENSP00000264895:V2602I	.|ENSP00000264895:V2602I	G|V	+|+	2|1	0|0	FRAS1|FRAS1	79615737|79615737	0.000000|0.000000	0.05858|0.05858	0.125000|0.125000	0.21846|0.21846	0.340000|0.340000	0.28889|0.28889	-0.153000|-0.153000	0.10144|0.10144	0.153000|0.153000	0.19213|0.19213	0.591000|0.591000	0.81541|0.81541	GGT|GTC	FRAS1	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000138759		0.607	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	HGNC	protein_coding		24	0.00	0	G			79396713	79396713	+1	no_errors	ENST00000264895	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	0.003	A
FRG1B	284802	genome.wustl.edu	37	20	29614272	29614272	+	5'UTR	SNP	A	A	C	rs374907529		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr20:29614272A>C	ENST00000278882.3	+	0	265				FRG1B_ENST00000358464.4_5'UTR|FRG1B_ENST00000439954.2_5'UTR			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						aagaagaaaaagagcaaagat	0.299																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-116A>C	20.37:g.29614272A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.299	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	31	0.00	0	A	NR_003579		29614272	29614272	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	88	11.88	12	SNP	0.996	C
FXR2	9513	genome.wustl.edu	37	17	7499186	7499186	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr17:7499186T>C	ENST00000250113.7	-	8	1121	c.787A>G	c.(787-789)Att>Gtt	p.I263V		NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	263						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CCCAACTCAATGGCGGTCACC	0.557																																						dbGAP											0													87.0	87.0	87.0					17																	7499186		1980	4156	6136	-	-	-	SO:0001583	missense	0			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.787A>G	17.37:g.7499186T>C	ENSP00000250113:p.Ile263Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.I263V	ENST00000250113.7	37	c.787	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	T	25.2	4.618196	0.87359	.	.	ENSG00000129245	ENST00000250113	T	0.53206	0.63	5.46	5.46	0.80206	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.77313	2.365	0.58432	D	0.999999	B;B	0.34214	0.442;0.442	P;P	0.46320	0.512;0.512	T	0.66077	-0.6013	10	0.87932	D	0	26.8	13.7867	0.63115	0.0:0.0:0.0:1.0	.	263;263	Q86V09;P51116	.;FXR2_HUMAN	V	263	ENSP00000250113:I263V	ENSP00000250113:I263V	I	-	1	0	FXR2	7439911	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	6.069000	0.71209	2.197000	0.70478	0.454000	0.30748	ATT	FXR2	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000129245		0.557	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1	61	0.00	0	T			7499186	7499186	-1	no_errors	ENST00000250113	ensembl	human	known	69_37n	missense	67	30.61	30	SNP	1.000	C
GABBR2	9568	genome.wustl.edu	37	9	101151241	101151241	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr9:101151241C>A	ENST00000259455.2	-	10	1883	c.1424G>T	c.(1423-1425)cGg>cTg	p.R475L		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	475					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)	p.R475Q(1)	NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GGAGATCTTCCGCAGCTGCTC	0.507																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											344.0	258.0	287.0					9																	101151241		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.1424G>T	9.37:g.101151241C>A	ENSP00000259455:p.Arg475Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.R475L	ENST00000259455.2	37	c.1424	CCDS6736.1	9	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891686	0.72524	.	.	ENSG00000136928	ENST00000259455	T	0.77877	-1.13	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	D	0.85102	0.5620	L	0.52905	1.665	0.80722	D	1	D	0.63880	0.993	D	0.74023	0.982	D	0.86550	0.1834	10	0.72032	D	0.01	.	15.788	0.78322	0.0:1.0:0.0:0.0	.	475	O75899	GABR2_HUMAN	L	475	ENSP00000259455:R475L	ENSP00000259455:R475L	R	-	2	0	GABBR2	100191062	1.000000	0.71417	0.575000	0.28536	0.986000	0.74619	7.538000	0.82048	2.389000	0.81357	0.655000	0.94253	CGG	GABBR2	-	NULL	ENSG00000136928		0.507	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	126	0.00	0	C			101151241	101151241	-1	no_errors	ENST00000259455	ensembl	human	known	69_37n	missense	99	43.75	77	SNP	0.998	A
GTSE1	51512	genome.wustl.edu	37	22	46704338	46704338	+	Missense_Mutation	SNP	C	C	G	rs535759667		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr22:46704338C>G	ENST00000454366.1	+	4	472	c.260C>G	c.(259-261)cCc>cGc	p.P87R		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	68					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		TCTGAGAGTCCCTTTGCCTGG	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		16110	0.0		0.0	False		,,,				2504	0.001				GBM(153;542 1915 12487 29016 50495)	dbGAP											0													101.0	112.0	108.0					22																	46704338		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.260C>G	22.37:g.46704338C>G	ENSP00000415430:p.Pro87Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	NULL	p.P87R	ENST00000454366.1	37	c.260	CCDS14074.2	22	.	.	.	.	.	.	.	.	.	.	C	3.716	-0.058564	0.07317	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.07114	3.22	4.52	-3.97	0.04094	.	1.255380	0.04910	N	0.453001	T	0.03477	0.0100	N	0.03983	-0.305	0.09310	N	1	B	0.24882	0.113	B	0.25291	0.059	T	0.45249	-0.9274	10	0.12430	T	0.62	0.0359	8.9424	0.35738	0.3134:0.4833:0.2033:0.0	.	68	Q9NYZ3	GTSE1_HUMAN	R	87;47	ENSP00000415430:P87R	ENSP00000354634:P47R	P	+	2	0	GTSE1	45083002	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.499000	0.06413	-0.413000	0.07507	-0.867000	0.03001	CCC	GTSE1	-	NULL	ENSG00000075218		0.517	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTSE1	HGNC	protein_coding	OTTHUMT00000318360.2	61	0.00	0	C	NM_016426		46704338	46704338	+1	no_errors	ENST00000454366	ensembl	human	known	69_37n	missense	43	39.44	28	SNP	0.000	G
IGHV3-49	28423	genome.wustl.edu	37	14	107013245	107013245	+	RNA	SNP	A	A	T	rs539837410		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr14:107013245A>T	ENST00000390625.2	-	0	129									immunoglobulin heavy variable 3-49																		CTCACATTGGACACCTGCAAA	0.522																																						dbGAP											0													88.0	84.0	85.0					14																	107013245		1951	4137	6088	-	-	-			0			M99676		14q32.33	2012-02-08			ENSG00000211965	ENSG00000211965		"""Immunoglobulins / IGH locus"""	5607	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151967		14.37:g.107013245A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V17D	ENST00000390625.2	37	c.50		14																																																																																			IGHV3-49	-	NULL	ENSG00000211965		0.522	IGHV3-49-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-49	HGNC	IG_V_gene	OTTHUMT00000324613.1	41	0.00	0	A	NG_001019		107013245	107013245	-1	no_stop_codon	ENST00000390625	ensembl	human	known	69_37n	missense	82	29.66	35	SNP	0.885	T
KCNA1	3736	genome.wustl.edu	37	12	5020726	5020726	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr12:5020726C>T	ENST00000382545.3	+	2	1289	c.182C>T	c.(181-183)aCg>aTg	p.T61M	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	61					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TTCCCCAACACGCTGCTGGGC	0.627																																						dbGAP											0													57.0	57.0	57.0					12																	5020726		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.182C>T	12.37:g.5020726C>T	ENSP00000371985:p.Thr61Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.T61M	ENST00000382545.3	37	c.182	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052987	0.75960	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.82081	-1.57	4.31	4.31	0.51392	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.95056	0.8399	H	0.99347	4.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97253	0.9899	10	0.87932	D	0	.	16.3111	0.82872	0.0:1.0:0.0:0.0	.	61	Q09470	KCNA1_HUMAN	M	61	ENSP00000371985:T61M	ENSP00000228858:T61M	T	+	2	0	KCNA1	4890987	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.555000	0.82223	2.388000	0.81334	0.650000	0.86243	ACG	KCNA1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv1.3	ENSG00000111262		0.627	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	61	0.00	0	C	NM_000217		5020726	5020726	+1	no_errors	ENST00000382545	ensembl	human	known	69_37n	missense	75	41.41	53	SNP	1.000	T
KIAA2018	205717	genome.wustl.edu	37	3	113374402	113374402	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr3:113374402C>G	ENST00000478658.1	-	5	6144	c.6127G>C	c.(6127-6129)Gat>Cat	p.D2043H	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.D2043H			Q68DE3	K2018_HUMAN	KIAA2018	2043						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TGTGGGCTATCAGGCATGAAA	0.438																																						dbGAP											0													96.0	95.0	96.0					3																	113374402		1941	4131	6072	-	-	-	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.6127G>C	3.37:g.113374402C>G	ENSP00000420721:p.Asp2043His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D2043H	ENST00000478658.1	37	c.6127	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	C	18.64	3.668005	0.67814	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.21932	1.98;1.98	5.8	5.8	0.92144	.	0.121088	0.53938	D	0.000056	T	0.38081	0.1027	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.07177	-1.0786	10	0.72032	D	0.01	-9.5584	20.0693	0.97712	0.0:1.0:0.0:0.0	.	2043	Q68DE3	K2018_HUMAN	H	2043	ENSP00000320794:D2043H;ENSP00000420721:D2043H	ENSP00000320794:D2043H	D	-	1	0	KIAA2018	114857092	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.294000	0.78760	2.758000	0.94735	0.563000	0.77884	GAT	KIAA2018	-	NULL	ENSG00000176542		0.438	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	32	0.00	0	C	NM_001009899		113374402	113374402	-1	no_errors	ENST00000316407	ensembl	human	known	69_37n	missense	62	12.50	9	SNP	1.000	G
KRI1	65095	genome.wustl.edu	37	19	10668659	10668659	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr19:10668659G>C	ENST00000312962.6	-	14	1385	c.1366C>G	c.(1366-1368)Ccc>Gcc	p.P456A	KRI1_ENST00000361821.5_Missense_Mutation_p.P452A	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	450						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TTGAAGTTGGGGTCCTCACAG	0.637																																						dbGAP											0													57.0	54.0	55.0					19																	10668659		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.1366C>G	19.37:g.10668659G>C	ENSP00000320917:p.Pro456Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Missense_Mutation	SNP	pfam_KRR1-interact_protein_1	p.P456A	ENST00000312962.6	37	c.1366	CCDS12242.1	19	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456781	0.43634	.	.	ENSG00000129347	ENST00000312962;ENST00000361821;ENST00000541101	T;T	0.09073	3.2;3.02	5.35	3.12	0.35913	.	0.238929	0.41194	N	0.000939	T	0.15609	0.0376	L	0.56280	1.765	0.35915	D	0.831398	D;D	0.62365	0.981;0.991	P;P	0.54759	0.76;0.76	T	0.16689	-1.0394	10	0.14656	T	0.56	-15.8526	14.5319	0.67931	0.0:0.2794:0.7206:0.0	.	456;452	Q8N9T8;D3YTE0	KRI1_HUMAN;.	A	456;452;456	ENSP00000320917:P456A;ENSP00000355366:P452A	ENSP00000320917:P456A	P	-	1	0	KRI1	10529659	1.000000	0.71417	0.998000	0.56505	0.367000	0.29736	3.776000	0.55356	0.577000	0.29470	0.557000	0.71058	CCC	KRI1	-	pfam_KRR1-interact_protein_1	ENSG00000129347		0.637	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KRI1	HGNC	protein_coding	OTTHUMT00000317705.1	65	0.00	0	G	NM_023008		10668659	10668659	-1	no_errors	ENST00000312962	ensembl	human	known	69_37n	missense	47	33.33	24	SNP	0.996	C
CDKN2D	1032	genome.wustl.edu	37	19	10676408	10676409	+	IGR	INS	-	-	G			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr19:10676408_10676409insG	ENST00000393599.2	-	0	1422				KRI1_ENST00000537964.1_5'UTR|KRI1_ENST00000361821.5_Frame_Shift_Ins_p.S53fs|KRI1_ENST00000312962.6_Frame_Shift_Ins_p.S57fs	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)						autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)			endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GCTCGTCGCTTGAGTCCGACTC	0.718																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273			19.37:g.10676409_10676409dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13102|Q6FGE9	Frame_Shift_Ins	INS	pfam_KRR1-interact_protein_1	p.S58fs	ENST00000393599.2	37	c.171_170	CCDS12244.1	19																																																																																			KRI1	-	NULL	ENSG00000129347		0.718	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRI1	HGNC	protein_coding	OTTHUMT00000452030.1	46	0.00	0	-	NM_079421		10676408	10676409	-1	no_errors	ENST00000312962	ensembl	human	known	69_37n	frame_shift_ins	47	22.95	14	INS	1.000:1.000	G
LIPN	643418	genome.wustl.edu	37	10	90530616	90530616	+	Silent	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr10:90530616C>A	ENST00000404459.1	+	6	687	c.687C>A	c.(685-687)acC>acA	p.T229T		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	229					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		TTTTTGGTACCAAAGGTTTCT	0.294																																						dbGAP											0													36.0	34.0	35.0					10																	90530616		1685	3787	5472	-	-	-	SO:0001819	synonymous_variant	0				CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.687C>A	10.37:g.90530616C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7KIH9	Silent	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.T229	ENST00000404459.1	37	c.687	CCDS44456.1	10																																																																																			LIPN	-	pfam_AB_hydrolase_1	ENSG00000204020		0.294	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPN	HGNC	protein_coding	OTTHUMT00000049254.2	17	0.00	0	C	XM_926751		90530616	90530616	+1	no_errors	ENST00000404459	ensembl	human	known	69_37n	silent	16	61.90	26	SNP	0.999	A
LLGL2	3993	genome.wustl.edu	37	17	73560623	73560623	+	Intron	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr17:73560623G>A	ENST00000392550.3	+	10	1153				LLGL2_ENST00000375227.4_Silent_p.*357*|LLGL2_ENST00000167462.5_Intron|LLGL2_ENST00000578363.1_Silent_p.*357*|LLGL2_ENST00000577200.1_Intron	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)						cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CCCAGGGTTAGGTGTGGGAGG	0.622																																						dbGAP											0													28.0	30.0	30.0					17																	73560623		2202	4299	6501	-	-	-	SO:0001627	intron_variant	0			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1036+35G>A	17.37:g.73560623G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14521|Q9BR62	Silent	SNP	pfam_LLGL2,superfamily_WD40_repeat_dom,prints_Lethal2_giant	p.*357	ENST00000392550.3	37	c.1071	CCDS32733.1	17																																																																																			LLGL2	-	NULL	ENSG00000073350		0.622	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	HGNC	protein_coding	OTTHUMT00000447633.1	86	0.00	0	G	NM_004524		73560623	73560623	+1	no_errors	ENST00000375227	ensembl	human	known	69_37n	silent	58	51.67	62	SNP	0.001	A
LPCAT1	79888	genome.wustl.edu	37	5	1466933	1466933	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr5:1466933C>A	ENST00000283415.3	-	13	1483	c.1351G>T	c.(1351-1353)Gtg>Ttg	p.V451L	LPCAT1_ENST00000503252.1_5'UTR	NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	451	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		AGCTCTGCCACCCCCAGGGCC	0.622																																						dbGAP											0													137.0	117.0	124.0					5																	1466933		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.1351G>T	5.37:g.1466933C>A	ENSP00000283415:p.Val451Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.V451L	ENST00000283415.3	37	c.1351	CCDS3864.1	5	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928811	0.52759	.	.	ENSG00000153395	ENST00000283415	T	0.73789	-0.78	4.47	3.59	0.41128	EF-hand-like domain (1);	0.058601	0.64402	D	0.000002	T	0.69360	0.3102	M	0.62266	1.93	0.54753	D	0.999986	B	0.12013	0.005	B	0.20955	0.032	T	0.64214	-0.6460	10	0.32370	T	0.25	-23.089	10.9194	0.47156	0.0:0.9047:0.0:0.0953	.	451	Q8NF37	PCAT1_HUMAN	L	451	ENSP00000283415:V451L	ENSP00000283415:V451L	V	-	1	0	LPCAT1	1519933	0.996000	0.38824	0.252000	0.24328	0.091000	0.18340	3.458000	0.53014	0.978000	0.38470	0.561000	0.74099	GTG	LPCAT1	-	pfscan_EF_HAND_2	ENSG00000153395		0.622	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	HGNC	protein_coding	OTTHUMT00000304032.1	55	0.00	0	C	NM_024830		1466933	1466933	-1	no_errors	ENST00000283415	ensembl	human	known	69_37n	missense	105	13.22	16	SNP	0.991	A
MC1R	4157	genome.wustl.edu	37	16	89981248	89981249	+	5'UTR	DEL	TG	TG	-			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr16:89981248_89981249delTG	ENST00000555427.1	+	0	1423_1424				RP11-566K11.7_ENST00000570217.1_RNA			Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)						G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		tgtgtgtgcctgtgtgtgtggg	0.53									Melanoma, Familial Clustering of																													dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555427.1:c.-880TG>-	16.37:g.89981256_89981257delTG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	RNA	DEL	-	NULL	ENST00000555427.1	37	NULL		16																																																																																			MC1R	-	-	ENSG00000258839		0.530	MC1R-002	PUTATIVE	basic	protein_coding	MC1R	HGNC	protein_coding	OTTHUMT00000412001.2	21	0.00	0	TG	NM_002386		89981248	89981249	+1	no_errors	ENST00000539976	ensembl	human	known	69_37n	rna	116	15.22	21	DEL	0.920:0.929	-
MIR4477B	100616194	genome.wustl.edu	37	9	68415338	68415338	+	RNA	SNP	A	A	C	rs75019967		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr9:68415338A>C	ENST00000581659.1	+	0	31					NR_039688.1|NR_039689.1				microRNA 4477b																		aatgtccttaatagcaatcct	0.363																																						dbGAP											0																																										-	-	-			0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68415338A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581659.1	37	NULL		9																																																																																			MIR4477A	-	-	ENSG00000266017		0.363	MIR4477B-201	KNOWN	basic	miRNA	MIR4477A	HGNC	miRNA		12	0.00	0	A	NR_039689		68415338	68415338	+1	no_errors	ENST00000581659	ensembl	human	known	69_37n	rna	14	26.32	5	SNP	0.191	C
MKNK2	2872	genome.wustl.edu	37	19	2042426	2042426	+	Splice_Site	SNP	C	C	G			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr19:2042426C>G	ENST00000591601.1	-	9	785	c.750G>C	c.(748-750)ccG>ccC	p.P250P	MKNK2_ENST00000309340.7_Splice_Site_p.P250P|MKNK2_ENST00000588014.1_5'UTR|MKNK2_ENST00000591142.1_5'Flank|MKNK2_ENST00000541165.1_Splice_Site_p.P119P|MKNK2_ENST00000250896.3_Splice_Site_p.P250P|MKNK2_ENST00000591588.1_5'Flank			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	250	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCCCTCACCGGAGTGAGCA	0.692																																						dbGAP											0													8.0	9.0	8.0					19																	2042426		2158	4260	6418	-	-	-	SO:0001630	splice_region_variant	0			AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.750+1G>C	19.37:g.2042426C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P250	ENST00000591601.1	37	c.750	CCDS12080.1	19																																																																																			MKNK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000099875		0.692	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKNK2	HGNC	protein_coding	OTTHUMT00000449312.1	51	0.00	0	C	NM_199054	Silent	2042426	2042426	-1	no_errors	ENST00000250896	ensembl	human	known	69_37n	silent	22	60.71	34	SNP	1.000	G
MX1	4599	genome.wustl.edu	37	21	42830560	42830560	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr21:42830560G>C	ENST00000398600.2	+	19	2889	c.1864G>C	c.(1864-1866)Gac>Cac	p.D622H	MX1_ENST00000398598.3_Missense_Mutation_p.D622H|MX1_ENST00000288383.6_Missense_Mutation_p.D599H|MX1_ENST00000455164.2_Missense_Mutation_p.D622H	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	622	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.|Stalk.				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GCTCCTGCAGGACAAGGACAC	0.607																																						dbGAP											0													118.0	113.0	115.0					21																	42830560		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1864G>C	21.37:g.42830560G>C	ENSP00000381601:p.Asp622His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.D622H	ENST00000398600.2	37	c.1864	CCDS13673.1	21	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599436	0.66332	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	4.7	1.83	0.25207	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.211790	0.48767	D	0.000170	T	0.68357	0.2992	M	0.83774	2.66	0.38077	D	0.936546	D	0.69078	0.997	D	0.69654	0.965	T	0.69873	-0.5027	10	0.72032	D	0.01	-33.0456	7.6226	0.28193	0.2848:0.0:0.7152:0.0	.	622	P20591	MX1_HUMAN	H	622;622;622;599	ENSP00000381601:D622H;ENSP00000381599:D622H;ENSP00000410523:D622H;ENSP00000288383:D599H	ENSP00000288383:D599H	D	+	1	0	MX1	41752430	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.109000	0.31135	0.259000	0.21709	0.655000	0.94253	GAC	MX1	-	pfam_GED,smart_GED	ENSG00000157601		0.607	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	HGNC	protein_coding	OTTHUMT00000195161.2	34	0.00	0	G			42830560	42830560	+1	no_errors	ENST00000398598	ensembl	human	known	69_37n	missense	54	19.40	13	SNP	1.000	C
MYH7B	57644	genome.wustl.edu	37	20	33575610	33575610	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr20:33575610C>T	ENST00000262873.7	+	16	1527	c.1435C>T	c.(1435-1437)Cgg>Tgg	p.R479W	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	437	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CACCTATGACCGGCTGTTCAG	0.632																																						dbGAP											0													52.0	61.0	58.0					20																	33575610		2090	4255	6345	-	-	-	SO:0001583	missense	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1435C>T	20.37:g.33575610C>T	ENSP00000262873:p.Arg479Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R479W	ENST00000262873.7	37	c.1435	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482275	0.63962	.	.	ENSG00000078814	ENST00000262873	D	0.89746	-2.56	3.33	3.33	0.38152	Myosin head, motor domain (2);	0.000000	0.30109	N	0.010393	D	0.96281	0.8787	H	0.98507	4.25	0.47621	D	0.999474	D	0.89917	1.0	D	0.97110	1.0	D	0.96476	0.9352	10	0.87932	D	0	.	11.25	0.49020	0.1833:0.8167:0.0:0.0	.	437	A7E2Y1	MYH7B_HUMAN	W	479	ENSP00000262873:R479W	ENSP00000262873:R479W	R	+	1	2	MYH7B	33039271	0.984000	0.35163	1.000000	0.80357	0.996000	0.88848	1.047000	0.30367	2.171000	0.68590	0.561000	0.74099	CGG	MYH7B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000078814		0.632	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	40	0.00	0	C	NM_020884		33575610	33575610	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	missense	86	27.12	32	SNP	1.000	T
MYL1	4632	genome.wustl.edu	37	2	211163235	211163235	+	Silent	SNP	G	G	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr2:211163235G>T	ENST00000352451.3	-	3	360	c.213C>A	c.(211-213)acC>acA	p.T71T	MYL1_ENST00000496436.1_5'UTR|MYL1_ENST00000341685.4_Silent_p.T27T	NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	71	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		CCTGGCTTAAGGTGATCTTGG	0.468																																						dbGAP											0													122.0	112.0	115.0					2																	211163235		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.213C>A	2.37:g.211163235G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4N6|B2R4T6|P06741|Q6IBD5	Silent	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.T71	ENST00000352451.3	37	c.213	CCDS2390.1	2																																																																																			MYL1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000168530		0.468	MYL1-001	KNOWN	basic|CCDS	protein_coding	MYL1	HGNC	protein_coding	OTTHUMT00000256566.2	39	0.00	0	G	NM_079420		211163235	211163235	-1	no_errors	ENST00000352451	ensembl	human	known	69_37n	silent	22	15.38	4	SNP	1.000	T
NACA	4666	genome.wustl.edu	37	12	57110262	57110262	+	Silent	SNP	T	T	C			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr12:57110262T>C	ENST00000454682.1	-	3	5333	c.5052A>G	c.(5050-5052)gtA>gtG	p.V1684V	NACA_ENST00000393891.4_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000550952.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1684	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GGGCAACAAGTACTTCTTTCA	0.507			T	BCL6	NHL																																	dbGAP		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													228.0	197.0	206.0					12																	57110262		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5052A>G	12.37:g.57110262T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Nas_poly-pep-assoc_cplx,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx	p.V1684	ENST00000454682.1	37	c.5052		12																																																																																			NACA	-	NULL	ENSG00000196531		0.507	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		50	0.00	0	T	NM_005594		57110262	57110262	-1	no_errors	ENST00000454682	ensembl	human	known	69_37n	silent	91	20.18	23	SNP	0.000	C
NALCN	259232	genome.wustl.edu	37	13	101828727	101828727	+	Splice_Site	SNP	T	T	G			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr13:101828727T>G	ENST00000251127.6	-	15	1846		c.e15-2			NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective						calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAGGAGGATCTATAAAATGGT	0.294																																						dbGAP											0													78.0	75.0	76.0					13																	101828727		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1765-2A>C	13.37:g.101828727T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Splice_Site	SNP	-	e14-2	ENST00000251127.6	37	c.1765-2	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253267	0.80135	.	.	ENSG00000102452	ENST00000251127	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9308	0.63994	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NALCN	100626728	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.451000	0.73481	2.275000	0.75901	0.528000	0.53228	.	NALCN	-	-	ENSG00000102452		0.294	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	13	0.00	0	T	NM_052867	Intron	101828727	101828727	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	splice_site	6	50.00	6	SNP	1.000	G
NUAK1	9891	genome.wustl.edu	37	12	106461705	106461705	+	Silent	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr12:106461705C>A	ENST00000261402.2	-	7	2240	c.861G>T	c.(859-861)ctG>ctT	p.L287L		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						GGTTCACCATCAGCATCCACC	0.547																																						dbGAP											0													59.0	59.0	59.0					12																	106461705		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.861G>T	12.37:g.106461705C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD39|Q96KA8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L287	ENST00000261402.2	37	c.861	CCDS31892.1	12																																																																																			NUAK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000074590		0.547	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	29	0.00	0	C	NM_014840		106461705	106461705	-1	no_errors	ENST00000261402	ensembl	human	known	69_37n	silent	31	11.43	4	SNP	1.000	A
PCNXL3	399909	genome.wustl.edu	37	11	65404257	65404258	+	Frame_Shift_Ins	INS	-	-	T	rs142310983|rs377546450	byFrequency	TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr11:65404257_65404258insT	ENST00000355703.3	+	35	6452_6453	c.5913_5914insT	c.(5914-5916)agcfs	p.S1972fs	MIR4690_ENST00000578459.1_RNA|SIPA1_ENST00000534313.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1972						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						Acctcagcctcagcctcagcct	0.649																																						dbGAP											0										83,3349		2,79,1635						-0.1	1.0		dbSNP_134	15	2,7288		0,2,3643	no	frameshift	PCNXL3	NM_032223.2		2,81,5278	A1A1,A1R,RR		0.0274,2.4184,0.7928				85,10637				-	-	-	SO:0001589	frameshift_variant	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	Exception_encountered	11.37:g.65404257_65404258insT	ENSP00000347931:p.Ser1972fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6MZN8	Frame_Shift_Ins	INS	pfam_Pecanex	p.S1971fs	ENST00000355703.3	37	c.5913_5914	CCDS44650.1	11																																																																																			PCNXL3	-	NULL	ENSG00000197136		0.649	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	26	0.00	0	-	NM_032223		65404257	65404258	+1	no_errors	ENST00000355703	ensembl	human	known	69_37n	frame_shift_ins	54	10.00	6	INS	0.980:0.982	T
PCSK5	5125	genome.wustl.edu	37	9	78790036	78790036	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr9:78790036G>A	ENST00000545128.1	+	14	2429	c.1891G>A	c.(1891-1893)Gat>Aat	p.D631N	PCSK5_ENST00000376767.3_Missense_Mutation_p.D631N|PCSK5_ENST00000376752.4_Missense_Mutation_p.D631N	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	631					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TGGCACAGAGGATTATGCAGG	0.507																																						dbGAP											0													104.0	100.0	102.0					9																	78790036		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1891G>A	9.37:g.78790036G>A	ENSP00000446280:p.Asp631Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EGF-like,prints_Peptidase_S8_subtilisin-rel	p.D631N	ENST00000545128.1	37	c.1891	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.843185	0.97016	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	T;T;T;T	0.69806	0.81;-0.43;0.63;1.66	5.92	5.92	0.95590	.	0.078821	0.52532	D	0.000078	T	0.62612	0.2442	L	0.28694	0.88	0.58432	D	0.999997	P;P	0.39862	0.692;0.565	B;B	0.41764	0.366;0.093	T	0.61422	-0.7066	10	0.42905	T	0.14	-17.4441	20.3343	0.98733	0.0:0.0:1.0:0.0	.	631;631	Q92824-2;B1AMG5	.;.	N	631;334;631;631;631;304	ENSP00000446280:D631N;ENSP00000365958:D631N;ENSP00000365943:D631N;ENSP00000411654:D304N	ENSP00000365943:D631N	D	+	1	0	PCSK5	77979856	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.666000	0.91149	2.822000	0.97130	0.650000	0.86243	GAT	PCSK5	-	superfamily_Growth_fac_rcpt,smart_Furin_repeat	ENSG00000099139		0.507	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		22	0.00	0	G			78790036	78790036	+1	no_errors	ENST00000545128	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	A
PHF21B	112885	genome.wustl.edu	37	22	45309797	45309797	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr22:45309797C>A	ENST00000313237.5	-	5	886	c.736G>T	c.(736-738)Gca>Tca	p.A246S	PHF21B_ENST00000396103.3_Missense_Mutation_p.A204S|PHF21B_ENST00000404079.2_Missense_Mutation_p.A192S|PHF21B_ENST00000447824.3_Missense_Mutation_p.A192S|PHF21B_ENST00000403565.1_Missense_Mutation_p.A42S	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	246							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		CGCGACTCTGCCGTGCTCTCG	0.632																																						dbGAP											0													82.0	82.0	82.0					22																	45309797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.736G>T	22.37:g.45309797C>A	ENSP00000324403:p.Ala246Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.A246S	ENST00000313237.5	37	c.736	CCDS14061.1	22	.	.	.	.	.	.	.	.	.	.	C	9.185	1.024648	0.19433	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000414269	T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79	4.7	3.69	0.42338	.	0.725491	0.12755	N	0.441858	T	0.32734	0.0839	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B	0.25563	0.012;0.091;0.055;0.129;0.02	B;B;B;B;B	0.25140	0.045;0.049;0.036;0.058;0.016	T	0.20538	-1.0272	10	0.17369	T	0.5	-19.9691	6.7351	0.23405	0.0:0.6961:0.1462:0.1577	.	192;204;192;246;42	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5	.;.;.;PF21B_HUMAN;.	S	42;246;204;192;192;42	ENSP00000385053:A42S;ENSP00000324403:A246S;ENSP00000379410:A204S;ENSP00000385105:A192S;ENSP00000388619:A192S;ENSP00000401091:A42S	ENSP00000324403:A246S	A	-	1	0	PHF21B	43688461	0.010000	0.17322	0.022000	0.16811	0.770000	0.43624	0.762000	0.26503	1.203000	0.43233	0.655000	0.94253	GCA	PHF21B	-	NULL	ENSG00000056487		0.632	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	HGNC	protein_coding	OTTHUMT00000321731.2	67	0.00	0	C	NM_138415		45309797	45309797	-1	no_errors	ENST00000313237	ensembl	human	known	69_37n	missense	66	49.23	64	SNP	0.004	A
PITRM1	10531	genome.wustl.edu	37	10	3205851	3205851	+	Intron	SNP	C	C	G	rs6602034	byFrequency	TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr10:3205851C>G	ENST00000224949.4	-	7	826				PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000451104.2_Intron|PITRM1_ENST00000380989.2_Intron|PITRM1-AS1_ENST00000598280.1_RNA			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1						positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						ATGCCATAAACTGTTAAGAAC	0.363													G|||	3484	0.695687	0.652	0.6556	5008	,	,		22552	0.7411		0.7038	False		,,,				2504	0.728					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.791+65G>C	10.37:g.3205851C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	RNA	SNP	-	NULL	ENST00000224949.4	37	NULL	CCDS59208.1	10																																																																																			PITRM1	-	-	ENSG00000107959		0.363	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	9	0.00	0	C			3205851	3205851	-1	no_errors	ENST00000488065	ensembl	human	known	69_37n	rna	9	52.63	10	SNP	0.000	G
PLXNA3	55558	genome.wustl.edu	37	X	153689607	153689607	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chrX:153689607G>A	ENST00000369682.3	+	3	938	c.763G>A	c.(763-765)Gag>Aag	p.E255K		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	255	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CACAGCGGGCGAGAAATTTTT	0.572																																						dbGAP											0													96.0	85.0	88.0					X																	153689607		2203	4300	6503	-	-	-	SO:0001583	missense	0			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.763G>A	X.37:g.153689607G>A	ENSP00000358696:p.Glu255Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HY36	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.E255K	ENST00000369682.3	37	c.763	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381508	0.82792	.	.	ENSG00000130827	ENST00000369682	T	0.05258	3.47	5.06	4.2	0.49525	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.25975	0.0633	M	0.85542	2.76	0.58432	D	0.999995	D	0.76494	0.999	D	0.74023	0.982	T	0.01894	-1.1252	10	0.59425	D	0.04	.	11.5314	0.50612	0.0903:0.0:0.9097:0.0	.	255	P51805	PLXA3_HUMAN	K	255	ENSP00000358696:E255K	ENSP00000358696:E255K	E	+	1	0	PLXNA3	153342801	1.000000	0.71417	0.998000	0.56505	0.630000	0.37929	7.860000	0.86993	1.128000	0.42052	0.529000	0.55759	GAG	PLXNA3	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000130827		0.572	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	HGNC	protein_coding	OTTHUMT00000081634.1	55	0.00	0	G	NM_017514		153689607	153689607	+1	no_errors	ENST00000369682	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	1.000	A
PRB3	5544	genome.wustl.edu	37	12	11420899	11420899	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr12:11420899C>T	ENST00000279573.7	-	3	419	c.284G>A	c.(283-285)cGt>cAt	p.R95H	PRB3_ENST00000440870.3_Intron|PRB3_ENST00000538488.1_Missense_Mutation_p.R95H|PRB3_ENST00000381842.3_Missense_Mutation_p.R95H			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	95	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CTTTCCCGGACGAGGTGGGGG	0.627																																						dbGAP											0													148.0	183.0	171.0					12																	11420899		2064	4213	6277	-	-	-	SO:0001583	missense	0					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.284G>A	12.37:g.11420899C>T	ENSP00000279573:p.Arg95His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	NULL	p.R95H	ENST00000279573.7	37	c.284		12	.	.	.	.	.	.	.	.	.	.	.	5.175	0.217829	0.09810	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.04317	3.65;3.67	0.704	-0.545	0.11843	.	5.139730	0.01320	U	0.010911	T	0.04770	0.0129	.	.	.	0.09310	N	1	D	0.69078	0.997	P	0.48304	0.573	T	0.30149	-0.9988	9	0.17369	T	0.5	.	2.3212	0.04211	0.0:0.4004:0.3384:0.2612	.	95	Q04118	PRB3_HUMAN	H	95	ENSP00000371264:R95H;ENSP00000442626:R95H	ENSP00000279573:R95H	R	-	2	0	PRB3	11312166	0.000000	0.05858	0.003000	0.11579	0.049000	0.14656	-2.116000	0.01327	-0.158000	0.11040	0.134000	0.15878	CGT	PRB3	-	NULL	ENSG00000197870		0.627	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	HGNC	protein_coding	OTTHUMT00000402119.5	38	0.00	0	C	NM_006249		11420899	11420899	-1	no_errors	ENST00000381842	ensembl	human	known	69_37n	missense	96	29.79	42	SNP	0.021	T
PRRC2B	84726	genome.wustl.edu	37	9	134305632	134305632	+	Missense_Mutation	SNP	C	C	G	rs200364610		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr9:134305632C>G	ENST00000357304.4	+	1	156	c.101C>G	c.(100-102)gCg>gGg	p.A34G	PRRC2B_ENST00000458550.1_Missense_Mutation_p.A34G|PRRC2B_ENST00000405995.1_Missense_Mutation_p.A34G	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	34							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TCAGTAGACGCGATTAGATCC	0.478																																						dbGAP											0													61.0	61.0	61.0					9																	134305632		1932	4136	6068	-	-	-	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.101C>G	9.37:g.134305632C>G	ENSP00000349856:p.Ala34Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.A34G	ENST00000357304.4	37	c.101	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457760	0.84317	.	.	ENSG00000130723	ENST00000405995;ENST00000541684;ENST00000357304;ENST00000458550	T;T;T	0.22945	1.93;1.93;1.93	6.17	6.17	0.99709	BAT2, N-terminal (1);	0.000000	0.39909	U	0.001226	T	0.25382	0.0617	N	0.21194	0.64	0.80722	D	1	P	0.42010	0.768	B	0.42422	0.387	T	0.00904	-1.1520	10	0.52906	T	0.07	-6.3511	19.8676	0.96824	0.0:1.0:0.0:0.0	.	34	Q5JSZ5	PRC2B_HUMAN	G	34	ENSP00000384606:A34G;ENSP00000349856:A34G;ENSP00000398853:A34G	ENSP00000349856:A34G	A	+	2	0	PRRC2B	133295453	0.998000	0.40836	0.966000	0.40874	0.927000	0.56198	3.773000	0.55333	2.941000	0.99782	0.655000	0.94253	GCG	PRRC2B	-	pfam_BAT2_N	ENSG00000130723		0.478	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		22	0.00	0	C			134305632	134305632	+1	no_errors	ENST00000357304	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.998	G
PUM1	9698	genome.wustl.edu	37	1	31465250	31465250	+	Missense_Mutation	SNP	T	T	C	rs560648926		TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr1:31465250T>C	ENST00000257075.5	-	7	1238	c.1145A>G	c.(1144-1146)aAt>aGt	p.N382S	PUM1_ENST00000373747.3_Missense_Mutation_p.N382S|PUM1_ENST00000440538.2_Missense_Mutation_p.N382S|PUM1_ENST00000423018.2_Missense_Mutation_p.N286S|PUM1_ENST00000424085.2_Intron|PUM1_ENST00000426105.2_Missense_Mutation_p.N382S|PUM1_ENST00000373741.4_Missense_Mutation_p.N418S|PUM1_ENST00000373742.2_Missense_Mutation_p.N322S	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	382					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TTGTTGAGAATTGTAGTCAAA	0.507													T|||	1	0.000199681	0.0	0.0014	5008	,	,		21516	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													100.0	93.0	95.0					1																	31465250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1145A>G	1.37:g.31465250T>C	ENSP00000257075:p.Asn382Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.N382S	ENST00000257075.5	37	c.1145	CCDS338.1	1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.340266	0.41398	.	.	ENSG00000134644	ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742;ENST00000543952	T;T;T;T;T;T;T	0.17691	2.26;2.52;2.52;2.46;2.51;2.48;2.27	5.41	5.41	0.78517	.	0.084915	0.85682	D	0.000000	T	0.18467	0.0443	L	0.55481	1.735	0.50467	D	0.999875	B;B;B;B;B;B;B;B	0.33904	0.431;0.009;0.298;0.015;0.209;0.13;0.209;0.13	B;B;B;B;B;B;B;B	0.30316	0.114;0.004;0.114;0.01;0.068;0.068;0.068;0.068	T	0.02026	-1.1227	10	0.37606	T	0.19	-7.8069	15.4059	0.74877	0.0:0.0:0.0:1.0	.	322;286;418;382;382;382;382;382	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.;.;.;.;PUM1_HUMAN;.;.;.	S	382;382;120;382;382;418;286;322;382	ENSP00000257075:N382S;ENSP00000362852:N382S;ENSP00000391723:N382S;ENSP00000401777:N382S;ENSP00000362846:N418S;ENSP00000399440:N286S;ENSP00000362847:N322S	ENSP00000257075:N382S	N	-	2	0	PUM1	31237837	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.485000	0.45250	2.176000	0.68965	0.533000	0.62120	AAT	PUM1	-	NULL	ENSG00000134644		0.507	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	36	0.00	0	T			31465250	31465250	-1	no_errors	ENST00000426105	ensembl	human	known	69_37n	missense	51	37.04	30	SNP	1.000	C
RPL6P27	645387	genome.wustl.edu	37	18	6462504	6462504	+	RNA	SNP	G	G	A	rs192499076	byFrequency	TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr18:6462504G>A	ENST00000583065.1	-	0	394									ribosomal protein L6 pseudogene 27																		TAAGCCACTAGCCAGCTGCTT	0.512													-|||	239	0.0477236	0.174	0.013	5008	,	,		17274	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0					18p11.31	2009-03-11				ENSG00000235552			36133	pseudogene	pseudogene						19123937	Standard	NG_009652		Approved						18.37:g.6462504G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000583065.1	37	NULL		18																																																																																			RPL6P27	-	-	ENSG00000235552		0.512	RPL6P27-002	KNOWN	basic	processed_transcript	RPL6P27	HGNC	pseudogene	OTTHUMT00000444194.1	16	0.00	0	G	NG_009652		6462504	6462504	-1	no_errors	ENST00000583065	ensembl	human	known	69_37n	rna	24	61.90	39	SNP	0.698	A
SART3	9733	genome.wustl.edu	37	12	108930340	108930340	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr12:108930340C>T	ENST00000228284.3	-	11	1630	c.1396G>A	c.(1396-1398)Gag>Aag	p.E466K	SART3_ENST00000431469.2_Missense_Mutation_p.E430K	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	466					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						TCACCACTCTCATTGAAACCT	0.388									Porokeratosis																													dbGAP											0													167.0	173.0	171.0					12																	108930340		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.1396G>A	12.37:g.108930340C>T	ENSP00000228284:p.Glu466Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	pfam_RRM_dom,pfam_LSM_interact,smart_HAT,smart_RRM_dom,pfscan_RRM_dom	p.E466K	ENST00000228284.3	37	c.1396	CCDS9117.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.570597	0.96540	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000535329;ENST00000412617;ENST00000546815	T;T;T	0.56611	2.5;1.42;0.45	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.72269	0.3439	M	0.71581	2.175	0.80722	D	1	D;P;D;D	0.89917	0.993;0.909;0.966;1.0	P;P;P;D	0.85130	0.903;0.777;0.71;0.997	T	0.64529	-0.6386	10	0.21014	T	0.42	-35.2625	20.3539	0.98825	0.0:1.0:0.0:0.0	.	414;484;430;466	E7EMI4;F8VV04;B7ZKM0;Q15020	.;.;.;SART3_HUMAN	K	466;430;42;414;484	ENSP00000228284:E466K;ENSP00000414453:E430K;ENSP00000449386:E484K	ENSP00000228284:E466K	E	-	1	0	SART3	107454470	1.000000	0.71417	0.979000	0.43373	0.972000	0.66771	7.190000	0.77755	2.826000	0.97356	0.655000	0.94253	GAG	SART3	-	NULL	ENSG00000075856		0.388	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART3	HGNC	protein_coding	OTTHUMT00000404094.1	36	0.00	0	C			108930340	108930340	-1	no_errors	ENST00000228284	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	1.000	T
SLC6A6	6533	genome.wustl.edu	37	3	14508135	14508135	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr3:14508135A>T	ENST00000454876.2	+	7	1173	c.844A>T	c.(844-846)Atc>Ttc	p.I282F	SLC6A6_ENST00000360861.3_Missense_Mutation_p.I282F			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	282					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						GTATCCTGACATCACCCGCCT	0.637																																						dbGAP											0													69.0	62.0	65.0					3																	14508135		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.844A>T	3.37:g.14508135A>T	ENSP00000398063:p.Ile282Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_taurine	p.I282F	ENST00000454876.2	37	c.844	CCDS33705.1	3	.	.	.	.	.	.	.	.	.	.	A	11.05	1.523350	0.27299	.	.	ENSG00000131389	ENST00000454876;ENST00000360861	T;T	0.72167	-0.63;-0.63	4.55	2.03	0.26663	.	0.402585	0.27881	N	0.017465	T	0.38506	0.1043	N	0.02960	-0.455	0.48762	D	0.999705	B	0.11235	0.004	B	0.12837	0.008	T	0.12142	-1.0559	10	0.08837	T	0.75	.	7.5881	0.28004	0.7792:0.1423:0.0786:0.0	.	282	P31641	SC6A6_HUMAN	F	282	ENSP00000398063:I282F;ENSP00000354107:I282F	ENSP00000354107:I282F	I	+	1	0	SLC6A6	14483139	1.000000	0.71417	0.997000	0.53966	0.950000	0.60333	0.946000	0.29069	0.673000	0.31224	0.402000	0.26972	ATC	SLC6A6	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000131389		0.637	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A6	HGNC	protein_coding	OTTHUMT00000340507.1	15	0.00	0	A	NM_003043		14508135	14508135	+1	no_errors	ENST00000360861	ensembl	human	known	69_37n	missense	16	48.39	15	SNP	0.999	T
SCN10A	6336	genome.wustl.edu	37	3	38793763	38793763	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr3:38793763C>T	ENST00000449082.2	-	11	1701	c.1702G>A	c.(1702-1704)Gaa>Aaa	p.E568K		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	568					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGTTGGTGTTCATCTTCTCCA	0.607																																						dbGAP											0													138.0	139.0	139.0					3																	38793763		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.1702G>A	3.37:g.38793763C>T	ENSP00000390600:p.Glu568Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.E568K	ENST00000449082.2	37	c.1702	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	C	3.356	-0.131445	0.06753	.	.	ENSG00000185313	ENST00000449082	D	0.95447	-3.71	4.31	4.31	0.51392	.	2.586540	0.02189	N	0.061234	D	0.89040	0.6602	N	0.08118	0	0.20821	N	0.999849	B	0.20887	0.049	B	0.17722	0.019	T	0.76761	-0.2840	10	0.06757	T	0.87	.	10.5792	0.45246	0.0:0.8046:0.1953:0.0	.	568	Q9Y5Y9	SCNAA_HUMAN	K	568	ENSP00000390600:E568K	ENSP00000390600:E568K	E	-	1	0	SCN10A	38768767	0.998000	0.40836	0.865000	0.33974	0.029000	0.11900	1.374000	0.34283	2.689000	0.91719	0.462000	0.41574	GAA	SCN10A	-	NULL	ENSG00000185313		0.607	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	30	0.00	0	C	NM_006514		38793763	38793763	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	0.641	T
NELFCD	51497	genome.wustl.edu	37	20	57564939	57564939	+	Silent	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr20:57564939G>A	ENST00000344018.3	+	7	738	c.711G>A	c.(709-711)acG>acA	p.T237T	NELFCD_ENST00000602795.1_Silent_p.T246T			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	237					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											GGGAGCACACGTACCTGTTTG	0.642																																						dbGAP											0													70.0	58.0	62.0					20																	57564939		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.711G>A	20.37:g.57564939G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Silent	SNP	pfam_TH1	p.T237	ENST00000344018.3	37	c.711		20																																																																																			TH1L	-	pfam_TH1	ENSG00000101158		0.642	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	TH1L	HGNC	protein_coding		22	0.00	0	G	NM_198976		57564939	57564939	+1	no_errors	ENST00000344018	ensembl	human	known	69_37n	silent	48	22.58	14	SNP	0.081	A
TIMMDC1	51300	genome.wustl.edu	37	3	119219614	119219614	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr3:119219614G>T	ENST00000494664.1	+	2	469	c.267G>T	c.(265-267)tgG>tgT	p.W89C	RP11-190C22.8_ENST00000609598.1_lincRNA|TIMMDC1_ENST00000493694.1_Intron	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	89						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						TCATTGGCTGGGTGTATGGGG	0.408																																						dbGAP											0													133.0	134.0	134.0					3																	119219614		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.267G>T	3.37:g.119219614G>T	ENSP00000418803:p.Trp89Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	pfam_Tim17/Tim22/Tim23/PMP24	p.W89C	ENST00000494664.1	37	c.267	CCDS33831.1	3	.	.	.	.	.	.	.	.	.	.	G	5.690	0.311913	0.10789	.	.	ENSG00000113845	ENST00000494664	T	0.28454	1.61	5.91	5.02	0.67125	.	0.285870	0.35495	N	0.003170	T	0.49660	0.1570	M	0.65975	2.015	0.80722	D	1	D	0.69078	0.997	D	0.64237	0.923	T	0.50988	-0.8762	10	0.56958	D	0.05	-1.6752	11.8148	0.52204	0.0:0.0:0.8037:0.1963	.	89	Q9NPL8	TIDC1_HUMAN	C	89	ENSP00000418803:W89C	ENSP00000264244:W89C	W	+	3	0	TIMMDC1	120702304	1.000000	0.71417	0.989000	0.46669	0.006000	0.05464	3.082000	0.50128	1.442000	0.47568	0.655000	0.94253	TGG	TIMMDC1	-	pfam_Tim17/Tim22/Tim23/PMP24	ENSG00000113845		0.408	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMMDC1	HGNC	protein_coding	OTTHUMT00000355077.3	31	0.00	0	G	NM_016589		119219614	119219614	+1	no_errors	ENST00000494664	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.981	T
TSC2	7249	genome.wustl.edu	37	16	2108763	2108763	+	Silent	SNP	C	C	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr16:2108763C>T	ENST00000219476.3	+	10	1494	c.864C>T	c.(862-864)gaC>gaT	p.D288D	TSC2_ENST00000439673.2_Silent_p.D251D|TSC2_ENST00000568454.1_Silent_p.D299D|TSC2_ENST00000382538.6_Silent_p.D239D|TSC2_ENST00000401874.2_Silent_p.D288D|TSC2_ENST00000350773.4_Silent_p.D288D|TSC2_ENST00000353929.4_Silent_p.D288D	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	288	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				ACATGGAGGACGCGCCCCTGC	0.597			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													dbGAP	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													58.0	51.0	54.0					16																	2108763		2194	4293	6487	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.864C>T	16.37:g.2108763C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP,superfamily_ARM-type_fold,prints_Tuberin,pfscan_Rap_GAP	p.D288	ENST00000219476.3	37	c.864	CCDS10458.1	16																																																																																			TSC2	-	pfam_Tuberin_N,superfamily_ARM-type_fold	ENSG00000103197		0.597	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	43	0.00	0	C	NM_000548		2108763	2108763	+1	no_errors	ENST00000219476	ensembl	human	known	69_37n	silent	45	31.82	21	SNP	0.383	T
TTC22	55001	genome.wustl.edu	37	1	55253397	55253397	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr1:55253397G>T	ENST00000371276.4	-	3	829	c.726C>A	c.(724-726)gaC>gaA	p.D242E	TTC22_ENST00000371274.4_Missense_Mutation_p.D242E	NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22	242										kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						GGTGGCGGGGGTCCTCGGACT	0.652																																						dbGAP											0													37.0	34.0	35.0					1																	55253397		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.726C>A	1.37:g.55253397G>T	ENSP00000360323:p.Asp242Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NWT4	Missense_Mutation	SNP	smart_TPR_repeat	p.D242E	ENST00000371276.4	37	c.726	CCDS44152.1	1	.	.	.	.	.	.	.	.	.	.	G	3.416	-0.119202	0.06838	.	.	ENSG00000006555	ENST00000371276;ENST00000371274;ENST00000448308	T;T	0.41758	0.99;2.5	4.3	-1.29	0.09288	Tetratricopeptide-like helical (1);	0.324668	0.31427	N	0.007664	T	0.16557	0.0398	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.15407	-1.0438	10	0.07813	T	0.8	-13.8796	1.5422	0.02557	0.1654:0.13:0.3532:0.3513	.	242;242	Q5TAA0;Q5TAA0-2	TTC22_HUMAN;.	E	242;242;23	ENSP00000360323:D242E;ENSP00000360321:D242E	ENSP00000360321:D242E	D	-	3	2	TTC22	55025985	0.824000	0.29247	0.061000	0.19648	0.013000	0.08279	0.266000	0.18534	-0.325000	0.08577	0.462000	0.41574	GAC	TTC22	-	NULL	ENSG00000006555		0.652	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TTC22	HGNC	protein_coding	OTTHUMT00000027438.1	67	0.00	0	G	NM_017904		55253397	55253397	-1	no_errors	ENST00000371276	ensembl	human	known	69_37n	missense	88	29.03	36	SNP	0.007	T
UBR5	51366	genome.wustl.edu	37	8	103284779	103284779	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr8:103284779A>T	ENST00000520539.1	-	48	7557	c.6951T>A	c.(6949-6951)aaT>aaA	p.N2317K	UBR5_ENST00000518205.1_Missense_Mutation_p.N46K|UBR5_ENST00000521922.1_Missense_Mutation_p.N2311K|UBR5_ENST00000220959.4_Missense_Mutation_p.N2317K	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2317					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CTTTGTTGGCATTTTGGATAC	0.388																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											0													182.0	177.0	179.0					8																	103284779		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.6951T>A	8.37:g.103284779A>T	ENSP00000429084:p.Asn2317Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.N2317K	ENST00000520539.1	37	c.6951	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	A	13.94	2.387017	0.42308	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922;ENST00000521566	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.39	4.23	0.50019	HECT (1);	0.051143	0.85682	D	0.000000	T	0.33323	0.0859	N	0.22421	0.69	0.45899	D	0.998744	B;B	0.13145	0.007;0.007	B;B	0.15484	0.013;0.013	T	0.07731	-1.0757	10	0.44086	T	0.13	.	10.9415	0.47276	0.9262:0.0:0.0738:0.0	.	2311;2317	E7EMW7;O95071	.;UBR5_HUMAN	K	2317;2317;46;2311;142	ENSP00000429084:N2317K;ENSP00000220959:N2317K;ENSP00000428693:N46K;ENSP00000427819:N2311K	ENSP00000220959:N2317K	N	-	3	2	UBR5	103353955	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.922000	0.56462	0.890000	0.36211	0.477000	0.44152	AAT	UBR5	-	superfamily_HECT	ENSG00000104517		0.388	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	97	0.00	0	A	NM_015902		103284779	103284779	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	missense	313	16.31	61	SNP	1.000	T
WFDC5	149708	genome.wustl.edu	37	20	43738395	43738395	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr20:43738395A>G	ENST00000307971.4	-	4	731	c.653T>C	c.(652-654)aTa>aCa	p.I218T	WFDC5_ENST00000372789.4_3'UTR			Q8TCV5	WFDC5_HUMAN	WAP four-disulfide core domain 5	218						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				GGAAGCTCGTATGGCAGTGGT	0.557																																					NSCLC(199;98 2227 9943 13455 41914)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY038181	CCDS33475.1	20q13.11	2013-01-21			ENSG00000175121	ENSG00000175121		"""WAP four-disulfide core domain containing"""	20477	protein-coding gene	gene with protein product		605161				12206714, 10680116	Standard	NM_145652		Approved	WAP1, dJ211D12.5	uc002xne.2	Q8TCV5	OTTHUMG00000046411	ENST00000307971.4:c.653T>C	20.37:g.43738395A>G	ENSP00000312381:p.Ile218Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H981|Q6UWE4	Missense_Mutation	SNP	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,prints_4-disulphide_core	p.I218T	ENST00000307971.4	37	c.653		20	.	.	.	.	.	.	.	.	.	.	A	8.759	0.923113	0.18056	.	.	ENSG00000175121	ENST00000307971	T	0.27402	1.67	3.35	-5.55	0.02536	.	.	.	.	.	T	0.25791	0.0628	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.41106	-0.9527	6	0.87932	D	0	0.7356	5.7032	0.17893	0.578:0.0:0.2796:0.1423	.	.	.	.	T	218	ENSP00000312381:I218T	ENSP00000312381:I218T	I	-	2	0	WFDC5	43171809	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.106000	0.03319	-1.331000	0.02252	-1.705000	0.00719	ATA	WFDC5	-	NULL	ENSG00000175121		0.557	WFDC5-002	KNOWN	not_organism_supported|basic	protein_coding	WFDC5	HGNC	protein_coding	OTTHUMT00000107192.1	66	0.00	0	A			43738395	43738395	-1	no_errors	ENST00000307971	ensembl	human	known	69_37n	missense	136	26.88	50	SNP	0.000	G
ZC2HC1A	51101	genome.wustl.edu	37	8	79629671	79629671	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr8:79629671C>A	ENST00000263849.4	+	9	1023	c.921C>A	c.(919-921)taC>taA	p.Y307*	IL7_ENST00000519833.1_5'Flank	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	307							metal ion binding (GO:0046872)										GGACTAAATACCCTGTAGAAT	0.378																																						dbGAP											0													156.0	159.0	158.0					8																	79629671		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.921C>A	8.37:g.79629671C>A	ENSP00000263849:p.Tyr307*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y372	Nonsense_Mutation	SNP	NULL	p.Y307*	ENST00000263849.4	37	c.921	CCDS6223.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.3|21.3	4.131189|4.131189	0.77549|0.77549	.|.	.|.	ENSG00000104427|ENSG00000104427	ENST00000519307|ENST00000263849	.|.	.|.	.|.	5.14|5.14	1.83|1.83	0.25207|0.25207	.|.	.|0.056794	.|0.64402	.|D	.|0.000001	T|.	0.54143|.	0.1840|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.46428|.	-0.9192|.	4|.	.|.	.|.	.|.	-5.8497|-5.8497	6.856|6.856	0.24040|0.24040	0.0:0.5719:0.0:0.4281|0.0:0.5719:0.0:0.4281	.|.	.|.	.|.	.|.	T|X	179|307	.|.	.|.	P|Y	+|+	1|3	0|2	FAM164A|FAM164A	79792226|79792226	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.671000|0.671000	0.25172|0.25172	0.673000|0.673000	0.31224|0.31224	0.591000|0.591000	0.81541|0.81541	CCC|TAC	ZC2HC1A	-	NULL	ENSG00000104427		0.378	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1A	HGNC	protein_coding	OTTHUMT00000379423.2	36	0.00	0	C	NM_016010		79629671	79629671	+1	no_errors	ENST00000263849	ensembl	human	known	69_37n	nonsense	119	20.67	31	SNP	1.000	A
ZNF407	55628	genome.wustl.edu	37	18	72345206	72345206	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chr18:72345206T>G	ENST00000299687.5	+	1	2231	c.2231T>G	c.(2230-2232)tTg>tGg	p.L744W	ZNF407_ENST00000577538.1_Missense_Mutation_p.L744W|ZNF407_ENST00000309902.6_Missense_Mutation_p.L744W|ZNF407_ENST00000582337.1_Missense_Mutation_p.L744W	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	744					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CTTTATTCATTGAGCAAAGAA	0.313																																						dbGAP											0													52.0	51.0	51.0					18																	72345206		1817	4089	5906	-	-	-	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.2231T>G	18.37:g.72345206T>G	ENSP00000299687:p.Leu744Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.L744W	ENST00000299687.5	37	c.2231	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	T	16.89	3.248425	0.59103	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.11712	2.75;3.18	5.56	5.56	0.83823	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);	0.580121	0.11918	U	0.516992	T	0.27313	0.0670	L	0.40543	1.245	0.39373	D	0.966111	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.987	T	0.00579	-1.1661	10	0.52906	T	0.07	.	15.7177	0.77681	0.0:0.0:0.0:1.0	.	744;744;744	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	W	744	ENSP00000299687:L744W;ENSP00000310359:L744W	ENSP00000299687:L744W	L	+	2	0	ZNF407	70474194	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	4.598000	0.61069	2.619000	0.88677	0.460000	0.39030	TTG	ZNF407	-	smart_Znf_U1,smart_Znf_C2H2-like	ENSG00000215421		0.313	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	26	0.00	0	T	NM_017757		72345206	72345206	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	1.000	G
ZNF41	7592	genome.wustl.edu	37	X	47308150	47308150	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I1-01A-11D-A21Q-09	TCGA-B6-A0I1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2290b078-6a5b-4c83-9dfb-b525bbf14e4e	82b4b870-3cc6-429f-bb9a-d53757437517	g.chrX:47308150G>A	ENST00000377065.4	-	5	1658	c.1019C>T	c.(1018-1020)tCa>tTa	p.S340L	ZNF41_ENST00000397050.2_Missense_Mutation_p.S350L|ZNF41_ENST00000313116.7_Missense_Mutation_p.S340L|ZNF41_ENST00000465311.1_5'Flank	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				AATGAGGTTTGATTTGAGGGT	0.413																																						dbGAP											0													59.0	61.0	60.0					X																	47308150		2202	4297	6499	-	-	-	SO:0001583	missense	0			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.1019C>T	X.37:g.47308150G>A	ENSP00000366265:p.Ser340Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S350L	ENST00000377065.4	37	c.1049	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	G	4.653	0.121464	0.08881	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.07444	3.19;3.19;3.19	3.68	1.8	0.24995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.29501	N	0.011978	T	0.19886	0.0478	M	0.73372	2.23	0.09310	N	1	D;D;B;D;D	0.71674	0.998;0.998;0.111;0.998;0.997	D;D;B;D;P	0.64776	0.929;0.929;0.041;0.929;0.852	T	0.03287	-1.1052	10	0.87932	D	0	.	5.6924	0.17837	0.0:0.1906:0.4152:0.3942	.	340;342;350;374;382	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	L	340;340;350	ENSP00000315173:S340L;ENSP00000366265:S340L;ENSP00000380243:S350L	ENSP00000315173:S340L	S	-	2	0	ZNF41	47193094	0.005000	0.15991	0.003000	0.11579	0.137000	0.21094	1.264000	0.33015	0.342000	0.23796	0.594000	0.82650	TCA	ZNF41	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000147124		0.413	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	HGNC	protein_coding	OTTHUMT00000056429.1	50	0.00	0	G	NM_153380		47308150	47308150	-1	no_errors	ENST00000397050	ensembl	human	known	69_37n	missense	118	24.84	39	SNP	0.004	A
