#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTR3B	57180	genome.wustl.edu	37	7	152513624	152513624	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr7:152513624C>T	ENST00000256001.8	+	6	625	c.491C>T	c.(490-492)aCg>aTg	p.T164M	ACTR3B_ENST00000537264.1_Missense_Mutation_p.T76M|ACTR3B_ENST00000377776.3_Missense_Mutation_p.T164M|ACTR3B_ENST00000397282.2_Missense_Mutation_p.T76M	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	164						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.T164M(1)		breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		CGTACGTTAACGGGGATAGTC	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	80.0	88.0					7																	152513624		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.491C>T	7.37:g.152513624C>T	ENSP00000256001:p.Thr164Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTG1|B4DFW4|Q7Z526|Q96BT2	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like	p.T164M	ENST00000256001.8	37	c.491	CCDS5934.1	7	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663773	0.29515	.	.	ENSG00000133627	ENST00000377776;ENST00000256001;ENST00000397282;ENST00000537264	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	4.66	3.78	0.43462	.	0.000000	0.64402	U	0.000005	T	0.45935	0.1367	H	0.99011	4.4	0.48135	D	0.999592	D;D	0.76494	0.999;0.994	P;P	0.60473	0.798;0.875	T	0.65969	-0.6039	10	0.87932	D	0	-10.1319	12.0636	0.53576	0.0:0.9162:0.0:0.0838	.	164;164	Q9P1U1-3;Q9P1U1	.;ARP3B_HUMAN	M	164;164;76;76	ENSP00000367007:T164M;ENSP00000256001:T164M;ENSP00000380452:T76M;ENSP00000446157:T76M	ENSP00000256001:T164M	T	+	2	0	ACTR3B	152144557	1.000000	0.71417	0.254000	0.24359	0.288000	0.27193	7.510000	0.81708	0.969000	0.38237	-0.320000	0.08662	ACG	ACTR3B	-	pfam_Actin-like,smart_Actin-like	ENSG00000133627		0.478	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR3B	HGNC	protein_coding	OTTHUMT00000322803.1	169	0.00	0	C	NM_020445		152513624	152513624	+1	no_errors	ENST00000256001	ensembl	human	known	69_37n	missense	178	21.93	50	SNP	0.990	T
AGBL1	123624	genome.wustl.edu	37	15	86838639	86838639	+	Splice_Site	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr15:86838639C>T	ENST00000441037.2	+	16	2331	c.2236C>T	c.(2236-2238)Cga>Tga	p.R746*	AGBL1-AS1_ENST00000566878.1_RNA|AGBL1-AS1_ENST00000564487.1_RNA|AGBL1_ENST00000389298.3_Splice_Site_p.R477*|AGBL1_ENST00000421325.2_Splice_Site_p.R746*	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	746					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.R746*(1)		NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						AGAGCAGTTCCGTGAGTAAAA	0.478																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											112.0	109.0	110.0					15																	86838639		1946	4139	6085	-	-	-	SO:0001630	splice_region_variant	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2236+1C>T	15.37:g.86838639C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X5|A6NJH6|C9JHL5	Nonsense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.R746*	ENST00000441037.2	37	c.2236	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.955072	0.97139	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	.	.	.	5.6	5.6	0.85130	.	0.219057	0.36591	N	0.002516	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7209	17.4687	0.87639	0.0:1.0:0.0:0.0	.	.	.	.	X	775;746;477	.	ENSP00000373949:R477X	R	+	1	2	AGBL1	84639643	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	1.276000	0.33156	2.789000	0.95967	0.650000	0.86243	CGA	AGBL1	-	pfam_Peptidase_M14	ENSG00000166748		0.478	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	151	0.00	0	C	NM_152336	Nonsense_Mutation	86838639	86838639	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	nonsense	60	44.95	49	SNP	1.000	T
API5	8539	genome.wustl.edu	37	11	43340343	43340343	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr11:43340343G>C	ENST00000531273.1	+	2	362	c.223G>C	c.(223-225)Gat>Cat	p.D75H	API5_ENST00000534695.1_Missense_Mutation_p.D75H|API5_ENST00000455725.2_Missense_Mutation_p.D64H|API5_ENST00000420461.2_Intron|API5_ENST00000534600.1_Missense_Mutation_p.D75H|API5_ENST00000378852.3_Missense_Mutation_p.D75H			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	75	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)	p.D75H(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						TGAGGATGAAGATGTATCTGT	0.363																																					Pancreas(1;98 122 5625 20895 49453)	dbGAP											2	Substitution - Missense(2)	breast(2)											109.0	102.0	104.0					11																	43340343		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.223G>C	11.37:g.43340343G>C	ENSP00000431391:p.Asp75His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Missense_Mutation	SNP	pfam_API5,superfamily_ARM-type_fold	p.D75H	ENST00000531273.1	37	c.223	CCDS44572.1	11	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661399	0.88154	.	.	ENSG00000166181	ENST00000534695;ENST00000455725;ENST00000531273;ENST00000378852;ENST00000534600	T;T;T;T;T	0.29917	1.55;2.35;2.35;2.35;2.35	5.83	4.92	0.64577	Armadillo-like helical (1);Armadillo-type fold (1);	0.091232	0.64402	D	0.000001	T	0.53562	0.1804	M	0.72894	2.215	0.80722	D	1	D;D;D	0.71674	0.998;0.992;0.99	D;P;P	0.67382	0.951;0.854;0.875	T	0.59064	-0.7524	10	0.87932	D	0	-53.7243	14.7687	0.69659	0.0699:0.0:0.9301:0.0	.	75;64;75	Q9BZZ5;B4E283;Q9BZZ5-2	API5_HUMAN;.;.	H	75;64;75;75;75	ENSP00000436189:D75H;ENSP00000399341:D64H;ENSP00000431391:D75H;ENSP00000368129:D75H;ENSP00000434462:D75H	ENSP00000368129:D75H	D	+	1	0	API5	43296919	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.004000	0.88535	1.487000	0.48415	0.650000	0.86243	GAT	API5	-	pfam_API5,superfamily_ARM-type_fold	ENSG00000166181		0.363	API5-002	KNOWN	basic|CCDS	protein_coding	API5	HGNC	protein_coding	OTTHUMT00000389545.1	147	0.00	0	G	NM_006595		43340343	43340343	+1	no_errors	ENST00000531273	ensembl	human	known	69_37n	missense	106	50.47	108	SNP	1.000	C
ASAP3	55616	genome.wustl.edu	37	1	23759634	23759634	+	Silent	SNP	C	C	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr1:23759634C>A	ENST00000336689.3	-	22	2303	c.2259G>T	c.(2257-2259)ccG>ccT	p.P753P	ASAP3_ENST00000495646.1_Silent_p.P257P|ASAP3_ENST00000437606.2_Silent_p.P744P	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	753					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.P753P(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CTGGCAAGGGCGGGGGACAGT	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											98.0	100.0	100.0					1																	23759634		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2259G>T	1.37:g.23759634C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,prints_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP	p.P753	ENST00000336689.3	37	c.2259	CCDS235.1	1																																																																																			ASAP3	-	NULL	ENSG00000088280		0.582	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP3	HGNC	protein_coding	OTTHUMT00000008916.2	83	0.00	0	C	NM_017707		23759634	23759634	-1	no_errors	ENST00000336689	ensembl	human	known	69_37n	silent	22	40.54	15	SNP	0.860	A
ATP11C	286410	genome.wustl.edu	37	X	138901509	138901509	+	Silent	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chrX:138901509G>A	ENST00000327569.3	-	3	332	c.234C>T	c.(232-234)atC>atT	p.I78I	ATP11C_ENST00000370543.1_Silent_p.I78I|ATP11C_ENST00000361648.2_Silent_p.I78I|ATP11C_ENST00000359686.2_Silent_p.I78I|ATP11C_ENST00000370557.1_Silent_p.I75I	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	78					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.I78I(2)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GTACAAGGAAGATTATGAGAA	0.308																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											28.0	32.0	31.0					X																	138901509		2200	4276	6476	-	-	-	SO:0001819	synonymous_variant	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.234C>T	X.37:g.138901509G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.I78	ENST00000327569.3	37	c.234	CCDS14668.1	X																																																																																			ATP11C	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000101974		0.308	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	93	0.00	0	G	NM_173694		138901509	138901509	-1	no_errors	ENST00000327569	ensembl	human	known	69_37n	silent	103	23.13	31	SNP	1.000	A
BEGAIN	57596	genome.wustl.edu	37	14	101005271	101005273	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr14:101005271_101005273delCCT	ENST00000355173.2	-	7	886_888	c.815_817delAGG	c.(814-819)gaggcc>gcc	p.E272del	CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000556751.1_In_Frame_Del_p.E208del|BEGAIN_ENST00000443071.2_In_Frame_Del_p.E272del	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	272						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				GCCGCCTCGGCCTCCTCCTCCTC	0.724																																					NSCLC(159;1889 2010 9965 27479 40101)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.815_817delAGG	14.37:g.101005280_101005282delCCT	ENSP00000347301:p.Glu272del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPU3|Q9P282	In_Frame_Del	DEL	superfamily_Prefoldin	p.E272in_frame_del	ENST00000355173.2	37	c.817_815	CCDS9962.1	14																																																																																			BEGAIN	-	NULL	ENSG00000183092		0.724	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BEGAIN	HGNC	protein_coding	OTTHUMT00000414329.1	20	0.00	0	CCT	NM_020836		101005271	101005273	-1	no_errors	ENST00000355173	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	0.781:0.856:0.982	-
C6orf165	154313	genome.wustl.edu	37	6	88125281	88125281	+	Intron	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr6:88125281C>T	ENST00000507897.1	+	5	366				C6ORF165_ENST00000369562.4_Intron			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165											NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		ATTATTACAGCTTAAGAAATT	0.308																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.284-123C>T	6.37:g.88125281C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	NULL	p.A95V	ENST00000507897.1	37	c.284	CCDS34498.1	6																																																																																			C6orf165	-	NULL	ENSG00000213204		0.308	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	HGNC	protein_coding	OTTHUMT00000470406.1	32	0.00	0	C	NM_178823		88125281	88125281	+1	no_errors	ENST00000489338	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.000	T
CACNA1F	778	genome.wustl.edu	37	X	49071852	49071852	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chrX:49071852G>A	ENST00000376265.2	-	28	3482	c.3421C>T	c.(3421-3423)Cgt>Tgt	p.R1141C	CACNA1F_ENST00000323022.5_Missense_Mutation_p.R1130C|CACNA1F_ENST00000376251.1_Missense_Mutation_p.R1076C	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1141	Dihydropyridine binding. {ECO:0000250}.				axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R1141C(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCTGGGCACGGAAAGTGATG	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	102.0	117.0					X																	49071852		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.3421C>T	X.37:g.49071852G>A	ENSP00000365441:p.Arg1141Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.R1141C	ENST00000376265.2	37	c.3421	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	.	22.1	4.243424	0.79912	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.97575	-4.44;-4.44;-4.44	5.22	4.35	0.52113	.	0.134314	0.47852	D	0.000202	D	0.97498	0.9181	L	0.51422	1.61	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	P;D	0.77004	0.897;0.989	D	0.97682	1.0173	10	0.87932	D	0	.	13.2223	0.59894	0.0:0.0:0.8395:0.1605	.	1130;1141	F5CIQ9;O60840	.;CAC1F_HUMAN	C	1076;1130;1141	ENSP00000365427:R1076C;ENSP00000321618:R1130C;ENSP00000365441:R1141C	ENSP00000321618:R1130C	R	-	1	0	CACNA1F	48958796	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.544000	0.73878	0.960000	0.38005	0.600000	0.82982	CGT	CACNA1F	-	prints_VDCCAlpha1	ENSG00000102001		0.507	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	1131	0.00	0	G	NM_005183		49071852	49071852	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	247	43.09	187	SNP	1.000	A
CASC5	57082	genome.wustl.edu	37	15	40947129	40947129	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr15:40947129G>C	ENST00000346991.5	+	23	6906	c.6516G>C	c.(6514-6516)aaG>aaC	p.K2172N	CASC5_ENST00000399668.2_Missense_Mutation_p.K2146N			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	2172	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.K2172N(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TCCTGGACAAGCGTTATAGGA	0.378																																						dbGAP											2	Substitution - Missense(2)	breast(2)											139.0	130.0	133.0					15																	40947129		1824	4079	5903	-	-	-	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.6516G>C	15.37:g.40947129G>C	ENSP00000335463:p.Lys2172Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.K2172N	ENST00000346991.5	37	c.6516	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	G	4.604	0.112266	0.08831	.	.	ENSG00000137812	ENST00000346991;ENST00000399668	T;T	0.05855	3.38;3.38	5.81	1.81	0.25067	.	0.371406	0.29565	N	0.011791	T	0.03136	0.0092	N	0.15975	0.35	0.09310	N	1	B;B	0.24186	0.099;0.099	B;B	0.25884	0.064;0.064	T	0.40515	-0.9559	10	0.30854	T	0.27	.	2.3639	0.04314	0.146:0.1278:0.4631:0.2631	.	2146;2172	Q8NG31-2;Q8NG31	.;CASC5_HUMAN	N	2172;2146	ENSP00000335463:K2172N;ENSP00000382576:K2146N	ENSP00000335463:K2172N	K	+	3	2	CASC5	38734421	0.216000	0.23585	0.427000	0.26684	0.040000	0.13550	0.098000	0.15189	0.377000	0.24735	-0.150000	0.13652	AAG	CASC5	-	NULL	ENSG00000137812		0.378	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	106	0.93	1	G	NM_144508		40947129	40947129	+1	no_errors	ENST00000346991	ensembl	human	known	69_37n	missense	60	36.84	35	SNP	0.033	C
CCDC33	80125	genome.wustl.edu	37	15	74588246	74588246	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr15:74588246A>G	ENST00000398814.3	+	11	1678	c.1247A>G	c.(1246-1248)gAa>gGa	p.E416G	CCDC33_ENST00000321288.5_Missense_Mutation_p.E619G|CCDC33_ENST00000563951.1_3'UTR	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	619								p.E416G(1)|p.E619G(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						ACTCCACGAGAAGCAGAGGAG	0.577																																						dbGAP											2	Substitution - Missense(2)	breast(2)											53.0	55.0	54.0					15																	74588246		2062	4202	6264	-	-	-	SO:0001583	missense	0			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1247A>G	15.37:g.74588246A>G	ENSP00000381795:p.Glu416Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.E619G	ENST00000398814.3	37	c.1856	CCDS42058.1	15	.	.	.	.	.	.	.	.	.	.	A	11.93	1.785478	0.31593	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	T;T	0.37058	1.22;1.94	4.09	-2.79	0.05841	.	2.190960	0.01852	N	0.035986	T	0.41534	0.1163	L	0.33485	1.01	0.09310	N	1	D;B	0.69078	0.997;0.041	P;B	0.61397	0.888;0.028	T	0.34725	-0.9817	10	0.44086	T	0.13	.	4.4714	0.11714	0.4815:0.0:0.3679:0.1506	.	619;416	C9JFX2;Q8N5R6-6	.;.	G	619;416	ENSP00000325012:E619G;ENSP00000381795:E416G	ENSP00000325012:E619G	E	+	2	0	CCDC33	72375299	0.051000	0.20477	0.000000	0.03702	0.001000	0.01503	0.562000	0.23531	-0.667000	0.05303	-1.288000	0.01363	GAA	CCDC33	-	NULL	ENSG00000140481		0.577	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC33	HGNC	protein_coding	OTTHUMT00000419491.2	275	0.00	0	A	NM_182791		74588246	74588246	+1	no_errors	ENST00000321288	ensembl	human	known	69_37n	missense	119	19.05	28	SNP	0.000	G
CDC37	11140	genome.wustl.edu	37	19	10514100	10514100	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr19:10514100G>A	ENST00000222005.2	-	1	109	c.56C>T	c.(55-57)aCg>aTg	p.T19M	MIR1181_ENST00000408639.1_RNA	NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	19					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)	p.T19M(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		GTTGGGGTGCGTCTCGTCTTC	0.662																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	66.0	72.0					19																	10514100		2203	4300	6503	-	-	-	SO:0001583	missense	0			U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.56C>T	19.37:g.10514100G>A	ENSP00000222005:p.Thr19Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YA2	Missense_Mutation	SNP	pfam_Cdc37_Hsp90-bd,pfam_Cdc37_N_dom,pfam_Cdc37_C	p.T19M	ENST00000222005.2	37	c.56	CCDS12237.1	19	.	.	.	.	.	.	.	.	.	.	G	33	5.203596	0.95033	.	.	ENSG00000105401	ENST00000222005	T	0.50277	0.75	4.76	4.76	0.60689	Cdc37, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66886	0.2835	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69824	0.966;0.966	T	0.71632	-0.4534	10	0.87932	D	0	.	15.2693	0.73686	0.0:0.0:1.0:0.0	.	19;19	Q6FG59;Q16543	.;CDC37_HUMAN	M	19	ENSP00000222005:T19M	ENSP00000222005:T19M	T	-	2	0	CDC37	10375100	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.748000	0.74877	2.194000	0.70268	0.561000	0.74099	ACG	CDC37	-	pfam_Cdc37_N_dom	ENSG00000105401		0.662	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC37	HGNC	protein_coding	OTTHUMT00000451987.1	158	0.00	0	G	NM_007065		10514100	10514100	-1	no_errors	ENST00000222005	ensembl	human	known	69_37n	missense	65	22.62	19	SNP	1.000	A
CNN3	1266	genome.wustl.edu	37	1	95368739	95368739	+	Missense_Mutation	SNP	A	A	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr1:95368739A>C	ENST00000370206.4	-	3	568	c.185T>G	c.(184-186)aTa>aGa	p.I62R	CNN3_ENST00000538964.1_Missense_Mutation_p.I62R|CNN3_ENST00000545882.1_Missense_Mutation_p.I21R|CNN3_ENST00000487539.1_5'UTR|CNN3_ENST00000394202.4_Missense_Mutation_p.I62R	NM_001839.3	NP_001830.1	Q15417	CNN3_HUMAN	calponin 3, acidic	62	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actomyosin structure organization (GO:0031032)|epithelial cell differentiation (GO:0030855)	focal adhesion (GO:0005925)		p.I62R(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|stomach(1)|urinary_tract(2)	18		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		TAGCTTGTTTATAAGTCTGAA	0.423																																						dbGAP											2	Substitution - Missense(2)	breast(1)|kidney(1)											75.0	73.0	74.0					1																	95368739		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025372	CCDS30775.1, CCDS65592.1, CCDS65593.1	1p22-p21	2010-07-08			ENSG00000117519	ENSG00000117519			2157	protein-coding gene	gene with protein product		602374				8526917	Standard	NM_001839		Approved		uc001dqz.4	Q15417	OTTHUMG00000010783	ENST00000370206.4:c.185T>G	1.37:g.95368739A>C	ENSP00000359225:p.Ile62Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFK6|B4DP09|F8WA86|Q6FHA7	Missense_Mutation	SNP	pfam_Calponin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin,prints_Calponin	p.I62R	ENST00000370206.4	37	c.185	CCDS30775.1	1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.912090	0.52439	.	.	ENSG00000117519	ENST00000370206;ENST00000538964;ENST00000394202;ENST00000545882;ENST00000415017	T;T;T;D;D	0.96041	-0.05;-0.05;-0.05;-3.89;-3.89	5.61	5.61	0.85477	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.96497	0.8857	H	0.96662	3.86	0.80722	D	1	B;B	0.31077	0.307;0.002	B;B	0.34722	0.188;0.012	D	0.96831	0.9611	10	0.87932	D	0	-22.8599	15.8096	0.78547	1.0:0.0:0.0:0.0	.	62;62	F8WA86;Q15417	.;CNN3_HUMAN	R	62;62;62;21;21	ENSP00000359225:I62R;ENSP00000437665:I62R;ENSP00000377752:I62R;ENSP00000440081:I21R;ENSP00000401452:I21R	ENSP00000359225:I62R	I	-	2	0	CNN3	95141327	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.871000	0.92346	2.132000	0.65825	0.533000	0.62120	ATA	CNN3	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,prints_SM22_calponin,prints_Calponin	ENSG00000117519		0.423	CNN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN3	HGNC	protein_coding	OTTHUMT00000029702.2	206	0.00	0	A	NM_001839		95368739	95368739	-1	no_errors	ENST00000370206	ensembl	human	known	69_37n	missense	197	24.81	65	SNP	1.000	C
CNTNAP5	129684	genome.wustl.edu	37	2	125555837	125555837	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr2:125555837C>A	ENST00000431078.1	+	19	3518	c.3154C>A	c.(3154-3156)Ctt>Att	p.L1052I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1052	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.L1052I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGCACCCAGTCTTTTGCTCTT	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	151.0	152.0					2																	125555837		1968	4146	6114	-	-	-	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3154C>A	2.37:g.125555837C>A	ENSP00000399013:p.Leu1052Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.L1052I	ENST00000431078.1	37	c.3154	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019315	0.35606	.	.	ENSG00000155052	ENST00000431078	T	0.38240	1.15	5.92	4.09	0.47781	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.44483	D	0.000444	T	0.29783	0.0744	L	0.45228	1.405	0.37177	D	0.903306	B	0.23316	0.083	B	0.25405	0.06	T	0.14448	-1.0472	10	0.15952	T	0.53	.	12.5598	0.56275	0.1322:0.7409:0.127:0.0	.	1052	Q8WYK1	CNTP5_HUMAN	I	1052	ENSP00000399013:L1052I	ENSP00000399013:L1052I	L	+	1	0	CNTNAP5	125272307	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.422000	0.44696	0.807000	0.34208	0.650000	0.86243	CTT	CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.463	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	264	0.00	0	C			125555837	125555837	+1	no_errors	ENST00000431078	ensembl	human	known	69_37n	missense	204	33.33	102	SNP	1.000	A
CPAMD8	27151	genome.wustl.edu	37	19	17039789	17039789	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr19:17039789C>G	ENST00000443236.1	-	24	3279	c.3248G>C	c.(3247-3249)aGa>aCa	p.R1083T		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1036						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1083T(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCAGAATGTTCTGAATTCATC	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											48.0	49.0	49.0					19																	17039789		1969	4154	6123	-	-	-	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3248G>C	19.37:g.17039789C>G	ENSP00000402505:p.Arg1083Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.R1083T	ENST00000443236.1	37	c.3248	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.66|11.66	1.704472|1.704472	0.30232|0.30232	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	3.51|3.51	1.27|1.27	0.21489|0.21489	.|Farnesoic acid O-methyl transferase (1);	.|0.000000	.|0.64402	.|U	.|0.000013	T|T	0.78227|0.78227	0.4250|0.4250	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.76288|0.76288	-0.3014|-0.3014	5|9	.|0.72032	.|D	.|0.01	.|.	7.9779|7.9779	0.30166|0.30166	0.0:0.7467:0.1613:0.092|0.0:0.7467:0.1613:0.092	.|.	.|1036	.|Q8IZJ3	.|CPMD8_HUMAN	Q|T	1094|1083	.|.	.|ENSP00000291440:R1083T	E|R	-|-	1|2	0|0	CPAMD8|CPAMD8	16900789|16900789	1.000000|1.000000	0.71417|0.71417	0.085000|0.085000	0.20634|0.20634	0.028000|0.028000	0.11728|0.11728	4.796000|4.796000	0.62496|0.62496	0.049000|0.049000	0.15920|0.15920	-0.175000|-0.175000	0.13238|0.13238	GAA|AGA	CPAMD8	-	pfam_Methyltransf_FA	ENSG00000160111		0.557	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	63	0.00	0	C	NM_015692		17039789	17039789	-1	no_errors	ENST00000291440	ensembl	human	known	69_37n	missense	52	24.64	17	SNP	1.000	G
CYP4F30P	100132708	genome.wustl.edu	37	2	131439076	131439076	+	RNA	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr2:131439076C>T	ENST00000438109.1	+	0	1063					NR_023391.1		Q9H0H9	C4F30_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 30, pseudogene																		TTCAAGGCTTCGGACTTCATT	0.512																																						dbGAP											0																																										-	-	-			0			AK093281		2q21.1	2013-11-11	2011-07-29	2011-07-29	ENSG00000214081	ENSG00000214081		"""Cytochrome P450s"""	25270	pseudogene	pseudogene			"""chromosome 2 open reading frame 14"""	C2orf14			Standard	NR_023391		Approved	DKFZp434F1719, 4F-se9[6:7:8]	uc002trt.3	Q9H0H9	OTTHUMG00000154046		2.37:g.131439076C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000438109.1	37	NULL		2																																																																																			CYP4F30P	-	-	ENSG00000214081		0.512	CYP4F30P-002	KNOWN	basic	processed_transcript	CYP4F30P	HGNC	pseudogene	OTTHUMT00000333660.1	20	0.00	0	C	NR_023391		131439076	131439076	+1	no_errors	ENST00000397485	ensembl	human	known	69_37n	rna	7	41.67	5	SNP	0.178	T
DCC	1630	genome.wustl.edu	37	18	50450136	50450136	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr18:50450136G>T	ENST00000442544.2	+	4	1373	c.757G>T	c.(757-759)Gaa>Taa	p.E253*	DCC_ENST00000412726.1_Nonsense_Mutation_p.E101*	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	253	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.E253*(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGTAGCCATTGAAGGAAAAGA	0.423																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											145.0	117.0	127.0					18																	50450136		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.757G>T	18.37:g.50450136G>T	ENSP00000389140:p.Glu253*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E253*	ENST00000442544.2	37	c.757	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	38	6.996083	0.97990	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	.	.	.	5.57	5.57	0.84162	.	0.404173	0.24937	N	0.034408	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	18.3168	0.90224	0.0:0.0:1.0:0.0	.	.	.	.	X	253;186;101	.	ENSP00000304146:E186X	E	+	1	0	DCC	48704134	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.097000	0.64542	2.623000	0.88846	0.655000	0.94253	GAA	DCC	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000187323		0.423	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	121	0.00	0	G	NM_005215		50450136	50450136	+1	no_errors	ENST00000442544	ensembl	human	known	69_37n	nonsense	157	39.15	101	SNP	1.000	T
DKK3	27122	genome.wustl.edu	37	11	12020297	12020297	+	Silent	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr11:12020297G>C	ENST00000396505.2	-	4	619	c.381C>G	c.(379-381)gtC>gtG	p.V127V	DKK3_ENST00000525493.1_Silent_p.V127V|DKK3_ENST00000450094.2_Intron|DKK3_ENST00000326932.4_Silent_p.V127V|DKK3_ENST00000527132.1_Intron	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	127					adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.V127V(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		TCTCTGAAAAGACCATTTGTC	0.418																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											199.0	174.0	182.0					11																	12020297		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.381C>G	11.37:g.12020297G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1I2|D3DQW1|Q9ULB7	Silent	SNP	pfam_Dickkopf_N	p.V127	ENST00000396505.2	37	c.381	CCDS7808.1	11																																																																																			DKK3	-	NULL	ENSG00000050165		0.418	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DKK3	HGNC	protein_coding	OTTHUMT00000385863.1	203	0.00	0	G	NM_013253		12020297	12020297	-1	no_errors	ENST00000326932	ensembl	human	known	69_37n	silent	111	84.84	627	SNP	0.840	C
DNAH6	1768	genome.wustl.edu	37	2	84949763	84949763	+	Silent	SNP	C	C	A	rs146647563	byFrequency	TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr2:84949763C>A	ENST00000237449.6	+	59	9815	c.9807C>A	c.(9805-9807)gcC>gcA	p.A3269A	DNAH6_ENST00000389394.3_Silent_p.A3269A			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3269	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A3269A(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTTCTGGTGCCATTAAAACCA	0.443																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											86.0	75.0	78.0					2																	84949763		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9807C>A	2.37:g.84949763C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.A3269	ENST00000237449.6	37	c.9807	CCDS46348.1	2																																																																																			DNAH6	-	NULL	ENSG00000115423		0.443	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	162	0.00	0	C	NM_001370		84949763	84949763	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	silent	140	33.96	72	SNP	1.000	A
DPF1	8193	genome.wustl.edu	37	19	38708105	38708105	+	Intron	SNP	T	T	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr19:38708105T>G	ENST00000420980.2	-	6	703				DPF1_ENST00000355526.4_Missense_Mutation_p.H268P|DPF1_ENST00000414789.1_Missense_Mutation_p.H186P|DPF1_ENST00000416611.1_Missense_Mutation_p.H242P|DPF1_ENST00000456296.1_Missense_Mutation_p.H242P|DPF1_ENST00000412732.1_Missense_Mutation_p.H186P	NM_004647.2	NP_004638.2	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1						apoptotic process (GO:0006915)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)	p.H268P(1)		large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CTCACGTTTATGGTTGTTTTT	0.672																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	89.0	89.0					19																	38708105		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U43843	CCDS33008.2, CCDS46064.1, CCDS46065.1	19q13.12	2013-01-28			ENSG00000011332	ENSG00000011332		"""Zinc fingers, PHD-type"""	20225	protein-coding gene	gene with protein product		601670				8812431	Standard	XM_005259288		Approved	neuro-d4, NEUD4, BAF45b	uc002ohm.3	Q92782	OTTHUMG00000157164	ENST00000420980.2:c.676+332A>C	19.37:g.38708105T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSY8|Q08AJ0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_C2H2-like,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_C2H2	p.H268P	ENST00000420980.2	37	c.803	CCDS33008.2	19	.	.	.	.	.	.	.	.	.	.	T	11.20	1.569323	0.28003	.	.	ENSG00000011332	ENST00000437720;ENST00000412732;ENST00000416611;ENST00000414789;ENST00000456296;ENST00000438060	D;D;D;D;T	0.90197	-2.62;-2.17;-2.62;-2.63;2.22	3.21	3.21	0.36854	.	.	.	.	.	T	0.81178	0.4768	N	0.20483	0.58	0.46478	D	0.999066	P;B;B;B	0.38978	0.652;0.014;0.058;0.005	B;B;B;B	0.35859	0.212;0.013;0.033;0.02	T	0.77877	-0.2424	8	.	.	.	-0.1539	10.8983	0.47036	0.0:0.0:0.0:1.0	.	242;241;268;268	E9PDV3;C8C3P2;Q6PJ73;Q92782-2	.;.;.;.	P	268;186;242;186;242;186	ENSP00000412098:H186P;ENSP00000390223:H242P;ENSP00000391884:H186P;ENSP00000411569:H242P;ENSP00000416347:H186P	.	H	-	2	0	DPF1	43399945	0.993000	0.37304	0.999000	0.59377	0.884000	0.51177	2.186000	0.42593	1.481000	0.48307	0.260000	0.18958	CAT	DPF1	-	NULL	ENSG00000011332		0.672	DPF1-001	KNOWN	basic|CCDS	protein_coding	DPF1	HGNC	protein_coding	OTTHUMT00000347721.1	107	0.00	0	T			38708105	38708105	-1	no_errors	ENST00000355526	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	1.000	G
ENOX1	55068	genome.wustl.edu	37	13	43930276	43930276	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr13:43930276C>T	ENST00000261488.6	-	8	1179	c.602G>A	c.(601-603)cGa>cAa	p.R201Q	ENOX1_ENST00000540032.1_Missense_Mutation_p.R14Q|ENOX1_ENST00000412891.1_Missense_Mutation_p.R201Q	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	201	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)	p.R201Q(2)		breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		AGACCCTAATCGCATCCTATA	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											50.0	47.0	48.0					13																	43930276		2203	4300	6503	-	-	-	SO:0001583	missense	0			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.602G>A	13.37:g.43930276C>T	ENSP00000261488:p.Arg201Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R201Q	ENST00000261488.6	37	c.602	CCDS9389.1	13	.	.	.	.	.	.	.	.	.	.	C	33	5.215509	0.95104	.	.	ENSG00000120658	ENST00000261488;ENST00000412891;ENST00000540032	T;T	0.52983	0.64;0.64	5.43	5.43	0.79202	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.75824	0.3902	M	0.90595	3.13	0.53688	D	0.999974	D;D	0.76494	0.999;0.998	P;D	0.79108	0.869;0.992	T	0.80970	-0.1144	10	0.72032	D	0.01	-10.7017	19.2593	0.93961	0.0:1.0:0.0:0.0	.	14;201	B7Z5K1;Q8TC92	.;ENOX1_HUMAN	Q	201;201;14	ENSP00000261488:R201Q;ENSP00000415054:R201Q	ENSP00000261488:R201Q	R	-	2	0	ENOX1	42828276	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	7.487000	0.81328	2.557000	0.86248	0.655000	0.94253	CGA	ENOX1	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000120658		0.493	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOX1	HGNC	protein_coding	OTTHUMT00000044717.2	50	0.00	0	C	NM_017993		43930276	43930276	-1	no_errors	ENST00000261488	ensembl	human	known	69_37n	missense	27	34.15	14	SNP	1.000	T
FAM101B	359845	genome.wustl.edu	37	17	293240	293240	+	Silent	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr17:293240G>A	ENST00000329099.4	-	2	149	c.150C>T	c.(148-150)gaC>gaT	p.D50D		NM_182705.2	NP_874364.1	Q8N5W9	F101B_HUMAN	family with sequence similarity 101, member B	120					actin cytoskeleton organization (GO:0030036)|epithelial to mesenchymal transition (GO:0001837)	actin cytoskeleton (GO:0015629)	filamin binding (GO:0031005)	p.D50D(2)		breast(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)|urinary_tract(1)	13		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		GCTGCACGTCGTCGATGAAGT	0.657																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(1)|breast(1)											62.0	69.0	66.0					17																	293240		2154	4253	6407	-	-	-	SO:0001819	synonymous_variant	0					17p13	2008-10-23			ENSG00000183688	ENSG00000183688			28705	protein-coding gene	gene with protein product		615928				12477932	Standard	NM_182705		Approved	MGC45871	uc002frj.3	Q8N5W9	OTTHUMG00000132483	ENST00000329099.4:c.150C>T	17.37:g.293240G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.D50	ENST00000329099.4	37	c.150		17																																																																																			FAM101B	-	NULL	ENSG00000183688		0.657	FAM101B-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	FAM101B	HGNC	protein_coding	OTTHUMT00000255652.1	43	0.00	0	G	NM_182705		293240	293240	-1	no_start_codon	ENST00000329099	ensembl	human	known	69_37n	silent	15	42.31	11	SNP	0.896	A
GMFG	9535	genome.wustl.edu	37	19	39826138	39826138	+	Missense_Mutation	SNP	C	C	G	rs538621702		TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr19:39826138C>G	ENST00000597595.1	-	2	245	c.37G>C	c.(37-39)Gag>Cag	p.E13Q	GMFG_ENST00000594700.1_Missense_Mutation_p.E13Q|GMFG_ENST00000601387.1_Intron|GMFG_ENST00000253054.8_5'UTR|GMFG_ENST00000602185.1_Intron|GMFG_ENST00000600322.1_5'UTR|GMFG_ENST00000598034.1_Missense_Mutation_p.E13Q|GMFG_ENST00000595636.1_Missense_Mutation_p.E13Q	NM_004877.2	NP_004868.1	O60234	GMFG_HUMAN	glia maturation factor, gamma	13	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				negative regulation of protein kinase activity (GO:0006469)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)	p.E13Q(1)		breast(1)|large_intestine(2)|liver(2)|lung(3)|skin(1)|stomach(1)	10	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.15e-27)|all cancers(26;1.3e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			TCTGTTAGCTCTGGGTCTACC	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	108.0	118.0					19																	39826138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001993	CCDS12532.1, CCDS74364.1	19q13.2	2014-08-12			ENSG00000130755	ENSG00000130755			4374	protein-coding gene	gene with protein product		604104				9545571, 9653160, 17127212	Standard	XM_005259440		Approved		uc002okz.4	O60234	OTTHUMG00000182811	ENST00000597595.1:c.37G>C	19.37:g.39826138C>G	ENSP00000472249:p.Glu13Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IB37	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin,pirsf_GMF-beta	p.E13Q	ENST00000597595.1	37	c.37	CCDS12532.1	19	.	.	.	.	.	.	.	.	.	.	C	27.9	4.875962	0.91664	.	.	ENSG00000130755	ENST00000253054	T	0.39406	1.08	4.18	4.18	0.49190	Actin-binding, cofilin/tropomyosin type (3);	0.319059	0.27513	N	0.019039	T	0.51126	0.1656	M	0.88450	2.955	0.52099	D	0.999941	P;B	0.35481	0.504;0.363	B;B	0.35073	0.052;0.195	T	0.63033	-0.6727	10	0.62326	D	0.03	-16.3197	14.0237	0.64573	0.0:1.0:0.0:0.0	.	13;13	O60234;Q6IB37	GMFG_HUMAN;.	Q	13	ENSP00000253054:E13Q	ENSP00000253054:E13Q	E	-	1	0	GMFG	44517978	0.791000	0.28800	0.989000	0.46669	0.881000	0.50899	3.132000	0.50523	2.154000	0.67381	0.561000	0.74099	GAG	GMFG	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin,pirsf_GMF-beta	ENSG00000130755		0.562	GMFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMFG	HGNC	protein_coding	OTTHUMT00000463839.1	228	0.00	0	C			39826138	39826138	-1	no_errors	ENST00000253054	ensembl	human	known	69_37n	missense	125	24.55	41	SNP	1.000	G
GREB1L	80000	genome.wustl.edu	37	18	19020328	19020328	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr18:19020328G>A	ENST00000580732.2	+	9	1429	c.1048G>A	c.(1048-1050)Gtt>Att	p.V350I	GREB1L_ENST00000424526.1_Missense_Mutation_p.V350I|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000269218.6_Missense_Mutation_p.V350I|GREB1L_ENST00000400483.4_Missense_Mutation_p.V350I|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000431264.1_Missense_Mutation_p.V350I			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	350						integral component of membrane (GO:0016021)		p.V351I(1)|p.V350I(1)		breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						TGTCCCTACAGTTCGCCCTCT	0.453																																						dbGAP											2	Substitution - Missense(2)	breast(2)											115.0	107.0	110.0					18																	19020328		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.1048G>A	18.37:g.19020328G>A	ENSP00000464162:p.Val350Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QN17|Q9H8F1	Missense_Mutation	SNP	NULL	p.V350I	ENST00000580732.2	37	c.1048	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556562	0.45487	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.13420	3.33;3.35;2.59;2.59	5.49	4.61	0.57282	.	.	.	.	.	T	0.06826	0.0174	N	0.03608	-0.345	0.23425	N	0.997703	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.32824	-0.9892	9	0.34782	T	0.22	-13.1005	10.7136	0.46000	0.2013:0.0:0.7987:0.0	.	350;350	Q9C091;Q9C091-2	GRB1L_HUMAN;.	I	350	ENSP00000412060:V350I;ENSP00000269218:V350I;ENSP00000383331:V350I;ENSP00000393125:V350I	ENSP00000269218:V350I	V	+	1	0	GREB1L	17274326	0.896000	0.30565	1.000000	0.80357	0.966000	0.64601	0.494000	0.22467	1.316000	0.45131	0.655000	0.94253	GTT	GREB1L	-	NULL	ENSG00000141449		0.453	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	607	0.16	1	G	NM_024935		19020328	19020328	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	missense	484	36.85	283	SNP	1.000	A
HIST1H4G	8369	genome.wustl.edu	37	6	26247074	26247074	+	Silent	SNP	G	G	C	rs201443702		TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr6:26247074G>C	ENST00000244537.4	-	1	185	c.132C>G	c.(130-132)gtC>gtG	p.V44V		NM_003547.2	NP_003538.1	Q99525	H4G_HUMAN	histone cluster 1, H4g	44						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V44V(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				AGATGCGCTTGACACCGCCAT	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											50.0	47.0	48.0					6																	26247074		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z80788	CCDS4599.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124578	ENSG00000275663		"""Histones / Replication-dependent"""	4792	protein-coding gene	gene with protein product		602832	"""H4 histone family, member L"", ""histone 1, H4g"""	H4FL		9119399, 12408966	Standard	NM_003547		Approved	H4/l	uc003nhf.3	Q99525	OTTHUMG00000014444	ENST00000244537.4:c.132C>G	6.37:g.26247074G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,prints_Histone_H4	p.V44	ENST00000244537.4	37	c.132	CCDS4599.1	6																																																																																			HIST1H4G	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,prints_Histone_H4	ENSG00000124578		0.567	HIST1H4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4G	HGNC	protein_coding	OTTHUMT00000040107.1	67	0.00	0	G	NM_003547		26247074	26247074	-1	no_errors	ENST00000244537	ensembl	human	known	69_37n	silent	38	37.70	23	SNP	0.999	C
IFNAR1	3454	genome.wustl.edu	37	21	34715607	34715607	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr21:34715607C>T	ENST00000270139.3	+	4	562	c.410C>T	c.(409-411)gCt>gTt	p.A137V	IFNAR1_ENST00000416947.2_Missense_Mutation_p.A68V|IFNAR1_ENST00000442357.2_Missense_Mutation_p.A137V	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	137	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)	p.A137V(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	CATTTAGAAGCTGAAGATAAG	0.348																																					Esophageal Squamous(73;817 1211 32990 35667 42746)	dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	149.0	150.0					21																	34715607		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.410C>T	21.37:g.34715607C>T	ENSP00000270139:p.Ala137Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1	p.A137V	ENST00000270139.3	37	c.410	CCDS13624.1	21	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566180	0.86439	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	T;T;T	0.30182	1.54;1.54;1.54	5.71	5.71	0.89125	Fibronectin, type III (1);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.479932	0.22128	N	0.064227	T	0.56337	0.1978	M	0.73962	2.25	0.36219	D	0.851861	D	0.89917	1.0	D	0.76071	0.987	T	0.64694	-0.6347	10	0.59425	D	0.04	-17.3145	15.3595	0.74460	0.0:1.0:0.0:0.0	.	137	P17181	INAR1_HUMAN	V	68;137;137	ENSP00000395606:A68V;ENSP00000270139:A137V;ENSP00000407406:A137V	ENSP00000270139:A137V	A	+	2	0	IFNAR1	33637477	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	3.692000	0.54727	2.691000	0.91804	0.650000	0.86243	GCT	IFNAR1	-	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1	ENSG00000142166		0.348	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	HGNC	protein_coding	OTTHUMT00000139823.4	318	0.00	0	C			34715607	34715607	+1	no_errors	ENST00000270139	ensembl	human	known	69_37n	missense	252	32.26	120	SNP	1.000	T
IGF2BP1	10642	genome.wustl.edu	37	17	47117353	47117353	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr17:47117353G>A	ENST00000290341.3	+	7	1052	c.718G>A	c.(718-720)Gct>Act	p.A240T	IGF2BP1_ENST00000431824.2_Intron	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	240	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)	p.A240T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CGCAGGTGCAGCTGAAAAAGC	0.532																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)	dbGAP											1	Substitution - Missense(1)	breast(1)											153.0	138.0	143.0					17																	47117353		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.718G>A	17.37:g.47117353G>A	ENSP00000290341:p.Ala240Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JT33	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.A240T	ENST00000290341.3	37	c.718	CCDS11543.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046989	0.75846	.	.	ENSG00000159217	ENST00000290341	T	0.40476	1.03	5.65	5.65	0.86999	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.28863	0.0716	N	0.12663	0.25	0.80722	D	1	B	0.24618	0.107	B	0.28305	0.088	T	0.09684	-1.0663	10	0.14252	T	0.57	-22.658	18.512	0.90920	0.0:0.0:1.0:0.0	.	240	Q9NZI8	IF2B1_HUMAN	T	240	ENSP00000290341:A240T	ENSP00000290341:A240T	A	+	1	0	IGF2BP1	44472352	1.000000	0.71417	0.645000	0.29479	0.911000	0.54048	7.995000	0.88328	2.655000	0.90218	0.655000	0.94253	GCT	IGF2BP1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000159217		0.532	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP1	HGNC	protein_coding	OTTHUMT00000364046.1	219	0.00	0	G	NM_006546		47117353	47117353	+1	no_errors	ENST00000290341	ensembl	human	known	69_37n	missense	86	42.00	63	SNP	1.000	A
KCTD21	283219	genome.wustl.edu	37	11	77884970	77884970	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr11:77884970C>A	ENST00000340067.3	-	2	909	c.631G>T	c.(631-633)Gtg>Ttg	p.V211L	KCTD21-AS1_ENST00000600795.1_RNA|KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000530261.1_RNA|KCTD21-AS1_ENST00000528468.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	211					protein homooligomerization (GO:0051260)			p.V211L(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			TTGGCGGGCACCACCCAGAGC	0.567																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											123.0	128.0	126.0					11																	77884970		2200	4292	6492	-	-	-	SO:0001583	missense	0			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.631G>T	11.37:g.77884970C>A	ENSP00000339340:p.Val211Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTR0	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.V211L	ENST00000340067.3	37	c.631	CCDS31645.1	11	.	.	.	.	.	.	.	.	.	.	C	13.68	2.308584	0.40895	.	.	ENSG00000188997	ENST00000340067	D	0.82803	-1.65	5.88	5.88	0.94601	.	0.123149	0.36066	N	0.002804	T	0.65974	0.2743	N	0.08118	0	0.32970	D	0.522165	B	0.02656	0.0	B	0.01281	0.0	T	0.62506	-0.6840	10	0.08179	T	0.78	.	14.8418	0.70230	0.0:0.8571:0.1429:0.0	.	211	Q4G0X4	KCD21_HUMAN	L	211	ENSP00000339340:V211L	ENSP00000339340:V211L	V	-	1	0	KCTD21	77562618	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	1.749000	0.38319	2.788000	0.95919	0.555000	0.69702	GTG	KCTD21	-	NULL	ENSG00000188997		0.567	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD21	HGNC	protein_coding	OTTHUMT00000390057.1	315	0.00	0	C	NM_001029859		77884970	77884970	-1	no_errors	ENST00000340067	ensembl	human	known	69_37n	missense	410	14.58	70	SNP	1.000	A
ICE1	23379	genome.wustl.edu	37	5	5463316	5463316	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr5:5463316T>G	ENST00000296564.7	+	13	4091	c.3869T>G	c.(3868-3870)gTa>gGa	p.V1290G		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1290					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.V1290G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CTCTTAAATGTAAATAACAAC	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											36.0	38.0	37.0					5																	5463316		1883	4106	5989	-	-	-	SO:0001583	missense	0																														ENST00000296564.7:c.3869T>G	5.37:g.5463316T>G	ENSP00000296564:p.Val1290Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.V1290G	ENST00000296564.7	37	c.3869	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	T	12.58	1.981025	0.34942	.	.	ENSG00000164151	ENST00000296564	T	0.11277	2.79	4.86	-3.98	0.04082	.	.	.	.	.	T	0.04272	0.0118	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41305	-0.9516	9	0.66056	D	0.02	0.3262	7.88	0.29616	0.0:0.5906:0.1652:0.2442	.	1290	Q9Y2F5	K0947_HUMAN	G	1290	ENSP00000296564:V1290G	ENSP00000296564:V1290G	V	+	2	0	KIAA0947	5516316	0.000000	0.05858	0.000000	0.03702	0.248000	0.25809	-1.302000	0.02746	-0.679000	0.05217	0.254000	0.18369	GTA	KIAA0947	-	NULL	ENSG00000164151		0.398	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	104	0.00	0	T			5463316	5463316	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	missense	91	31.34	42	SNP	0.000	G
KIF27	55582	genome.wustl.edu	37	9	86503485	86503485	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr9:86503485G>C	ENST00000297814.2	-	8	2145	c.2002C>G	c.(2002-2004)Cag>Gag	p.Q668E	KIF27_ENST00000413982.1_Missense_Mutation_p.Q668E|KIF27_ENST00000376347.1_Missense_Mutation_p.Q59E|KIF27_ENST00000334204.2_Missense_Mutation_p.Q668E	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	668					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q668E(1)		breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TCTGGCTTCTGAATCCATGAA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	75.0	75.0					9																	86503485		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.2002C>G	9.37:g.86503485G>C	ENSP00000297814:p.Gln668Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q668E	ENST00000297814.2	37	c.2002	CCDS6665.1	9	.	.	.	.	.	.	.	.	.	.	G	2.804	-0.248443	0.05867	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	4.27	3.3	0.37823	.	0.450633	0.18265	N	0.146506	T	0.33527	0.0866	L	0.36672	1.1	0.21652	N	0.99961	B;B;B	0.18461	0.015;0.028;0.013	B;B;B	0.21360	0.015;0.034;0.01	T	0.17806	-1.0357	10	0.18710	T	0.47	.	8.0417	0.30526	0.0:0.0:0.6169:0.3831	.	668;668;668	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	E	668;668;668;59	ENSP00000297814:Q668E;ENSP00000401688:Q668E;ENSP00000333928:Q668E;ENSP00000365525:Q59E	ENSP00000297814:Q668E	Q	-	1	0	KIF27	85693305	1.000000	0.71417	0.958000	0.39756	0.916000	0.54674	2.228000	0.42981	1.009000	0.39289	0.585000	0.79938	CAG	KIF27	-	NULL	ENSG00000165115		0.348	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	HGNC	protein_coding	OTTHUMT00000052861.1	86	0.00	0	G	NM_017576		86503485	86503485	-1	no_errors	ENST00000297814	ensembl	human	known	69_37n	missense	132	16.98	27	SNP	0.993	C
LRP1	4035	genome.wustl.edu	37	12	57567573	57567573	+	Silent	SNP	C	C	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr12:57567573C>A	ENST00000243077.3	+	22	3823	c.3357C>A	c.(3355-3357)atC>atA	p.I1119I		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1119	LDL-receptor class A 9. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.I1119I(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTCGGTGCATCAGCAAAGCGT	0.627																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											158.0	130.0	139.0					12																	57567573		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3357C>A	12.37:g.57567573C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.I1119	ENST00000243077.3	37	c.3357	CCDS8932.1	12																																																																																			LRP1	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000123384		0.627	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	198	0.00	0	C	NM_002332		57567573	57567573	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	silent	42	34.38	22	SNP	1.000	A
LZTR1	8216	genome.wustl.edu	37	22	21342406	21342406	+	Splice_Site	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr22:21342406C>T	ENST00000215739.8	+	5	867	c.508C>T	c.(508-510)Cgg>Tgg	p.R170W	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Splice_Site_p.R151W	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	170					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R170W(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AATTGAAGGACGGTGAGAAAC	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	74.0	75.0					22																	21342406		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.509+1C>T	22.37:g.21342406C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14776|Q20WK0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R170W	ENST00000215739.8	37	c.508	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	C	22.3	4.271287	0.80469	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.44482	0.92;0.92	5.81	2.21	0.28008	Kelch-type beta propeller (1);	0.060529	0.64402	D	0.000001	T	0.50240	0.1604	L	0.39898	1.24	0.80722	D	1	D;D;D;D	0.76494	0.998;0.994;0.999;0.999	P;P;P;D	0.64687	0.727;0.696;0.849;0.928	T	0.55179	-0.8181	10	0.72032	D	0.01	-40.3839	12.2784	0.54751	0.5044:0.4956:0.0:0.0	.	151;129;170;129	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	W	129;170;151	ENSP00000215739:R170W;ENSP00000374006:R151W	ENSP00000215739:R170W	R	+	1	2	LZTR1	19672406	0.917000	0.31117	0.999000	0.59377	0.985000	0.73830	1.880000	0.39628	1.397000	0.46682	0.655000	0.94253	CGG	LZTR1	-	smart_Kelch_1	ENSG00000099949		0.493	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	101	0.00	0	C	NM_006767	Missense_Mutation	21342406	21342406	+1	no_errors	ENST00000215739	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.814	T
MARK2	2011	genome.wustl.edu	37	11	63669754	63669754	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr11:63669754C>T	ENST00000509502.2	+	12	1550	c.1087C>T	c.(1087-1089)Cag>Tag	p.Q363*	MARK2_ENST00000502399.3_Nonsense_Mutation_p.Q396*|MARK2_ENST00000315032.8_Nonsense_Mutation_p.Q396*|MARK2_ENST00000413835.2_Nonsense_Mutation_p.Q396*|MARK2_ENST00000425897.2_Nonsense_Mutation_p.Q363*|MARK2_ENST00000350490.7_Nonsense_Mutation_p.Q396*|MARK2_ENST00000377810.3_Nonsense_Mutation_p.Q363*|MARK2_ENST00000377809.4_Nonsense_Mutation_p.Q396*|MARK2_ENST00000508192.1_Nonsense_Mutation_p.Q396*|MARK2_ENST00000408948.3_Nonsense_Mutation_p.Q363*|MARK2_ENST00000402010.2_Nonsense_Mutation_p.Q396*|MARK2_ENST00000513765.2_Nonsense_Mutation_p.Q363*|MARK2_ENST00000361128.5_Nonsense_Mutation_p.Q396*	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2									p.Q363*(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						CCACAAGGTACAGCGCAGCGT	0.577																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											82.0	71.0	75.0					11																	63669754		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.1087C>T	11.37:g.63669754C>T	ENSP00000423974:p.Gln363*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.Q396*	ENST00000509502.2	37	c.1186	CCDS41665.1	11	.	.	.	.	.	.	.	.	.	.	C	37	6.524955	0.97637	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000502399;ENST00000509502;ENST00000513765;ENST00000408948;ENST00000425897	.	.	.	5.07	4.16	0.48862	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	12.6442	0.56725	0.0:0.9187:0.0:0.0813	.	.	.	.	X	396;396;396;396;363;396;396;396;396;363;363;363;363	.	ENSP00000326632:Q396X	Q	+	1	0	MARK2	63426330	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.879000	0.69690	1.363000	0.46019	0.555000	0.69702	CAG	MARK2	-	NULL	ENSG00000072518		0.577	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	MARK2	HGNC	protein_coding	OTTHUMT00000360862.2	314	0.00	0	C	NM_017490		63669754	63669754	+1	no_errors	ENST00000402010	ensembl	human	known	69_37n	nonsense	120	34.07	62	SNP	1.000	T
MIB1	57534	genome.wustl.edu	37	18	19426998	19426998	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr18:19426998C>T	ENST00000261537.6	+	16	2569	c.2305C>T	c.(2305-2307)Cga>Tga	p.R769*	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	769					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R769*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			CCTGAGCATTCGAAATAAGAA	0.453																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											91.0	83.0	86.0					18																	19426998		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2305C>T	18.37:g.19426998C>T	ENSP00000261537:p.Arg769*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Mib_Herc2,pfam_Znf_ZZ,superfamily_Ankyrin_rpt-contain_dom,smart_Znf_ZZ,smart_Ankyrin_rpt,smart_Znf_RING,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_RING,pfscan_Znf_ZZ	p.R769*	ENST00000261537.6	37	c.2305	CCDS11871.1	18	.	.	.	.	.	.	.	.	.	.	C	41	9.160779	0.99085	.	.	ENSG00000101752	ENST00000261537	.	.	.	5.15	4.27	0.50696	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-8.9515	14.0223	0.64563	0.0:0.9256:0.0:0.0744	.	.	.	.	X	769	.	ENSP00000261537:R769X	R	+	1	2	MIB1	17680996	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.073000	0.71245	2.415000	0.81967	0.655000	0.94253	CGA	MIB1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000101752		0.453	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIB1	HGNC	protein_coding	OTTHUMT00000254675.1	77	0.00	0	C	NM_020774		19426998	19426998	+1	no_errors	ENST00000261537	ensembl	human	known	69_37n	nonsense	71	34.55	38	SNP	1.000	T
MRPS7	51081	genome.wustl.edu	37	17	73261843	73261843	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr17:73261843G>C	ENST00000245539.6	+	5	795	c.568G>C	c.(568-570)Gag>Cag	p.E190Q	MRPS7_ENST00000579002.1_Missense_Mutation_p.E219Q	NM_015971.3	NP_057055.2	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7	190					translation (GO:0006412)	cytosolic small ribosomal subunit (GO:0022627)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.E190Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)	6	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			GATGATCACTGAGTGCCGGGA	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	72.0	72.0					17																	73261843		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051348	CCDS11718.1	17q25.1	2012-09-13				ENSG00000125445		"""Mitochondrial ribosomal proteins / small subunits"""	14499	protein-coding gene	gene with protein product		611974					Standard	NM_015971		Approved	MRP-S, RP-S7, RPMS7	uc002jnm.4	Q9Y2R9		ENST00000245539.6:c.568G>C	17.37:g.73261843G>C	ENSP00000245539:p.Glu190Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N5|Q53GD6	Missense_Mutation	SNP	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom	p.E190Q	ENST00000245539.6	37	c.568	CCDS11718.1	17	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571216	0.65765	.	.	ENSG00000125445	ENST00000245539	T	0.46063	0.88	6.07	6.07	0.98685	Ribosomal protein S7 domain (3);	0.000000	0.85682	D	0.000000	T	0.66925	0.2839	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.60068	-0.7335	10	0.32370	T	0.25	-40.0791	20.6593	0.99626	0.0:0.0:1.0:0.0	.	190	Q9Y2R9	RT07_HUMAN	Q	190	ENSP00000245539:E190Q	ENSP00000245539:E190Q	E	+	1	0	MRPS7	70773438	1.000000	0.71417	0.971000	0.41717	0.906000	0.53458	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GAG	MRPS7	-	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom	ENSG00000125445		0.572	MRPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS7	HGNC	protein_coding	OTTHUMT00000446666.1	102	0.00	0	G	NM_015971		73261843	73261843	+1	no_errors	ENST00000245539	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	1.000	C
MYO10	4651	genome.wustl.edu	37	5	16671048	16671048	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr5:16671048C>G	ENST00000513610.1	-	39	5924	c.5470G>C	c.(5470-5472)Gaa>Caa	p.E1824Q	MYO10_ENST00000274203.9_Missense_Mutation_p.E1181Q|MYO10_ENST00000515803.1_Missense_Mutation_p.E1163Q|MYO10_ENST00000427430.2_Missense_Mutation_p.E1181Q|MYO10_ENST00000505695.1_Missense_Mutation_p.E1163Q	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1824	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.E1824Q(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						AGGTTTTCTTCCGGGGCTGGA	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											34.0	40.0	38.0					5																	16671048		2037	4191	6228	-	-	-	SO:0001583	missense	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.5470G>C	5.37:g.16671048C>G	ENSP00000421280:p.Glu1824Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.E1824Q	ENST00000513610.1	37	c.5470	CCDS54834.1	5	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874525	0.72180	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51	5.52	5.52	0.82312	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	.	.	.	.	D	0.90854	0.7127	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.91510	0.5226	9	0.66056	D	0.02	.	19.4559	0.94889	0.0:1.0:0.0:0.0	.	703;1464;1824	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	Q	1824;1163;1181;1163;1181	ENSP00000421280:E1824Q;ENSP00000425051:E1163Q;ENSP00000274203:E1181Q;ENSP00000421170:E1163Q;ENSP00000391106:E1181Q	ENSP00000274203:E1181Q	E	-	1	0	MYO10	16724048	1.000000	0.71417	0.066000	0.19879	0.260000	0.26232	7.786000	0.85741	2.586000	0.87340	0.563000	0.77884	GAA	MYO10	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000145555		0.572	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1	105	0.00	0	C	NM_012334		16671048	16671048	-1	no_errors	ENST00000513610	ensembl	human	known	69_37n	missense	57	22.97	17	SNP	0.996	G
NMRAL1	57407	genome.wustl.edu	37	16	4511847	4511847	+	Silent	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr16:4511847G>C	ENST00000574733.1	-	6	1563	c.834C>G	c.(832-834)ctC>ctG	p.L278L	NMRAL1_ENST00000283429.6_Silent_p.L278L|NMRAL1_ENST00000404295.3_Silent_p.L278L|NMRAL1_ENST00000572391.1_5'Flank|NMRAL1_ENST00000574425.1_Silent_p.L278L			Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	278						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L278L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|prostate(2)|stomach(1)	15						CCTTGGGGTTGAGTCTCAGGG	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											133.0	128.0	130.0					16																	4511847		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF225419	CCDS10516.1	16p13.3	2013-10-11			ENSG00000153406	ENSG00000153406		"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	24987	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 48A, member 1"""					19027726	Standard	NM_020677		Approved	FLJ25918, HSCARG, SDR48A1	uc002cwo.3	Q9HBL8	OTTHUMG00000129468	ENST00000574733.1:c.834C>G	16.37:g.4511847G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_NmrA,pfam_DH_sc/Rdtase_SDR,pfam_RCK_N	p.L278	ENST00000574733.1	37	c.834	CCDS10516.1	16																																																																																			NMRAL1	-	NULL	ENSG00000153406		0.622	NMRAL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NMRAL1	HGNC	protein_coding	OTTHUMT00000438579.1	132	0.00	0	G	NM_020677		4511847	4511847	-1	no_errors	ENST00000283429	ensembl	human	known	69_37n	silent	49	23.44	15	SNP	1.000	C
PPP1R17	10842	genome.wustl.edu	37	7	31735126	31735126	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr7:31735126G>C	ENST00000342032.3	+	3	754	c.126G>C	c.(124-126)aaG>aaC	p.K42N	PPP1R17_ENST00000409146.3_Intron	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	42					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)	p.K42N(1)									ATCTCAAAAAGAAGCCTAGAA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	99.0	98.0					7																	31735126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.126G>C	7.37:g.31735126G>C	ENSP00000340125:p.Lys42Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE58|Q9UDQ0	Missense_Mutation	SNP	NULL	p.K42N	ENST00000342032.3	37	c.126	CCDS5436.1	7	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071393	0.55646	.	.	ENSG00000106341	ENST00000342032	T	0.36520	1.25	5.45	4.56	0.56223	.	0.065002	0.64402	D	0.000006	T	0.48352	0.1495	M	0.62723	1.935	0.80722	D	1	P	0.51351	0.944	P	0.52957	0.714	T	0.46373	-0.9196	10	0.51188	T	0.08	-15.5139	14.8175	0.70045	0.0738:0.0:0.9262:0.0	.	42	O96001	PPR17_HUMAN	N	42	ENSP00000340125:K42N	ENSP00000340125:K42N	K	+	3	2	C7orf16	31701651	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.412000	0.34714	2.719000	0.93026	0.655000	0.94253	AAG	PPP1R17	-	NULL	ENSG00000106341		0.393	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R17	HGNC	protein_coding	OTTHUMT00000250498.1	345	0.00	0	G	NM_006658		31735126	31735126	+1	no_errors	ENST00000342032	ensembl	human	known	69_37n	missense	279	26.19	99	SNP	1.000	C
PRB2	653247	genome.wustl.edu	37	12	11546633	11546633	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr12:11546633T>A	ENST00000389362.4	-	3	414	c.379A>T	c.(379-381)Aac>Tac	p.N127Y	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	127	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)		p.N127Y(1)|p.N106Y(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGAGGCTGGTTGCCTCCTTGT	0.602																																						dbGAP											2	Substitution - Missense(2)	breast(2)											303.0	286.0	292.0					12																	11546633		2203	4300	6503	-	-	-	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.379A>T	12.37:g.11546633T>A	ENSP00000374013:p.Asn127Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.N127Y	ENST00000389362.4	37	c.379	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	5.335	0.247131	0.10130	.	.	ENSG00000121335	ENST00000389362	T	0.05081	3.5	1.58	-3.16	0.05217	.	6.493090	0.01100	U	0.005347	T	0.07863	0.0197	M	0.65498	2.005	0.09310	N	1	B	0.20052	0.041	B	0.16722	0.016	T	0.34775	-0.9815	10	0.18710	T	0.47	.	3.6154	0.08075	0.1974:0.0:0.3958:0.4068	.	127	P02812	PRB2_HUMAN	Y	127	ENSP00000374013:N127Y	ENSP00000374013:N127Y	N	-	1	0	PRB2	11437900	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.985000	0.03751	-1.197000	0.02673	-0.895000	0.02911	AAC	PRB2	-	NULL	ENSG00000121335		0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	921	0.00	0	T	NM_006248		11546633	11546633	-1	no_errors	ENST00000389362	ensembl	human	known	69_37n	missense	1703	15.09	303	SNP	0.000	A
PRICKLE3	4007	genome.wustl.edu	37	X	49032267	49032267	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chrX:49032267C>T	ENST00000376317.3	-	9	1697	c.1603G>A	c.(1603-1605)Gac>Aac	p.D535N	PRICKLE3_ENST00000536904.1_Missense_Mutation_p.D454N|PRICKLE3_ENST00000540849.1_Missense_Mutation_p.D467N|PRICKLE3_ENST00000538114.1_Missense_Mutation_p.D359N	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	535							zinc ion binding (GO:0008270)	p.D535N(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						GATCCCGCGTCACATTGATAG	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											143.0	109.0	121.0					X																	49032267		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.1603G>A	X.37:g.49032267C>T	ENSP00000365494:p.Asp535Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.D535N	ENST00000376317.3	37	c.1603	CCDS14320.1	X	.	.	.	.	.	.	.	.	.	.	-	11.06	1.527553	0.27299	.	.	ENSG00000012211	ENST00000376317;ENST00000536904;ENST00000540849;ENST00000538114	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.34	3.76	1.84	0.25277	.	0.209202	0.24048	N	0.042021	T	0.46386	0.1390	N	0.24115	0.695	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.40040	-0.9584	10	0.72032	D	0.01	-10.9085	4.7055	0.12848	0.0:0.6491:0.2182:0.1327	.	497;454;535	B7Z6S4;B7Z8F2;O43900	.;.;PRIC3_HUMAN	N	535;454;467;359	ENSP00000365494:D535N;ENSP00000441385:D454N;ENSP00000446051:D467N;ENSP00000441743:D359N	ENSP00000365494:D535N	D	-	1	0	PRICKLE3	48919211	0.015000	0.18098	0.907000	0.35723	0.373000	0.29922	-0.016000	0.12613	0.640000	0.30582	0.455000	0.32223	GAC	PRICKLE3	-	NULL	ENSG00000012211		0.587	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	HGNC	protein_coding	OTTHUMT00000060811.1	223	0.00	0	C	NM_006150		49032267	49032267	-1	no_errors	ENST00000376317	ensembl	human	known	69_37n	missense	66	43.10	50	SNP	0.142	T
PRKD1	5587	genome.wustl.edu	37	14	30107713	30107713	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr14:30107713C>A	ENST00000331968.5	-	6	1196	c.967G>T	c.(967-969)Gaa>Taa	p.E323*	PRKD1_ENST00000415220.2_Nonsense_Mutation_p.E331*|PRKD1_ENST00000551644.1_5'UTR	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	323					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.E323*(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		ATGGTCACTTCGCCAAGGCAG	0.393																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											189.0	167.0	174.0					14																	30107713		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.967G>T	14.37:g.30107713C>A	ENSP00000333568:p.Glu323*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL64|B2RAF6	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.E323*	ENST00000331968.5	37	c.967	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	C	37	6.148578	0.97324	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.0552	15.8481	0.78907	0.1362:0.8638:0.0:0.0	.	.	.	.	X	323;331	.	ENSP00000333568:E323X	E	-	1	0	PRKD1	29177464	1.000000	0.71417	0.981000	0.43875	0.963000	0.63663	6.042000	0.70996	2.696000	0.92011	0.650000	0.86243	GAA	PRKD1	-	NULL	ENSG00000184304		0.393	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	216	0.00	0	C	NM_002742		30107713	30107713	-1	no_errors	ENST00000331968	ensembl	human	known	69_37n	nonsense	194	18.07	43	SNP	1.000	A
R3HDML	140902	genome.wustl.edu	37	20	42966018	42966018	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr20:42966018G>A	ENST00000217043.2	+	1	393	c.221G>A	c.(220-222)cGg>cAg	p.R74Q		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	74	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)	p.R74Q(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			AACCACATCCGGGCCAGTGTG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	55.0	56.0					20																	42966018		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.221G>A	20.37:g.42966018G>A	ENSP00000217043:p.Arg74Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.R74Q	ENST00000217043.2	37	c.221	CCDS13329.1	20	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239674	0.79800	.	.	ENSG00000101074	ENST00000217043	T	0.57752	0.38	5.18	5.18	0.71444	CAP domain (3);	0.000000	0.85682	D	0.000000	D	0.85022	0.5602	H	0.99261	4.49	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	D	0.91789	0.5442	10	0.87932	D	0	.	18.686	0.91563	0.0:0.0:1.0:0.0	.	74	Q9H3Y0	CRSPL_HUMAN	Q	74	ENSP00000217043:R74Q	ENSP00000217043:R74Q	R	+	2	0	R3HDML	42399432	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	8.731000	0.91529	2.419000	0.82065	0.385000	0.25706	CGG	R3HDML	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000101074		0.617	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	R3HDML	HGNC	protein_coding	OTTHUMT00000079344.1	66	0.00	0	G	NM_178491		42966018	42966018	+1	no_errors	ENST00000217043	ensembl	human	known	69_37n	missense	22	30.30	10	SNP	1.000	A
RARG	5916	genome.wustl.edu	37	12	53607025	53607025	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr12:53607025G>A	ENST00000425354.2	-	9	1508	c.1021C>T	c.(1021-1023)Cgc>Tgc	p.R341C	RARG_ENST00000394426.1_Missense_Mutation_p.R341C|RARG_ENST00000327550.3_Missense_Mutation_p.R269C|RARG_ENST00000543762.1_5'UTR|RARG_ENST00000543726.1_Missense_Mutation_p.R319C|RARG_ENST00000338561.5_Missense_Mutation_p.R330C	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	341	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R341C(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	AGGTCCATGCGGTCTATGGGG	0.607											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											34.0	37.0	36.0					12																	53607025		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.1021C>T	12.37:g.53607025G>A	ENSP00000388510:p.Arg341Cys	Somatic	993	WXS	Illumina GAIIx	Phase_IV	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.R341C	ENST00000425354.2	37	c.1021	CCDS8850.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.266300	0.95399	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000327550;ENST00000338561;ENST00000543726	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.42	5.42	0.78866	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.053635	0.85682	D	0.000000	T	0.71350	0.3329	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.76091	-0.3086	10	0.62326	D	0.03	.	18.3727	0.90412	0.0:0.0:1.0:0.0	.	319;341;330	B7Z4F1;P13631;F1D8P1	.;RARG_HUMAN;.	C	341;341;269;330;319	ENSP00000388510:R341C;ENSP00000377947:R341C;ENSP00000332695:R269C;ENSP00000343698:R330C;ENSP00000444335:R319C	ENSP00000332695:R269C	R	-	1	0	RARG	51893292	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.837000	0.99465	2.712000	0.92718	0.563000	0.77884	CGC	RARG	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000172819		0.607	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARG	HGNC	protein_coding	OTTHUMT00000109404.2	133	0.00	0	G	NM_000966		53607025	53607025	-1	no_errors	ENST00000394426	ensembl	human	known	69_37n	missense	32	47.54	29	SNP	1.000	A
RNASEH2A	10535	genome.wustl.edu	37	19	12923995	12923995	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr19:12923995G>A	ENST00000221486.4	+	7	830	c.736G>A	c.(736-738)Gag>Aag	p.E246K		NM_006397.2	NP_006388.2	O75792	RNH2A_HUMAN	ribonuclease H2, subunit A	246					DNA replication (GO:0006260)|mismatch repair (GO:0006298)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	metal ion binding (GO:0046872)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)	p.E246K(1)		breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	14						GACCATCCTGGAGAAAGAGGC	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	62.0	67.0					19																	12923995		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z97029	CCDS12282.1	19p13.13	2014-09-17	2006-08-17			ENSG00000104889	3.1.26.-		18518	protein-coding gene	gene with protein product		606034	"""ribonuclease H2, large subunit"", ""Aicardi-Goutieres syndrome 4"""			9789007, 16845400	Standard	NM_006397		Approved	RNASEHI, RNHIA, RNHL, AGS4	uc002mvg.1	O75792		ENST00000221486.4:c.736G>A	19.37:g.12923995G>A	ENSP00000221486:p.Glu246Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCY1|Q96F11	Missense_Mutation	SNP	pfam_RNase_HII/HIII_dom,superfamily_RNaseH-like_dom,tigrfam_RNase_H2_suA	p.E246K	ENST00000221486.4	37	c.736	CCDS12282.1	19	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690142	0.48097	.	.	ENSG00000104889	ENST00000221486	D	0.86097	-2.07	5.59	5.59	0.84812	Ribonuclease HII, helix-loop-helix cap domain (1);Ribonuclease H-like (1);	0.105547	0.64402	D	0.000008	D	0.82637	0.5080	L	0.51422	1.61	0.53688	D	0.999972	B	0.09022	0.002	B	0.14023	0.01	T	0.76721	-0.2855	10	0.30078	T	0.28	-33.298	18.3397	0.90300	0.0:0.0:1.0:0.0	.	246	O75792	RNH2A_HUMAN	K	246	ENSP00000221486:E246K	ENSP00000221486:E246K	E	+	1	0	RNASEH2A	12784995	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	7.006000	0.76329	2.622000	0.88805	0.655000	0.94253	GAG	RNASEH2A	-	superfamily_RNaseH-like_dom	ENSG00000104889		0.587	RNASEH2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEH2A	HGNC	protein_coding	OTTHUMT00000451507.1	452	0.00	0	G	NM_006397		12923995	12923995	+1	no_errors	ENST00000221486	ensembl	human	known	69_37n	missense	153	15.93	29	SNP	1.000	A
RSPH14	27156	genome.wustl.edu	37	22	23401684	23401684	+	Missense_Mutation	SNP	G	G	A	rs145771609	byFrequency	TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr22:23401684G>A	ENST00000216036.4	-	7	1199	c.1003C>T	c.(1003-1005)Cgg>Tgg	p.R335W		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		335								p.R335W(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		CGGGCTGCCCGCTGTAAGGCT	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	106.0	107.0					22																	23401684		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000216036.4:c.1003C>T	22.37:g.23401684G>A	ENSP00000216036:p.Arg335Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_HEAT,pfam_Armadillo,superfamily_ARM-type_fold	p.R335W	ENST00000216036.4	37	c.1003	CCDS13803.1	22	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173040	0.57584	.	.	ENSG00000100218	ENST00000216036	T	0.37411	1.2	5.08	0.373	0.16178	Armadillo-type fold (1);	1.769690	0.03092	N	0.159989	T	0.51210	0.1661	L	0.47190	1.495	0.09310	N	1	D	0.89917	1.0	D	0.70935	0.971	T	0.30060	-0.9991	10	0.54805	T	0.06	-15.9406	6.4818	0.22067	0.0852:0.0:0.4501:0.4647	.	335	Q9UHP6	RTDR1_HUMAN	W	335	ENSP00000216036:R335W	ENSP00000216036:R335W	R	-	1	2	RTDR1	21731684	0.003000	0.15002	0.009000	0.14445	0.006000	0.05464	0.693000	0.25497	-0.010000	0.14271	0.561000	0.74099	CGG	RTDR1	-	superfamily_ARM-type_fold	ENSG00000100218		0.577	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTDR1	HGNC	protein_coding	OTTHUMT00000319049.1	113	0.00	0	G			23401684	23401684	-1	no_errors	ENST00000216036	ensembl	human	known	69_37n	missense	81	27.03	30	SNP	0.004	A
SERBP1	26135	genome.wustl.edu	37	1	67895731	67895732	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr1:67895731_67895732insG	ENST00000370995.2	-	1	337_338	c.252_253insC	c.(250-255)cccagcfs	p.S85fs	SERBP1_ENST00000370994.4_Frame_Shift_Ins_p.S85fs|SERBP1_ENST00000361219.6_Frame_Shift_Ins_p.S85fs|SERBP1_ENST00000370990.5_Frame_Shift_Ins_p.S85fs			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	85					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						ACGCCAACGCTGGGGGGCAGCG	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.253dupC	1.37:g.67895737_67895737dupG	ENSP00000360034:p.Ser85fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Frame_Shift_Ins	INS	pfam_HABP4_PAIRBP1-bd	p.S84fs	ENST00000370995.2	37	c.253_252	CCDS30746.1	1																																																																																			SERBP1	-	NULL	ENSG00000142864		0.629	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SERBP1	HGNC	protein_coding	OTTHUMT00000025984.2	28	0.00	0	-	NM_001018067		67895731	67895732	-1	no_errors	ENST00000370995	ensembl	human	known	69_37n	frame_shift_ins	28	12.50	4	INS	0.614:0.912	G
SF3B1	23451	genome.wustl.edu	37	2	198267459	198267459	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr2:198267459G>A	ENST00000335508.6	-	14	1989	c.1898C>T	c.(1897-1899)gCt>gTt	p.A633V	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	633					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.A633V(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGCTACAACAGCAAAAGCTCT	0.448			Mis		myelodysplastic syndrome																																	dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	1	Substitution - Missense(1)	breast(1)											96.0	94.0	95.0					2																	198267459		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1898C>T	2.37:g.198267459G>A	ENSP00000335321:p.Ala633Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.A633V	ENST00000335508.6	37	c.1898	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.538661	0.96474	.	.	ENSG00000115524	ENST00000335508	T	0.68181	-0.31	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85978	0.5823	M	0.92604	3.325	0.80722	D	1	D	0.57899	0.981	D	0.63033	0.91	D	0.88525	0.3099	10	0.87932	D	0	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	633	O75533	SF3B1_HUMAN	V	633	ENSP00000335321:A633V	ENSP00000335321:A633V	A	-	2	0	SF3B1	197975704	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.749000	0.98871	2.752000	0.94435	0.655000	0.94253	GCT	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.448	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	111	0.00	0	G			198267459	198267459	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	43	54.26	51	SNP	1.000	A
SLC25A18	83733	genome.wustl.edu	37	22	18069986	18069986	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr22:18069986C>G	ENST00000327451.6	+	8	1032	c.494C>G	c.(493-495)tCt>tGt	p.S165C	AC004019.13_ENST00000443935.1_RNA|SLC25A18_ENST00000399813.1_Missense_Mutation_p.S165C	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	165						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)	p.S165C(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		AGGCGCCCCTCTGCCACCCTC	0.647																																					Colon(118;1560 1625 18964 29606 50093)	dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	87.0	89.0					22																	18069986		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.494C>G	22.37:g.18069986C>G	ENSP00000329033:p.Ser165Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.S165C	ENST00000327451.6	37	c.494	CCDS13744.1	22	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524477	0.85600	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	T;T	0.81163	-1.46;-1.46	4.95	4.95	0.65309	Mitochondrial carrier domain (2);	0.120556	0.64402	D	0.000014	D	0.89712	0.6794	H	0.95950	3.745	0.58432	D	0.999999	B	0.32101	0.356	B	0.41510	0.359	D	0.91448	0.5179	10	0.66056	D	0.02	.	17.3738	0.87386	0.0:1.0:0.0:0.0	.	165	Q9H1K4	GHC2_HUMAN	C	165	ENSP00000329033:S165C;ENSP00000382710:S165C	ENSP00000329033:S165C	S	+	2	0	SLC25A18	16449986	0.996000	0.38824	0.795000	0.32087	0.857000	0.48899	7.229000	0.78088	2.475000	0.83589	0.485000	0.47835	TCT	SLC25A18	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000182902		0.647	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A18	HGNC	protein_coding	OTTHUMT00000316214.3	140	0.00	0	C	NM_031481		18069986	18069986	+1	no_errors	ENST00000327451	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	0.996	G
SLC8A3	6547	genome.wustl.edu	37	14	70515731	70515731	+	Silent	SNP	C	C	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr14:70515731C>A	ENST00000381269.2	-	7	2913	c.2160G>T	c.(2158-2160)ggG>ggT	p.G720G	SLC8A3_ENST00000356921.2_Silent_p.G714G|SLC8A3_ENST00000357887.3_Silent_p.G718G|SLC8A3_ENST00000216568.7_Silent_p.G91G|SLC8A3_ENST00000528359.1_Silent_p.G718G|SLC8A3_ENST00000534137.1_Silent_p.G717G|SLC8A3_ENST00000533541.1_Silent_p.G77G|SLC8A3_ENST00000394330.2_Silent_p.G77G	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	720					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.G718G(1)|p.G720G(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GCCTCTCCTCCCCGGATTCAT	0.527																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											95.0	76.0	82.0					14																	70515731		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2160G>T	14.37:g.70515731C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.G720	ENST00000381269.2	37	c.2160	CCDS35498.1	14																																																																																			SLC8A3	-	tigrfam_Na_Ca_Ex	ENSG00000100678		0.527	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	HGNC	protein_coding	OTTHUMT00000390736.1	218	0.00	0	C			70515731	70515731	-1	no_errors	ENST00000381269	ensembl	human	known	69_37n	silent	57	49.11	55	SNP	0.151	A
SMARCA2	6595	genome.wustl.edu	37	9	2076304	2076304	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr9:2076304G>C	ENST00000382203.1	+	13	2220	c.2011G>C	c.(2011-2013)Gag>Cag	p.E671Q	SMARCA2_ENST00000357248.2_Missense_Mutation_p.E671Q|SMARCA2_ENST00000382194.1_Missense_Mutation_p.E671Q|SMARCA2_ENST00000349721.2_Missense_Mutation_p.E671Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	671					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.E667Q(1)|p.E671Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AGAAGTTTCTGAGAAGGATGC	0.393																																						dbGAP											2	Substitution - Missense(2)	breast(2)											134.0	136.0	135.0					9																	2076304		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2011G>C	9.37:g.2076304G>C	ENSP00000371638:p.Glu671Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.E671Q	ENST00000382203.1	37	c.2011	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	g	26.1	4.705211	0.89018	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28	5.92	5.92	0.95590	.	0.211136	0.38959	N	0.001517	D	0.86772	0.6013	L	0.49126	1.545	0.80722	D	1	P;P;P	0.46912	0.76;0.886;0.818	B;B;B	0.44278	0.273;0.445;0.259	D	0.86838	0.2015	10	0.49607	T	0.09	-35.6173	18.5065	0.90900	0.0:0.0:1.0:0.0	.	272;671;671	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	Q	671	ENSP00000265773:E671Q;ENSP00000349788:E671Q;ENSP00000371638:E671Q;ENSP00000371629:E671Q	ENSP00000265773:E671Q	E	+	1	0	SMARCA2	2066304	1.000000	0.71417	0.969000	0.41365	0.979000	0.70002	7.115000	0.77110	2.811000	0.96726	0.651000	0.88453	GAG	SMARCA2	-	NULL	ENSG00000080503		0.393	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	481	0.00	0	G	NM_003070		2076304	2076304	+1	no_errors	ENST00000349721	ensembl	human	known	69_37n	missense	528	43.18	402	SNP	0.999	C
SMYD3	64754	genome.wustl.edu	37	1	246091315	246091315	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr1:246091315C>A	ENST00000388985.4	-	7	619	c.620G>T	c.(619-621)aGc>aTc	p.S207I	SMYD3_ENST00000366517.1_5'UTR|SMYD3_ENST00000541742.1_Missense_Mutation_p.S148I|SMYD3_ENST00000490107.1_Missense_Mutation_p.S148I			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	207	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)	p.S207I(1)|p.S148I(1)		breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		GGGGTCACAGCTGTGATTGAG	0.468																																						dbGAP											2	Substitution - Missense(2)	breast(2)											74.0	72.0	72.0					1																	246091315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.620G>T	1.37:g.246091315C>A	ENSP00000373637:p.Ser207Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.S207I	ENST00000388985.4	37	c.620	CCDS53486.1	1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838299	0.91117	.	.	ENSG00000185420	ENST00000541742;ENST00000490107;ENST00000544586;ENST00000388985;ENST00000391836	D;D;D;D	0.94184	-2.48;-2.48;-2.48;-3.37	5.65	5.65	0.86999	SET domain (3);	0.132141	0.64402	D	0.000001	D	0.97278	0.9110	M	0.87456	2.885	0.58432	D	0.999999	D;D	0.89917	0.978;1.0	P;D	0.91635	0.602;0.999	D	0.97609	1.0128	10	0.87932	D	0	-1.7083	19.7321	0.96186	0.0:1.0:0.0:0.0	.	207;18	Q9H7B4;B3KN46	SMYD3_HUMAN;.	I	148;148;37;207;18	ENSP00000444184:S148I;ENSP00000419184:S148I;ENSP00000373637:S207I;ENSP00000375712:S18I	ENSP00000373637:S207I	S	-	2	0	SMYD3	244157938	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.064000	0.64338	2.652000	0.90054	0.650000	0.86243	AGC	SMYD3	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000185420		0.468	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD3	HGNC	protein_coding		128	0.00	0	C	NM_022743		246091315	246091315	-1	no_errors	ENST00000388985	ensembl	human	known	69_37n	missense	151	11.11	19	SNP	1.000	A
ZNF425	155054	genome.wustl.edu	37	7	148801933	148801933	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I2-01A-11W-A050-09	TCGA-B6-A0I2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9cae7c8-a62b-46ad-a98b-82e6b5fddf00	541dbb6d-4173-4885-9387-b9607b1ed40f	g.chr7:148801933C>G	ENST00000378061.2	-	4	1162	c.1030G>C	c.(1030-1032)Ggc>Cgc	p.G344R		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	344					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G344R(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ACCTTCATGCCCCTCTTCAGG	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	47.0	48.0					7																	148801933		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1030G>C	7.37:g.148801933C>G	ENSP00000367300:p.Gly344Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPM1|Q08AG3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.G344R	ENST00000378061.2	37	c.1030	CCDS34773.1	7	.	.	.	.	.	.	.	.	.	.	C	10.50	1.367468	0.24771	.	.	ENSG00000204947	ENST00000378061	T	0.15017	2.46	3.16	-2.99	0.05497	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06554	0.0168	N	0.13235	0.315	0.09310	N	1	B	0.33694	0.421	B	0.29267	0.1	T	0.39231	-0.9624	9	0.14656	T	0.56	.	4.9507	0.14013	0.0:0.1427:0.4726:0.3847	.	344	Q6IV72	ZN425_HUMAN	R	344	ENSP00000367300:G344R	ENSP00000367300:G344R	G	-	1	0	ZNF425	148432866	0.000000	0.05858	0.000000	0.03702	0.893000	0.52053	-4.315000	0.00254	-0.597000	0.05813	0.655000	0.94253	GGC	ZNF425	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204947		0.642	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	60	0.00	0	C	XM_088140		148801933	148801933	-1	no_errors	ENST00000378061	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	0.001	G
