#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS15	170689	genome.wustl.edu	37	11	130343075	130343075	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr11:130343075delA	ENST00000299164.2	+	8	2212	c.2212delA	c.(2212-2214)aacfs	p.N738fs		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	738	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GTACCTGCTCAACGGGCATTT	0.632																																						dbGAP											0													67.0	64.0	65.0					11																	130343075		2201	4297	6498	-	-	-	SO:0001589	frameshift_variant	0			AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2212delA	11.37:g.130343075delA	ENSP00000299164:p.Asn738fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MI6	Frame_Shift_Del	DEL	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS,prints_Pept_M12B_ADAM-TS8	p.N738fs	ENST00000299164.2	37	c.2212	CCDS8488.1	11																																																																																			ADAMTS15	-	pfam_ADAM_spacer1	ENSG00000166106		0.632	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS15	HGNC	protein_coding	OTTHUMT00000385638.1	23	0.00	0	A	NM_139055		130343075	130343075	+1	no_errors	ENST00000299164	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000	-
CEMP1	752014	genome.wustl.edu	37	16	2580462	2580462	+	Silent	SNP	T	T	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr16:2580462T>G	ENST00000567119.1	-	1	947	c.613A>C	c.(613-615)Aga>Cga	p.R205R	CEMP1_ENST00000565480.1_Intron|AMDHD2_ENST00000413459.3_Missense_Mutation_p.L496R|AMDHD2_ENST00000565570.1_3'UTR|AMDHD2_ENST00000302956.4_3'UTR|MIR3178_ENST00000581887.1_RNA|CEMP1_ENST00000382350.1_Silent_p.R205R	NM_001048212.3	NP_001041677.1	Q6PRD7	CEMP1_HUMAN	cementum protein 1	205						cytoplasm (GO:0005737)				lung(1)|skin(1)	2						CTCTTGGCTCTGAGGACAGCC	0.617																																						dbGAP											0													50.0	53.0	52.0					16																	2580462		1978	4159	6137	-	-	-	SO:0001819	synonymous_variant	0			AY584596	CCDS42108.1	16p13.3	2006-09-22							32553	protein-coding gene	gene with protein product	"""cementum protein-23"""	611113				16263347	Standard	NM_001048212		Approved	CP-23	uc002cqr.3	Q6PRD7		ENST00000567119.1:c.613A>C	16.37:g.2580462T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUY1	Missense_Mutation	SNP	pfam_Amidohydro_1,pfam_Amidohydro_3,superfamily_Metal-dep_hydrolase_composite	p.L496R	ENST00000567119.1	37	c.1487	CCDS42108.1	16	.	.	.	.	.	.	.	.	.	.	T	4.928	0.172341	0.09391	.	.	ENSG00000162066	ENST00000413459	.	.	.	2.14	-0.182	0.13287	.	.	.	.	.	T	0.17959	0.0431	.	.	.	0.09310	N	1	P	0.45768	0.866	B	0.35655	0.207	T	0.14531	-1.0469	7	0.87932	D	0	.	4.34	0.11105	0.0:0.3552:0.0:0.6448	.	496	Q9Y303-3	.	R	496	.	ENSP00000391596:L496R	L	+	2	0	AMDHD2	2520463	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.510000	0.06328	-0.071000	0.12886	0.418000	0.28097	CTG	AMDHD2	-	NULL	ENSG00000162066		0.617	CEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMDHD2	HGNC	protein_coding	OTTHUMT00000435686.1	49	0.00	0	T	NM_001048212		2580462	2580462	+1	no_errors	ENST00000413459	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.000	G
ANK3	288	genome.wustl.edu	37	10	61832621	61832621	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr10:61832621G>A	ENST00000280772.2	-	37	8209	c.8018C>T	c.(8017-8019)cCa>cTa	p.P2673L	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2673					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.P2673L(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CATCTTCTCTGGGCTGCTGGG	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	81.0	84.0					10																	61832621		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.8018C>T	10.37:g.61832621G>A	ENSP00000280772:p.Pro2673Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.P2673L	ENST00000280772.2	37	c.8018	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061742	0.55432	.	.	ENSG00000151150	ENST00000280772	T	0.77489	-1.1	5.83	5.83	0.93111	.	0.000000	0.41823	D	0.000808	D	0.83862	0.5346	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80894	-0.1178	10	0.32370	T	0.25	.	20.1237	0.97972	0.0:0.0:1.0:0.0	.	2673	Q12955	ANK3_HUMAN	L	2673	ENSP00000280772:P2673L	ENSP00000280772:P2673L	P	-	2	0	ANK3	61502627	1.000000	0.71417	0.974000	0.42286	0.285000	0.27093	9.869000	0.99810	2.759000	0.94783	0.561000	0.74099	CCA	ANK3	-	NULL	ENSG00000151150		0.557	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	71	0.00	0	G	NM_020987		61832621	61832621	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	63	21.25	17	SNP	1.000	A
ANKAR	150709	genome.wustl.edu	37	2	190602506	190602506	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:190602506C>G	ENST00000520309.1	+	18	3609	c.3521C>G	c.(3520-3522)tCt>tGt	p.S1174C	ANKAR_ENST00000281412.6_3'UTR|ANKAR_ENST00000313581.4_Missense_Mutation_p.S1174C|ANKAR_ENST00000431575.2_Missense_Mutation_p.S1103C|ANKAR_ENST00000438402.2_3'UTR	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1174						integral component of membrane (GO:0016021)		p.S1174C(1)|p.S1103C(1)		breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ATGACCATATCTATTTTTGAA	0.313																																						dbGAP											2	Substitution - Missense(2)	breast(2)											65.0	64.0	64.0					2																	190602506		2203	4297	6500	-	-	-	SO:0001583	missense	0			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.3521C>G	2.37:g.190602506C>G	ENSP00000427882:p.Ser1174Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Armadillo,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Armadillo	p.S1174C	ENST00000520309.1	37	c.3521	CCDS33351.2	2	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105367	0.56291	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000431575;ENST00000374838	T;T;T	0.04862	3.54;3.54;3.54	5.92	5.92	0.95590	.	0.369905	0.25178	N	0.032546	T	0.20373	0.0490	L	0.59436	1.845	0.80722	D	1	D	0.67145	0.996	P	0.58970	0.849	T	0.00006	-1.2509	10	0.59425	D	0.04	-7.6234	19.078	0.93171	0.0:1.0:0.0:0.0	.	250	E9PHS9	.	C	1174;1174;1103;250	ENSP00000427882:S1174C;ENSP00000313513:S1174C;ENSP00000393043:S1103C	ENSP00000313513:S1174C	S	+	2	0	ANKAR	190310751	0.298000	0.24417	0.687000	0.30102	0.725000	0.41563	1.506000	0.35747	2.809000	0.96659	0.650000	0.86243	TCT	ANKAR	-	superfamily_ARM-type_fold	ENSG00000151687		0.313	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKAR	HGNC	protein_coding	OTTHUMT00000335045.3	159	0.00	0	C	NM_144708		190602506	190602506	+1	no_errors	ENST00000313581	ensembl	human	known	69_37n	missense	107	23.57	33	SNP	0.467	G
ARFGEF1	10565	genome.wustl.edu	37	8	68189547	68189547	+	Silent	SNP	A	A	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr8:68189547A>G	ENST00000262215.3	-	8	1562	c.1173T>C	c.(1171-1173)gaT>gaC	p.D391D		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	391					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.D391D(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CTGACAATCTATCATCAGGTA	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											185.0	158.0	167.0					8																	68189547		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1173T>C	8.37:g.68189547A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.D391	ENST00000262215.3	37	c.1173	CCDS6199.1	8																																																																																			ARFGEF1	-	superfamily_ARM-type_fold	ENSG00000066777		0.403	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	131	0.00	0	A	NM_006421		68189547	68189547	-1	no_errors	ENST00000262215	ensembl	human	known	69_37n	silent	239	14.64	41	SNP	1.000	G
ARHGAP12	94134	genome.wustl.edu	37	10	32197724	32197724	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr10:32197724T>A	ENST00000344936.2	-	3	294	c.60A>T	c.(58-60)gaA>gaT	p.E20D	ARHGAP12_ENST00000311380.4_Missense_Mutation_p.E20D|ARHGAP12_ENST00000396144.4_Missense_Mutation_p.E20D|ARHGAP12_ENST00000375245.4_Missense_Mutation_p.E20D|ARHGAP12_ENST00000375250.5_Missense_Mutation_p.E20D	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	20	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.E20D(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				CATAATCATATTCCACCTCAA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											184.0	172.0	176.0					10																	32197724		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.60A>T	10.37:g.32197724T>A	ENSP00000345808:p.Glu20Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_Rsp5_WWP,smart_SH3_domain,smart_WW_Rsp5_WWP,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.E20D	ENST00000344936.2	37	c.60	CCDS7170.1	10	.	.	.	.	.	.	.	.	.	.	T	19.92	3.915573	0.73098	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81	5.73	-2.55	0.06288	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.61949	0.2388	M	0.70275	2.135	0.40641	D	0.981947	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999;0.998	T	0.64896	-0.6299	10	0.59425	D	0.04	.	12.8972	0.58106	0.0:0.5496:0.0:0.4504	.	20;20;20;20;20;20	Q1RLN5;B3KR88;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3	.;.;.;.;RHG12_HUMAN;.	D	20	ENSP00000310984:E20D;ENSP00000364399:E20D;ENSP00000345808:E20D;ENSP00000379448:E20D;ENSP00000364394:E20D	ENSP00000310984:E20D	E	-	3	2	ARHGAP12	32237730	0.004000	0.15560	0.991000	0.47740	0.987000	0.75469	-1.304000	0.02741	-0.333000	0.08476	0.528000	0.53228	GAA	ARHGAP12	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000165322		0.368	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	HGNC	protein_coding	OTTHUMT00000047465.1	312	0.00	0	T			32197724	32197724	-1	no_errors	ENST00000344936	ensembl	human	known	69_37n	missense	384	16.70	77	SNP	0.988	A
ARHGEF3	50650	genome.wustl.edu	37	3	56766419	56766420	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr3:56766419_56766420insA	ENST00000296315.3	-	9	1242_1243	c.1074_1075insT	c.(1072-1077)cttgtgfs	p.V359fs	ARHGEF3_ENST00000338458.4_Frame_Shift_Ins_p.V391fs|ARHGEF3_ENST00000496106.1_Frame_Shift_Ins_p.V365fs|ARHGEF3_ENST00000495373.1_Frame_Shift_Ins_p.V359fs|ARHGEF3_ENST00000413728.2_Frame_Shift_Ins_p.V365fs|ARHGEF3_ENST00000497267.1_Frame_Shift_Ins_p.V330fs	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	359	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CGAGTGATCACAAGCACTTCTT	0.465																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.1075dupT	3.37:g.56766421_56766421dupA	ENSP00000296315:p.Val359fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Frame_Shift_Ins	INS	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.V390fs	ENST00000296315.3	37	c.1171_1170	CCDS2878.1	3																																																																																			ARHGEF3	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000163947		0.465	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF3	HGNC	protein_coding	OTTHUMT00000352431.2	47	0.00	0	-	NM_019555		56766419	56766420	-1	no_errors	ENST00000338458	ensembl	human	known	69_37n	frame_shift_ins	47	45.98	40	INS	1.000:0.949	A
ASMTL	8623	genome.wustl.edu	37	X	1554633	1554633	+	Silent	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:1554633G>A	ENST00000381317.3	-	4	324	c.292C>T	c.(292-294)Ctg>Ttg	p.L98L	ASMTL_ENST00000416733.2_Intron|ASMTL_ENST00000381333.4_Silent_p.L82L|ASMTL_ENST00000534940.1_Silent_p.L40L|ASMTL_ENST00000463763.1_5'Flank	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	98	MAF-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)	p.L98L(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCTTCTCCAGAATCAGCCCC	0.612																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											96.0	110.0	106.0					X																	1554633		1958	4123	6081	-	-	-	SO:0001819	synonymous_variant	0			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.292C>T	X.37:g.1554633G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Silent	SNP	pfam_Maf,pfam_O_MeTrfase_2,tigrfam_Maf	p.L98	ENST00000381317.3	37	c.292	CCDS43917.1	X																																																																																			ASMTL	-	pfam_Maf,tigrfam_Maf	ENSG00000169093		0.612	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL	HGNC	protein_coding	OTTHUMT00000055595.1	129	0.00	0	G	NM_004192		1554633	1554633	-1	no_errors	ENST00000381317	ensembl	human	known	69_37n	silent	49	37.97	30	SNP	0.973	A
ASTN1	460	genome.wustl.edu	37	1	177133537	177133537	+	Silent	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:177133537G>A	ENST00000367654.3	-	1	487	c.276C>T	c.(274-276)ttC>ttT	p.F92F	ASTN1_ENST00000424564.2_Silent_p.F92F|ASTN1_ENST00000361833.2_Silent_p.F92F|ASTN1_ENST00000367657.3_Silent_p.F92F|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	92					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.F92F(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CACCCAGCACGAAGTAGGGCA	0.692																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											32.0	27.0	29.0					1																	177133537		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.276C>T	1.37:g.177133537G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.F92	ENST00000367654.3	37	c.276		1																																																																																			ASTN1	-	NULL	ENSG00000152092		0.692	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		45	0.00	0	G	NM_004319		177133537	177133537	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	silent	76	31.25	35	SNP	1.000	A
ASTN2	23245	genome.wustl.edu	37	9	119903677	119903677	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr9:119903677C>T	ENST00000313400.4	-	4	1196	c.1096G>A	c.(1096-1098)Gag>Aag	p.E366K	ASTN2_ENST00000373996.3_Missense_Mutation_p.E366K|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000361209.2_Intron			O75129	ASTN2_HUMAN	astrotactin 2	366					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TGACCGATCTCGATGGGCGTG	0.602																																						dbGAP											0													108.0	88.0	95.0					9																	119903677		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1096G>A	9.37:g.119903677C>T	ENSP00000314038:p.Glu366Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.E366K	ENST00000313400.4	37	c.1096		9	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034464	0.75617	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986	T;T;T	0.12465	2.86;2.86;2.68	5.06	5.06	0.68205	.	0.159823	0.42964	D	0.000639	T	0.33673	0.0871	.	.	.	0.47994	D	0.999561	D;P	0.63046	0.992;0.544	P;B	0.62649	0.905;0.042	T	0.02232	-1.1191	8	.	.	.	-25.4269	16.6107	0.84882	0.0:1.0:0.0:0.0	.	366;366	O75129;O75129-3	ASTN2_HUMAN;.	K	366;366;93	ENSP00000314038:E366K;ENSP00000363108:E366K;ENSP00000363098:E93K	.	E	-	1	0	ASTN2	118943498	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.640000	0.67875	2.347000	0.79759	0.557000	0.71058	GAG	ASTN2	-	NULL	ENSG00000148219		0.602	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		250	0.00	0	C	NM_014010		119903677	119903677	-1	no_errors	ENST00000313400	ensembl	human	known	69_37n	missense	264	20.96	70	SNP	1.000	T
ATL2	64225	genome.wustl.edu	37	2	38527429	38527429	+	Silent	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:38527429T>C	ENST00000378954.4	-	10	1114	c.1113A>G	c.(1111-1113)ccA>ccG	p.P371P	ATL2_ENST00000419554.2_Silent_p.P371P|ATL2_ENST00000332337.4_Silent_p.P353P|ATL2_ENST00000402054.1_Silent_p.P200P|ATL2_ENST00000406122.1_Silent_p.P200P|ATL2_ENST00000546051.1_Silent_p.P200P|ATL2_ENST00000539122.1_Silent_p.P200P|ATL2_ENST00000452935.2_Silent_p.P353P	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	371					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.P371P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						GCATGGACTTTGGATGTGGAA	0.378																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											142.0	139.0	140.0					2																	38527429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1113A>G	2.37:g.38527429T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Silent	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.P371	ENST00000378954.4	37	c.1113	CCDS46260.1	2																																																																																			ATL2	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000119787		0.378	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATL2	HGNC	protein_coding	OTTHUMT00000219886.2	340	0.00	0	T	NM_022374		38527429	38527429	-1	no_errors	ENST00000378954	ensembl	human	known	69_37n	silent	193	24.61	63	SNP	0.991	C
ATF2	1386	genome.wustl.edu	37	2	175939354	175939354	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:175939354G>T	ENST00000264110.2	-	14	1799	c.1501C>A	c.(1501-1503)Cag>Aag	p.Q501K	ATF2_ENST00000409437.1_Missense_Mutation_p.Q385K|ATF2_ENST00000538946.1_3'UTR|ATF2_ENST00000426833.3_Missense_Mutation_p.Q483K|ATF2_ENST00000409499.1_Missense_Mutation_p.Q140K|ATF2_ENST00000487334.2_3'UTR|ATF2_ENST00000345739.5_Missense_Mutation_p.Q443K|ATF2_ENST00000392544.1_Missense_Mutation_p.Q501K|ATF2_ENST00000409635.1_Missense_Mutation_p.Q443K|ATF2_ENST00000392543.2_Missense_Mutation_p.Q122K	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	501					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q501K(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	CCTGAGGGCTGTGACTGGGAG	0.468																																					Pancreas(17;87 705 4534 15538 30988)	dbGAP											1	Substitution - Missense(1)	breast(1)											43.0	40.0	41.0					2																	175939354		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.1501C>A	2.37:g.175939354G>T	ENSP00000264110:p.Gln501Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pirsf_TF_cAMP-dep,pfscan_Znf_C2H2,pfscan_bZIP	p.Q501K	ENST00000264110.2	37	c.1501	CCDS2262.1	2	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635645	0.47049	.	.	ENSG00000115966	ENST00000264110;ENST00000345739;ENST00000542046;ENST00000409437;ENST00000409635;ENST00000392544;ENST00000409499;ENST00000426833;ENST00000392543	T;T;T;T;T;T	0.76839	-1.05;0.53;-0.42;0.53;-1.05;-1.03	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.85168	0.5635	L	0.58101	1.795	0.80722	D	1	P;P;B;P	0.49447	0.924;0.571;0.102;0.713	P;B;B;P	0.59424	0.857;0.163;0.021;0.678	D	0.83628	0.0143	10	0.46703	T	0.11	-30.3765	18.7402	0.91770	0.0:0.0:1.0:0.0	.	483;140;443;501	A4D7U4;Q96JT8;Q3B7B7;P15336	.;.;.;ATF2_HUMAN	K	501;443;478;385;443;501;140;483;122	ENSP00000264110:Q501K;ENSP00000340576:Q443K;ENSP00000386326:Q385K;ENSP00000387093:Q443K;ENSP00000376327:Q501K;ENSP00000407911:Q483K	ENSP00000264110:Q501K	Q	-	1	0	ATF2	175647600	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	8.767000	0.91732	2.868000	0.98415	0.555000	0.69702	CAG	ATF2	-	pirsf_TF_cAMP-dep	ENSG00000115966		0.468	ATF2-001	KNOWN	basic|CCDS	protein_coding	ATF2	HGNC	protein_coding	OTTHUMT00000255562.1	63	0.00	0	G	NM_001880		175939354	175939354	-1	no_errors	ENST00000264110	ensembl	human	known	69_37n	missense	92	20.00	23	SNP	1.000	T
CATSPER1	117144	genome.wustl.edu	37	11	65792950	65792950	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr11:65792950G>C	ENST00000312106.5	-	1	1038	c.901C>G	c.(901-903)Cag>Gag	p.Q301E		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	301	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.Q301E(1)		breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						tcttggtgctgatggtagtct	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											210.0	177.0	188.0					11																	65792950		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.901C>G	11.37:g.65792950G>C	ENSP00000309052:p.Gln301Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96P76	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.Q301E	ENST00000312106.5	37	c.901	CCDS8127.1	11	.	.	.	.	.	.	.	.	.	.	G	1.228	-0.624981	0.03636	.	.	ENSG00000175294	ENST00000312106	D	0.96685	-4.09	2.92	-1.89	0.07689	.	2.532300	0.02176	N	0.060087	D	0.91185	0.7223	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.82279	-0.0536	10	0.02654	T	1	0.3747	2.3691	0.04326	0.1227:0.3109:0.4064:0.1601	.	301	Q8NEC5	CTSR1_HUMAN	E	301	ENSP00000309052:Q301E	ENSP00000309052:Q301E	Q	-	1	0	CATSPER1	65549526	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	0.026000	0.13599	-0.374000	0.07967	0.184000	0.17185	CAG	CATSPER1	-	NULL	ENSG00000175294		0.592	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	HGNC	protein_coding	OTTHUMT00000391055.1	724	0.00	0	G	NM_053054		65792950	65792950	-1	no_errors	ENST00000312106	ensembl	human	known	69_37n	missense	520	31.58	240	SNP	0.000	C
CDK5RAP2	55755	genome.wustl.edu	37	9	123201946	123201946	+	Silent	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr9:123201946T>C	ENST00000349780.4	-	24	3632	c.3453A>G	c.(3451-3453)gaA>gaG	p.E1151E	CDK5RAP2_ENST00000360190.4_Silent_p.E1151E|CDK5RAP2_ENST00000360822.3_Silent_p.E1119E|CDK5RAP2_ENST00000359309.3_Silent_p.E1110E	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1151	Interaction with MAPRE1.				brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)	p.E1151E(1)		breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CCTGGGCCCCTTCTGTCCCAC	0.463											OREG0019438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											92.0	87.0	89.0					9																	123201946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3453A>G	9.37:g.123201946T>C		Somatic	1524	WXS	Illumina GAIIx	Phase_IV	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	pfam_Spindle_assoc	p.E1151	ENST00000349780.4	37	c.3453	CCDS6823.1	9																																																																																			CDK5RAP2	-	NULL	ENSG00000136861		0.463	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	321	0.00	0	T	NM_018249		123201946	123201946	-1	no_errors	ENST00000349780	ensembl	human	known	69_37n	silent	150	47.55	136	SNP	0.998	C
CEP68	23177	genome.wustl.edu	37	2	65299440	65299440	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:65299440C>G	ENST00000377990.2	+	3	1413	c.1210C>G	c.(1210-1212)Cca>Gca	p.P404A	RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000260569.4_Missense_Mutation_p.P404A|CEP68_ENST00000546106.1_Missense_Mutation_p.P404A|CEP68_ENST00000497039.1_3'UTR|CEP68_ENST00000537589.1_Missense_Mutation_p.P16A	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	404					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.P404A(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						CCCCAGAGCCCCAGGCAGTAG	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	66.0	67.0					2																	65299440		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1210C>G	2.37:g.65299440C>G	ENSP00000367229:p.Pro404Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	NULL	p.P404A	ENST00000377990.2	37	c.1210	CCDS1880.2	2	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924235	0.34002	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000537589;ENST00000260569;ENST00000545501	T;T;T;T	0.24350	2.56;2.54;1.86;2.54	5.38	-0.291	0.12843	.	0.854162	0.10554	N	0.661111	T	0.21674	0.0522	M	0.72118	2.19	0.30631	N	0.757445	B;B;B;B;B	0.28350	0.004;0.004;0.01;0.208;0.019	B;B;B;B;B	0.22152	0.015;0.015;0.006;0.038;0.018	T	0.34700	-0.9818	10	0.56958	D	0.05	-0.3352	0.9329	0.01339	0.1483:0.3249:0.1704:0.3564	.	392;404;404;404;404	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	A	404;404;16;404;392	ENSP00000367229:P404A;ENSP00000438306:P404A;ENSP00000443357:P16A;ENSP00000260569:P404A	ENSP00000260569:P404A	P	+	1	0	CEP68	65152944	0.000000	0.05858	0.379000	0.26080	0.912000	0.54170	-0.382000	0.07408	-0.040000	0.13580	0.591000	0.81541	CCA	CEP68	-	NULL	ENSG00000011523		0.607	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP68	HGNC	protein_coding	OTTHUMT00000251727.2	88	0.00	0	C	NM_015147		65299440	65299440	+1	no_errors	ENST00000377990	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.423	G
CHGB	1114	genome.wustl.edu	37	20	5904091	5904091	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr20:5904091C>A	ENST00000378961.4	+	4	1505	c.1301C>A	c.(1300-1302)aCc>aAc	p.T434N		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	434						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)	p.T434N(1)		breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						ATGTCTGACACCAGAGAAGAG	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	90.0	90.0					20																	5904091		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1301C>A	20.37:g.5904091C>A	ENSP00000368244:p.Thr434Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.T434N	ENST00000378961.4	37	c.1301	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.472060	0.01044	.	.	ENSG00000089199	ENST00000378961	T	0.01685	4.69	4.88	-3.72	0.04411	.	3.198470	0.00721	N	0.000898	T	0.00875	0.0029	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47420	-0.9119	10	0.18276	T	0.48	0.8897	3.8681	0.09025	0.1947:0.1937:0.4672:0.1444	.	434	P05060	SCG1_HUMAN	N	434	ENSP00000368244:T434N	ENSP00000368244:T434N	T	+	2	0	CHGB	5852091	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-0.541000	0.06099	-0.200000	0.10300	0.655000	0.94253	ACC	CHGB	-	pfam_Granin	ENSG00000089199		0.547	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	HGNC	protein_coding	OTTHUMT00000077897.2	132	0.00	0	C	NM_001819		5904091	5904091	+1	no_errors	ENST00000378961	ensembl	human	known	69_37n	missense	76	39.68	50	SNP	0.000	A
CLDN17	26285	genome.wustl.edu	37	21	31538837	31538837	+	Silent	SNP	T	T	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr21:31538837T>A	ENST00000286808.3	-	1	134	c.99A>T	c.(97-99)tcA>tcT	p.S33S		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	33					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.S33S(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						CAACAAAAGCTGATACTCTCC	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											69.0	71.0	70.0					21																	31538837		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.99A>T	21.37:g.31538837T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJB5|Q6UY37	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin14,prints_Claudin8	p.S33	ENST00000286808.3	37	c.99	CCDS13586.1	21																																																																																			CLDN17	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin14	ENSG00000156282		0.507	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN17	HGNC	protein_coding	OTTHUMT00000182261.1	130	0.00	0	T	NM_012131		31538837	31538837	-1	no_errors	ENST00000286808	ensembl	human	known	69_37n	silent	111	20.14	28	SNP	0.219	A
COL5A3	50509	genome.wustl.edu	37	19	10088137	10088137	+	Silent	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:10088137G>A	ENST00000264828.3	-	43	3223	c.3138C>T	c.(3136-3138)ggC>ggT	p.G1046G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1046	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.G1046G(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGCCAGGGGGGCCACGTTCTC	0.657																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											40.0	49.0	46.0					19																	10088137		2200	4298	6498	-	-	-	SO:0001819	synonymous_variant	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3138C>T	19.37:g.10088137G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ6	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.G1046	ENST00000264828.3	37	c.3138	CCDS12222.1	19																																																																																			COL5A3	-	NULL	ENSG00000080573		0.657	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	128	0.00	0	G	NM_015719		10088137	10088137	-1	no_errors	ENST00000264828	ensembl	human	known	69_37n	silent	51	26.09	18	SNP	0.000	A
CPAMD8	27151	genome.wustl.edu	37	19	17057997	17057997	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:17057997A>T	ENST00000443236.1	-	21	2721	c.2690T>A	c.(2689-2691)gTt>gAt	p.V897D		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	850						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V897D(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						AGGATGCCCAACAAACTGGAT	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											166.0	165.0	166.0					19																	17057997		2058	4214	6272	-	-	-	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2690T>A	19.37:g.17057997A>T	ENSP00000402505:p.Val897Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.V897D	ENST00000443236.1	37	c.2690	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.56|14.56	2.573351|2.573351	0.45902|0.45902	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	3.46|3.46	3.46|3.46	0.39613|0.39613	.|.	.|0.202955	.|0.33309	.|N	.|0.005053	T|T	0.64583|0.64583	0.2611|0.2611	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|P	.|0.57548	.|0.823	T|T	0.62282|0.62282	-0.6887|-0.6887	5|9	.|0.14656	.|T	.|0.56	.|.	11.9823|11.9823	0.53127|0.53127	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|850	.|Q8IZJ3	.|CPMD8_HUMAN	M|D	908|897	.|.	.|ENSP00000291440:V897D	L|V	-|-	1|2	2|0	CPAMD8|CPAMD8	16918997|16918997	1.000000|1.000000	0.71417|0.71417	0.046000|0.046000	0.18839|0.18839	0.991000|0.991000	0.79684|0.79684	5.856000|5.856000	0.69518|0.69518	1.239000|1.239000	0.43787|0.43787	0.402000|0.402000	0.26972|0.26972	TTG|GTT	CPAMD8	-	NULL	ENSG00000160111		0.607	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	151	0.00	0	A	NM_015692		17057997	17057997	-1	no_errors	ENST00000291440	ensembl	human	known	69_37n	missense	50	56.41	66	SNP	0.998	T
CPED1	79974	genome.wustl.edu	37	7	120737791	120737791	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr7:120737791C>A	ENST00000310396.5	+	6	1122	c.655C>A	c.(655-657)Cag>Aag	p.Q219K	CPED1_ENST00000423795.1_5'UTR|CPED1_ENST00000450913.2_Missense_Mutation_p.Q219K	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	219						endoplasmic reticulum (GO:0005783)		p.Q219K(1)									GTGTCTGGATCAGGGAATGCA	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	150.0	151.0					7																	120737791		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.655C>A	7.37:g.120737791C>A	ENSP00000309772:p.Gln219Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.Q219K	ENST00000310396.5	37	c.655	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450688	0.43531	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913	T;T;T	0.55413	0.52;0.52;0.52	5.49	4.56	0.56223	.	0.816439	0.11335	N	0.574595	T	0.52468	0.1736	M	0.72118	2.19	0.38571	D	0.949943	B;B	0.30406	0.206;0.278	B;B	0.28011	0.085;0.057	T	0.51841	-0.8654	10	0.30078	T	0.28	-11.5035	13.0951	0.59187	0.0:0.8244:0.1756:0.0	.	219;219	A4D0V7-2;A4D0V7	.;CG058_HUMAN	K	219	ENSP00000309772:Q219K;ENSP00000398082:Q219K;ENSP00000406122:Q219K	ENSP00000309772:Q219K	Q	+	1	0	C7orf58	120525027	1.000000	0.71417	0.781000	0.31783	0.605000	0.37080	2.673000	0.46858	2.561000	0.86390	0.557000	0.71058	CAG	CPED1	-	NULL	ENSG00000106034		0.448	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	181	0.00	0	C	NM_024913		120737791	120737791	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	missense	106	36.14	60	SNP	0.590	A
DIS3L	115752	genome.wustl.edu	37	15	66587367	66587367	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr15:66587367C>G	ENST00000319212.4	+	2	231	c.181C>G	c.(181-183)Cca>Gca	p.P61A	DIS3L_ENST00000319194.5_5'UTR|RP11-653J6.1_ENST00000564269.1_RNA|DIS3L_ENST00000441424.2_5'UTR	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	61					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.P61A(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TTACGTGATCCCAGACTGGAA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											228.0	188.0	200.0					15																	66587367		690	1590	2280	-	-	-	SO:0001583	missense	0				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.181C>G	15.37:g.66587367C>G	ENSP00000321711:p.Pro61Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.P61A	ENST00000319212.4	37	c.181	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	C	19.91	3.915041	0.72983	.	.	ENSG00000166938	ENST00000319212	T	0.26810	1.71	5.17	5.17	0.71159	.	.	.	.	.	T	0.54743	0.1877	M	0.85197	2.74	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.66084	0.941;0.938	T	0.59306	-0.7479	9	0.45353	T	0.12	-0.0117	17.6819	0.88246	0.0:1.0:0.0:0.0	.	61;61	Q8TF46;Q8TF46-3	DI3L1_HUMAN;.	A	61	ENSP00000321711:P61A	ENSP00000321711:P61A	P	+	1	0	DIS3L	64374421	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	6.961000	0.76042	2.403000	0.81681	0.655000	0.94253	CCA	DIS3L	-	NULL	ENSG00000166938		0.368	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2	138	0.00	0	C	NM_133375		66587367	66587367	+1	no_errors	ENST00000319212	ensembl	human	known	69_37n	missense	63	16.00	12	SNP	1.000	G
DNAH12	201625	genome.wustl.edu	37	3	57343879	57343879	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr3:57343879G>C	ENST00000351747.2	-	53	8476	c.8296C>G	c.(8296-8298)Ctt>Gtt	p.L2766V	DNAH12_ENST00000344804.4_Missense_Mutation_p.L353V	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2766	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L2766V(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GTAAATGGAAGTTTCTACCAG	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)																																								-	-	-	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.8296C>G	3.37:g.57343879G>C	ENSP00000295937:p.Leu2766Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L2766V	ENST00000351747.2	37	c.8296		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.0|26.0	4.692503|4.692503	0.88735|0.88735	.|.	.|.	ENSG00000174844|ENSG00000174844	ENST00000351747;ENST00000466540;ENST00000344804|ENST00000462199	T;T;T|.	0.20738|.	2.05;2.05;2.05|.	5.92|5.92	5.92|5.92	0.95590|0.95590	Dynein heavy chain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84906|0.84906	0.5576|0.5576	M|M	0.89214|0.89214	3.015|3.015	0.40915|0.40915	D|D	0.984267|0.984267	P;D|.	0.58620|.	0.817;0.983|.	P;D|.	0.64410|.	0.596;0.925|.	D|D	0.86690|0.86690	0.1922|0.1922	10|5	0.87932|.	D|.	0|.	.|.	19.2962|19.2962	0.94122|0.94122	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	353;2766|.	Q6ZR08-2;Q6ZR08|.	.;DYH12_HUMAN|.	V|S	2766;411;353|456	ENSP00000295937:L2766V;ENSP00000420359:L411V;ENSP00000340464:L353V|.	ENSP00000340464:L353V|.	L|T	-|-	1|2	0|0	DNAH12|DNAH12	57318919|57318919	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	9.651000|9.651000	0.98493|0.98493	2.795000|2.795000	0.96236|0.96236	0.655000|0.655000	0.94253|0.94253	CTT|ACT	DNAH12	-	pfam_Dynein_heavy	ENSG00000174844		0.388	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		63	0.00	0	G	NM_178504		57343879	57343879	-1	no_errors	ENST00000351747	ensembl	human	known	69_37n	missense	67	28.72	27	SNP	1.000	C
DNAJC27	51277	genome.wustl.edu	37	2	25174424	25174424	+	Splice_Site	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:25174424C>G	ENST00000264711.2	-	6	718		c.e6-1		DNAJC27_ENST00000534855.1_Splice_Site	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27						small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)	p.?(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						TATAAAAGGTCTACAAGAAGA	0.358																																						dbGAP											1	Unknown(1)	breast(1)											54.0	56.0	55.0					2																	25174424		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.529-1G>C	2.37:g.25174424C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JV88|Q86Y24	Splice_Site	SNP	-	e6-1	ENST00000264711.2	37	c.529-1	CCDS1716.1	2	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687039	0.88639	.	.	ENSG00000115137	ENST00000264711;ENST00000534855	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9006	0.92440	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAJC27	25027928	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.626000	0.83164	2.805000	0.96524	0.655000	0.94253	.	DNAJC27	-	-	ENSG00000115137		0.358	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC27	HGNC	protein_coding	OTTHUMT00000246855.3	98	0.00	0	C	NM_016544	Intron	25174424	25174424	-1	no_errors	ENST00000264711	ensembl	human	known	69_37n	splice_site	58	28.40	23	SNP	1.000	G
ERG	2078	genome.wustl.edu	37	21	39817428	39817428	+	Silent	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr21:39817428G>C	ENST00000417133.2	-	4	341	c.156C>G	c.(154-156)tcC>tcG	p.S52S	ERG_ENST00000398897.1_Intron|ERG_ENST00000398907.1_Silent_p.S45S|ERG_ENST00000398910.1_Silent_p.S52S|ERG_ENST00000288319.7_Silent_p.S45S|ERG_ENST00000429727.2_Silent_p.S45S|ERG_ENST00000398905.1_Silent_p.S45S|ERG_ENST00000442448.1_Silent_p.S52S|ERG_ENST00000398911.1_Silent_p.S52S|ERG_ENST00000453032.2_Intron|ERG_ENST00000398919.2_Silent_p.S52S	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.S52S(1)	EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GGCTCATCTTGGAAGTCTGTC	0.557			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)	dbGAP		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	1	Substitution - coding silent(1)	breast(1)											118.0	92.0	101.0					21																	39817428		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.156C>G	21.37:g.39817428G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,prints_Ets,pfscan_Ets	p.S52	ENST00000417133.2	37	c.156	CCDS46648.1	21																																																																																			ERG	-	NULL	ENSG00000157554		0.557	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ERG	HGNC	protein_coding	OTTHUMT00000207532.2	124	0.00	0	G	NM_182918		39817428	39817428	-1	no_errors	ENST00000398919	ensembl	human	known	69_37n	silent	90	18.18	20	SNP	1.000	C
ERN2	10595	genome.wustl.edu	37	16	23706244	23706244	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr16:23706244G>T	ENST00000457008.2	-	16	1787	c.1749C>A	c.(1747-1749)caC>caA	p.H583Q	ERN2_ENST00000256797.4_Missense_Mutation_p.H683Q					endoplasmic reticulum to nucleus signaling 2									p.H683Q(1)		large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TCAGGTCCCGGTGCACTGTGG	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	54.0	53.0					16																	23706244		2197	4300	6497	-	-	-	SO:0001583	missense	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1749C>A	16.37:g.23706244G>T	ENSP00000413812:p.His583Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_cat_dom	p.H683Q	ENST00000457008.2	37	c.2049		16	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709239	0.68615	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.79554	-1.28;-1.28	5.39	4.43	0.53597	.	0.000000	0.85682	D	0.000000	D	0.93946	0.8062	H	0.99379	4.54	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95386	0.8477	10	0.87932	D	0	.	12.2692	0.54695	0.0831:0.0:0.9169:0.0	.	583;635	E7ETG2;A5YM65	.;.	Q	683;583	ENSP00000256797:H683Q;ENSP00000413812:H583Q	ENSP00000256797:H683Q	H	-	3	2	ERN2	23613745	1.000000	0.71417	0.999000	0.59377	0.722000	0.41435	2.200000	0.42724	1.404000	0.46819	0.655000	0.94253	CAC	ERN2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000134398		0.622	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1	160	0.00	0	G			23706244	23706244	-1	no_errors	ENST00000256797	ensembl	human	known	69_37n	missense	53	30.26	23	SNP	1.000	T
F8	2157	genome.wustl.edu	37	X	154091404	154091404	+	Silent	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:154091404G>A	ENST00000360256.4	-	23	6728	c.6528C>T	c.(6526-6528)agC>agT	p.S2176S	F8_ENST00000330287.6_Silent_p.S41S	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2176	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.S2176S(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TGCTGCGAATGCTATAATGAG	0.428																																						dbGAP											2	Substitution - coding silent(2)	breast(2)	GRCh37	CM053870	F8	M							180.0	150.0	160.0					X																	154091404		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6528C>T	X.37:g.154091404G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14286|Q5HY69	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S2176	ENST00000360256.4	37	c.6528	CCDS35457.1	X																																																																																			F8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000185010		0.428	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	180	0.00	0	G			154091404	154091404	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	silent	230	11.54	30	SNP	0.025	A
FAM161B	145483	genome.wustl.edu	37	14	74413296	74413297	+	Frame_Shift_Ins	INS	-	-	G	rs113301882	byFrequency	TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr14:74413296_74413297insG	ENST00000534936.1	-	2	171_172	c.66_67insC	c.(64-69)cccgagfs	p.E23fs	FAM161B_ENST00000286544.3_Frame_Shift_Ins_p.E86fs			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	23										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						GCGAAGGACTCGGGGGGAAATA	0.465																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.67dupC	14.37:g.74413302_74413302dupG	ENSP00000445326:p.Glu23fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z882|J3KNA2	Frame_Shift_Ins	INS	pfam_UPF0564	p.E85fs	ENST00000534936.1	37	c.256_255		14																																																																																			FAM161B	-	NULL	ENSG00000156050		0.465	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	FAM161B	HGNC	protein_coding		67	0.00	0	-	NM_152445		74413296	74413297	-1	no_errors	ENST00000286544	ensembl	human	known	69_37n	frame_shift_ins	21	16.00	4	INS	0.058:0.068	G
FAM186A	121006	genome.wustl.edu	37	12	50744938	50744938	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr12:50744938T>A	ENST00000327337.5	-	4	5676	c.5677A>T	c.(5677-5679)Act>Tct	p.T1893S	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.T1893S	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1893	Pro-rich.							p.T1893S(1)									TGCTCAGCAGTGGCAGGAGGC	0.572																																					NSCLC(138;1796 1887 12511 19463 37884)	dbGAP											1	Substitution - Missense(1)	breast(1)											43.0	55.0	51.0					12																	50744938		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.5677A>T	12.37:g.50744938T>A	ENSP00000329995:p.Thr1893Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.T1893S	ENST00000327337.5	37	c.5677	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	T	13.28	2.190828	0.38707	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.12569	2.68;2.67	3.97	-7.79	0.01218	.	.	.	.	.	T	0.03915	0.0110	N	0.08118	0	0.09310	N	1	B;B	0.25312	0.123;0.123	B;B	0.19666	0.026;0.026	T	0.39099	-0.9630	9	0.18710	T	0.47	.	1.296	0.02070	0.249:0.1935:0.3802:0.1774	.	1893;1893	F5GYN0;A6NE01	.;F186A_HUMAN	S	1893	ENSP00000441337:T1893S;ENSP00000329995:T1893S	ENSP00000329995:T1893S	T	-	1	0	FAM186A	49031205	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-1.673000	0.01951	-1.273000	0.02424	0.459000	0.35465	ACT	FAM186A	-	NULL	ENSG00000185958		0.572	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	114	0.00	0	T	XM_001718353		50744938	50744938	-1	no_errors	ENST00000327337	ensembl	human	known	69_37n	missense	74	39.52	49	SNP	0.000	A
FAM193A	8603	genome.wustl.edu	37	4	2648490	2648491	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr4:2648490_2648491insT	ENST00000324666.5	+	5	720_721	c.369_370insT	c.(370-372)gagfs	p.E124fs	FAM193A_ENST00000545951.1_Frame_Shift_Ins_p.E124fs|FAM193A_ENST00000505311.1_Frame_Shift_Ins_p.E124fs|FAM193A_ENST00000382839.3_Frame_Shift_Ins_p.E124fs|FAM193A_ENST00000502458.1_Frame_Shift_Ins_p.E124fs	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	124										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GTTCCGAGGAGGAGCTGCGCAG	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		Exception_encountered	4.37:g.2648490_2648491insT	ENSP00000324587:p.Glu124fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Frame_Shift_Ins	INS	NULL	p.E123fs	ENST00000324666.5	37	c.369_370	CCDS58875.1	4																																																																																			FAM193A	-	NULL	ENSG00000125386		0.619	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1	42	0.00	0	-	NM_003704		2648490	2648491	+1	no_errors	ENST00000324666	ensembl	human	known	69_37n	frame_shift_ins	19	38.71	12	INS	0.990:1.000	T
FAM193A	8603	genome.wustl.edu	37	4	2648493	2648494	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr4:2648493_2648494insC	ENST00000324666.5	+	5	723_724	c.372_373insC	c.(373-375)ctgfs	p.L125fs	FAM193A_ENST00000545951.1_Frame_Shift_Ins_p.L125fs|FAM193A_ENST00000505311.1_Frame_Shift_Ins_p.L125fs|FAM193A_ENST00000382839.3_Frame_Shift_Ins_p.L125fs|FAM193A_ENST00000502458.1_Frame_Shift_Ins_p.L125fs	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	125										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						CCGAGGAGGAGCTGCGCAGAGT	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.373dupC	4.37:g.2648494_2648494dupC	ENSP00000324587:p.Leu125fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Frame_Shift_Ins	INS	NULL	p.L124fs	ENST00000324666.5	37	c.372_373	CCDS58875.1	4																																																																																			FAM193A	-	NULL	ENSG00000125386		0.624	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1	41	0.00	0	-	NM_003704		2648493	2648494	+1	no_errors	ENST00000324666	ensembl	human	known	69_37n	frame_shift_ins	18	40.00	12	INS	1.000:1.000	C
FAM228A	653140	genome.wustl.edu	37	2	24406369	24406369	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:24406369C>T	ENST00000295150.3	+	5	342	c.256C>T	c.(256-258)Cga>Tga	p.R86*	RP11-507M3.1_ENST00000584973.1_3'UTR	NM_001040710.1	NP_001035800.1	Q86W67	F228A_HUMAN	family with sequence similarity 228, member A	86								p.R86*(1)									TGTAGGAAAACGACATTCCAT	0.413																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											69.0	63.0	65.0					2																	24406369		1859	4106	5965	-	-	-	SO:0001587	stop_gained	0				CCDS42659.1	2p23.3	2012-07-04	2012-07-04	2012-07-04	ENSG00000186453	ENSG00000186453			34418	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 84"""	C2orf84			Standard	NM_001040710		Approved	FLJ30851	uc002rfc.3	Q86W67	OTTHUMG00000151903	ENST00000295150.3:c.256C>T	2.37:g.24406369C>T	ENSP00000295150:p.Arg86*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.R86*	ENST00000295150.3	37	c.256	CCDS42659.1	2	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241297	0.58995	.	.	ENSG00000186453	ENST00000295150	.	.	.	4.47	-3.56	0.04626	.	1.974420	0.02451	N	0.085579	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-20.4739	0.5258	0.00620	0.3896:0.2244:0.1295:0.2565	.	.	.	.	X	86	.	ENSP00000295150:R86X	R	+	1	2	C2orf84	24259873	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	-2.355000	0.01088	-0.668000	0.05296	-0.266000	0.10368	CGA	FAM228A	-	NULL	ENSG00000186453		0.413	FAM228A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM228A	HGNC	protein_coding	OTTHUMT00000324342.1	205	0.00	0	C	NM_001040710		24406369	24406369	+1	no_errors	ENST00000295150	ensembl	human	known	69_37n	nonsense	128	20.00	32	SNP	0.001	T
FAM98A	25940	genome.wustl.edu	37	2	33810513	33810513	+	Splice_Site	DEL	T	T	-			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:33810513delT	ENST00000238823.8	-	8	1029		c.e8-2		FAM98A_ENST00000403368.1_3'UTR|FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000441530.2_Splice_Site			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A								poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					CATCAACACCTACAGAATAGG	0.433																																						dbGAP											1	Unknown(1)	breast(1)											30.0	30.0	30.0					2																	33810513		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.889-2A>-	2.37:g.33810513delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNA2|Q9Y3Y6	Splice_Site	DEL	-	e8-2	ENST00000238823.8	37	c.889-2	CCDS33179.1	2																																																																																			FAM98A	-	-	ENSG00000119812		0.433	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM98A	HGNC	protein_coding	OTTHUMT00000325457.2	90	0.00	0	T	NM_015475	Intron	33810513	33810513	-1	no_errors	ENST00000238823	ensembl	human	known	69_37n	splice_site_del	75	22.00	22	DEL	0.999	-
FLNC	2318	genome.wustl.edu	37	7	128482326	128482326	+	Missense_Mutation	SNP	C	C	A	rs370539335		TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr7:128482326C>A	ENST00000325888.8	+	14	2424	c.2163C>A	c.(2161-2163)aaC>aaA	p.N721K	FLNC_ENST00000346177.6_Missense_Mutation_p.N721K	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	721					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.N721K(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TGATCCCCAACGGCGACGGCA	0.612											OREG0018297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	65.0	61.0					7																	128482326		2152	4242	6394	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2163C>A	7.37:g.128482326C>A	ENSP00000327145:p.Asn721Lys	Somatic	1565	WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.N721K	ENST00000325888.8	37	c.2163	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284473	0.23392	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.86230	-2.09;-2.09	5.54	-11.1	0.00147	Immunoglobulin E-set (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.165964	0.51477	D	0.000088	T	0.75184	0.3815	L	0.38175	1.15	0.25473	N	0.987809	B;B	0.13145	0.003;0.007	B;B	0.19391	0.01;0.025	T	0.45279	-0.9272	10	0.20046	T	0.44	.	16.4357	0.83874	0.0:0.6328:0.0918:0.2755	.	721;721	Q14315-2;Q14315	.;FLNC_HUMAN	K	721	ENSP00000327145:N721K;ENSP00000344002:N721K	ENSP00000327145:N721K	N	+	3	2	FLNC	128269562	0.000000	0.05858	0.062000	0.19696	0.946000	0.59487	-5.972000	0.00087	-2.525000	0.00495	-0.781000	0.03364	AAC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.612	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	55	0.00	0	C			128482326	128482326	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	10	26.67	4	SNP	0.029	A
FRG1B	284802	genome.wustl.edu	37	20	29632707	29632707	+	Silent	SNP	G	G	A	rs6057187		TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr20:29632707G>A	ENST00000278882.3	+	8	902	c.522G>A	c.(520-522)gaG>gaA	p.E174E	FRG1B_ENST00000358464.4_Silent_p.E174E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	174								p.E174E(10)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTTTGCATGAGACGCTTCTGG	0.313																																						dbGAP											10	Substitution - coding silent(10)	endometrium(6)|kidney(4)																																								-	-	-	SO:0001819	synonymous_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.522G>A	20.37:g.29632707G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	Silent	SNP	pfam_FRG1,superfamily_Actin_cross-linking	p.E174	ENST00000278882.3	37	c.522		20																																																																																			FRG1B	-	pfam_FRG1	ENSG00000149531		0.313	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	31	0.00	0	G	NR_003579		29632707	29632707	+1	no_errors	ENST00000278882	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	1.000	A
GDPD1	284161	genome.wustl.edu	37	17	57352538	57352538	+	IGR	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:57352538G>A	ENST00000284116.4	+	0	1821				GDPD1_ENST00000581140.1_Silent_p.L283L	NM_182569.3	NP_872375.2	Q8N9F7	GDPD1_HUMAN	glycerophosphodiester phosphodiesterase domain containing 1						glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)	p.L283L(1)		endometrium(1)|kidney(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					GCAGCTATTTGGTAGTGTCTT	0.413																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											205.0	191.0	195.0					17																	57352538		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			AK094770	CCDS11616.1, CCDS58583.1, CCDS58584.1	17q23.2	2011-01-25				ENSG00000153982			20883	protein-coding gene	gene with protein product						14612981	Standard	NM_182569		Approved	FLJ37451, GDE4	uc002ixk.2	Q8N9F7			17.37:g.57352538G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8W735|Q56VR1|Q8N4E3	Silent	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.L283	ENST00000284116.4	37	c.849	CCDS11616.1	17																																																																																			GDPD1	-	NULL	ENSG00000153982		0.413	GDPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD1	HGNC	protein_coding	OTTHUMT00000446024.1	301	0.00	0	G	NM_182569		57352538	57352538	+1	no_errors	ENST00000581140	ensembl	human	known	69_37n	silent	346	10.08	39	SNP	0.003	A
GGA2	23062	genome.wustl.edu	37	16	23492053	23492053	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr16:23492053C>T	ENST00000309859.4	-	10	1001	c.919G>A	c.(919-921)Gtt>Att	p.V307I	GGA2_ENST00000569182.1_5'Flank|GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	307	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)	p.V307I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		TACAGCAGAACTCCTTGGGTG	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	92.0	95.0					16																	23492053		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.919G>A	16.37:g.23492053C>T	ENSP00000311962:p.Val307Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ENTH_VHS,superfamily_Coatomer/clathrin_app_Ig-like,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.V307I	ENST00000309859.4	37	c.919	CCDS10611.1	16	.	.	.	.	.	.	.	.	.	.	C	8.450	0.852935	0.17106	.	.	ENSG00000103365	ENST00000309859	T	0.48836	0.8	4.69	4.69	0.59074	GAT (2);	0.066609	0.64402	D	0.000014	T	0.43523	0.1251	N	0.17082	0.46	0.80722	D	1	D	0.65815	0.995	D	0.63033	0.91	T	0.24119	-1.0169	10	0.02654	T	1	-21.7429	13.299	0.60313	0.0:1.0:0.0:0.0	.	307	Q9UJY4	GGA2_HUMAN	I	307	ENSP00000311962:V307I	ENSP00000311962:V307I	V	-	1	0	GGA2	23399554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.673000	0.37534	2.568000	0.86640	0.655000	0.94253	GTT	GGA2	-	pfam_GAT,pfscan_GAT	ENSG00000103365		0.502	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA2	HGNC	protein_coding	OTTHUMT00000214019.1	114	0.00	0	C			23492053	23492053	-1	no_errors	ENST00000309859	ensembl	human	known	69_37n	missense	75	15.56	14	SNP	1.000	T
GOLGA6L2	283685	genome.wustl.edu	37	15	23685820	23685820	+	Missense_Mutation	SNP	G	G	T	rs199834625		TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr15:23685820G>T	ENST00000567107.1	-	8	1854	c.1802C>A	c.(1801-1803)gCa>gAa	p.A601E	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0								p.A601E(2)		breast(1)|endometrium(7)	8						tcctcctgctgccacatcttc	0.587																																						dbGAP											2	Substitution - Missense(2)	breast(2)																																								-	-	-	SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1802C>A	15.37:g.23685820G>T	ENSP00000454407:p.Ala601Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	Missense_Mutation	SNP	NULL	p.A601E	ENST00000567107.1	37	c.1802		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.587	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	10	0.00	0	G	NM_182561		23685820	23685820	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	missense	10	33.33	5	SNP	0.000	T
GPATCH8	23131	genome.wustl.edu	37	17	42477506	42477506	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:42477506G>T	ENST00000591680.1	-	8	1969	c.1939C>A	c.(1939-1941)Cct>Act	p.P647T	GPATCH8_ENST00000434000.1_Missense_Mutation_p.P569T	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	647							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P647T(1)		breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CTACCCCCAGGCTCCTGCTTG	0.542											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	50.0	50.0					17																	42477506		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.1939C>A	17.37:g.42477506G>T	ENSP00000467556:p.Pro647Thr	Somatic	909	WXS	Illumina GAIIx	Phase_IV	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_Znf_C2H2_jaz,smart_G_patch_dom,pfscan_Znf_C2H2,pfscan_G_patch_dom	p.P647T	ENST00000591680.1	37	c.1939	CCDS32666.1	17	.	.	.	.	.	.	.	.	.	.	G	11.28	1.591023	0.28357	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.11712	2.75	5.11	5.11	0.69529	.	0.178926	0.42053	D	0.000766	T	0.07413	0.0187	N	0.19112	0.55	0.33075	D	0.535831	B	0.30763	0.294	B	0.24974	0.057	T	0.11518	-1.0584	10	0.41790	T	0.15	-13.5016	12.1084	0.53825	0.0782:0.0:0.9218:0.0	.	647	Q9UKJ3	GPTC8_HUMAN	T	647;569	ENSP00000395016:P569T	ENSP00000335486:P647T	P	-	1	0	GPATCH8	39833032	0.960000	0.32886	1.000000	0.80357	0.866000	0.49608	1.469000	0.35343	2.669000	0.90835	0.491000	0.48974	CCT	GPATCH8	-	NULL	ENSG00000186566		0.542	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH8	HGNC	protein_coding	OTTHUMT00000457797.1	175	0.00	0	G	NM_001002909		42477506	42477506	-1	no_errors	ENST00000591680	ensembl	human	known	69_37n	missense	168	19.05	40	SNP	0.701	T
GPR61	83873	genome.wustl.edu	37	1	110086349	110086349	+	Silent	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:110086349C>G	ENST00000527748.1	+	2	1388	c.705C>G	c.(703-705)gcC>gcG	p.A235A	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.A235A(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		TCCGAGTGGCCCGCGTGGCTG	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											133.0	141.0	138.0					1																	110086349		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.705C>G	1.37:g.110086349C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A235	ENST00000527748.1	37	c.705	CCDS801.1	1																																																																																			GPR61	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000156097		0.602	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GPR61	HGNC	protein_coding	OTTHUMT00000385575.1	44	0.00	0	C			110086349	110086349	+1	no_errors	ENST00000404129	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	0.945	G
GPR161	23432	genome.wustl.edu	37	1	168066094	168066094	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:168066094T>C	ENST00000367838.1	-	5	1064	c.751A>G	c.(751-753)Agc>Ggc	p.S251G	GPR161_ENST00000361697.2_Missense_Mutation_p.S251G|GPR161_ENST00000539777.1_Missense_Mutation_p.S173G|GPR161_ENST00000271357.5_Missense_Mutation_p.S251G|GPR161_ENST00000367835.1_Missense_Mutation_p.S251G|GPR161_ENST00000367836.1_Missense_Mutation_p.S119G|GPR161_ENST00000537209.1_Missense_Mutation_p.S271G|GPR161_ENST00000546300.1_Missense_Mutation_p.S137G	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	251					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)	p.S251G(1)		breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					TTCCTCCTGCTGCCTGAAGAG	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	115.0	113.0					1																	168066094		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.751A>G	1.37:g.168066094T>C	ENSP00000356812:p.Ser251Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.S271G	ENST00000367838.1	37	c.811	CCDS1268.1	1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.454424	0.84209	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50701	0.1631	M	0.72353	2.195	0.42596	D	0.993269	D;D;D;D;D;D	0.76494	0.998;0.997;0.998;0.999;0.986;0.99	D;D;D;D;P;P	0.76071	0.957;0.948;0.987;0.977;0.775;0.891	T	0.54180	-0.8332	9	0.48119	T	0.1	-28.9186	15.5148	0.75815	0.0:0.0:0.0:1.0	.	271;137;173;271;251;251	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	G	251;251;119;251;137;173;271;251	ENSP00000356812:S251G;ENSP00000271357:S251G;ENSP00000356810:S119G;ENSP00000356809:S251G;ENSP00000444348:S137G;ENSP00000437576:S173G;ENSP00000441039:S271G;ENSP00000355194:S251G	ENSP00000271357:S251G	S	-	1	0	GPR161	166332718	1.000000	0.71417	0.991000	0.47740	0.964000	0.63967	7.854000	0.86942	2.207000	0.71202	0.459000	0.35465	AGC	GPR161	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000143147		0.602	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR161	HGNC	protein_coding	OTTHUMT00000083829.1	67	0.00	0	T	NM_007369		168066094	168066094	-1	no_errors	ENST00000537209	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	1.000	C
GRIA1	2890	genome.wustl.edu	37	5	153030053	153030053	+	Silent	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr5:153030053C>A	ENST00000285900.5	+	4	967	c.624C>A	c.(622-624)cgC>cgA	p.R208R	GRIA1_ENST00000448073.4_Silent_p.R218R|GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000518142.1_Silent_p.R128R|GRIA1_ENST00000518783.1_Silent_p.R218R|GRIA1_ENST00000521843.2_Silent_p.R139R|GRIA1_ENST00000340592.5_Silent_p.R208R	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	208					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.R208R(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	AATCAGAACGCCTCAATGCTA	0.527																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											87.0	79.0	82.0					5																	153030053		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.624C>A	5.37:g.153030053C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R218	ENST00000285900.5	37	c.654	CCDS4322.1	5																																																																																			GRIA1	-	pfam_ANF_lig-bd_rcpt	ENSG00000155511		0.527	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	306	0.00	0	C			153030053	153030053	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	silent	195	24.42	63	SNP	0.995	A
HELZ	9931	genome.wustl.edu	37	17	65105258	65105258	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:65105258G>A	ENST00000358691.5	-	29	4629	c.4463C>T	c.(4462-4464)tCg>tTg	p.S1488L	HELZ_ENST00000580168.1_Missense_Mutation_p.S1489L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1488						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S1488L(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AGGTAATCCCGAGGGGTTCTC	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	67.0	67.0					17																	65105258		1853	4096	5949	-	-	-	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.4463C>T	17.37:g.65105258G>A	ENSP00000351524:p.Ser1488Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	I6L9H4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S1488L	ENST00000358691.5	37	c.4463	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	G	8.251	0.809031	0.16537	.	.	ENSG00000198265	ENST00000358691	D	0.83250	-1.7	5.9	5.9	0.94986	.	0.706306	0.15115	N	0.279739	T	0.72803	0.3506	N	0.14661	0.345	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.12156	0.007;0.007	T	0.62946	-0.6746	10	0.48119	T	0.1	0.0065	15.0466	0.71833	0.0:0.0:0.858:0.142	.	1489;1488	B7ZLW2;P42694	.;HELZ_HUMAN	L	1488	ENSP00000351524:S1488L	ENSP00000351524:S1488L	S	-	2	0	HELZ	62535720	0.977000	0.34250	0.009000	0.14445	0.359000	0.29487	4.968000	0.63728	2.804000	0.96469	0.549000	0.68633	TCG	HELZ	-	NULL	ENSG00000198265		0.448	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1	103	0.00	0	G	NM_014877		65105258	65105258	-1	no_errors	ENST00000358691	ensembl	human	known	69_37n	missense	162	24.88	54	SNP	0.034	A
HIP1	3092	genome.wustl.edu	37	7	75174474	75174474	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr7:75174474G>C	ENST00000336926.6	-	26	2598	c.2572C>G	c.(2572-2574)Cct>Gct	p.P858A	HIP1_ENST00000434438.2_Missense_Mutation_p.P807A	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	858	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.P860A(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AACTCTTTAGGGGATGCTGTA	0.413			T	PDGFRB	CMML																																	dbGAP		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	1	Substitution - Missense(1)	breast(1)											111.0	115.0	114.0					7																	75174474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2572C>G	7.37:g.75174474G>C	ENSP00000336747:p.Pro858Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	pfam_ANTH,pfam_ILWEQ,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ,pfscan_Epsin-like_N,pfscan_ILWEQ	p.P858A	ENST00000336926.6	37	c.2572	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	g	6.697	0.497310	0.12762	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.28454	1.61;1.61	5.6	4.72	0.59763	I/LWEQ (4);	0.260319	0.45126	D	0.000395	T	0.13372	0.0324	N	0.04090	-0.28	0.40222	D	0.977749	B;B	0.09022	0.001;0.002	B;B	0.15052	0.007;0.012	T	0.09058	-1.0692	10	0.06625	T	0.88	-10.455	12.7825	0.57485	0.0791:0.0:0.9209:0.0	.	807;858	E7ES17;O00291	.;HIP1_HUMAN	A	858;807	ENSP00000336747:P858A;ENSP00000410300:P807A	ENSP00000336747:P858A	P	-	1	0	HIP1	75012410	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.555000	0.60767	1.372000	0.46190	0.655000	0.94253	CCT	HIP1	-	pfam_ILWEQ,smart_ILWEQ,pfscan_ILWEQ	ENSG00000127946		0.413	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2	98	0.00	0	G	NM_005338		75174474	75174474	-1	no_errors	ENST00000336926	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	1.000	C
HIVEP2	3097	genome.wustl.edu	37	6	143074259	143074259	+	Silent	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr6:143074259C>T	ENST00000367604.1	-	9	7965	c.7326G>A	c.(7324-7326)aaG>aaA	p.K2442K	RP1-67K17.3_ENST00000437067.1_RNA|HIVEP2_ENST00000367603.2_Silent_p.K2442K|HIVEP2_ENST00000012134.2_Silent_p.K2442K			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	2442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K2442K(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GTAGCTGACTCTTTTCTGATG	0.368																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	dbGAP											1	Substitution - coding silent(1)	breast(1)											184.0	177.0	179.0					6																	143074259		1954	4166	6120	-	-	-	SO:0001819	synonymous_variant	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.7326G>A	6.37:g.143074259C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q02646|Q5THT5|Q9NS05	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K2442	ENST00000367604.1	37	c.7326	CCDS43510.1	6																																																																																			HIVEP2	-	NULL	ENSG00000010818		0.368	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	154	0.00	0	C			143074259	143074259	-1	no_errors	ENST00000012134	ensembl	human	known	69_37n	silent	129	16.23	25	SNP	1.000	T
HPSE	10855	genome.wustl.edu	37	4	84227420	84227420	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr4:84227420A>T	ENST00000405413.2	-	10	1278	c.1142T>A	c.(1141-1143)aTg>aAg	p.M381K	HPSE_ENST00000513463.1_Missense_Mutation_p.M323K|HPSE_ENST00000512196.1_Intron|HPSE_ENST00000311412.5_Missense_Mutation_p.M381K	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	381					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)	p.M381K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	TACTTGCCTCATCACCACTTC	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											150.0	136.0	141.0					4																	84227420		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.1142T>A	4.37:g.84227420A>T	ENSP00000384262:p.Met381Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Missense_Mutation	SNP	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.M381K	ENST00000405413.2	37	c.1142	CCDS3602.1	4	.	.	.	.	.	.	.	.	.	.	A	25.1	4.600001	0.87055	.	.	ENSG00000173083	ENST00000311412;ENST00000405413;ENST00000454730;ENST00000513463	T;T;T	0.29397	1.57;1.57;1.57	5.08	5.08	0.68730	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.036403	0.85682	D	0.000000	T	0.51024	0.1650	M	0.82517	2.595	0.80722	D	1	D;D;D	0.65815	0.991;0.995;0.982	P;P;P	0.56163	0.626;0.793;0.626	T	0.53514	-0.8428	10	0.30854	T	0.27	-25.886	14.6684	0.68926	1.0:0.0:0.0:0.0	.	323;323;381	A9JIG7;E9PGR1;Q9Y251	.;.;HPSE_HUMAN	K	381;381;95;323	ENSP00000308107:M381K;ENSP00000384262:M381K;ENSP00000421365:M323K	ENSP00000308107:M381K	M	-	2	0	HPSE	84446444	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.074000	0.89500	2.130000	0.65690	0.402000	0.26972	ATG	HPSE	-	superfamily_Glycoside_hydrolase_SF	ENSG00000173083		0.433	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HPSE	HGNC	protein_coding	OTTHUMT00000252812.2	191	0.00	0	A	NM_006665		84227420	84227420	-1	no_errors	ENST00000311412	ensembl	human	known	69_37n	missense	105	24.46	34	SNP	1.000	T
IGSF5	150084	genome.wustl.edu	37	21	41142941	41142941	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr21:41142941G>T	ENST00000380588.4	+	4	620	c.517G>T	c.(517-519)Gat>Tat	p.D173Y	IGSF5_ENST00000479378.1_3'UTR	NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	173	Ig-like V-type 2.				single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.D173Y(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				CCGGCTCCCGGATATTTCCTG	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	64.0	65.0					21																	41142941		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.517G>T	21.37:g.41142941G>T	ENSP00000369962:p.Asp173Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.D173Y	ENST00000380588.4	37	c.517	CCDS33562.1	21	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171645	0.38315	.	.	ENSG00000183067	ENST00000380588	T	0.09073	3.02	5.17	-0.959	0.10343	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.090370	0.06775	N	0.784287	T	0.17195	0.0413	L	0.42245	1.32	0.09310	N	1	D	0.69078	0.997	P	0.62649	0.905	T	0.31251	-0.9950	10	0.62326	D	0.03	-6.0889	7.8941	0.29695	0.327:0.1063:0.5666:0.0	.	173	Q9NSI5	IGSF5_HUMAN	Y	173	ENSP00000369962:D173Y	ENSP00000369962:D173Y	D	+	1	0	IGSF5	40064811	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.209000	0.17435	-0.307000	0.08804	-1.761000	0.00669	GAT	IGSF5	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000183067		0.507	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IGSF5	HGNC	protein_coding	OTTHUMT00000195005.1	135	0.00	0	G			41142941	41142941	+1	no_errors	ENST00000380588	ensembl	human	novel	69_37n	missense	67	33.00	33	SNP	0.004	T
IL17B	27190	genome.wustl.edu	37	5	148756510	148756510	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr5:148756510G>A	ENST00000261796.3	-	2	150	c.100C>T	c.(100-102)Cgg>Tgg	p.R34W	IL17B_ENST00000505432.1_5'UTR|RP11-394O4.3_ENST00000521756.1_RNA	NM_014443.2	NP_055258.1	Q9UHF5	IL17B_HUMAN	interleukin 17B	34					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.R34W(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|urinary_tract(1)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCCAGGCCGCCCTTGCCCC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											43.0	46.0	45.0					5																	148756510		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF184969	CCDS4297.1	5q33.1	2011-07-14			ENSG00000127743	ENSG00000127743		"""Interleukins and interleukin receptors"""	5982	protein-coding gene	gene with protein product	"""neuronal interleukin-17-related factor"""	604627				10639155	Standard	NM_014443		Approved	IL-17B, ZCYTO7, IL-20, MGC138900, MGC138901, NIRF	uc003lqo.3	Q9UHF5	OTTHUMG00000130051	ENST00000261796.3:c.100C>T	5.37:g.148756510G>A	ENSP00000261796:p.Arg34Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CE5	Missense_Mutation	SNP	pfam_Interleukin-17,prints_Interleukin-17_chordata	p.R34W	ENST00000261796.3	37	c.100	CCDS4297.1	5	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051986	0.36181	.	.	ENSG00000127743	ENST00000261796	T	0.61980	0.06	5.24	1.84	0.25277	.	0.245049	0.28398	N	0.015493	T	0.54319	0.1851	L	0.29908	0.895	0.09310	N	1	D	0.60575	0.988	P	0.46339	0.513	T	0.56062	-0.8041	10	0.87932	D	0	-18.0062	15.1978	0.73108	0.0:0.0:0.526:0.474	.	34	Q9UHF5	IL17B_HUMAN	W	34	ENSP00000261796:R34W	ENSP00000261796:R34W	R	-	1	2	IL17B	148736703	0.000000	0.05858	0.542000	0.28115	0.331000	0.28603	0.292000	0.19011	0.646000	0.30693	0.561000	0.74099	CGG	IL17B	-	pfam_Interleukin-17	ENSG00000127743		0.617	IL17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17B	HGNC	protein_coding	OTTHUMT00000252330.1	32	0.00	0	G	NM_014443		148756510	148756510	-1	no_errors	ENST00000261796	ensembl	human	known	69_37n	missense	15	46.43	13	SNP	0.011	A
IQGAP3	128239	genome.wustl.edu	37	1	156502784	156502784	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:156502784C>T	ENST00000361170.2	-	32	4101	c.4091G>A	c.(4090-4092)aGc>aAc	p.S1364N		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1364					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.S1364N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGAAGCAGGCTACGGGTGTT	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											205.0	160.0	175.0					1																	156502784		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4091G>A	1.37:g.156502784C>T	ENSP00000354451:p.Ser1364Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.S1364N	ENST00000361170.2	37	c.4091	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	C	8.828	0.939273	0.18281	.	.	ENSG00000183856	ENST00000361170	T	0.51817	0.69	4.23	3.32	0.38043	.	0.259259	0.38837	N	0.001554	T	0.22044	0.0531	L	0.46885	1.475	0.28746	N	0.901687	D	0.53151	0.958	B	0.40066	0.318	T	0.03017	-1.1082	10	0.42905	T	0.14	-9.7104	11.0511	0.47889	0.0:0.9074:0.0:0.0926	.	1364	Q86VI3	IQGA3_HUMAN	N	1364	ENSP00000354451:S1364N	ENSP00000354451:S1364N	S	-	2	0	IQGAP3	154769408	1.000000	0.71417	0.810000	0.32431	0.100000	0.18952	2.223000	0.42936	1.136000	0.42199	0.462000	0.41574	AGC	IQGAP3	-	NULL	ENSG00000183856		0.572	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	463	0.00	0	C	NM_178229		156502784	156502784	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	missense	209	17.58	45	SNP	0.992	T
KCNH5	27133	genome.wustl.edu	37	14	63473181	63473181	+	Silent	SNP	A	A	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr14:63473181A>G	ENST00000322893.7	-	3	475	c.207T>C	c.(205-207)taT>taC	p.Y69Y	KCNH5_ENST00000394968.1_Silent_p.Y11Y|KCNH5_ENST00000394964.2_Silent_p.Y11Y|KCNH5_ENST00000420622.2_Silent_p.Y69Y	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	69	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.Y69Y(1)|p.Y11Y(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TCAATTCCCCATACATAAAAC	0.343																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											73.0	70.0	71.0					14																	63473181		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.207T>C	14.37:g.63473181A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JP98	Silent	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.Y69	ENST00000322893.7	37	c.207	CCDS9756.1	14																																																																																			KCNH5	-	pfam_PAS_fold,tigrfam_PAS	ENSG00000140015		0.343	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1	153	0.00	0	A	NM_139318		63473181	63473181	-1	no_errors	ENST00000322893	ensembl	human	known	69_37n	silent	185	14.35	31	SNP	1.000	G
KCNJ6	3763	genome.wustl.edu	37	21	39086885	39086886	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr21:39086885_39086886insGG	ENST00000609713.1	-	3	1163_1164	c.574_575insCC	c.(574-576)aaafs	p.K192fs	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Frame_Shift_Ins_p.K192fs	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	192					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	TTGAGAGATTTTTACAAACATG	0.48																																					Pancreas(48;379 1118 2936 19024 28214)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.574_575insCC	21.37:g.39086885_39086886insGG	ENSP00000477437:p.Lys192fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJ74|Q53WW6	Frame_Shift_Ins	INS	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir3.2	p.K192fs	ENST00000609713.1	37	c.575_574	CCDS42927.1	21																																																																																			KCNJ6	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000157542		0.480	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ6	HGNC	protein_coding	OTTHUMT00000194828.2	17	0.00	0	-	NM_002240		39086885	39086886	-1	no_errors	ENST00000288309	ensembl	human	known	69_37n	frame_shift_ins	33	56.00	42	INS	1.000:1.000	GG
LHFPL1	340596	genome.wustl.edu	37	X	111874827	111874827	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:111874827T>C	ENST00000371968.3	-	4	723	c.484A>G	c.(484-486)Acc>Gcc	p.T162A	LHFPL1_ENST00000536453.1_Missense_Mutation_p.T129A|LHFPL1_ENST00000478229.1_5'UTR	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	162						integral component of membrane (GO:0016021)		p.T162A(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						AGCCGACAGGTACCTGTGAGA	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											36.0	34.0	35.0					X																	111874827		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.484A>G	X.37:g.111874827T>C	ENSP00000361036:p.Thr162Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1N1|Q496M9|Q496N0|Q6UXU2	Missense_Mutation	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.T162A	ENST00000371968.3	37	c.484	CCDS14562.1	X	.	.	.	.	.	.	.	.	.	.	t	7.947	0.744027	0.15710	.	.	ENSG00000182508	ENST00000371968;ENST00000536453	T;T	0.71817	-0.56;-0.6	5.19	5.19	0.71726	.	0.163302	0.56097	D	0.000038	T	0.62527	0.2435	L	0.45581	1.43	0.44694	D	0.997686	B;P	0.36974	0.349;0.576	B;B	0.39805	0.123;0.31	T	0.58335	-0.7654	10	0.09590	T	0.72	-16.7102	11.8079	0.52165	0.0:0.0:0.0:1.0	.	129;162	Q86WI0-2;Q86WI0	.;LHPL1_HUMAN	A	162;129	ENSP00000361036:T162A;ENSP00000444573:T129A	ENSP00000361036:T162A	T	-	1	0	LHFPL1	111761483	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	5.413000	0.66399	1.917000	0.55516	0.483000	0.47432	ACC	LHFPL1	-	pfam_Lipome_HGMIC_fus_partner-like	ENSG00000182508		0.458	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL1	HGNC	protein_coding	OTTHUMT00000057947.1	83	0.00	0	T	NM_178175		111874827	111874827	-1	no_errors	ENST00000371968	ensembl	human	known	69_37n	missense	119	19.33	29	SNP	1.000	C
LONP2	83752	genome.wustl.edu	37	16	48295483	48295483	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr16:48295483T>G	ENST00000285737.4	+	5	965	c.872T>G	c.(871-873)gTc>gGc	p.V291G	LONP2_ENST00000535754.1_Missense_Mutation_p.V247G	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal									p.V291G(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						AAAGTCTGTGTCAAAGAGATA	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	95.0	95.0					16																	48295483		2200	4299	6499	-	-	-	SO:0001583	missense	0			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.872T>G	16.37:g.48295483T>G	ENSP00000285737:p.Val291Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Pept_S16_lon	p.V291G	ENST00000285737.4	37	c.872	CCDS10734.1	16	.	.	.	.	.	.	.	.	.	.	T	12.27	1.886560	0.33348	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	T;T	0.30981	1.52;1.51	5.88	4.79	0.61399	.	0.255590	0.39341	N	0.001395	T	0.24851	0.0603	L	0.39397	1.21	0.58432	D	0.999999	B;B	0.23735	0.09;0.09	B;B	0.20767	0.031;0.031	T	0.03423	-1.1038	10	0.25751	T	0.34	-16.0227	11.8451	0.52378	0.0:0.0681:0.0:0.9319	.	247;291	B7ZKL7;Q86WA8	.;LONP2_HUMAN	G	291;20;247;247	ENSP00000285737:V291G;ENSP00000445426:V247G	ENSP00000285737:V291G	V	+	2	0	LONP2	46852984	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.175000	0.65021	1.058000	0.40530	0.482000	0.46254	GTC	LONP2	-	tigrfam_Pept_S16_lon	ENSG00000102910		0.338	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP2	HGNC	protein_coding	OTTHUMT00000256839.2	137	0.00	0	T	NM_031490		48295483	48295483	+1	no_errors	ENST00000285737	ensembl	human	known	69_37n	missense	94	32.37	45	SNP	1.000	G
MADD	8567	genome.wustl.edu	37	11	47331104	47331104	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr11:47331104G>A	ENST00000311027.5	+	28	4264	c.4099G>A	c.(4099-4101)Gaa>Aaa	p.E1367K	MADD_ENST00000406482.1_Missense_Mutation_p.E1265K|MADD_ENST00000402192.2_Missense_Mutation_p.E1307K|MADD_ENST00000349238.3_Missense_Mutation_p.E1328K|MADD_ENST00000405573.2_Missense_Mutation_p.E177K|MADD_ENST00000402799.1_Missense_Mutation_p.E1265K|MADD_ENST00000407859.3_Missense_Mutation_p.E1285K|MADD_ENST00000395336.3_Missense_Mutation_p.E1367K|MADD_ENST00000342922.4_Missense_Mutation_p.E1308K|MADD_ENST00000395344.3_Missense_Mutation_p.E1261K	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.E1367K(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GGAAGATGATGAAGATCGCTT	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											169.0	148.0	155.0					11																	47331104		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4099G>A	11.37:g.47331104G>A	ENSP00000310933:p.Glu1367Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.E1367K	ENST00000311027.5	37	c.4099	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.183828	0.94885	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.70631	1.76;1.59;1.61;1.7;1.74;1.58;1.59;1.77;1.75;-0.5	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.83408	0.5248	M	0.67397	2.05	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.999;0.999;0.999;0.999;0.998;0.999;0.998;0.998	D;D;D;D;D;D;D;D;D;D;D	0.85130	0.997;0.993;0.993;0.997;0.997;0.997;0.997;0.996;0.996;0.993;0.996	D	0.85481	0.1179	10	0.87932	D	0	-15.2503	18.4016	0.90518	0.0:0.0:1.0:0.0	.	177;1261;1261;1367;1265;1265;1265;1328;1285;1367;1308	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	K	1308;1265;1265;1265;1328;1367;1285;1261;1367;1307;177	ENSP00000343902:E1308K;ENSP00000385585:E1265K;ENSP00000384435:E1265K;ENSP00000304505:E1328K;ENSP00000310933:E1367K;ENSP00000384204:E1285K;ENSP00000378753:E1261K;ENSP00000378745:E1367K;ENSP00000384287:E1307K;ENSP00000384483:E177K	ENSP00000310933:E1367K	E	+	1	0	MADD	47287680	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.471000	0.97696	2.327000	0.79052	0.563000	0.77884	GAA	MADD	-	NULL	ENSG00000110514		0.502	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	291	0.00	0	G			47331104	47331104	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	missense	228	18.79	53	SNP	1.000	A
MAP2	4133	genome.wustl.edu	37	2	210559945	210559945	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:210559945G>T	ENST00000360351.4	+	7	3557	c.3051G>T	c.(3049-3051)aaG>aaT	p.K1017N	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.K1013N|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1017					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.K1017N(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAGCAGAGAAGGGTCTTAGTT	0.418																																					Pancreas(27;423 979 28787 29963)	dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	96.0	96.0					2																	210559945		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3051G>T	2.37:g.210559945G>T	ENSP00000353508:p.Lys1017Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.K1017N	ENST00000360351.4	37	c.3051	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874672	0.33069	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25749	1.78;1.78	5.72	0.511	0.16989	MAP2/Tau projection (1);	0.259114	0.33670	N	0.004670	T	0.27731	0.0682	L	0.56769	1.78	0.23696	N	0.997085	P;P	0.51147	0.928;0.942	P;P	0.51079	0.526;0.658	T	0.06661	-1.0814	10	0.44086	T	0.13	-5.464	4.0613	0.09839	0.3713:0.2131:0.4156:0.0	.	1013;1017	P11137-3;P11137	.;MAP2_HUMAN	N	1017;1013	ENSP00000353508:K1017N;ENSP00000392164:K1013N	ENSP00000353508:K1017N	K	+	3	2	MAP2	210268190	0.087000	0.21565	0.990000	0.47175	0.121000	0.20230	0.597000	0.24059	0.455000	0.26910	-0.312000	0.09012	AAG	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.418	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	94	0.00	0	G	NM_001039538		210559945	210559945	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	0.428	T
MDGA2	161357	genome.wustl.edu	37	14	47530633	47530633	+	Silent	SNP	T	T	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr14:47530633T>A	ENST00000399232.2	-	7	1501	c.1137A>T	c.(1135-1137)ccA>ccT	p.P379P	MDGA2_ENST00000426342.1_Silent_p.P150P|MDGA2_ENST00000357362.3_Silent_p.P150P|MDGA2_ENST00000439988.3_Silent_p.P448P	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	379	Ig-like 4.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P150P(2)|p.P448P(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						AACTTCTTAATGGACGACCAT	0.408																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											144.0	129.0	134.0					14																	47530633		1884	4111	5995	-	-	-	SO:0001819	synonymous_variant	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1137A>T	14.37:g.47530633T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I154F	ENST00000399232.2	37	c.460		14	.	.	.	.	.	.	.	.	.	.	T	9.603	1.129134	0.21041	.	.	ENSG00000139915	ENST00000554762	.	.	.	5.86	-2.44	0.06502	.	.	.	.	.	T	0.40473	0.1118	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33599	-0.9862	4	.	.	.	.	2.9334	0.05807	0.1009:0.3463:0.1658:0.3871	.	.	.	.	F	154	.	.	I	-	1	0	MDGA2	46600383	0.056000	0.20664	0.992000	0.48379	0.997000	0.91878	-0.740000	0.04861	-0.063000	0.13065	0.533000	0.62120	ATT	MDGA2	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000139915		0.408	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	70	0.00	0	T	NM_182830		47530633	47530633	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000554762	ensembl	human	novel	69_37n	missense	36	59.09	52	SNP	0.572	A
METTL11B	149281	genome.wustl.edu	37	1	170136716	170136716	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:170136716G>T	ENST00000439373.2	+	4	777	c.670G>T	c.(670-672)Gtg>Ttg	p.V224L		NM_001136107.1	NP_001129579.1	Q5VVY1	NTM1B_HUMAN	methyltransferase like 11B	224						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)	p.V224L(1)		NS(1)|breast(2)|endometrium(3)|prostate(2)	8						GAAGGACAATGTGGCCCGGGA	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	61.0	64.0					1																	170136716		692	1591	2283	-	-	-	SO:0001583	missense	0			AL445203, CAH72139	CCDS44275.1	1q24.2	2012-11-05	2008-06-11	2008-06-11	ENSG00000203740	ENSG00000203740			31932	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 184"""	C1orf184			Standard	NM_001136107		Approved	HOMT1B	uc009wvv.1	Q5VVY1	OTTHUMG00000035959	ENST00000439373.2:c.670G>T	1.37:g.170136716G>T	ENSP00000408058:p.Val224Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXI0	Missense_Mutation	SNP	pfam_DUF858_MeTrfase_lik,pfam_Methyltransf_11,pirsf_DUF858_MeTrfase_lik	p.V224L	ENST00000439373.2	37	c.670	CCDS44275.1	1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530655	0.64860	.	.	ENSG00000203740	ENST00000439373	T	0.13901	2.55	5.16	5.16	0.70880	.	0.096387	0.64402	D	0.000001	T	0.07818	0.0196	L	0.37697	1.125	0.43647	D	0.996051	P	0.35551	0.509	B	0.37091	0.241	T	0.21177	-1.0253	10	0.31617	T	0.26	-22.3765	18.6157	0.91302	0.0:0.0:1.0:0.0	.	224	Q5VVY1	NTM1B_HUMAN	L	224	ENSP00000408058:V224L	ENSP00000408058:V224L	V	+	1	0	METTL11B	168403340	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	7.337000	0.79256	2.569000	0.86673	0.650000	0.86243	GTG	METTL11B	-	pfam_DUF858_MeTrfase_lik,pirsf_DUF858_MeTrfase_lik	ENSG00000203740		0.527	METTL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL11B	HGNC	protein_coding	OTTHUMT00000087586.2	79	0.00	0	G	NM_001136107		170136716	170136716	+1	no_errors	ENST00000439373	ensembl	human	known	69_37n	missense	141	14.55	24	SNP	1.000	T
METTL13	51603	genome.wustl.edu	37	1	171763540	171763540	+	Silent	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:171763540G>A	ENST00000361735.3	+	7	1964	c.1698G>A	c.(1696-1698)cgG>cgA	p.R566R	METTL13_ENST00000367737.5_Silent_p.R410R|METTL13_ENST00000466643.1_3'UTR|METTL13_ENST00000362019.3_Silent_p.R480R|METTL13_ENST00000458517.1_Silent_p.R565R	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	566							methyltransferase activity (GO:0008168)	p.R566R(1)		breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						TCCCAGCACGGCCTTGCTACG	0.438																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											98.0	86.0	90.0					1																	171763540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1698G>A	1.37:g.171763540G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Silent	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.R566	ENST00000361735.3	37	c.1698	CCDS1299.1	1																																																																																			METTL13	-	pfam_Spermidine/spermine_synthase	ENSG00000010165		0.438	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5	185	0.54	1	G	NM_014955		171763540	171763540	+1	no_errors	ENST00000361735	ensembl	human	known	69_37n	silent	140	17.54	30	SNP	0.000	A
KMT2C	58508	genome.wustl.edu	37	7	151917808	151917808	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr7:151917808G>C	ENST00000262189.6	-	23	3730	c.3512C>G	c.(3511-3513)aCt>aGt	p.T1171S	KMT2C_ENST00000355193.2_Missense_Mutation_p.T1171S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1171					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T1171S(2)									CTGGGTATAAGTCTTGGGTGG	0.378																																						dbGAP											2	Substitution - Missense(2)	breast(2)											39.0	38.0	39.0					7																	151917808		2202	4296	6498	-	-	-	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3512C>G	7.37:g.151917808G>C	ENSP00000262189:p.Thr1171Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.T1171S	ENST00000262189.6	37	c.3512	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343232	0.61073	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83992	-1.78;-1.79	4.54	4.54	0.55810	.	0.000000	0.44902	U	0.000416	D	0.88336	0.6409	L	0.54323	1.7	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.80764	0.97;0.994	D	0.85802	0.1374	10	0.22706	T	0.39	.	17.6308	0.88106	0.0:0.0:1.0:0.0	.	1171;232	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	S	1171	ENSP00000262189:T1171S;ENSP00000347325:T1171S	ENSP00000262189:T1171S	T	-	2	0	MLL3	151548741	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.351000	0.97073	2.209000	0.71365	0.484000	0.47621	ACT	MLL3	-	NULL	ENSG00000055609		0.378	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	107	0.00	0	G			151917808	151917808	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	missense	129	18.87	30	SNP	1.000	C
MOV10	4343	genome.wustl.edu	37	1	113239380	113239380	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:113239380G>A	ENST00000413052.2	+	14	2500	c.2110G>A	c.(2110-2112)Gag>Aag	p.E704K	RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000369644.1_Missense_Mutation_p.E648K|MOV10_ENST00000357443.2_Missense_Mutation_p.E704K|MOV10_ENST00000369645.1_Missense_Mutation_p.E704K|MOV10_ENST00000468624.1_3'UTR	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	704					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.E704K(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		CTCACTGCTGGAGCGGCTGCT	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	49.0	54.0					1																	113239380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.2110G>A	1.37:g.113239380G>A	ENSP00000399797:p.Glu704Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	NULL	p.E704K	ENST00000413052.2	37	c.2110	CCDS853.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.866088	0.97043	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000369644;ENST00000357443;ENST00000369648	D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97126	0.9061	M	0.87381	2.88	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.97334	0.9952	10	0.87932	D	0	-28.4552	19.4526	0.94873	0.0:0.0:1.0:0.0	.	704	Q9HCE1	MOV10_HUMAN	K	704;704;648;704;642	ENSP00000399797:E704K;ENSP00000358659:E704K;ENSP00000358658:E648K;ENSP00000350028:E704K	ENSP00000350028:E704K	E	+	1	0	MOV10	113040903	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.536000	0.98067	2.698000	0.92095	0.561000	0.74099	GAG	MOV10	-	NULL	ENSG00000155363		0.602	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1	296	0.00	0	G	NM_020963		113239380	113239380	+1	no_errors	ENST00000357443	ensembl	human	known	69_37n	missense	97	35.10	53	SNP	1.000	A
MRPL45	84311	genome.wustl.edu	37	17	36474595	36474595	+	Silent	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:36474595T>C	ENST00000312513.5	+	5	632	c.471T>C	c.(469-471)caT>caC	p.H157H		NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	157						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)	p.H157H(1)		breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GCTCAGACCATGACCGACTTC	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											197.0	182.0	187.0					17																	36474595		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.471T>C	17.37:g.36474595T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L436|Q6ZMJ5	Silent	SNP	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45	p.H157	ENST00000312513.5	37	c.471	CCDS11326.1	17																																																																																			MRPL45	-	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45	ENSG00000174100		0.403	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	MRPL45	HGNC	protein_coding	OTTHUMT00000256792.3	174	0.00	0	T	NM_032351		36474595	36474595	+1	no_errors	ENST00000312513	ensembl	human	known	69_37n	silent	129	14.00	21	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	9065990	9065990	+	Silent	SNP	A	A	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:9065990A>G	ENST00000397910.4	-	3	21659	c.21456T>C	c.(21454-21456)ccT>ccC	p.P7152P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7154	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P7152P(2)|p.P2785P(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCAGCTTTGGAGGTGAACTGG	0.507																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											193.0	177.0	182.0					19																	9065990		2080	4224	6304	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21456T>C	19.37:g.9065990A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.P7152	ENST00000397910.4	37	c.21456	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	588	0.00	0	A	NM_024690		9065990	9065990	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	508	29.07	209	SNP	0.000	G
MUC4	4585	genome.wustl.edu	37	3	195507242	195507242	+	Missense_Mutation	SNP	C	C	A	rs567957149|rs74187968	byFrequency	TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr3:195507242C>A	ENST00000463781.3	-	2	11668	c.11209G>T	c.(11209-11211)Gca>Tca	p.A3737S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3737S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCTGTGGATGCTGAGGAAGGG	0.572													.|||	53	0.0105831	0.0136	0.0086	5008	,	,		10241	0.0069		0.0139	False		,,,				2504	0.0082					dbGAP											0													35.0	34.0	34.0					3																	195507242		619	1580	2199	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11209G>T	3.37:g.195507242C>A	ENSP00000417498:p.Ala3737Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.A3737S	ENST00000463781.3	37	c.11209	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	c	2.940	-0.219185	0.06101	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.56;1.45	.	.	.	.	0.435754	0.11199	U	0.589055	T	0.12561	0.0305	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.26155	-1.0111	8	.	.	.	.	2.155	0.03810	0.0:0.332:0.3413:0.3266	.	3609	E7ESK3	.	S	3737	ENSP00000417498:A3737S;ENSP00000420243:A3737S	.	A	-	1	0	MUC4	196992021	0.000000	0.05858	0.005000	0.12908	0.022000	0.10575	-0.526000	0.06207	-0.927000	0.03766	0.064000	0.15345	GCA	MUC4	-	NULL	ENSG00000145113		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	11	0.00	0	C	NM_018406		195507242	195507242	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	0.018	A
MUC4	4585	genome.wustl.edu	37	3	195512103	195512103	+	Silent	SNP	G	G	A	rs437805	byFrequency	TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr3:195512103G>A	ENST00000463781.3	-	2	6807	c.6348C>T	c.(6346-6348)acC>acT	p.T2116T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2116T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGCATCGGTGTCATGAA	0.562																																						dbGAP											0													81.0	69.0	72.0					3																	195512103		691	1590	2281	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6348C>T	3.37:g.195512103G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T2116	ENST00000463781.3	37	c.6348	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	34	0.00	0	G	NM_018406		195512103	195512103	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	25	21.88	7	SNP	0.138	A
MYCN	4613	genome.wustl.edu	37	2	16086025	16086025	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:16086025T>A	ENST00000281043.3	+	3	1498	c.1201T>A	c.(1201-1203)Ttt>Att	p.F401I		NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	401	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F401I(1)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			TCGGTCCAGCTTTCTCACGCT	0.567			A		neuroblastoma																																	dbGAP		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	1	Substitution - Missense(1)	breast(1)											84.0	91.0	89.0					2																	16086025		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.1201T>A	2.37:g.16086025T>A	ENSP00000281043:p.Phe401Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XS5|Q6LDT9	Missense_Mutation	SNP	pfam_Tscrpt_reg_Myc_N,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd,prints_Tscrpt_reg_Myc	p.F401I	ENST00000281043.3	37	c.1201	CCDS1687.1	2	.	.	.	.	.	.	.	.	.	.	T	26.0	4.698766	0.88830	.	.	ENSG00000134323	ENST00000281043;ENST00000426211	D	0.91295	-2.82	5.14	5.14	0.70334	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.94863	0.8340	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95460	0.8542	10	0.87932	D	0	-21.5512	15.2756	0.73739	0.0:0.0:0.0:1.0	.	401	P04198	MYCN_HUMAN	I	401;319	ENSP00000281043:F401I	ENSP00000281043:F401I	F	+	1	0	MYCN	16003476	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.980000	0.88113	2.092000	0.63282	0.496000	0.49642	TTT	MYCN	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd,prints_Tscrpt_reg_Myc	ENSG00000134323		0.567	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYCN	HGNC	protein_coding	OTTHUMT00000095469.2	43	0.00	0	T	NM_005378		16086025	16086025	+1	no_errors	ENST00000281043	ensembl	human	known	69_37n	missense	14	48.15	13	SNP	1.000	A
MYH9	4627	genome.wustl.edu	37	22	36681952	36681952	+	Silent	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr22:36681952C>G	ENST00000216181.5	-	36	5339	c.5109G>C	c.(5107-5109)cgG>cgC	p.R1703R	MYH9_ENST00000475726.1_5'UTR	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1703					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.R1703R(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCAGCTCATCCCGCTCCTGCT	0.662			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - coding silent(1)	breast(1)											55.0	52.0	53.0					22																	36681952		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.5109G>C	22.37:g.36681952C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.R1703	ENST00000216181.5	37	c.5109	CCDS13927.1	22																																																																																			MYH9	-	pfam_Myosin_tail,superfamily_tRNA-bd_arm	ENSG00000100345		0.662	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	83	0.00	0	C	NM_002473		36681952	36681952	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	silent	25	41.86	18	SNP	1.000	G
NAV1	89796	genome.wustl.edu	37	1	201618306	201618306	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:201618306G>T	ENST00000367296.4	+	1	930	c.510G>T	c.(508-510)aaG>aaT	p.K170N	NAV1_ENST00000367302.1_Missense_Mutation_p.K183N|NAV1_ENST00000367297.4_Missense_Mutation_p.K170N|NAV1_ENST00000367300.3_Missense_Mutation_p.K170N|NAV1_ENST00000295624.6_Missense_Mutation_p.K170N	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	170					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.K170N(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						ACCTGGGAAAGCCGAGCCGGA	0.687																																						dbGAP											1	Substitution - Missense(1)	breast(1)																																								-	-	-	SO:0001583	missense	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.510G>T	1.37:g.201618306G>T	ENSP00000356265:p.Lys170Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	smart_AAA+_ATPase	p.K170N	ENST00000367296.4	37	c.510	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.680162	0.68042	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	4.74	3.78	0.43462	.	0.139403	0.46758	D	0.000279	T	0.50326	0.1609	L	0.47716	1.5	0.33673	D	0.61116	D	0.71674	0.998	D	0.68943	0.961	T	0.61917	-0.6964	10	0.72032	D	0.01	-19.026	5.51	0.16876	0.1242:0.2046:0.6712:0.0	.	170	Q8NEY1-3	.	N	183;170;170;170;170	ENSP00000356271:K183N;ENSP00000356265:K170N;ENSP00000295624:K170N;ENSP00000356266:K170N;ENSP00000356269:K170N	ENSP00000295624:K170N	K	+	3	2	NAV1	199884929	1.000000	0.71417	0.995000	0.50966	0.846000	0.48090	2.565000	0.45939	0.855000	0.35359	0.313000	0.20887	AAG	NAV1	-	NULL	ENSG00000134369		0.687	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	13	0.00	0	G	NM_020443		201618306	201618306	+1	no_errors	ENST00000367296	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	1.000	T
NCOR1	9611	genome.wustl.edu	37	17	15943800	15943800	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:15943800G>A	ENST00000268712.3	-	43	6945	c.6688C>T	c.(6688-6690)Cag>Tag	p.Q2230*	NCOR1_ENST00000395857.3_Nonsense_Mutation_p.Q814*|AC002553.1_ENST00000442828.1_Intron|NCOR1_ENST00000395851.1_Nonsense_Mutation_p.Q2127*	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2230	ID2. {ECO:0000250}.|Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.Q2230*(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTTCCTGGCTGAGCAGCTGCT	0.318																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											75.0	68.0	71.0					17																	15943800		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.6688C>T	17.37:g.15943800G>A	ENSP00000268712:p.Gln2230*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Nonsense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q2230*	ENST00000268712.3	37	c.6688	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460797	0.84317	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.1049	18.6919	0.91586	0.0:0.0:1.0:0.0	.	.	.	.	X	2230;2127;2134;814	.	ENSP00000268712:Q2230X	Q	-	1	0	NCOR1	15884525	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.756000	0.91651	2.655000	0.90218	0.655000	0.94253	CAG	NCOR1	-	NULL	ENSG00000141027		0.318	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	100	0.00	0	G	NM_006311		15943800	15943800	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	nonsense	31	54.29	38	SNP	1.000	A
NLRP9	338321	genome.wustl.edu	37	19	56244140	56244140	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:56244140T>C	ENST00000332836.2	-	2	1084	c.1057A>G	c.(1057-1059)Agg>Ggg	p.R353G		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	353	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.R353G(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TCTTCTCCCCTCTCTAGCCTC	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	104.0	105.0					19																	56244140		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1057A>G	19.37:g.56244140T>C	ENSP00000331857:p.Arg353Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN12|Q86W27	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R353G	ENST00000332836.2	37	c.1057	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	T	12.66	2.004656	0.35320	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	D	0.84070	-1.8	2.56	1.49	0.22878	.	.	.	.	.	T	0.81735	0.4885	L	0.48260	1.515	0.09310	N	1	D	0.52996	0.957	P	0.52823	0.71	T	0.69610	-0.5099	9	0.48119	T	0.1	.	7.081	0.25231	0.0:0.0:0.23:0.77	.	353	Q7RTR0	NALP9_HUMAN	G	353	ENSP00000331857:R353G	ENSP00000331857:R353G	R	-	1	2	NLRP9	60935952	0.000000	0.05858	0.005000	0.12908	0.012000	0.07955	-0.024000	0.12435	0.399000	0.25367	0.524000	0.50904	AGG	NLRP9	-	NULL	ENSG00000185792		0.408	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	156	0.00	0	T	NM_176820		56244140	56244140	-1	no_errors	ENST00000332836	ensembl	human	known	69_37n	missense	124	44.89	101	SNP	0.015	C
NMNAT2	23057	genome.wustl.edu	37	1	183255842	183255842	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:183255842delG	ENST00000287713.6	-	5	737	c.403delC	c.(403-405)cagfs	p.Q135fs	NMNAT2_ENST00000473046.1_5'UTR|NMNAT2_ENST00000294868.4_Frame_Shift_Del_p.Q130fs	NM_015039.3	NP_055854.1	Q9BZQ4	NMNA2_HUMAN	nicotinamide nucleotide adenylyltransferase 2	135					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|late endosome (GO:0005770)|synapse (GO:0045202)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	18						TAAATGGGCTGGGGGGTCTCG	0.542																																						dbGAP											0													164.0	150.0	155.0					1																	183255842		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF288395	CCDS1353.1, CCDS1354.1	1q25	2008-02-05	2003-04-30	2003-05-02	ENSG00000157064	ENSG00000157064			16789	protein-coding gene	gene with protein product		608701	"""chromosome 1 open reading frame 15"""	C1orf15		11318611, 12359228	Standard	NM_015039		Approved	KIAA0479, PNAT2	uc001gqc.2	Q9BZQ4	OTTHUMG00000035519	ENST00000287713.6:c.403delC	1.37:g.183255842delG	ENSP00000287713:p.Gln135fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75067|Q5T1Q3|Q8WU99|Q96QW1	Frame_Shift_Del	DEL	pfam_Cytidylyltransf	p.Q135fs	ENST00000287713.6	37	c.403	CCDS1353.1	1																																																																																			NMNAT2	-	pfam_Cytidylyltransf	ENSG00000157064		0.542	NMNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT2	HGNC	protein_coding	OTTHUMT00000086255.1	514	0.00	0	G			183255842	183255842	-1	no_errors	ENST00000287713	ensembl	human	known	69_37n	frame_shift_del	309	14.99	55	DEL	1.000	-
NPHS1	4868	genome.wustl.edu	37	19	36330494	36330494	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:36330494G>C	ENST00000378910.5	-	21	2830	c.2831C>G	c.(2830-2832)cCa>cGa	p.P944R	NPHS1_ENST00000353632.6_Missense_Mutation_p.P944R	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	944	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.P944R(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TAATCCTGATGGAGGGTCAGG	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	53.0	52.0					19																	36330494		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2831C>G	19.37:g.36330494G>C	ENSP00000368190:p.Pro944Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDH2|C3RX61	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P944R	ENST00000378910.5	37	c.2831	CCDS32996.1	19	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724125	0.48728	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	D;T	0.82619	-1.63;-1.38	5.3	5.3	0.74995	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93798	0.8017	H	0.95745	3.715	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.95422	0.8508	10	0.87932	D	0	-12.5076	16.4567	0.84019	0.0:0.0:1.0:0.0	.	944	O60500	NPHN_HUMAN	R	944	ENSP00000368190:P944R;ENSP00000343634:P944R	ENSP00000343634:P944R	P	-	2	0	NPHS1	41022334	1.000000	0.71417	0.256000	0.24389	0.268000	0.26511	7.308000	0.78929	2.496000	0.84212	0.585000	0.79938	CCA	NPHS1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000161270		0.527	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	239	0.00	0	G			36330494	36330494	-1	no_errors	ENST00000378910	ensembl	human	known	69_37n	missense	101	27.86	39	SNP	0.982	C
NTRK1	4914	genome.wustl.edu	37	1	156848984	156848984	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:156848984C>A	ENST00000524377.1	+	15	1917	c.1876C>A	c.(1876-1878)Cag>Aag	p.Q626K	NTRK1_ENST00000358660.3_Missense_Mutation_p.Q623K|NTRK1_ENST00000368196.3_Missense_Mutation_p.Q620K|NTRK1_ENST00000392302.2_Missense_Mutation_p.Q590K	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	626	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Q590K(1)|p.Q626K(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GGGTCTGGGGCAGCTGCTGGC	0.637			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																												dbGAP		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	2	Substitution - Missense(2)	breast(2)											26.0	28.0	27.0					1																	156848984		2202	4300	6502	-	-	-	SO:0001583	missense	0			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1876C>A	1.37:g.156848984C>A	ENSP00000431418:p.Gln626Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Cys-rich_flank_reg_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_neurotrophic_rcpt_1,prints_Tyr_kinase_NGF_rcpt	p.Q626K	ENST00000524377.1	37	c.1876	CCDS1161.1	1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.122724	0.77436	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	4.37	4.37	0.52481	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.297604	0.24590	N	0.037226	T	0.67163	0.2864	N	0.25825	0.765	0.80722	D	1	B;B;B;P	0.41475	0.318;0.026;0.042;0.751	B;B;B;B	0.38562	0.276;0.015;0.038;0.238	T	0.76102	-0.3082	10	0.72032	D	0.01	.	15.9854	0.80147	0.0:1.0:0.0:0.0	.	623;620;626;590	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	K	590;620;626;623	ENSP00000376120:Q590K;ENSP00000357179:Q620K;ENSP00000431418:Q626K;ENSP00000351486:Q623K	ENSP00000351486:Q623K	Q	+	1	0	NTRK1	155115608	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.860000	0.69546	2.432000	0.82394	0.561000	0.74099	CAG	NTRK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198400		0.637	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	HGNC	protein_coding	OTTHUMT00000392279.1	126	0.00	0	C	NM_002529		156848984	156848984	+1	no_errors	ENST00000524377	ensembl	human	known	69_37n	missense	107	15.62	20	SNP	1.000	A
NXF5	55998	genome.wustl.edu	37	X	101092628	101092628	+	Splice_Site	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:101092628T>C	ENST00000361708.2	-	15	1279		c.e15-2		NXF5_ENST00000537026.1_Splice_Site|NXF5_ENST00000473265.2_Splice_Site			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.?(2)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						TCTGCAGGTCTATAGAGAAGA	0.532																																						dbGAP											2	Unknown(2)	lung(1)|breast(1)											113.0	102.0	106.0					X																	101092628		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.920-2A>G	X.37:g.101092628T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Splice_Site	SNP	-	e13-2	ENST00000361708.2	37	c.920-2		X	.	.	.	.	.	.	.	.	.	.	t	9.415	1.081645	0.20309	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	.	.	.	2.33	2.33	0.28932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8827	0.29631	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NXF5	100979284	1.000000	0.71417	0.002000	0.10522	0.017000	0.09413	4.571000	0.60879	1.189000	0.43028	0.226000	0.17787	.	NXF5	-	-	ENSG00000126952		0.532	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		279	0.00	0	T		Intron	101092628	101092628	-1	no_errors	ENST00000263032	ensembl	human	known	69_37n	splice_site	118	44.60	95	SNP	0.446	C
OTOP2	92736	genome.wustl.edu	37	17	72927076	72927076	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:72927076C>G	ENST00000580223.1	+	5	1376	c.1346C>G	c.(1345-1347)aCc>aGc	p.T449S	OTOP2_ENST00000331427.4_Missense_Mutation_p.T449S			Q7RTS6	OTOP2_HUMAN	otopetrin 2	449						integral component of membrane (GO:0016021)		p.T449S(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					CTCACCTTCACCAACCTGGAT	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	83.0	89.0					17																	72927076		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1346C>G	17.37:g.72927076C>G	ENSP00000463837:p.Thr449Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Otopetrin	p.T449S	ENST00000580223.1	37	c.1346	CCDS11708.1	17	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361766	0.01235	.	.	ENSG00000183034	ENST00000331427	T	0.09073	3.02	5.28	3.25	0.37280	.	0.767498	0.12044	N	0.504767	T	0.03871	0.0109	N	0.08118	0	0.18873	N	0.999988	B	0.25390	0.125	B	0.28465	0.09	T	0.47849	-0.9085	10	0.10377	T	0.69	-5.3264	5.0959	0.14733	0.1636:0.6256:0.0:0.2108	.	449	Q7RTS6	OTOP2_HUMAN	S	449	ENSP00000332528:T449S	ENSP00000332528:T449S	T	+	2	0	OTOP2	70438671	0.027000	0.19231	0.797000	0.32132	0.038000	0.13279	0.694000	0.25512	0.581000	0.29539	0.462000	0.41574	ACC	OTOP2	-	NULL	ENSG00000183034		0.627	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1	77	0.00	0	C	NM_178160		72927076	72927076	+1	no_errors	ENST00000331427	ensembl	human	known	69_37n	missense	86	12.24	12	SNP	0.991	G
PKHD1	5314	genome.wustl.edu	37	6	51824744	51824744	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr6:51824744G>T	ENST00000371117.3	-	36	6107	c.5832C>A	c.(5830-5832)gaC>gaA	p.D1944E	PKHD1_ENST00000340994.4_Missense_Mutation_p.D1944E	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1944	G8 1. {ECO:0000255|PROSITE- ProRule:PRU00817}.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.D1944E(2)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTGTGACGTTGTCGCCATCTT	0.488											OREG0017492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											2	Substitution - Missense(2)	breast(2)											174.0	154.0	161.0					6																	51824744		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5832C>A	6.37:g.51824744G>T	ENSP00000360158:p.Asp1944Glu	Somatic	980	WXS	Illumina GAIIx	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.D1944E	ENST00000371117.3	37	c.5832	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770650	0.69992	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.89617	-2.54;-2.54	5.69	4.82	0.62117	G8 domain (2);	0.075641	0.53938	D	0.000052	D	0.88738	0.6518	L	0.52126	1.63	0.30750	N	0.745259	D;D	0.89917	0.998;1.0	D;D	0.75020	0.971;0.985	D	0.84982	0.0889	10	0.31617	T	0.26	.	13.529	0.61611	0.0743:0.0:0.9257:0.0	.	1944;1944	P08F94-2;P08F94	.;PKHD1_HUMAN	E	1944	ENSP00000360158:D1944E;ENSP00000341097:D1944E	ENSP00000341097:D1944E	D	-	3	2	PKHD1	51932703	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.246000	0.32803	1.405000	0.46838	0.655000	0.94253	GAC	PKHD1	-	pfam_G8_domain	ENSG00000170927		0.488	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	170	0.00	0	G	NM_138694		51824744	51824744	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	missense	179	18.26	40	SNP	1.000	T
PLCH1	23007	genome.wustl.edu	37	3	155212270	155212270	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr3:155212270C>G	ENST00000340059.7	-	15	1894	c.1895G>C	c.(1894-1896)aGa>aCa	p.R632T	PLCH1_ENST00000460012.1_Missense_Mutation_p.R614T|PLCH1_ENST00000447496.2_Missense_Mutation_p.R632T|PLCH1_ENST00000494598.1_Missense_Mutation_p.R632T|PLCH1_ENST00000414191.1_Missense_Mutation_p.R614T|PLCH1_ENST00000334686.6_Missense_Mutation_p.R614T	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	632	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.R632T(1)|p.R614T(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTGATGTGCTCTTGTTTCACT	0.408																																						dbGAP											2	Substitution - Missense(2)	breast(2)											162.0	155.0	157.0					3																	155212270		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.1895G>C	3.37:g.155212270C>G	ENSP00000345988:p.Arg632Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R632T	ENST00000340059.7	37	c.1895	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985114	0.74474	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.63	5.63	0.86233	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	N	0.17345	0.48	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.968	D;D;P	0.75020	0.974;0.985;0.811	T	0.67810	-0.5574	10	0.25106	T	0.35	.	19.7096	0.96089	0.0:1.0:0.0:0.0	.	614;632;632	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	T	632;614;632;632;614;614	ENSP00000419100:R632T;ENSP00000417502:R614T;ENSP00000402759:R632T;ENSP00000345988:R632T;ENSP00000335469:R614T;ENSP00000412977:R614T	ENSP00000335469:R614T	R	-	2	0	PLCH1	156694964	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.377000	0.79668	2.652000	0.90054	0.655000	0.94253	AGA	PLCH1	-	pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pfscan_PLipase_C_Pinositol-sp_Y	ENSG00000114805		0.408	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	250	0.00	0	C	NM_014996		155212270	155212270	-1	no_errors	ENST00000340059	ensembl	human	known	69_37n	missense	358	16.16	69	SNP	1.000	G
PMEPA1	56937	genome.wustl.edu	37	20	56227380	56227380	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr20:56227380T>A	ENST00000341744.3	-	4	912	c.593A>T	c.(592-594)gAt>gTt	p.D198V	PMEPA1_ENST00000395814.1_Missense_Mutation_p.D148V|PMEPA1_ENST00000395816.3_Missense_Mutation_p.D148V|PMEPA1_ENST00000347215.4_Missense_Mutation_p.D163V|PMEPA1_ENST00000265626.4_Missense_Mutation_p.D148V	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	198					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)	p.D198V(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						CCTGGCACTATCCATCAGGTC	0.692																																						dbGAP											1	Substitution - Missense(1)	breast(1)											36.0	41.0	39.0					20																	56227380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.593A>T	20.37:g.56227380T>A	ENSP00000345826:p.Asp198Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Missense_Mutation	SNP	NULL	p.D198V	ENST00000341744.3	37	c.593	CCDS13463.1	20	.	.	.	.	.	.	.	.	.	.	T	17.31	3.358348	0.61403	.	.	ENSG00000124225	ENST00000341744;ENST00000347215;ENST00000395816;ENST00000265626;ENST00000395814;ENST00000414037	T;T;T;T;T;T	0.56611	0.45;0.5;0.49;0.49;0.49;0.54	5.53	4.4	0.53042	.	0.104005	0.64402	D	0.000007	T	0.68421	0.2999	M	0.76574	2.34	0.80722	D	1	B;D	0.67145	0.441;0.996	B;P	0.62089	0.377;0.898	T	0.71715	-0.4509	10	0.87932	D	0	-31.902	12.5669	0.56314	0.0:0.0:0.1391:0.8609	.	163;198	Q5JY37;Q969W9	.;PMEPA_HUMAN	V	198;163;148;148;148;170	ENSP00000345826:D198V;ENSP00000344014:D163V;ENSP00000379161:D148V;ENSP00000265626:D148V;ENSP00000379159:D148V;ENSP00000401506:D170V	ENSP00000265626:D148V	D	-	2	0	PMEPA1	55660786	1.000000	0.71417	0.887000	0.34795	0.464000	0.32679	7.079000	0.76829	0.890000	0.36211	0.528000	0.53228	GAT	PMEPA1	-	NULL	ENSG00000124225		0.692	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEPA1	HGNC	protein_coding	OTTHUMT00000079858.2	77	0.00	0	T	NM_020182		56227380	56227380	-1	no_errors	ENST00000341744	ensembl	human	known	69_37n	missense	7	78.12	25	SNP	0.998	A
POTEC	388468	genome.wustl.edu	37	18	14542680	14542680	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr18:14542680C>A	ENST00000358970.5	-	1	465	c.466G>T	c.(466-468)Gat>Tat	p.D156Y	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	156								p.D156Y(1)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						ACGATGAGATCCTTTCTGGGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											176.0	165.0	168.0					18																	14542680		692	1591	2283	-	-	-	SO:0001583	missense	0			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.466G>T	18.37:g.14542680C>A	ENSP00000351856:p.Asp156Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D156Y	ENST00000358970.5	37	c.466	CCDS45835.1	18	.	.	.	.	.	.	.	.	.	.	C	10.69	1.420751	0.25639	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.52983	0.64	1.24	-1.28	0.09318	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.55289	0.1911	L	0.54863	1.705	0.09310	N	1	D	0.76494	0.999	D	0.83275	0.996	T	0.45381	-0.9265	9	0.72032	D	0.01	.	3.1185	0.06382	0.0:0.306:0.4063:0.2877	.	156	B2RU33	POTEC_HUMAN	Y	156	ENSP00000351856:D156Y	ENSP00000351856:D156Y	D	-	1	0	POTEC	14532680	0.000000	0.05858	0.001000	0.08648	0.086000	0.17979	-0.315000	0.08081	-0.433000	0.07286	0.197000	0.17608	GAT	POTEC	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000183206		0.582	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	321	0.00	0	C	XM_496269		14542680	14542680	-1	no_errors	ENST00000358970	ensembl	human	known	69_37n	missense	116	44.23	92	SNP	0.001	A
PRF1	5551	genome.wustl.edu	37	10	72360527	72360527	+	Silent	SNP	G	G	A	rs181323749	byFrequency	TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr10:72360527G>A	ENST00000441259.1	-	2	292	c.132C>T	c.(130-132)gcC>gcT	p.A44A	PRF1_ENST00000373209.2_Silent_p.A44A	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	44	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CACCCTCCCCGGCCAGCCATG	0.677			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																													dbGAP	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	0													29.0	31.0	30.0					10																	72360527		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.132C>T	10.37:g.72360527G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6X4|Q59F57|Q86WX7	Silent	SNP	pfam_MACPF,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_MACPF,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A44	ENST00000441259.1	37	c.132	CCDS7305.1	10																																																																																			PRF1	-	NULL	ENSG00000180644		0.677	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRF1	HGNC	protein_coding	OTTHUMT00000048517.2	51	0.00	0	G	NM_005041		72360527	72360527	-1	no_errors	ENST00000318971	ensembl	human	known	69_37n	silent	23	25.81	8	SNP	0.006	A
PSMC4	5704	genome.wustl.edu	37	19	40480261	40480261	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:40480261C>T	ENST00000157812.2	+	4	581	c.383C>T	c.(382-384)gCc>gTc	p.A128V	PSMC4_ENST00000455878.2_Missense_Mutation_p.A97V	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	128					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A128V(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AAGCCCAACGCCTCAGTGGCC	0.592																																					Colon(105;1478 1543 4034 6132 38638)	dbGAP											1	Substitution - Missense(1)	breast(1)											62.0	50.0	54.0					19																	40480261		2203	4300	6503	-	-	-	SO:0001583	missense	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.383C>T	19.37:g.40480261C>T	ENSP00000157812:p.Ala128Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.A128V	ENST00000157812.2	37	c.383	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	c	15.30	2.791309	0.50102	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.94537	-3.45;-3.44	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.91047	0.7183	L	0.27975	0.815	0.80722	D	1	B;P	0.35226	0.123;0.491	B;B	0.38842	0.087;0.283	D	0.91956	0.5575	10	0.87932	D	0	0.142	15.0466	0.71833	0.0:1.0:0.0:0.0	.	97;128	P43686-2;P43686	.;PRS6B_HUMAN	V	128;97	ENSP00000157812:A128V;ENSP00000413869:A97V	ENSP00000157812:A128V	A	+	2	0	PSMC4	45172101	1.000000	0.71417	0.991000	0.47740	0.765000	0.43378	7.372000	0.79612	2.137000	0.66172	0.491000	0.48974	GCC	PSMC4	-	tigrfam_26S_Psome_P45	ENSG00000013275		0.592	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	44	0.00	0	C	NM_006503		40480261	40480261	+1	no_errors	ENST00000157812	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	T
PTPRG	5793	genome.wustl.edu	37	3	62259418	62259418	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr3:62259418G>A	ENST00000474889.1	+	23	3741	c.3364G>A	c.(3364-3366)Gga>Aga	p.G1122R	PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000462497.1_RNA|PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000466893.1_RNA|PTPRG-AS1_ENST00000475371.1_RNA|PTPRG-AS1_ENST00000479018.1_RNA|PTPRG_ENST00000295874.10_Missense_Mutation_p.G1093R	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1122					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G1122R(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		AGCCATTCTTGGAAAGGAGAC	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											185.0	170.0	175.0					3																	62259418		2203	4300	6503	-	-	-	SO:0001583	missense	0			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.3364G>A	3.37:g.62259418G>A	ENSP00000418112:p.Gly1122Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.G1122R	ENST00000474889.1	37	c.3364	CCDS2895.1	3	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125834	0.77436	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.50813	0.73;0.74	6.06	6.06	0.98353	.	0.102148	0.64402	D	0.000001	T	0.45498	0.1345	L	0.41236	1.265	0.58432	D	0.999998	B;B;B	0.19200	0.011;0.034;0.013	B;B;B	0.18871	0.003;0.023;0.007	T	0.21177	-1.0253	10	0.48119	T	0.1	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	368;1093;1122	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	R	1122;1093	ENSP00000418112:G1122R;ENSP00000295874:G1093R	ENSP00000295874:G1093R	G	+	1	0	PTPRG	62234458	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.444000	0.60001	2.879000	0.98667	0.650000	0.86243	GGA	PTPRG	-	NULL	ENSG00000144724		0.433	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRG	HGNC	protein_coding	OTTHUMT00000351674.1	192	0.00	0	G	NM_002841		62259418	62259418	+1	no_errors	ENST00000474889	ensembl	human	known	69_37n	missense	167	13.47	26	SNP	1.000	A
RAB40A	142684	genome.wustl.edu	37	X	102755666	102755666	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:102755666G>T	ENST00000372633.1	-	1	2137	c.19C>A	c.(19-21)Ccc>Acc	p.P7T	LL0XNC01-250H12.3_ENST00000445990.1_RNA|RAB40A_ENST00000304236.1_Missense_Mutation_p.P7T			Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	7					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.P7T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						GCCTGGTCGGGGCTGCCCGGG	0.657																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	39.0	39.0					X																	102755666		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132748	CCDS35357.1	Xq22.1	2009-08-25			ENSG00000172476	ENSG00000172476		"""RAB, member RAS oncogene"""	18283	protein-coding gene	gene with protein product						11697911	Standard	NM_080879		Approved	RAR2A, Rar-2	uc004ekk.3	Q8WXH6	OTTHUMG00000022100	ENST00000372633.1:c.19C>A	X.37:g.102755666G>T	ENSP00000361716:p.Pro7Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00407|Q17RQ5|Q6DK06|Q8TF06	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_SOCS_C,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_SOCS_C,prints_Small_GTPase,pfscan_SOCS_C,tigrfam_Small_GTP-bd_dom	p.P7T	ENST00000372633.1	37	c.19	CCDS35357.1	X	.	.	.	.	.	.	.	.	.	.	.	14.13	2.443546	0.43429	.	.	ENSG00000172476	ENST00000372633;ENST00000304236	T;T	0.71461	-0.57;-0.57	1.53	0.527	0.17084	.	0.000000	0.47455	U	0.000224	T	0.73497	0.3594	L	0.46741	1.465	0.47584	D	0.999464	D	0.89917	1.0	D	0.83275	0.996	T	0.67933	-0.5542	10	0.45353	T	0.12	.	5.8833	0.18868	0.2164:0.0:0.7836:0.0	.	7	Q8WXH6	RB40A_HUMAN	T	7	ENSP00000361716:P7T;ENSP00000305648:P7T	ENSP00000305648:P7T	P	-	1	0	RAB40A	102642322	1.000000	0.71417	0.009000	0.14445	0.499000	0.33736	5.957000	0.70323	-0.127000	0.11661	0.284000	0.19432	CCC	RAB40A	-	NULL	ENSG00000172476		0.657	RAB40A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40A	HGNC	protein_coding	OTTHUMT00000057714.1	66	0.00	0	G			102755666	102755666	-1	no_errors	ENST00000304236	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	T
RENBP	5973	genome.wustl.edu	37	X	153209420	153209420	+	Silent	SNP	T	T	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:153209420T>C	ENST00000393700.3	-	4	296	c.216A>G	c.(214-216)gtA>gtG	p.V72V	RENBP_ENST00000369997.3_Silent_p.V58V|RENBP_ENST00000412763.1_Silent_p.V72V|RENBP_ENST00000462086.1_5'Flank	NM_002910.5	NP_002901.2	P51606	RENBP_HUMAN	renin binding protein	72					N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)|regulation of blood pressure (GO:0008217)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|endopeptidase inhibitor activity (GO:0004866)|N-acylglucosamine 2-epimerase activity (GO:0050121)	p.V72V(1)|p.V62V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	AATACATCCATACCTGCGGGG	0.622																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											62.0	50.0	54.0					X																	153209420		2197	4293	6490	-	-	-	SO:0001819	synonymous_variant	0				CCDS14738.2	Xq28	2013-09-23	2001-11-28		ENSG00000102032	ENSG00000102032			9959	protein-coding gene	gene with protein product	"""N-acylglucosamine 2-epimerase"", ""GlcNAc 2-epimerase"", ""N-acetyl-D-glucosamine 2-epimerase"""	312420	"""renin-binding protein"""			1618798	Standard	NM_002910		Approved	RNBP, RBP	uc004fjo.2	P51606	OTTHUMG00000024224	ENST00000393700.3:c.216A>G	X.37:g.153209420T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNZ3|Q96BI6	Silent	SNP	pfam_AGE/RnBP,superfamily_6-hairpin_glycosidase-like	p.V72	ENST00000393700.3	37	c.216	CCDS14738.2	X																																																																																			RENBP	-	pfam_AGE/RnBP,superfamily_6-hairpin_glycosidase-like	ENSG00000102032		0.622	RENBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RENBP	HGNC	protein_coding	OTTHUMT00000061103.3	47	0.00	0	T	NM_002910		153209420	153209420	-1	no_errors	ENST00000393700	ensembl	human	known	69_37n	silent	4	69.23	9	SNP	0.228	C
ROR1	4919	genome.wustl.edu	37	1	64515405	64515405	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:64515405C>T	ENST00000371079.1	+	3	581	c.206C>T	c.(205-207)aCg>aTg	p.T69M	ROR1_ENST00000482426.1_3'UTR|ROR1_ENST00000371080.1_Missense_Mutation_p.T69M	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	69	Ig-like C2-type.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.T69M(2)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						AACATCACCACGTCTCTGGGC	0.547																																						dbGAP											2	Substitution - Missense(2)	ovary(1)|breast(1)											139.0	134.0	136.0					1																	64515405		2203	4300	6503	-	-	-	SO:0001583	missense	0			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.206C>T	1.37:g.64515405C>T	ENSP00000360120:p.Thr69Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.T69M	ENST00000371079.1	37	c.206	CCDS626.1	1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134388	0.77662	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.67345	-0.26;-0.26	5.8	5.8	0.92144	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.44285	D	0.000470	T	0.72550	0.3474	L	0.41079	1.255	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.74674	0.881;0.984	T	0.72293	-0.4336	10	0.52906	T	0.07	.	20.062	0.97678	0.0:1.0:0.0:0.0	.	69;69	Q01973;Q66K77	ROR1_HUMAN;.	M	69;69;72	ENSP00000360121:T69M;ENSP00000360120:T69M	ENSP00000360120:T69M	T	+	2	0	ROR1	64287993	0.998000	0.40836	0.972000	0.41901	0.961000	0.63080	3.803000	0.55560	2.730000	0.93505	0.563000	0.77884	ACG	ROR1	-	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000185483		0.547	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR1	HGNC	protein_coding	OTTHUMT00000025002.1	163	0.00	0	C	NM_005012		64515405	64515405	+1	no_errors	ENST00000371079	ensembl	human	known	69_37n	missense	98	32.88	48	SNP	1.000	T
RPGR	6103	genome.wustl.edu	37	X	38144855	38144855	+	Intron	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:38144855C>A	ENST00000339363.3	-	14	2688				RPGR_ENST00000342811.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.G1133W|RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000309513.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.G1133W(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CCTGATGGCCCGTTTTTTAAA	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											197.0	179.0	185.0					X																	38144855		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1491G>T	X.37:g.38144855C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.G1133W	ENST00000339363.3	37	c.3397		X	.	.	.	.	.	.	.	.	.	.	c	0.043	-1.276750	0.01410	.	.	ENSG00000156313	ENST00000378505	T	0.50001	0.76	3.91	1.05	0.20165	.	.	.	.	.	T	0.60869	0.2302	M	0.65498	2.005	0.09310	N	1	D	0.76494	0.999	D	0.71184	0.972	T	0.48625	-0.9019	9	0.87932	D	0	.	6.9524	0.24552	0.0:0.6595:0.0:0.3405	.	1133	E9PE28	.	W	1133	ENSP00000367766:G1133W	ENSP00000367766:G1133W	G	-	1	0	RPGR	38029799	0.749000	0.28305	0.018000	0.16275	0.084000	0.17831	0.980000	0.29513	0.120000	0.18254	-0.919000	0.02742	GGG	RPGR	-	NULL	ENSG00000156313		0.378	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		61	0.00	0	C	NM_000328		38144855	38144855	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	missense	31	40.38	21	SNP	0.038	A
SEMA4G	57715	genome.wustl.edu	37	10	102740951	102740951	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr10:102740951G>C	ENST00000370250.4	+	13	2028	c.1655G>C	c.(1654-1656)aGa>aCa	p.R552T	MRPL43_ENST00000318325.2_Intron|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000210633.3_Missense_Mutation_p.R557T|MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000370242.4_Intron|SEMA4G_ENST00000517724.1_Missense_Mutation_p.R557T	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	552	PSI.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R557T(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		GACATAGAGAGAGGAAATCGA	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	115.0	124.0					10																	102740951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.1655G>C	10.37:g.102740951G>C	ENSP00000359270:p.Arg552Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.R557T	ENST00000370250.4	37	c.1670		10	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350773	0.41599	.	.	ENSG00000095539	ENST00000370250;ENST00000517724;ENST00000210633	T;T;T	0.21361	2.01;2.22;2.26	5.25	5.25	0.73442	.	1.202780	0.05668	N	0.588204	T	0.22627	0.0546	L	0.48935	1.535	0.32395	N	0.552696	B;B	0.30146	0.27;0.058	B;B	0.32289	0.143;0.064	T	0.17137	-1.0379	10	0.11794	T	0.64	.	11.3227	0.49433	0.0834:0.0:0.9166:0.0	.	557;557	A1A5C6;Q9NTN9-2	.;.	T	552;557;557	ENSP00000359270:R552T;ENSP00000430175:R557T;ENSP00000210633:R557T	ENSP00000210633:R557T	R	+	2	0	SEMA4G	102730941	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	2.118000	0.41949	2.441000	0.82636	0.305000	0.20034	AGA	SEMA4G	-	superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000095539		0.483	SEMA4G-002	KNOWN	basic	protein_coding	SEMA4G	HGNC	protein_coding	OTTHUMT00000049920.2	221	0.00	0	G			102740951	102740951	+1	no_errors	ENST00000210633	ensembl	human	known	69_37n	missense	89	31.01	40	SNP	0.998	C
SGCE	8910	genome.wustl.edu	37	7	94232698	94232698	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr7:94232698C>G	ENST00000265735.7	-	6	839	c.729G>C	c.(727-729)caG>caC	p.Q243H	SGCE_ENST00000447873.1_Missense_Mutation_p.Q243H|SGCE_ENST00000428696.2_Missense_Mutation_p.Q243H|SGCE_ENST00000445866.2_Missense_Mutation_p.Q243H|SGCE_ENST00000437425.2_Missense_Mutation_p.Q202H|SGCE_ENST00000415788.2_Missense_Mutation_p.Q279H	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	243	Cys-rich.				cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)	p.Q243H(2)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TCAATTGATTCTGTGGATTTT	0.343																																						dbGAP											2	Substitution - Missense(2)	breast(2)											89.0	85.0	86.0					7																	94232698		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.729G>C	7.37:g.94232698C>G	ENSP00000265735:p.Gln243His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Missense_Mutation	SNP	pfam_Sarcoglycan_2,superfamily_Cadherin-like,smart_Cadg	p.Q243H	ENST00000265735.7	37	c.729	CCDS5637.1	7	.	.	.	.	.	.	.	.	.	.	C	8.684	0.905870	0.17760	.	.	ENSG00000127990	ENST00000265735;ENST00000445866;ENST00000437425;ENST00000447873;ENST00000428696;ENST00000415788	D;D;D;D;D;D	0.97710	-4.5;-4.5;-4.5;-4.5;-4.5;-4.5	5.01	3.19	0.36642	.	0.058893	0.64402	D	0.000001	D	0.92841	0.7723	N	0.16478	0.41	0.44927	D	0.997945	B;B;B;B;B;B	0.13145	0.007;0.002;0.003;0.002;0.001;0.002	B;B;B;B;B;B	0.16289	0.015;0.007;0.009;0.007;0.005;0.003	D	0.87864	0.2666	10	0.41790	T	0.15	-4.8501	8.7675	0.34711	0.0:0.6365:0.0:0.3635	.	279;202;243;243;243;243	B7Z2R4;E9PEH6;E9PF60;G5E9K6;O43556;C9JR67	.;.;.;.;SGCE_HUMAN;.	H	243;243;202;243;243;279	ENSP00000265735:Q243H;ENSP00000398930:Q243H;ENSP00000394061:Q202H;ENSP00000388734:Q243H;ENSP00000397536:Q243H;ENSP00000405313:Q279H	ENSP00000265735:Q243H	Q	-	3	2	SGCE	94070634	0.998000	0.40836	1.000000	0.80357	0.753000	0.42808	0.440000	0.21592	0.775000	0.33450	0.563000	0.77884	CAG	SGCE	-	pfam_Sarcoglycan_2	ENSG00000127990		0.343	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCE	HGNC	protein_coding	OTTHUMT00000255251.2	167	0.00	0	C			94232698	94232698	-1	no_errors	ENST00000445866	ensembl	human	known	69_37n	missense	153	22.34	44	SNP	0.998	G
SLC10A1	6554	genome.wustl.edu	37	14	70245196	70245196	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr14:70245196C>T	ENST00000216540.4	-	4	930	c.797G>A	c.(796-798)tGt>tAt	p.C266Y		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	266					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)	p.C266Y(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	GATGGTGGAACAGAGTTGGAC	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											164.0	135.0	145.0					14																	70245196		2203	4300	6503	-	-	-	SO:0001583	missense	0			L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.797G>A	14.37:g.70245196C>T	ENSP00000216540:p.Cys266Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGB6|Q2TU29	Missense_Mutation	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.C266Y	ENST00000216540.4	37	c.797	CCDS9797.1	14	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670070	0.67814	.	.	ENSG00000100652	ENST00000216540	T	0.81247	-1.47	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.91358	0.7274	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93009	0.6430	10	0.87932	D	0	-15.7756	18.0549	0.89361	0.0:1.0:0.0:0.0	.	266	Q14973	NTCP_HUMAN	Y	266	ENSP00000216540:C266Y	ENSP00000216540:C266Y	C	-	2	0	SLC10A1	69314949	1.000000	0.71417	0.960000	0.40013	0.410000	0.31052	7.519000	0.81809	2.499000	0.84300	0.561000	0.74099	TGT	SLC10A1	-	tigrfam_Bil_ac_transpt	ENSG00000100652		0.512	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A1	HGNC	protein_coding	OTTHUMT00000412464.1	159	0.00	0	C			70245196	70245196	-1	no_errors	ENST00000216540	ensembl	human	known	69_37n	missense	60	39.39	39	SNP	1.000	T
SLC17A3	10786	genome.wustl.edu	37	6	25850741	25850741	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr6:25850741C>A	ENST00000360657.3	-	7	990	c.705G>T	c.(703-705)atG>atT	p.M235I	SLC17A3_ENST00000361703.6_Missense_Mutation_p.M235I|SLC17A3_ENST00000397060.4_Missense_Mutation_p.M313I			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	235					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)	p.M313I(1)|p.M235I(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						TGTATACAACCATTGTGCTAA	0.438																																						dbGAP											2	Substitution - Missense(2)	breast(2)											193.0	155.0	168.0					6																	25850741		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.705G>T	6.37:g.25850741C>A	ENSP00000353873:p.Met235Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.M313I	ENST00000360657.3	37	c.939	CCDS4566.2	6	.	.	.	.	.	.	.	.	.	.	C	4.647	0.120229	0.08881	.	.	ENSG00000124564	ENST00000397060;ENST00000360657;ENST00000361703	T;T;T	0.55588	0.51;0.51;0.51	3.53	-2.07	0.07276	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.732920	0.03797	N	0.263818	T	0.09905	0.0243	N	0.10733	0.035	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.12156	0.007;0.006;0.005	T	0.08432	-1.0722	10	0.37606	T	0.19	.	0.4637	0.00520	0.3427:0.2859:0.1573:0.2141	.	235;313;235	B7Z531;B7Z511;O00476	.;.;NPT4_HUMAN	I	313;235;235	ENSP00000380250:M313I;ENSP00000353873:M235I;ENSP00000355307:M235I	ENSP00000353873:M235I	M	-	3	0	SLC17A3	25958720	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.538000	0.06120	-0.477000	0.06832	0.585000	0.79938	ATG	SLC17A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000124564		0.438	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	SLC17A3	HGNC	protein_coding	OTTHUMT00000040070.2	255	0.00	0	C			25850741	25850741	-1	no_errors	ENST00000397060	ensembl	human	known	69_37n	missense	155	33.62	79	SNP	0.000	A
SLC25A44	9673	genome.wustl.edu	37	1	156169758	156169758	+	Silent	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:156169758C>A	ENST00000359511.4	+	2	292	c.120C>A	c.(118-120)ctC>ctA	p.L40L	SLC25A44_ENST00000469537.1_3'UTR|SLC25A44_ENST00000423538.2_Silent_p.L40L	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	40					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.L40L(1)		breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					CATTCACCCTCATCCGCACCC	0.517																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											160.0	154.0	156.0					1																	156169758		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.120C>A	1.37:g.156169758C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75034	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_Mitochondrial_sb/sol_carrier	p.L40	ENST00000359511.4	37	c.120	CCDS1133.1	1																																																																																			SLC25A44	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000160785		0.517	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	HGNC	protein_coding	OTTHUMT00000040856.1	492	0.00	0	C	NM_014655		156169758	156169758	+1	no_errors	ENST00000359511	ensembl	human	known	69_37n	silent	329	19.16	78	SNP	1.000	A
SLC31A1	1317	genome.wustl.edu	37	9	116021131	116021131	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr9:116021131C>G	ENST00000374212.4	+	4	512	c.360C>G	c.(358-360)caC>caG	p.H120Q	CDC26_ENST00000490408.1_Intron|SLC31A1_ENST00000374210.6_Missense_Mutation_p.H120Q	NM_001859.3	NP_001850.1	O15431	COPT1_HUMAN	solute carrier family 31 (copper transporter), member 1	120					cellular copper ion homeostasis (GO:0006878)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)|copper uptake transmembrane transporter activity (GO:0015088)	p.H120Q(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7					Bortezomib(DB00188)|Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGGAGACACACAAAACTGTTG	0.488																																					Ovarian(135;1049 1799 4519 17564 28677)	dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	90.0	96.0					9																	116021131		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83460	CCDS6789.1	9q32	2013-07-17	2013-07-17		ENSG00000136868	ENSG00000136868		"""Solute carriers"""	11016	protein-coding gene	gene with protein product	copper transport 1 homolog (S. cerevisiae)	603085		COPT1		9207117	Standard	NM_001859		Approved	hCTR1, CTR1	uc004bgu.3	O15431	OTTHUMG00000020519	ENST00000374212.4:c.360C>G	9.37:g.116021131C>G	ENSP00000363329:p.His120Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z6|Q53GR5|Q5T1M4	Missense_Mutation	SNP	pfam_Cop_transporter	p.H120Q	ENST00000374212.4	37	c.360	CCDS6789.1	9	.	.	.	.	.	.	.	.	.	.	C	11.20	1.567553	0.28003	.	.	ENSG00000136868	ENST00000374212;ENST00000374210	T;T	0.76316	-1.01;-1.01	5.82	3.04	0.35103	.	0.000000	0.85682	D	0.000000	T	0.67392	0.2888	L	0.39467	1.215	0.80722	D	1	P;B	0.34934	0.476;0.339	B;B	0.36186	0.219;0.147	T	0.58148	-0.7687	10	0.24483	T	0.36	-19.4051	10.3334	0.43835	0.0:0.7902:0.0:0.2098	.	120;120	Q5T1M3;O15431	.;COPT1_HUMAN	Q	120	ENSP00000363329:H120Q;ENSP00000363327:H120Q	ENSP00000363327:H120Q	H	+	3	2	SLC31A1	115060952	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.403000	0.34612	0.393000	0.25203	-0.143000	0.13931	CAC	SLC31A1	-	pfam_Cop_transporter	ENSG00000136868		0.488	SLC31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC31A1	HGNC	protein_coding	OTTHUMT00000053715.1	113	0.00	0	C	NM_001859		116021131	116021131	+1	no_errors	ENST00000374212	ensembl	human	known	69_37n	missense	111	14.62	19	SNP	1.000	G
SPTA1	6708	genome.wustl.edu	37	1	158606472	158606472	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:158606472G>A	ENST00000368147.4	-	37	5449	c.5269C>T	c.(5269-5271)Cgc>Tgc	p.R1757C		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1757					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1757C(2)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCCTCTAGGCGTTTGTGCTTC	0.473																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											119.0	116.0	117.0					1																	158606472		1866	4097	5963	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5269C>T	1.37:g.158606472G>A	ENSP00000357129:p.Arg1757Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.R1757C	ENST00000368147.4	37	c.5269	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146494	0.77888	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.53423	0.62;0.62	5.26	5.26	0.73747	.	.	.	.	.	T	0.66954	0.2842	M	0.84433	2.695	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.71163	-0.4673	9	0.66056	D	0.02	.	15.7406	0.77891	0.0:0.0:1.0:0.0	.	1757	P02549	SPTA1_HUMAN	C	1757	ENSP00000357130:R1757C;ENSP00000357129:R1757C	ENSP00000357129:R1757C	R	-	1	0	SPTA1	156873096	1.000000	0.71417	0.531000	0.27976	0.951000	0.60555	6.107000	0.71517	2.744000	0.94065	0.650000	0.86243	CGC	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	145	0.00	0	G	NM_003126		158606472	158606472	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	79	46.62	69	SNP	1.000	A
SYT8	90019	genome.wustl.edu	37	11	1857139	1857139	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr11:1857139delG	ENST00000381968.3	+	4	452	c.324delG	c.(322-324)ctgfs	p.L108fs	SYT8_ENST00000341958.3_Frame_Shift_Del_p.L94fs|SYT8_ENST00000483280.1_3'UTR|SYT8_ENST00000535046.1_Frame_Shift_Del_p.L246fs|SYT8_ENST00000436964.2_Frame_Shift_Del_p.L94fs	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	108					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGGATGGCCTGGAGTCCAGCC	0.647																																						dbGAP											0													46.0	46.0	46.0					11																	1857139		2201	4299	6500	-	-	-	SO:0001589	frameshift_variant	0			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.324delG	11.37:g.1857139delG	ENSP00000371394:p.Leu108fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFJ4|Q9NSV9	Frame_Shift_Del	DEL	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,pfscan_C2_membr_targeting	p.E109fs	ENST00000381968.3	37	c.324	CCDS7726.2	11																																																																																			SYT8	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000149043		0.647	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	HGNC	protein_coding	OTTHUMT00000025013.4	47	0.00	0	G			1857139	1857139	+1	no_errors	ENST00000381968	ensembl	human	known	69_37n	frame_shift_del	8	20.00	2	DEL	0.077	-
TEX14	56155	genome.wustl.edu	37	17	56700371	56700371	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:56700371C>G	ENST00000240361.8	-	4	339	c.254G>C	c.(253-255)cGc>cCc	p.R85P	TEX14_ENST00000349033.5_Missense_Mutation_p.R85P|TEX14_ENST00000389934.3_Missense_Mutation_p.R85P			Q8IWB6	TEX14_HUMAN	testis expressed 14	85					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.R85P(2)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATCAAAGCAGCGGCTGGGGAG	0.567																																						dbGAP											2	Substitution - Missense(2)	breast(2)											62.0	46.0	52.0					17																	56700371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.254G>C	17.37:g.56700371C>G	ENSP00000240361:p.Arg85Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.R85P	ENST00000240361.8	37	c.254	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472290	0.84533	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.66995	-0.24;-0.24;-0.24	5.21	5.21	0.72293	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000004	T	0.77987	0.4213	L	0.48877	1.53	0.48511	D	0.999668	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.79801	-0.1650	10	0.87932	D	0	-22.2167	17.6767	0.88232	0.0:1.0:0.0:0.0	.	85;85;85	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	P	85	ENSP00000240361:R85P;ENSP00000374584:R85P;ENSP00000268910:R85P	ENSP00000240361:R85P	R	-	2	0	TEX14	54055370	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.718000	0.68455	2.583000	0.87209	0.655000	0.94253	CGC	TEX14	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000121101		0.567	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1	98	0.00	0	C			56700371	56700371	-1	no_errors	ENST00000240361	ensembl	human	known	69_37n	missense	115	20.00	29	SNP	1.000	G
TRPC5	7224	genome.wustl.edu	37	X	111155910	111155910	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:111155910C>A	ENST00000262839.2	-	3	1427	c.509G>T	c.(508-510)cGg>cTg	p.R170L		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	170					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.R170L(1)		biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTGGTGGGGCCGTGGGATAGT	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	96.0	101.0					X																	111155910		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.509G>T	X.37:g.111155910C>A	ENSP00000262839:p.Arg170Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R170L	ENST00000262839.2	37	c.509	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555929	0.86231	.	.	ENSG00000072315	ENST00000262839	T	0.70986	-0.53	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.70298	0.3208	N	0.14661	0.345	0.58432	D	0.999995	P;D	0.57257	0.884;0.979	P;P	0.57846	0.511;0.828	T	0.74794	-0.3544	10	0.51188	T	0.08	-14.7195	18.2995	0.90158	0.0:1.0:0.0:0.0	.	171;170	Q59G51;Q9UL62	.;TRPC5_HUMAN	L	170	ENSP00000262839:R170L	ENSP00000262839:R170L	R	-	2	0	TRPC5	111042566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.235000	0.51328	2.260000	0.74910	0.529000	0.55759	CGG	TRPC5	-	smart_Ankyrin_rpt,tigrfam_TRP_channel	ENSG00000072315		0.527	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	99	0.00	0	C	NM_012471		111155910	111155910	-1	no_errors	ENST00000262839	ensembl	human	known	69_37n	missense	89	20.54	23	SNP	1.000	A
TSSC1	7260	genome.wustl.edu	37	2	3261182	3261182	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:3261182G>A	ENST00000382125.4	-	4	496	c.304C>T	c.(304-306)Ccg>Tcg	p.P102S	TSSC1_ENST00000443925.2_Missense_Mutation_p.P102S|TSSC1_ENST00000398659.4_Missense_Mutation_p.P129S|TSSC1_ENST00000478754.1_5'UTR	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	102								p.P102S(1)		breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		AATTCCTTCGGCATCCTCCAC	0.542																																					Colon(140;1261 1762 4183 34270 49743)	dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	91.0	95.0					2																	3261182		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.304C>T	2.37:g.3261182G>A	ENSP00000371559:p.Pro102Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W4Y1|O43179|Q53S19|Q53SG2	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P102S	ENST00000382125.4	37	c.304	CCDS1651.1	2	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025414	0.93518	.	.	ENSG00000032389	ENST00000382125;ENST00000398659;ENST00000443925;ENST00000444776	T;D;T	0.83992	2.67;-1.79;2.67	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80742	0.4681	M	0.64170	1.965	0.80722	D	1	B	0.31968	0.349	B	0.29176	0.099	T	0.77466	-0.2577	10	0.20519	T	0.43	1.1964	18.2929	0.90136	0.0:0.0:1.0:0.0	.	102	Q53HC9	TSSC1_HUMAN	S	102;129;102;136	ENSP00000371559:P102S;ENSP00000381652:P129S;ENSP00000389080:P102S	ENSP00000371559:P102S	P	-	1	0	TSSC1	3240189	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.643000	0.98464	2.549000	0.85964	0.650000	0.86243	CCG	TSSC1	-	NULL	ENSG00000032389		0.542	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC1	HGNC	protein_coding	OTTHUMT00000206694.2	108	0.00	0	G	NM_003310		3261182	3261182	-1	no_errors	ENST00000382125	ensembl	human	known	69_37n	missense	79	25.93	28	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179449278	179449278	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:179449278C>G	ENST00000591111.1	-	261	60301	c.60077G>C	c.(60076-60078)cGa>cCa	p.R20026P	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R12727P|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R21667P|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R19099P|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R12794P|TTN_ENST00000460472.2_Missense_Mutation_p.R12602P			Q8WZ42	TITIN_HUMAN	titin	20026	Fibronectin type-III 45. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R12794P(1)|p.R19099P(1)|p.R19097P(1)|p.R12602P(1)|p.R12727P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGGTGACTCGTGCATTCTT	0.398																																						dbGAP											5	Substitution - Missense(5)	breast(5)											81.0	76.0	78.0					2																	179449278		1891	4121	6012	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.60077G>C	2.37:g.179449278C>G	ENSP00000465570:p.Arg20026Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R19099P	ENST00000591111.1	37	c.57296		2	.	.	.	.	.	.	.	.	.	.	C	12.86	2.064143	0.36373	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	6.04	5.16	0.70880	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70527	0.3234	M	0.66439	2.03	0.54753	D	0.999983	D;D;D;D	0.61697	0.99;0.99;0.99;0.982	P;P;P;P	0.56612	0.802;0.802;0.802;0.733	T	0.75167	-0.3413	9	0.87932	D	0	.	16.9292	0.86186	0.1286:0.8714:0.0:0.0	.	12602;12727;12794;20026	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	19099;12602;12794;12727;12600	ENSP00000343764:R19099P;ENSP00000434586:R12602P;ENSP00000340554:R12794P;ENSP00000352154:R12727P	ENSP00000340554:R12794P	R	-	2	0	TTN	179157524	0.252000	0.23972	1.000000	0.80357	0.998000	0.95712	1.477000	0.35431	1.542000	0.49330	0.561000	0.74099	CGA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	98	0.00	0	C	NM_133378		179449278	179449278	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	76	29.63	32	SNP	1.000	G
UGT8	7368	genome.wustl.edu	37	4	115586909	115586909	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr4:115586909delC	ENST00000310836.6	+	4	1561	c.1039delC	c.(1039-1041)cttfs	p.L347fs	UGT8_ENST00000394511.3_Frame_Shift_Del_p.L347fs	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	347					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)	p.H349fs*8(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		AAATGACCTGCTTGGTAAGTC	0.338																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											126.0	117.0	120.0					4																	115586909		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.1039delC	4.37:g.115586909delC	ENSP00000311648:p.Leu347fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXU7|O00196	Frame_Shift_Del	DEL	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.H349fs	ENST00000310836.6	37	c.1039	CCDS3705.1	4																																																																																			UGT8	-	pfam_UDP_glucos_trans	ENSG00000174607		0.338	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT8	HGNC	protein_coding	OTTHUMT00000256426.2	326	0.00	0	C	NM_003360		115586909	115586909	+1	no_errors	ENST00000310836	ensembl	human	known	69_37n	frame_shift_del	65	50.36	69	DEL	1.000	-
UTP14C	9724	genome.wustl.edu	37	13	52605143	52605143	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr13:52605143G>T	ENST00000521776.2	+	2	2936	c.2203G>T	c.(2203-2205)Gat>Tat	p.D735Y		NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	735					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)		p.D735Y(1)		breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		AAAAGCAGAGGATGTGGGCTA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	120.0	124.0					13																	52605143		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.2203G>T	13.37:g.52605143G>T	ENSP00000428619:p.Asp735Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5FWG3|Q92555	Missense_Mutation	SNP	pfam_SSU_processome_Utp14	p.D735Y	ENST00000521776.2	37	c.2203	CCDS31978.1	13	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269284	0.59540	.	.	ENSG00000253797	ENST00000521776	T	0.20881	2.04	3.04	3.04	0.35103	.	0.215645	0.38548	N	0.001653	T	0.45776	0.1359	M	0.83312	2.635	0.58432	D	0.999994	D	0.64830	0.994	D	0.70227	0.968	T	0.50996	-0.8761	9	.	.	.	-16.4508	11.8685	0.52507	0.0:0.0:1.0:0.0	.	735	Q5TAP6	UT14C_HUMAN	Y	735	ENSP00000428619:D735Y	.	D	+	1	0	UTP14C	51503144	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	5.698000	0.68302	1.704000	0.51252	0.455000	0.32223	GAT	UTP14C	-	NULL	ENSG00000253797		0.473	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP14C	HGNC	protein_coding	OTTHUMT00000045049.2	190	0.00	0	G	NM_021645		52605143	52605143	+1	no_errors	ENST00000521776	ensembl	human	known	69_37n	missense	95	29.63	40	SNP	1.000	T
VMP1	81671	genome.wustl.edu	37	17	57917167	57917167	+	Silent	SNP	C	C	G	rs111262775	byFrequency	TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr17:57917167C>G	ENST00000262291.4	+	12	1426	c.1116C>G	c.(1114-1116)gtC>gtG	p.V372V	VMP1_ENST00000588617.1_3'UTR|VMP1_ENST00000536180.1_Silent_p.V275V|VMP1_ENST00000537567.1_Silent_p.V238V|VMP1_ENST00000539763.1_Silent_p.V180V|MIR21_ENST00000362134.1_RNA|VMP1_ENST00000545362.1_Silent_p.V316V	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	372					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						AAAAGTTGGTCGTTGTCATGG	0.388																																						dbGAP											0													311.0	294.0	300.0					17																	57917167		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.1116C>G	17.37:g.57917167C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVV9|Q9H0P4|Q9P089	Silent	SNP	NULL	p.V372	ENST00000262291.4	37	c.1116	CCDS11619.1	17																																																																																			VMP1	-	NULL	ENSG00000062716		0.388	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VMP1	HGNC	protein_coding	OTTHUMT00000448793.1	344	0.00	0	C	NM_030938		57917167	57917167	+1	no_errors	ENST00000262291	ensembl	human	known	69_37n	silent	392	12.30	55	SNP	0.072	G
YTHDF3	253943	genome.wustl.edu	37	8	64099266	64099266	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr8:64099266C>T	ENST00000539294.1	+	4	1010	c.694C>T	c.(694-696)Cct>Tct	p.P232S	YTHDF3_ENST00000517371.1_Intron|YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000542911.2_Missense_Mutation_p.P43S	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	233							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			CAGTGCAGCACCTAAACCAAC	0.517																																						dbGAP											0													92.0	98.0	96.0					8																	64099266		2060	4206	6266	-	-	-	SO:0001583	missense	0			BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.694C>T	8.37:g.64099266C>T	ENSP00000473496:p.Pro232Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXL4|Q63Z37|Q659A3	RNA	SNP	-	NULL	ENST00000539294.1	37	NULL		8																																																																																			YTHDF3	-	-	ENSG00000185728		0.517	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	YTHDF3	HGNC	protein_coding		94	0.00	0	C	NM_152758		64099266	64099266	+1	no_errors	ENST00000339066	ensembl	human	known	69_37n	rna	134	12.99	20	SNP	1.000	T
YY1AP1	55249	genome.wustl.edu	37	1	155638533	155638533	+	Intron	SNP	G	G	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr1:155638533G>C	ENST00000295566.4	-	9	950				YY1AP1_ENST00000404643.1_Intron|YY1AP1_ENST00000535662.1_Intron|YY1AP1_ENST00000476093.1_5'Flank|YY1AP1_ENST00000355499.4_Missense_Mutation_p.T255S|YY1AP1_ENST00000361831.5_Missense_Mutation_p.T244S|YY1AP1_ENST00000347088.5_Missense_Mutation_p.T255S|YY1AP1_ENST00000368330.2_Missense_Mutation_p.T255S|YY1AP1_ENST00000407221.1_Intron|MSTO1_ENST00000538143.1_Intron|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000405763.3_Missense_Mutation_p.T393S|YY1AP1_ENST00000311573.5_Intron|YY1AP1_ENST00000359205.5_Missense_Mutation_p.T244S|YY1AP1_ENST00000438245.2_3'UTR|YY1AP1_ENST00000368339.5_Missense_Mutation_p.T393S|YY1AP1_ENST00000368340.5_Intron	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1						regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T393S(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AAGAAACTCAGTCCCTTCAAA	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											178.0	156.0	164.0					1																	155638533		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.927-25C>G	1.37:g.155638533G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	NULL	p.T393S	ENST00000295566.4	37	c.1178	CCDS1115.1	1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757182	0.69648	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000347088;ENST00000361831;ENST00000368330;ENST00000368339;ENST00000405763	T;T;T;T;T;T	0.25912	1.79;1.79;1.79;1.79;1.79;1.77	3.4	3.4	0.38934	.	.	.	.	.	T	0.30103	0.0754	L	0.43701	1.375	0.80722	D	1	D;D;D;D	0.76494	0.999;0.996;0.999;0.999	D;D;D;D	0.85130	0.982;0.986;0.982;0.997	T	0.02705	-1.1121	9	0.29301	T	0.29	.	14.9327	0.70929	0.0:0.0:1.0:0.0	.	321;393;393;255	B4DQQ0;B4DMP2;B0QZ55;Q9H869-2	.;.;.;.	S	244;255;255;244;255;393;393	ENSP00000352134:T244S;ENSP00000347686:T255S;ENSP00000316079:T255S;ENSP00000355298:T244S;ENSP00000357314:T255S;ENSP00000357323:T393S	ENSP00000316079:T255S	T	-	2	0	YY1AP1	153905157	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	4.690000	0.61731	1.879000	0.54435	0.462000	0.41574	ACT	YY1AP1	-	NULL	ENSG00000163374		0.448	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	YY1AP1	HGNC	protein_coding	OTTHUMT00000086027.1	444	0.00	0	G	NM_139118		155638533	155638533	-1	no_errors	ENST00000368339	ensembl	human	known	69_37n	missense	406	22.48	118	SNP	1.000	C
YY2	404281	genome.wustl.edu	37	X	21875634	21875634	+	Silent	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chrX:21875634C>G	ENST00000429584.2	+	1	1530	c.1032C>G	c.(1030-1032)ccC>ccG	p.P344P	MBTPS2_ENST00000365779.2_Intron|MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000379484.5_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	344	Mediates transcriptional repression.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P344P(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						TCGTGTGCCCCTTCGATGTTT	0.493																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											201.0	202.0	201.0					X																	21875634		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.1032C>G	X.37:g.21875634C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP10|Q6Q1S4	Silent	SNP	smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.P344	ENST00000429584.2	37	c.1032	CCDS14202.1	X																																																																																			YY2	-	smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	ENSG00000230797		0.493	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY2	HGNC	protein_coding	OTTHUMT00000056025.1	53	0.00	0	C	NM_206923		21875634	21875634	+1	no_errors	ENST00000429584	ensembl	human	known	69_37n	silent	27	18.18	6	SNP	0.499	G
ZC3H15	55854	genome.wustl.edu	37	2	187370515	187370515	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:187370515G>A	ENST00000337859.6	+	8	1140	c.913G>A	c.(913-915)Gat>Aat	p.D305N	ZC3H15_ENST00000544130.1_Missense_Mutation_p.D100N	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	305					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.D305N(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			GGTCAATGATGATGATGAGGA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	126.0	128.0					2																	187370515		2006	4171	6177	-	-	-	SO:0001583	missense	0				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.913G>A	2.37:g.187370515G>A	ENSP00000338788:p.Asp305Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.D305N	ENST00000337859.6	37	c.913	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.898058	0.97081	.	.	ENSG00000065548	ENST00000337859;ENST00000544130;ENST00000536434	T	0.42131	0.98	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.70465	0.3227	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.70410	-0.4879	10	0.52906	T	0.07	-12.8042	20.8794	0.99867	0.0:0.0:1.0:0.0	.	305	Q8WU90	ZC3HF_HUMAN	N	305;100;305	ENSP00000338788:D305N	ENSP00000338788:D305N	D	+	1	0	ZC3H15	187078760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GAT	ZC3H15	-	NULL	ENSG00000065548		0.408	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	HGNC	protein_coding	OTTHUMT00000334547.2	123	0.00	0	G	NM_018471		187370515	187370515	+1	no_errors	ENST00000337859	ensembl	human	known	69_37n	missense	86	23.89	27	SNP	1.000	A
ZNF317	57693	genome.wustl.edu	37	19	9271595	9271596	+	Frame_Shift_Ins	INS	-	-	G	rs534702883		TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:9271595_9271596insG	ENST00000247956.6	+	7	1579_1580	c.1274_1275insG	c.(1273-1278)aagaccfs	p.T426fs	ZNF317_ENST00000360385.3_Frame_Shift_Ins_p.T394fs	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						CAGTGCGGGAAGACCTTCCGAA	0.515																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1275dupG	19.37:g.9271596_9271596dupG	ENSP00000247956:p.Thr426fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T426fs	ENST00000247956.6	37	c.1274_1275	CCDS12210.1	19																																																																																			ZNF317	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130803		0.515	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF317	HGNC	protein_coding	OTTHUMT00000448995.1	197	0.00	0	-	NM_020933		9271595	9271596	+1	no_errors	ENST00000247956	ensembl	human	known	69_37n	frame_shift_ins	77	43.80	60	INS	0.601:0.025	G
ZNF317	57693	genome.wustl.edu	37	19	9271933	9271934	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:9271933_9271934insA	ENST00000247956.6	+	7	1917_1918	c.1612_1613insA	c.(1612-1614)gccfs	p.A538fs	ZNF317_ENST00000360385.3_Frame_Shift_Ins_p.A506fs	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						CTGTGGGAAGGCCTTCAGCATA	0.579																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		Exception_encountered	19.37:g.9271933_9271934insA	ENSP00000247956:p.Ala538fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A538fs	ENST00000247956.6	37	c.1612_1613	CCDS12210.1	19																																																																																			ZNF317	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130803		0.579	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF317	HGNC	protein_coding	OTTHUMT00000448995.1	153	0.00	0	-	NM_020933		9271933	9271934	+1	no_errors	ENST00000247956	ensembl	human	known	69_37n	frame_shift_ins	83	43.54	64	INS	0.836:0.860	A
ZNF658	26149	genome.wustl.edu	37	9	40774719	40774719	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr9:40774719C>G	ENST00000602553.1	-	5	850	c.556G>C	c.(556-558)Gag>Cag	p.E186Q	ZNF658_ENST00000377626.3_Missense_Mutation_p.E186Q|ZNF658_ENST00000441795.1_Missense_Mutation_p.E184Q			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E186Q(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TAAGATTTCTCTTCAGCATGA	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											13.0	14.0	14.0					9																	40774719		2013	3971	5984	-	-	-	SO:0001583	missense	0			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.556G>C	9.37:g.40774719C>G	ENSP00000473484:p.Glu186Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E186Q	ENST00000602553.1	37	c.556	CCDS35023.1	9	.	.	.	.	.	.	.	.	.	.	c	7.178	0.589080	0.13812	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.06687	3.37;3.27	1.82	0.887	0.19200	.	.	.	.	.	T	0.12347	0.0300	L	0.60845	1.875	0.09310	N	0.999996	B;P	0.51933	0.009;0.949	B;P	0.47118	0.031;0.538	T	0.15150	-1.0447	9	0.62326	D	0.03	.	8.6886	0.34254	0.0:0.7672:0.2328:0.0	.	186;186	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	Q	184;186	ENSP00000408462:E184Q;ENSP00000366853:E186Q	ENSP00000366853:E186Q	E	-	1	0	ZNF658	40764719	0.147000	0.22687	0.004000	0.12327	0.023000	0.10783	2.401000	0.44513	0.326000	0.23384	-1.600000	0.00815	GAG	ZNF658	-	NULL	ENSG00000196409		0.323	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1	29	0.00	0	C	NM_033160		40774719	40774719	-1	no_errors	ENST00000377626	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	0.554	G
ZNF749	388567	genome.wustl.edu	37	19	57953288	57953288	+	Silent	SNP	C	C	T			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr19:57953288C>T	ENST00000334181.4	+	2	301	c.51C>T	c.(49-51)ttC>ttT	p.F17F	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F17F(1)		breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		CCATATATTTCTCCCAAGAGG	0.418																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											241.0	240.0	240.0					19																	57953288		2084	4258	6342	-	-	-	SO:0001819	synonymous_variant	0			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.51C>T	19.37:g.57953288C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F17	ENST00000334181.4	37	c.51	CCDS33132.2	19																																																																																			ZNF749	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000186230		0.418	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF749	HGNC	protein_coding	OTTHUMT00000317879.1	498	0.00	0	C	NM_001023561		57953288	57953288	+1	no_errors	ENST00000334181	ensembl	human	known	69_37n	silent	168	50.30	170	SNP	0.396	T
ZRANB3	84083	genome.wustl.edu	37	2	136023137	136023137	+	Silent	SNP	A	A	C			TCGA-B6-A0I8-01A-11W-A050-09	TCGA-B6-A0I8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ba80b13a-e20a-441b-b845-b617cc861ce7	4ff30155-adbf-49dd-a3f2-d040142f0b6f	g.chr2:136023137A>C	ENST00000264159.6	-	12	1622	c.1506T>G	c.(1504-1506)tcT>tcG	p.S502S	ZRANB3_ENST00000401392.1_Silent_p.S502S|ZRANB3_ENST00000536680.1_Silent_p.S502S	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	502					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.S502S(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		TTAACTCTTCAGAACTGTCAT	0.368																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											112.0	102.0	105.0					2																	136023137		1879	4101	5980	-	-	-	SO:0001819	synonymous_variant	0			AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1506T>G	2.37:g.136023137A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S502	ENST00000264159.6	37	c.1506	CCDS46419.1	2																																																																																			ZRANB3	-	NULL	ENSG00000121988		0.368	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	HGNC	protein_coding	OTTHUMT00000318254.1	139	0.00	0	A	NM_032143		136023137	136023137	-1	no_errors	ENST00000264159	ensembl	human	known	69_37n	silent	96	17.24	20	SNP	0.041	C
