#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL6B	51412	genome.wustl.edu	37	7	100245130	100245131	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr7:100245130_100245131insG	ENST00000160382.5	-	8	801_802	c.695_696insC	c.(694-696)ccafs	p.P232fs		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	232					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TCTTCCAGTTTGGGGGGGCACC	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.696dupC	7.37:g.100245137_100245137dupG	ENSP00000160382:p.Pro232fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2D0|O75421	Frame_Shift_Ins	INS	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.N233fs	ENST00000160382.5	37	c.696_695	CCDS5702.1	7																																																																																			ACTL6B	-	pfam_Actin-like,smart_Actin-like	ENSG00000077080		0.609	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	21	0.00	0	-	NM_016188		100245130	100245131	-1	no_errors	ENST00000160382	ensembl	human	known	69_37n	frame_shift_ins	25	16.67	5	INS	1.000:1.000	G
ADAMTS9	56999	genome.wustl.edu	37	3	64589940	64589940	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr3:64589940G>T	ENST00000498707.1	-	24	3884	c.3542C>A	c.(3541-3543)gCa>gAa	p.A1181E	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.A1153E	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1181					glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A1181E(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GGTTCTTGGTGCACTGTATGT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	89.0	89.0					3																	64589940		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3542C>A	3.37:g.64589940G>T	ENSP00000418735:p.Ala1181Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.A1181E	ENST00000498707.1	37	c.3542	CCDS2903.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.903|2.903	-0.227029|-0.227029	0.06022|0.06022	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000295903;ENST00000498707|ENST00000481060	T;T|.	0.59638|.	0.25;0.27|.	4.92|4.92	-0.708|-0.708	0.11241|0.11241	.|.	0.527453|.	0.19201|.	N|.	0.120195|.	T|T	0.15349|0.15349	0.0370|0.0370	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B|.	0.27416|.	0.001;0.178;0.0|.	B;B;B|.	0.29353|.	0.002;0.101;0.002|.	T|T	0.28808|0.28808	-1.0032|-1.0032	10|5	0.02654|.	T|.	1|.	.|.	5.4893|5.4893	0.16767|0.16767	0.4675:0.149:0.3835:0.0|0.4675:0.149:0.3835:0.0	.|.	1153;1181;1181|.	B7ZVX9;Q9P2N4-1;Q9P2N4|.	.;.;ATS9_HUMAN|.	E|N	1153;1181|237	ENSP00000295903:A1153E;ENSP00000418735:A1181E|.	ENSP00000295903:A1153E|.	A|H	-|-	2|1	0|0	ADAMTS9|ADAMTS9	64564980|64564980	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.282000|0.282000	0.26991|0.26991	1.200000|1.200000	0.32247|0.32247	-0.114000|-0.114000	0.11936|0.11936	-1.223000|-1.223000	0.01593|0.01593	GCA|CAC	ADAMTS9	-	superfamily_Thrombospondin_1_rpt	ENSG00000163638		0.512	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	167	0.00	0	G			64589940	64589940	-1	no_errors	ENST00000498707	ensembl	human	known	69_37n	missense	215	20.37	55	SNP	0.000	T
ANK2	287	genome.wustl.edu	37	4	114199618	114199618	+	Silent	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr4:114199618C>T	ENST00000357077.4	+	17	1838	c.1785C>T	c.(1783-1785)aaC>aaT	p.N595N	ANK2_ENST00000264366.6_Silent_p.N595N|ANK2_ENST00000394537.3_Silent_p.N595N|ANK2_ENST00000506722.1_Silent_p.N574N	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	595					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.N595N(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTTTACAGAACGGCCTTACCC	0.473											OREG0016024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	82.0	86.0					4																	114199618		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1785C>T	4.37:g.114199618C>T		Somatic	1456	WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.N595	ENST00000357077.4	37	c.1785	CCDS3702.1	4																																																																																			ANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.473	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	65	0.00	0	C	NM_001148		114199618	114199618	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	silent	62	27.27	24	SNP	0.988	T
ASXL3	80816	genome.wustl.edu	37	18	31325701	31325701	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr18:31325701C>A	ENST00000269197.5	+	12	5889	c.5889C>A	c.(5887-5889)ttC>ttA	p.F1963L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1963					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F1963L(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CATTTGCCTTCAACAGGCATC	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	103.0	104.0					18																	31325701		1964	4148	6112	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5889C>A	18.37:g.31325701C>A	ENSP00000269197:p.Phe1963Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.F1963L	ENST00000269197.5	37	c.5889	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407992	0.42715	.	.	ENSG00000141431	ENST00000269197	T	0.18174	2.23	5.5	4.63	0.57726	.	.	.	.	.	T	0.11281	0.0275	L	0.27053	0.805	0.34843	D	0.740832	P	0.37061	0.58	B	0.31946	0.138	T	0.19844	-1.0293	9	0.59425	D	0.04	.	8.8439	0.35159	0.0:0.7602:0.0:0.2398	.	1963	Q9C0F0	ASXL3_HUMAN	L	1963	ENSP00000269197:F1963L	ENSP00000269197:F1963L	F	+	3	2	ASXL3	29579699	1.000000	0.71417	0.995000	0.50966	0.579000	0.36224	3.105000	0.50314	1.311000	0.45024	0.591000	0.81541	TTC	ASXL3	-	NULL	ENSG00000141431		0.512	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	58	0.00	0	C			31325701	31325701	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	0.998	A
ATG2A	23130	genome.wustl.edu	37	11	64669591	64669591	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr11:64669591C>T	ENST00000377264.3	-	29	4074	c.3962G>A	c.(3961-3963)aGt>aAt	p.S1321N	ATG2A_ENST00000421419.2_Missense_Mutation_p.S1323N	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1321					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.S1321N(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TGGGGCCCCACTCCGTTCACC	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	85.0	84.0					11																	64669591		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.3962G>A	11.37:g.64669591C>T	ENSP00000366475:p.Ser1321Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.S1323N	ENST00000377264.3	37	c.3968	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	C	14.93	2.680950	0.47886	.	.	ENSG00000110046	ENST00000421419;ENST00000377264	T;T	0.07216	3.21;3.21	4.54	2.64	0.31445	.	0.521935	0.19778	N	0.106289	T	0.08313	0.0207	L	0.60455	1.87	0.44762	D	0.99776	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.16808	-1.0390	10	0.15952	T	0.53	.	7.8001	0.29170	0.0:0.7422:0.165:0.0928	.	1321;1323	Q2TAZ0;Q2TAZ0-3	ATG2A_HUMAN;.	N	1323;1321	ENSP00000410522:S1323N;ENSP00000366475:S1321N	ENSP00000366475:S1321N	S	-	2	0	ATG2A	64426167	0.784000	0.28713	1.000000	0.80357	0.887000	0.51463	3.227000	0.51262	0.463000	0.27118	0.563000	0.77884	AGT	ATG2A	-	NULL	ENSG00000110046		0.627	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	29	0.00	0	C	NM_015104		64669591	64669591	-1	no_errors	ENST00000421419	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	T
ATP2B3	492	genome.wustl.edu	37	X	152807210	152807210	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chrX:152807210G>A	ENST00000349466.2	+	4	816	c.490G>A	c.(490-492)Gtc>Atc	p.V164I	ATP2B3_ENST00000393842.1_Missense_Mutation_p.V164I|ATP2B3_ENST00000359149.3_Missense_Mutation_p.V164I|ATP2B3_ENST00000263519.4_Missense_Mutation_p.V164I|ATP2B3_ENST00000370186.1_Missense_Mutation_p.V164I|ATP2B3_ENST00000370181.2_Missense_Mutation_p.V164I			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	164					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.V164I(4)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTGCTGTCCGTCATCTGTGT	0.607																																						dbGAP											4	Substitution - Missense(4)	breast(4)											122.0	104.0	110.0					X																	152807210		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.490G>A	X.37:g.152807210G>A	ENSP00000343886:p.Val164Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.V164I	ENST00000349466.2	37	c.490	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387399	0.61956	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	5.68	5.68	0.88126	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.137075	0.47455	D	0.000222	D	0.92224	0.7534	L	0.46947	1.48	0.58432	D	0.999996	D;D	0.60575	0.988;0.974	P;P	0.56434	0.798;0.607	D	0.92314	0.5860	10	0.51188	T	0.08	-11.2872	17.3953	0.87443	0.0:0.0:1.0:0.0	.	164;164	Q16720;Q16720-2	AT2B3_HUMAN;.	I	164	ENSP00000359205:V164I;ENSP00000343886:V164I;ENSP00000377425:V164I;ENSP00000352062:V164I;ENSP00000263519:V164I;ENSP00000359200:V164I	ENSP00000263519:V164I	V	+	1	0	ATP2B3	152460404	1.000000	0.71417	0.914000	0.36105	0.319000	0.28217	9.800000	0.99124	2.377000	0.81083	0.600000	0.82982	GTC	ATP2B3	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000067842		0.607	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	40	0.00	0	G	NM_021949		152807210	152807210	+1	no_errors	ENST00000263519	ensembl	human	known	69_37n	missense	26	40.91	18	SNP	1.000	A
BCKDHA	593	genome.wustl.edu	37	19	41932386	41932387	+	IGR	INS	-	-	G	rs565646140|rs201006983		TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr19:41932386_41932387insG	ENST00000269980.2	+	0	2103				B3GNT8_ENST00000601379.1_Intron|B3GNT8_ENST00000321702.2_Frame_Shift_Ins_p.A100fs|CTC-435M10.6_ENST00000598887.1_RNA	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						GTGGCGGCGGCGGCCCCCCAAG	0.688																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41932388_41932388dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DP47|E7EW46|Q16034|Q16472	Frame_Shift_Ins	INS	pfam_Glyco_trans_31	p.A99fs	ENST00000269980.2	37	c.298_297	CCDS12581.1	19																																																																																			B3GNT8	-	NULL	ENSG00000177191		0.688	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT8	HGNC	protein_coding	OTTHUMT00000398313.3	8	0.00	0	-	NM_000709		41932386	41932387	-1	no_errors	ENST00000321702	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.133:0.128	G
BBS2	583	genome.wustl.edu	37	16	56536710	56536710	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr16:56536710C>T	ENST00000245157.5	-	8	1235	c.815G>A	c.(814-816)cGa>cAa	p.R272Q	BBS2_ENST00000561951.1_5'UTR|BBS2_ENST00000568104.1_Missense_Mutation_p.R272Q	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	272					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.R272Q(2)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						TCGGTCACTTCGAGCATCAAC	0.363									Bardet-Biedl syndrome																													dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											58.0	55.0	56.0					16																	56536710		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.815G>A	16.37:g.56536710C>T	ENSP00000245157:p.Arg272Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CM0|Q96SN9	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_2_prot	p.R272Q	ENST00000245157.5	37	c.815	CCDS32451.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.651686	0.96714	.	.	ENSG00000125124	ENST00000245157	T	0.65549	-0.16	5.92	5.92	0.95590	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.82107	0.4965	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79550	-0.1757	10	0.33141	T	0.24	-6.7716	20.3207	0.98668	0.0:1.0:0.0:0.0	.	272;272	A8K0N9;Q9BXC9	.;BBS2_HUMAN	Q	272	ENSP00000245157:R272Q	ENSP00000245157:R272Q	R	-	2	0	BBS2	55094211	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.768000	0.85345	2.813000	0.96785	0.561000	0.74099	CGA	BBS2	-	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_2_prot	ENSG00000125124		0.363	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS2	HGNC	protein_coding	OTTHUMT00000434386.2	104	0.95	1	C	NM_031885		56536710	56536710	-1	no_errors	ENST00000245157	ensembl	human	known	69_37n	missense	94	23.58	29	SNP	1.000	T
BCL2L13	23786	genome.wustl.edu	37	22	18209657	18209657	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr22:18209657G>T	ENST00000317582.5	+	7	1162	c.815G>T	c.(814-816)gGc>gTc	p.G272V	BCL2L13_ENST00000485631.1_3'UTR|BCL2L13_ENST00000337612.5_Missense_Mutation_p.G110V|BCL2L13_ENST00000543133.1_Missense_Mutation_p.G110V|BCL2L13_ENST00000538149.1_Missense_Mutation_p.G148V|BCL2L13_ENST00000355028.3_3'UTR|BCL2L13_ENST00000418951.2_3'UTR	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	272					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.G272V(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		GTGTCACTAGGCCCTGAGTCC	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	49.0	53.0					22																	18209657		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.815G>T	22.37:g.18209657G>T	ENSP00000318883:p.Gly272Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Missense_Mutation	SNP	pfam_Bcl2_BH,pfscan_Bcl2-like_apoptosis	p.G272V	ENST00000317582.5	37	c.815	CCDS13746.1	22	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619841	0.87460	.	.	ENSG00000099968	ENST00000317582;ENST00000543133;ENST00000538149;ENST00000337612	T;T;T;T	0.61392	1.46;0.13;0.11;0.13	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.75722	0.3888	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75218	-0.3395	10	0.59425	D	0.04	-10.9085	20.1577	0.98120	0.0:0.0:1.0:0.0	.	148;272	B7Z238;Q9BXK5	.;B2L13_HUMAN	V	272;110;148;110	ENSP00000318883:G272V;ENSP00000437667:G110V;ENSP00000441344:G148V;ENSP00000338932:G110V	ENSP00000318883:G272V	G	+	2	0	BCL2L13	16589657	1.000000	0.71417	0.935000	0.37517	0.625000	0.37756	8.917000	0.92751	2.767000	0.95098	0.655000	0.94253	GGC	BCL2L13	-	NULL	ENSG00000099968		0.512	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L13	HGNC	protein_coding	OTTHUMT00000316184.1	58	0.00	0	G	NM_015367		18209657	18209657	+1	no_errors	ENST00000317582	ensembl	human	known	69_37n	missense	18	61.70	29	SNP	1.000	T
BLCAP	10904	genome.wustl.edu	37	20	36147543	36147543	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr20:36147543G>C	ENST00000373537.2	-	2	348	c.34C>G	c.(34-36)Ctc>Gtc	p.L12V	BLCAP_ENST00000397134.1_Missense_Mutation_p.L12V|BLCAP_ENST00000414542.2_Missense_Mutation_p.L12V|BLCAP_ENST00000397137.1_Missense_Mutation_p.L12V|NNAT_ENST00000062104.2_5'Flank|BLCAP_ENST00000397131.1_Missense_Mutation_p.L12V|BLCAP_ENST00000397135.1_Missense_Mutation_p.L12V|NNAT_ENST00000346199.2_5'Flank	NM_001167823.1|NM_006698.3	NP_001161295.1|NP_006689.1	P62952	BLCAP_HUMAN	bladder cancer associated protein	12					apoptotic nuclear changes (GO:0030262)|cell cycle (GO:0007049)	integral component of membrane (GO:0016021)		p.L12V(1)		breast(1)|large_intestine(1)|lung(2)|stomach(1)	5		Myeloproliferative disorder(115;0.00878)				TTGGGGATGAGGAGGACGGGC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											17.0	20.0	19.0					20																	36147543		2202	4296	6498	-	-	-	SO:0001583	missense	0			AF053470	CCDS13295.1	20q11.23	2006-01-29			ENSG00000166619	ENSG00000166619			1055	protein-coding gene	gene with protein product		613110				10197429	Standard	NM_006698		Approved	BC10	uc021wdf.1	P62952	OTTHUMG00000032419	ENST00000373537.2:c.34C>G	20.37:g.36147543G>C	ENSP00000362637:p.Leu12Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2K7|O60629|Q9D3B5	Missense_Mutation	SNP	pfam_BC10-like	p.L12V	ENST00000373537.2	37	c.34	CCDS13295.1	20	.	.	.	.	.	.	.	.	.	.	G	17.07	3.296107	0.60086	.	.	ENSG00000166619	ENST00000373537;ENST00000397137;ENST00000414542;ENST00000397135;ENST00000397134;ENST00000397131;ENST00000432507;ENST00000445723;ENST00000414080	.	.	.	5.16	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.79076	0.4385	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.82396	-0.0478	8	0.87932	D	0	-11.5289	13.5694	0.61836	0.0:0.1569:0.8431:0.0	.	12	P62952	BLCAP_HUMAN	V	12	.	ENSP00000362637:L12V	L	-	1	0	BLCAP	35580957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.751000	0.85126	1.390000	0.46547	0.585000	0.79938	CTC	BLCAP	-	pfam_BC10-like	ENSG00000166619		0.617	BLCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLCAP	HGNC	protein_coding	OTTHUMT00000079113.2	40	0.00	0	G	NM_006698		36147543	36147543	-1	no_errors	ENST00000373537	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	C
C16orf78	123970	genome.wustl.edu	37	16	49433130	49433130	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr16:49433130G>A	ENST00000299191.3	+	5	856	c.739G>A	c.(739-741)Gtc>Atc	p.V247I		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	247						nucleus (GO:0005634)		p.V247I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						CCCCCACATGGTCGAAGAGGA	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	119.0	128.0					16																	49433130		2199	4300	6499	-	-	-	SO:0001583	missense	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.739G>A	16.37:g.49433130G>A	ENSP00000299191:p.Val247Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V247I	ENST00000299191.3	37	c.739	CCDS10738.1	16	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975746	0.34848	.	.	ENSG00000166152	ENST00000299191	T	0.52057	0.68	5.26	-5.34	0.02705	.	1.337470	0.05343	N	0.530491	T	0.43144	0.1234	M	0.63428	1.95	0.19300	N	0.999971	B	0.23891	0.093	B	0.19666	0.026	T	0.39522	-0.9610	9	.	.	.	-14.2465	12.5031	0.55966	0.7547:0.0:0.2453:0.0	.	247	Q8WTQ4	CP078_HUMAN	I	247	ENSP00000299191:V247I	.	V	+	1	0	C16orf78	47990631	0.095000	0.21747	0.006000	0.13384	0.272000	0.26649	0.109000	0.15417	-0.892000	0.03935	-0.258000	0.10820	GTC	C16orf78	-	NULL	ENSG00000166152		0.493	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1	110	0.00	0	G	NM_144602		49433130	49433130	+1	no_errors	ENST00000299191	ensembl	human	known	69_37n	missense	132	15.38	24	SNP	0.002	A
CNOT11	55571	genome.wustl.edu	37	2	101879132	101879132	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr2:101879132G>A	ENST00000289382.3	+	3	974	c.811G>A	c.(811-813)Gga>Aga	p.G271R		NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	271					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.G271R(2)									TTTAGTCAGCGGACCAAAGCC	0.418																																						dbGAP											2	Substitution - Missense(2)	ovary(1)|breast(1)											61.0	62.0	62.0					2																	101879132		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.811G>A	2.37:g.101879132G>A	ENSP00000289382:p.Gly271Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2M9|Q8N681	Missense_Mutation	SNP	pfam_DUF2363	p.G271R	ENST00000289382.3	37	c.811	CCDS2050.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.575661	0.96553	.	.	ENSG00000158435	ENST00000289382	T	0.34667	1.35	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	L	0.61036	1.89	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.43540	-0.9385	10	0.16420	T	0.52	-18.9532	20.3931	0.98965	0.0:0.0:1.0:0.0	.	271	Q9UKZ1	CB029_HUMAN	R	271	ENSP00000289382:G271R	ENSP00000289382:G271R	G	+	1	0	C2orf29	101245564	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.731000	0.98807	2.824000	0.97209	0.655000	0.94253	GGA	C2orf29	-	NULL	ENSG00000158435		0.418	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf29	HGNC	protein_coding	OTTHUMT00000253181.1	188	0.00	0	G	NM_017546		101879132	101879132	+1	no_errors	ENST00000289382	ensembl	human	known	69_37n	missense	73	27.00	27	SNP	1.000	A
C9orf153	389766	genome.wustl.edu	37	9	88842313	88842313	+	Splice_Site	SNP	T	T	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr9:88842313T>A	ENST00000376001.3	-	4	323		c.e4-2		C9orf153_ENST00000339137.3_Intron|C9orf153_ENST00000469914.1_Intron	NM_001276366.1	NP_001263295.1	Q5TBE3	CI153_HUMAN	chromosome 9 open reading frame 153									p.?(1)		breast(1)|lung(1)	2						TTATTGACACTGTATAAAGCA	0.318																																						dbGAP											1	Unknown(1)	breast(1)											76.0	76.0	76.0					9																	88842313		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0				CCDS35055.1, CCDS35055.2	9q22.1	2012-04-03			ENSG00000187753	ENSG00000187753			31456	protein-coding gene	gene with protein product							Standard	NM_001276366		Approved	bA507D14.1	uc031teh.1	Q5TBE3	OTTHUMG00000020134	ENST00000376001.3:c.243-2A>T	9.37:g.88842313T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBE4	Splice_Site	SNP	-	e3-2	ENST00000376001.3	37	c.243-2	CCDS35055.1	9	.	.	.	.	.	.	.	.	.	.	T	1.848	-0.465848	0.04476	.	.	ENSG00000187753	ENST00000376001	.	.	.	1.27	-1.72	0.08107	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.1848	0.03883	0.0:0.2572:0.3224:0.4204	.	.	.	.	.	-1	.	.	.	-	.	.	C9orf153	88032133	0.000000	0.05858	0.000000	0.03702	0.138000	0.21146	-0.251000	0.08818	-0.439000	0.07222	0.113000	0.15668	.	C9orf153	-	-	ENSG00000187753		0.318	C9orf153-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	C9orf153	HGNC	protein_coding	OTTHUMT00000052913.1	53	0.00	0	T	NM_001010907	Intron	88842313	88842313	-1	no_errors	ENST00000376001	ensembl	human	known	69_37n	splice_site	35	28.57	14	SNP	0.000	A
DAAM1	23002	genome.wustl.edu	37	14	59792440	59792440	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr14:59792440T>A	ENST00000395125.1	+	8	1071	c.1048T>A	c.(1048-1050)Ttt>Att	p.F350I	DAAM1_ENST00000360909.3_Missense_Mutation_p.F350I|DAAM1_ENST00000351081.1_Missense_Mutation_p.F350I	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	350	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)	p.F350I(1)		breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TGCCAAAAGATTTGAACTGGT	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	125.0	125.0					14																	59792440		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1048T>A	14.37:g.59792440T>A	ENSP00000378557:p.Phe350Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_Actin-bd_FH2/DRF_autoreg	p.F350I	ENST00000395125.1	37	c.1048	CCDS9737.1	14	.	.	.	.	.	.	.	.	.	.	T	23.2	4.383110	0.82792	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	D;D;D	0.84223	-1.82;-1.82;-1.82	5.35	5.35	0.76521	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84951	0.5586	M	0.76170	2.325	0.80722	D	1	B;B	0.31705	0.288;0.336	B;B	0.30716	0.073;0.119	D	0.84620	0.0683	10	0.48119	T	0.1	.	15.79	0.78350	0.0:0.0:0.0:1.0	.	350;350	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	I	350	ENSP00000354162:F350I;ENSP00000247170:F350I;ENSP00000378557:F350I	ENSP00000247170:F350I	F	+	1	0	DAAM1	58862193	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.825000	0.86693	2.371000	0.80710	0.533000	0.62120	TTT	DAAM1	-	pfam_Drf_FH3,superfamily_ARM-type_fold	ENSG00000100592		0.328	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2	288	0.00	0	T	NM_014992		59792440	59792440	+1	no_errors	ENST00000351081	ensembl	human	known	69_37n	missense	145	33.79	74	SNP	1.000	A
DISP2	85455	genome.wustl.edu	37	15	40660037	40660038	+	Frame_Shift_Ins	INS	-	-	G	rs75662097	byFrequency	TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr15:40660037_40660038insG	ENST00000267889.3	+	8	1811_1812	c.1724_1725insG	c.(1723-1728)tcggggfs	p.SG575fs	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	575	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CAGCTGCCGTCGGGGGGGCTGG	0.663																																						dbGAP											0										16,4240		0,16,2112						5.6	0.9			24	14,8234		0,14,4110	no	frameshift	DISP2	NM_033510.1		0,30,6222	A1A1,A1R,RR		0.1697,0.3759,0.2399				30,12474				-	-	-	SO:0001589	frameshift_variant	0			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.1731dupG	15.37:g.40660044_40660044dupG	ENSP00000267889:p.Ser575fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHW3|Q9C0C1	Frame_Shift_Ins	INS	pfscan_SSD	p.L578fs	ENST00000267889.3	37	c.1724_1725	CCDS10056.1	15																																																																																			DISP2	-	pfscan_SSD	ENSG00000140323		0.663	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DISP2	HGNC	protein_coding	OTTHUMT00000252249.1	18	0.00	0	-	NM_033510		40660037	40660038	+1	no_errors	ENST00000267889	ensembl	human	known	69_37n	frame_shift_ins	15	16.67	3	INS	0.288:0.002	G
EEF2K	29904	genome.wustl.edu	37	16	22268146	22268146	+	Silent	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr16:22268146C>T	ENST00000263026.5	+	7	1170	c.696C>T	c.(694-696)atC>atT	p.I232I		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	232	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)	p.I232I(2)		breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		AGCACTACATCGAGGGCAAGT	0.592																																					NSCLC(195;1411 2157 20319 27471 51856)	dbGAP											2	Substitution - coding silent(2)	breast(2)											142.0	100.0	114.0					16																	22268146		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.696C>T	16.37:g.22268146C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N588	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Sel1-like,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	p.I232	ENST00000263026.5	37	c.696	CCDS10604.1	16																																																																																			EEF2K	-	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	ENSG00000103319		0.592	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2K	HGNC	protein_coding	OTTHUMT00000211580.2	64	0.00	0	C	NM_013302		22268146	22268146	+1	no_errors	ENST00000263026	ensembl	human	known	69_37n	silent	56	20.00	14	SNP	0.984	T
NUTM2B	729262	genome.wustl.edu	37	10	81465816	81465816	+	Missense_Mutation	SNP	C	C	T	rs199845914	byFrequency	TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr10:81465816C>T	ENST00000429828.1	+	2	784	c.401C>T	c.(400-402)cCg>cTg	p.P134L	RP11-119F19.2_ENST00000601369.1_RNA|NUTM2B_ENST00000372321.1_Missense_Mutation_p.P67L|NUTM2B_ENST00000448135.1_Missense_Mutation_p.P134L|RP11-119F19.2_ENST00000596088.1_RNA|RP11-119F19.2_ENST00000600376.1_RNA	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	134																	GTGCTGGGACCGGGCGTGACC	0.627																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.401C>T	10.37:g.81465816C>T	ENSP00000394623:p.Pro134Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM73	Missense_Mutation	SNP	NULL	p.P134L	ENST00000429828.1	37	c.401		10	.	.	.	.	.	.	.	.	.	.	.	6.703	0.498388	0.12762	.	.	ENSG00000188199	ENST00000448135;ENST00000429828;ENST00000372321	T;T;T	0.25912	1.77;1.77;1.77	1.56	-1.09	0.09904	.	.	.	.	.	T	0.22437	0.0541	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30387	-0.9980	6	0.56958	D	0.05	.	4.3658	0.11223	0.0:0.4808:0.0:0.5192	.	.	.	.	L	134;134;67	ENSP00000391631:P134L;ENSP00000394623:P134L;ENSP00000361396:P67L	ENSP00000361396:P67L	P	+	2	0	FAM22B	81135822	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.029000	0.12329	-0.211000	0.10124	0.391000	0.25812	CCG	FAM22B	-	NULL	ENSG00000188199		0.627	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	FAM22B	HGNC	protein_coding		8	0.00	0	C	NG_012780		81465816	81465816	+1	no_errors	ENST00000429828	ensembl	human	known	69_37n	missense	8	55.56	10	SNP	0.000	T
FLG	2312	genome.wustl.edu	37	1	152285981	152285981	+	Missense_Mutation	SNP	G	G	A	rs184361545	byFrequency	TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr1:152285981G>A	ENST00000368799.1	-	3	1416	c.1381C>T	c.(1381-1383)Cgg>Tgg	p.R461W	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	461	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R461W(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTCCAGACCGTTCCCCTGAC	0.582									Ichthyosis				-|||	2	0.000399361	0.0008	0.0	5008	,	,		18528	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											211.0	203.0	206.0					1																	152285981		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1381C>T	1.37:g.152285981G>A	ENSP00000357789:p.Arg461Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.R461W	ENST00000368799.1	37	c.1381	CCDS30860.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	-	9.622	1.134186	0.21123	.	.	ENSG00000143631	ENST00000368799	T	0.01767	4.65	2.8	-3.69	0.04450	.	.	.	.	.	T	0.02047	0.0064	M	0.63428	1.95	0.09310	N	1	D	0.89917	1.0	D	0.74023	0.982	T	0.28713	-1.0035	9	0.66056	D	0.02	.	4.2997	0.10918	0.0:0.3397:0.3907:0.2695	.	461	P20930	FILA_HUMAN	W	461	ENSP00000357789:R461W	ENSP00000357789:R461W	R	-	1	2	FLG	150552605	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.324000	0.00512	-0.817000	0.04335	-0.464000	0.05259	CGG	FLG	-	NULL	ENSG00000143631		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	196	0.00	0	G	NM_002016		152285981	152285981	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	153	33.19	76	SNP	0.000	A
GPR52	9293	genome.wustl.edu	37	1	174417411	174417411	+	Silent	SNP	C	C	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr1:174417411C>A	ENST00000367685.2	+	1	200	c.162C>A	c.(160-162)atC>atA	p.I54I	RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000251507.4_Intron|RABGAP1L_ENST00000357444.6_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	54					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.I54I(1)		breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						CATTTCTGATCATTGCTGGGA	0.443																																					Ovarian(92;924 1390 1930 16467 40583)	dbGAP											1	Substitution - coding silent(1)	breast(1)											282.0	246.0	258.0					1																	174417411		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.162C>A	1.37:g.174417411C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75654|Q4VBL6|Q6ISM0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.I54	ENST00000367685.2	37	c.162	CCDS30941.1	1																																																																																			GPR52	-	prints_7TM_GPCR_Rhodpsn	ENSG00000203737		0.443	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR52	HGNC	protein_coding	OTTHUMT00000084511.1	284	0.00	0	C	NM_005684		174417411	174417411	+1	no_errors	ENST00000367685	ensembl	human	known	69_37n	silent	182	35.66	102	SNP	1.000	A
IGKV2D-26	28884	genome.wustl.edu	37	2	90025217	90025218	+	RNA	INS	-	-	C	rs187527217	byFrequency	TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr2:90025217_90025218insC	ENST00000390268.2	+	0	95_96									immunoglobulin kappa variable 2D-26																		AGTGCAGAGATTGTGATGACCC	0.416																																						dbGAP											0																																										-	-	-			0			X12689		2p11.2	2012-02-08			ENSG00000211623	ENSG00000211623		"""Immunoglobulins / IGK locus"""	5798	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151606		2.37:g.90025217_90025218insC		Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V23fs	ENST00000390268.2	37	c.65_66		2																																																																																			IGKV2D-26	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211623		0.416	IGKV2D-26-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV2D-26	HGNC	IG_V_gene	OTTHUMT00000323278.2	168	0.00	0	-	NG_000833		90025217	90025218	+1	no_stop_codon	ENST00000390268	ensembl	human	known	69_37n	frame_shift_ins	202	19.52	49	INS	0.000:0.000	C
ITGB7	3695	genome.wustl.edu	37	12	53594062	53594063	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr12:53594062_53594063insC	ENST00000267082.5	-	3	396_397	c.165_166insG	c.(163-168)atcctcfs	p.L56fs	ITGB7_ENST00000550743.2_Frame_Shift_Ins_p.L56fs|ITGB7_ENST00000338737.4_Frame_Shift_Ins_p.L56fs|ITGB7_ENST00000422257.3_Frame_Shift_Ins_p.L56fs	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	56					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGGTGTGAGAGGATGCACTTCT	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.165_166insG	12.37:g.53594062_53594063insC	ENSP00000267082:p.Leu56fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UCP7|Q9UCS7	Frame_Shift_Ins	INS	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Plexin-like_fold,superfamily_Integrin_bsu_tail,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.L55fs	ENST00000267082.5	37	c.166_165	CCDS8849.1	12																																																																																			ITGB7	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	ENSG00000139626		0.540	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB7	HGNC	protein_coding	OTTHUMT00000405821.2	113	0.00	0	-			53594062	53594063	-1	no_errors	ENST00000267082	ensembl	human	known	69_37n	frame_shift_ins	85	80.46	350	INS	0.994:0.997	C
LRRC43	254050	genome.wustl.edu	37	12	122669187	122669187	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr12:122669187G>A	ENST00000339777.4	+	2	300	c.272G>A	c.(271-273)cGc>cAc	p.R91H	LRRC43_ENST00000425921.1_5'UTR	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	91								p.R91H(1)		NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GTCCGCAGCCGCCACTCCCCC	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	42.0	41.0					12																	122669187		1948	4134	6082	-	-	-	SO:0001583	missense	0			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.272G>A	12.37:g.122669187G>A	ENSP00000344233:p.Arg91His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZVT9	Missense_Mutation	SNP	NULL	p.R91H	ENST00000339777.4	37	c.272	CCDS45001.1	12	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907017	0.52333	.	.	ENSG00000158113	ENST00000339777	T	0.55588	0.51	4.94	0.924	0.19418	.	.	.	.	.	T	0.23649	0.0572	N	0.08118	0	0.58432	D	0.999993	B	0.33807	0.426	B	0.11329	0.006	T	0.03981	-1.0987	9	0.52906	T	0.07	-2.3834	5.9409	0.19192	0.1277:0.4215:0.3783:0.0725	.	91	Q8N309	LRC43_HUMAN	H	91	ENSP00000344233:R91H	ENSP00000344233:R91H	R	+	2	0	LRRC43	121235140	0.001000	0.12720	0.996000	0.52242	0.951000	0.60555	-0.107000	0.10873	0.125000	0.18397	-0.384000	0.06662	CGC	LRRC43	-	NULL	ENSG00000158113		0.607	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	HGNC	protein_coding	OTTHUMT00000401589.1	98	0.00	0	G	NM_152759		122669187	122669187	+1	no_errors	ENST00000339777	ensembl	human	known	69_37n	missense	80	32.20	38	SNP	0.836	A
MED12	9968	genome.wustl.edu	37	X	70344907	70344907	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chrX:70344907C>T	ENST00000374080.3	+	15	2169	c.2137C>T	c.(2137-2139)Cca>Tca	p.P713S	MED12_ENST00000333646.6_Missense_Mutation_p.P713S|MED12_ENST00000374102.1_Missense_Mutation_p.P713S			Q93074	MED12_HUMAN	mediator complex subunit 12	713					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.P713S(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GGTGAAGCCCCCACCCAAGGA	0.557			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	2	Substitution - Missense(2)	breast(2)											68.0	63.0	65.0					X																	70344907		1941	4128	6069	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2137C>T	X.37:g.70344907C>T	ENSP00000363193:p.Pro713Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.P713S	ENST00000374080.3	37	c.2137	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	2.820	-0.245015	0.05906	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.27104	1.69;1.69;1.69;1.69	4.9	4.02	0.46733	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.699450	0.14820	N	0.296529	T	0.17023	0.0409	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.10296	0.001;0.0;0.002;0.003	B;B;B;B	0.19666	0.005;0.003;0.012;0.026	T	0.21759	-1.0236	10	0.07325	T	0.83	-0.8269	13.7548	0.62930	0.1548:0.8452:0.0:0.0	.	713;560;713;713	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	S	713;713;713;713;681	ENSP00000333125:P713S;ENSP00000363215:P713S;ENSP00000363193:P713S;ENSP00000414203:P681S	ENSP00000333125:P713S	P	+	1	0	MED12	70261632	0.003000	0.15002	0.997000	0.53966	0.991000	0.79684	1.558000	0.36309	1.037000	0.40024	0.529000	0.55759	CCA	MED12	-	pfam_Mediator_Med12_LCEWAV	ENSG00000184634		0.557	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	267	0.00	0	C	NM_005120		70344907	70344907	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	246	33.96	127	SNP	0.162	T
MRC1	4360	genome.wustl.edu	37	10	18155491	18155491	+	Splice_Site	SNP	G	G	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr10:18155491G>A	ENST00000239761.3	+	12	1887	c.1784G>A	c.(1783-1785)gGg>gAg	p.G595E	RP11-457D2.3_ENST00000442231.1_RNA	NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	595	C-type lectin 3. {ECO:0000255|PROSITE- ProRule:PRU00040}.				receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.G595E(1)		breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						TTTAATGCAGGGCGAAAGCCA	0.493																																					GBM(115;1153 1594 28187 28781 35884)	dbGAP											1	Substitution - Missense(1)	breast(1)											6.0	6.0	6.0					10																	18155491		1955	3286	5241	-	-	-	SO:0001630	splice_region_variant	0			J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.1784-1G>A	10.37:g.18155491G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKW3|Q5VSJ2|Q5VSK2	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.G595E	ENST00000239761.3	37	c.1784	CCDS7123.1	10	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265529	0.40095	.	.	ENSG00000120586	ENST00000239761	T	0.18810	2.19	3.95	3.95	0.45737	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.53938	U	0.000052	T	0.27765	0.0683	N	0.16130	0.375	0.49798	D	0.999825	D	0.71674	0.998	D	0.70935	0.971	T	0.12319	-1.0552	9	.	.	.	.	16.5219	0.84319	0.0:0.0:1.0:0.0	.	595	P22897	MRC1_HUMAN	E	595	ENSP00000239761:G595E	.	G	+	2	0	MRC1	18195497	1.000000	0.71417	0.817000	0.32601	0.091000	0.18340	6.644000	0.74338	2.184000	0.69523	0.436000	0.28706	GGG	MRC1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000120586		0.493	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC1	HGNC	protein_coding	OTTHUMT00000047057.1	60	0.00	0	G	NM_002438	Missense_Mutation	18155491	18155491	+1	no_errors	ENST00000239761	ensembl	human	known	69_37n	missense	16	77.14	54	SNP	0.997	A
MYO3A	53904	genome.wustl.edu	37	10	26243889	26243889	+	Silent	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr10:26243889C>T	ENST00000265944.5	+	4	421	c.255C>T	c.(253-255)taC>taT	p.Y85Y	MYO3A_ENST00000376301.1_Silent_p.Y85Y|MYO3A_ENST00000543632.1_Silent_p.Y85Y|MYO3A_ENST00000376302.1_Silent_p.Y85Y	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	85	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Y85Y(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						ATGGGATATACTTTAAGAAGG	0.378																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											140.0	142.0	141.0					10																	26243889		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.255C>T	10.37:g.26243889C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.Y85	ENST00000265944.5	37	c.255	CCDS7148.1	10																																																																																			MYO3A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095777		0.378	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	230	0.00	0	C	NM_017433		26243889	26243889	+1	no_errors	ENST00000265944	ensembl	human	known	69_37n	silent	204	14.29	34	SNP	1.000	T
NPFFR2	10886	genome.wustl.edu	37	4	72897694	72897694	+	Missense_Mutation	SNP	G	G	C	rs71655703		TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr4:72897694G>C	ENST00000308744.6	+	1	174	c.76G>C	c.(76-78)Gag>Cag	p.E26Q	NPFFR2_ENST00000344413.5_Missense_Mutation_p.E26Q	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	26					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ACCGGACAAGGAGGCGGGGAG	0.667																																						dbGAP											0													34.0	40.0	38.0					4																	72897694		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.76G>C	4.37:g.72897694G>C	ENSP00000307822:p.Glu26Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96RV1|Q9NR49	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NPFF_rcpt_2,prints_NPFF_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.E26Q	ENST00000308744.6	37	c.76	CCDS3551.1	4	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386286	0.25031	.	.	ENSG00000056291	ENST00000308744;ENST00000344413	T	0.75367	-0.93	3.43	0.667	0.17907	.	.	.	.	.	T	0.46092	0.1375	N	0.08118	0	0.09310	N	1	B	0.33694	0.421	B	0.26864	0.074	T	0.33904	-0.9850	9	0.44086	T	0.13	.	2.8326	0.05505	0.2459:0.0:0.5335:0.2206	.	26	Q9Y5X5	NPFF2_HUMAN	Q	26	ENSP00000307822:E26Q	ENSP00000307822:E26Q	E	+	1	0	NPFFR2	73116558	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.133000	0.15912	0.108000	0.17862	-0.516000	0.04426	GAG	NPFFR2	-	NULL	ENSG00000056291		0.667	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	NPFFR2	HGNC	protein_coding	OTTHUMT00000252170.2	65	0.00	0	G	NM_004885		72897694	72897694	+1	no_errors	ENST00000308744	ensembl	human	known	69_37n	missense	53	26.39	19	SNP	0.000	C
NPTX2	4885	genome.wustl.edu	37	7	98254285	98254285	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr7:98254285G>A	ENST00000265634.3	+	3	860	c.695G>A	c.(694-696)cGc>cAc	p.R232H		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	232	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.R232H(1)		breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CTCCCACTCCGCACAAACTAC	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											229.0	184.0	199.0					7																	98254285		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.695G>A	7.37:g.98254285G>A	ENSP00000265634:p.Arg232His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.R232H	ENST00000265634.3	37	c.695	CCDS5657.1	7	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322440	0.81580	.	.	ENSG00000106236	ENST00000265634	T	0.16073	2.37	5.57	5.57	0.84162	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.56171	0.1967	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68977	-0.5267	10	0.87932	D	0	-16.1906	18.5305	0.90990	0.0:0.0:1.0:0.0	.	232	P47972	NPTX2_HUMAN	H	232	ENSP00000265634:R232H	ENSP00000265634:R232H	R	+	2	0	NPTX2	98092221	1.000000	0.71417	0.984000	0.44739	0.246000	0.25737	9.813000	0.99286	2.619000	0.88677	0.561000	0.74099	CGC	NPTX2	-	superfamily_ConA-like_lec_gl,smart_Pentaxin	ENSG00000106236		0.597	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX2	HGNC	protein_coding	OTTHUMT00000334982.1	15	0.00	0	G	NM_002523		98254285	98254285	+1	no_errors	ENST00000265634	ensembl	human	known	69_37n	missense	11	45.00	9	SNP	1.000	A
NSMCE4A	54780	genome.wustl.edu	37	10	123719061	123719062	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr10:123719061_123719062delTT	ENST00000369023.3	-	9	1088_1089	c.1037_1038delAA	c.(1036-1038)caafs	p.Q346fs	NSMCE4A_ENST00000489266.1_5'UTR	NM_001167865.1|NM_017615.2	NP_001161337.1|NP_060085.2	Q9NXX6	NSE4A_HUMAN	non-SMC element 4 homolog A (S. cerevisiae)	346					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of response to DNA damage stimulus (GO:2001022)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)		p.Q346fs*2(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	6		all_neural(114;0.138)|Glioma(114;0.222)				GATTTCTAACTTGTGTGTTATG	0.371																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF258584	CCDS7624.1	10q26.13	2007-05-17	2006-11-24	2006-11-24	ENSG00000107672	ENSG00000107672			25935	protein-coding gene	gene with protein product		612987	"""chromosome 10 open reading frame 86"""	C10orf86		15752197	Standard	NM_017615		Approved	FLJ20003, bA500G22.3, NSE4A	uc001lfs.3	Q9NXX6	OTTHUMG00000019180	ENST00000369023.3:c.1037_1038delAA	10.37:g.123719061_123719062delTT	ENSP00000358019:p.Gln346fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQQ5|Q6P673|Q8WY66|Q9BS90	Frame_Shift_Del	DEL	pfam_Nse4	p.Q346fs	ENST00000369023.3	37	c.1038_1037	CCDS7624.1	10																																																																																			NSMCE4A	-	pfam_Nse4	ENSG00000107672		0.371	NSMCE4A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMCE4A	HGNC	protein_coding	OTTHUMT00000050749.1	567	0.00	0	TT	NM_017615		123719061	123719062	-1	no_errors	ENST00000369023	ensembl	human	known	69_37n	frame_shift_del	329	25.43	119	DEL	0.220:0.489	-
OR2T3	343173	genome.wustl.edu	37	1	248636826	248636826	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr1:248636826C>T	ENST00000359594.2	+	1	200	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R59C(1)		breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCAGAGCCCCGCCTCCACAC	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											12.0	9.0	10.0					1																	248636826		2131	4000	6131	-	-	-	SO:0001583	missense	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.175C>T	1.37:g.248636826C>T	ENSP00000352604:p.Arg59Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R59C	ENST00000359594.2	37	c.175	CCDS31117.1	1	.	.	.	.	.	.	.	.	.	.	c	10.66	1.413949	0.25465	.	.	ENSG00000196539	ENST00000359594	T	0.00588	6.37	2.65	1.67	0.24075	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00815	0.0027	M	0.69185	2.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42378	-0.9455	9	0.62326	D	0.03	.	6.1407	0.20259	0.214:0.5773:0.2087:0.0	.	59	Q8NH03	OR2T3_HUMAN	C	59	ENSP00000352604:R59C	ENSP00000352604:R59C	R	+	1	0	OR2T3	246703449	0.000000	0.05858	0.005000	0.12908	0.414000	0.31173	-0.970000	0.03810	0.192000	0.20272	0.186000	0.17326	CGC	OR2T3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196539		0.572	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	367	0.27	1	C	NM_001005495		248636826	248636826	+1	no_errors	ENST00000359594	ensembl	human	known	69_37n	missense	393	20.12	99	SNP	0.001	T
PDS5B	23047	genome.wustl.edu	37	13	33344430	33344430	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr13:33344430G>C	ENST00000315596.10	+	32	3982	c.3796G>C	c.(3796-3798)Gag>Cag	p.E1266Q		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1266					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.E1266Q(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GCAGTGGCCTGAGGAAAAGAG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	65.0	64.0					13																	33344430		1917	4132	6049	-	-	-	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.3796G>C	13.37:g.33344430G>C	ENSP00000313851:p.Glu1266Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1266Q	ENST00000315596.10	37	c.3796	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	G	15.56	2.869432	0.51588	.	.	ENSG00000083642	ENST00000315596;ENST00000421084;ENST00000447833	.	.	.	6.08	6.08	0.98989	.	0.050187	0.85682	D	0.000000	T	0.42607	0.1210	N	0.12182	0.205	0.52501	D	0.999958	B	0.22604	0.072	B	0.24394	0.053	T	0.26258	-1.0108	9	0.19147	T	0.46	-0.4528	18.8526	0.92238	0.0:0.0:1.0:0.0	.	1266	Q9NTI5	PDS5B_HUMAN	Q	1266;1266;218	.	ENSP00000313851:E1266Q	E	+	1	0	PDS5B	32242430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.930000	0.87610	2.894000	0.99253	0.591000	0.81541	GAG	PDS5B	-	NULL	ENSG00000083642		0.448	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	145	0.00	0	G	NM_015032		33344430	33344430	+1	no_errors	ENST00000315596	ensembl	human	known	69_37n	missense	64	28.89	26	SNP	1.000	C
PGK1	5230	genome.wustl.edu	37	X	77378339	77378339	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chrX:77378339G>T	ENST00000373316.4	+	7	816	c.649G>T	c.(649-651)Gtt>Ttt	p.V217F	PGK1_ENST00000442431.1_Missense_Mutation_p.V81F|PGK1_ENST00000537456.1_Missense_Mutation_p.V189F	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	217					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.V217F(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	TAGAGCTAAAGTTGCAGACAA	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	94.0	101.0					X																	77378339		2203	4300	6503	-	-	-	SO:0001583	missense	0			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.649G>T	X.37:g.77378339G>T	ENSP00000362413:p.Val217Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Missense_Mutation	SNP	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase,prints_Phosphoglycerate_kinase	p.V217F	ENST00000373316.4	37	c.649	CCDS14438.1	X	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035366	0.75617	.	.	ENSG00000102144	ENST00000373316;ENST00000442431;ENST00000450919;ENST00000537456	D;D;D	0.94537	-3.45;-3.42;-3.45	5.19	4.32	0.51571	Phosphoglycerate kinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98635	0.9543	H	0.99870	4.87	0.58432	D	0.999997	D	0.89917	1.0	D	0.81914	0.995	D	0.98457	1.0594	10	0.87932	D	0	-12.7246	13.55	0.61726	0.0:0.0:0.8435:0.1565	.	217	P00558	PGK1_HUMAN	F	217;81;42;189	ENSP00000362413:V217F;ENSP00000405452:V81F;ENSP00000444708:V189F	ENSP00000362413:V217F	V	+	1	0	PGK1	77264995	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.756000	0.98918	1.064000	0.40671	0.594000	0.82650	GTT	PGK1	-	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase,prints_Phosphoglycerate_kinase	ENSG00000102144		0.378	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK1	HGNC	protein_coding	OTTHUMT00000057310.1	375	0.00	0	G			77378339	77378339	+1	no_errors	ENST00000373316	ensembl	human	known	69_37n	missense	310	13.89	50	SNP	1.000	T
PKD1L1	168507	genome.wustl.edu	37	7	47872771	47872771	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr7:47872771G>C	ENST00000289672.2	-	41	6304	c.6254C>G	c.(6253-6255)gCc>gGc	p.A2085G		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2085					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CAGCTTAGGGGCTGGACAAGC	0.567																																						dbGAP											0													60.0	48.0	52.0					7																	47872771		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6254C>G	7.37:g.47872771G>C	ENSP00000289672:p.Ala2085Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.A2085G	ENST00000289672.2	37	c.6254	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	G	3.464	-0.109393	0.06924	.	.	ENSG00000158683	ENST00000289672	T	0.19532	2.14	2.8	0.816	0.18768	.	31.246500	0.00465	N	0.000112	T	0.18341	0.0440	L	0.36672	1.1	0.09310	N	1	B	0.23650	0.089	B	0.19391	0.025	T	0.19192	-1.0313	10	0.25751	T	0.34	8.6223	7.2684	0.26242	0.0:0.0:0.5259:0.4741	.	2085	Q8TDX9	PK1L1_HUMAN	G	2085	ENSP00000289672:A2085G	ENSP00000289672:A2085G	A	-	2	0	PKD1L1	47839296	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.030000	0.12308	0.196000	0.20367	0.563000	0.77884	GCC	PKD1L1	-	NULL	ENSG00000158683		0.567	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	32	0.00	0	G	NM_138295		47872771	47872771	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	24	72.41	63	SNP	0.000	C
PKD1L1	168507	genome.wustl.edu	37	7	47872839	47872841	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	TGA	TGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr7:47872839_47872841delTGA	ENST00000289672.2	-	41	6234_6236	c.6184_6186delTCA	c.(6184-6186)tcadel	p.S2062del		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2062					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGAGAATGGCTGATGCAGGTTGC	0.557																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6184_6186delTCA	7.37:g.47872839_47872841delTGA	ENSP00000289672:p.Ser2062del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	In_Frame_Del	DEL	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.S2062in_frame_del	ENST00000289672.2	37	c.6186_6184	CCDS34633.1	7																																																																																			PKD1L1	-	NULL	ENSG00000158683		0.557	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	64	0.00	0	TGA	NM_138295		47872839	47872841	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	in_frame_del	36	36.84	21	DEL	0.002:0.002:0.000	-
PKD1L1	168507	genome.wustl.edu	37	7	47872848	47872849	+	Frame_Shift_Ins	INS	-	-	C	rs534163236		TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr7:47872848_47872849insC	ENST00000289672.2	-	41	6226_6227	c.6176_6177insG	c.(6175-6177)caafs	p.Q2059fs		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2059					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CTGATGCAGGTTGCTAGAATGA	0.559																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6176_6177insG	7.37:g.47872848_47872849insC	ENSP00000289672:p.Gln2059fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Frame_Shift_Ins	INS	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.P2060fs	ENST00000289672.2	37	c.6177_6176	CCDS34633.1	7																																																																																			PKD1L1	-	NULL	ENSG00000158683		0.559	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	62	0.00	0	-	NM_138295		47872848	47872849	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	frame_shift_ins	33	38.89	21	INS	0.000:0.000	C
PRDX5	25824	genome.wustl.edu	37	11	64089058	64089059	+	Splice_Site	DEL	GT	GT	-			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr11:64089058_64089059delGT	ENST00000265462.4	+	6	668_669	c.540_541delGT	c.(538-543)aggttc>agtc	p.RF180fs	PRDX5_ENST00000352435.4_Splice_Site_p.RF136fs|PRDX5_ENST00000347941.4_Splice_Site_p.RF91fs	NM_012094.4	NP_036226	P30044	PRDX5_HUMAN	peroxiredoxin 5	180	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular response to reactive oxygen species (GO:0034614)|hydrogen peroxide catabolic process (GO:0042744)|inflammatory response (GO:0006954)|NADPH oxidation (GO:0070995)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|positive regulation of collagen biosynthetic process (GO:0032967)|reactive nitrogen species metabolic process (GO:2001057)|regulation of apoptosis involved in tissue homeostasis (GO:0060785)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	antioxidant activity (GO:0016209)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|peroxidase activity (GO:0004601)|peroxiredoxin activity (GO:0051920)|peroxynitrite reductase activity (GO:0072541)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase III regulatory region DNA binding (GO:0001016)			breast(1)|kidney(1)|lung(1)|skin(1)	4					Auranofin(DB00995)	TTTCCGGCAGGTTCTCCATGGT	0.599																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AF197952	CCDS8069.1, CCDS8070.1, CCDS8071.1	11q13	2008-07-21			ENSG00000126432	ENSG00000126432			9355	protein-coding gene	gene with protein product	"""antioxidant enzyme B166"", ""thioredoxin peroxidase PMP20"", ""peroxisomal antioxidant enzyme"", ""TPx type VI"", ""liver tissue 2D-page spot 71B"", ""Alu co-repressor 1"""	606583				10514471, 10521424	Standard	NM_012094		Approved	ACR1, AOEB166, MGC142285, PRXV, PMP20, B166, PRDX6, PLP, SBBI10, MGC117264, MGC142283	uc001nzu.3	P30044	OTTHUMG00000168805	ENST00000265462.4:c.540-1GT>-	11.37:g.64089058_64089059delGT		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC19|A6NG06|B7ZLJ4|B7ZVW3|Q14CK0|Q6IAF2|Q9UBU5|Q9UJU4|Q9UKX4	Frame_Shift_Del	DEL	pfam_Redoxin,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold	p.R180fs	ENST00000265462.4	37	c.540_541	CCDS8069.1	11																																																																																			PRDX5	-	pfam_Redoxin,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold	ENSG00000126432		0.599	PRDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX5	HGNC	protein_coding	OTTHUMT00000401148.1	23	0.00	0	GT	NM_181651	Frame_Shift_Del	64089058	64089059	+1	no_errors	ENST00000265462	ensembl	human	known	69_37n	frame_shift_del	34	37.50	21	DEL	1.000:1.000	-
PTGER3	5733	genome.wustl.edu	37	1	71512366	71512366	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr1:71512366G>C	ENST00000306666.5	-	1	1105	c.895C>G	c.(895-897)Ctg>Gtg	p.L299V	ZRANB2-AS1_ENST00000450461.1_RNA|PTGER3_ENST00000370932.2_Missense_Mutation_p.L299V|PTGER3_ENST00000356595.4_Missense_Mutation_p.L299V|PTGER3_ENST00000460330.1_Missense_Mutation_p.L299V|PTGER3_ENST00000351052.5_Missense_Mutation_p.L299V|PTGER3_ENST00000414819.1_Missense_Mutation_p.L299V|PTGER3_ENST00000370924.4_Missense_Mutation_p.L299V|PTGER3_ENST00000354608.5_Missense_Mutation_p.L299V|PTGER3_ENST00000370931.3_Missense_Mutation_p.L299V	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	299					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CTACCTACCAGGAGCGGAGAC	0.602																																						dbGAP											0													43.0	38.0	39.0					1																	71512366		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.895C>G	1.37:g.71512366G>C	ENSP00000302313:p.Leu299Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srbc,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP3_rcpt,prints_Prostanoid_rcpt,prints_EP3_rcpt_2,prints_Prostglndn_DP_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Thbox_rcpt	p.L299V	ENST00000306666.5	37	c.895	CCDS657.1	1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286281	0.59867	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	4.98	1.65	0.23941	GPCR, rhodopsin-like superfamily (1);	0.219445	0.40064	N	0.001193	T	0.30386	0.0763	L	0.47190	1.495	0.58432	D	0.999998	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.78314	0.991;0.988;0.985;0.991;0.991;0.985;0.985;0.991	T	0.10154	-1.0642	10	0.14252	T	0.57	-21.3433	9.5687	0.39414	0.3137:0.0:0.6863:0.0	.	299;299;299;299;299;299;299;299	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	V	299	ENSP00000359969:L299V;ENSP00000359970:L299V;ENSP00000280208:L299V;ENSP00000418073:L299V;ENSP00000346624:L299V;ENSP00000349003:L299V;ENSP00000401423:L299V;ENSP00000302313:L299V;ENSP00000359962:L299V	ENSP00000302313:L299V	L	-	1	2	PTGER3	71284954	0.998000	0.40836	0.768000	0.31515	0.933000	0.57130	2.693000	0.47027	0.517000	0.28361	0.462000	0.41574	CTG	PTGER3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000050628		0.602	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTGER3	HGNC	protein_coding	OTTHUMT00000026076.1	24	0.00	0	G	NM_000957		71512366	71512366	-1	no_errors	ENST00000354608	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	0.881	C
PTPRN2	5799	genome.wustl.edu	37	7	157874006	157874007	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr7:157874006_157874007insG	ENST00000389418.4	-	11	1715_1716	c.1706_1707insC	c.(1705-1707)gatfs	p.D569fs	PTPRN2_ENST00000409483.1_Frame_Shift_Ins_p.D531fs|PTPRN2_ENST00000389416.4_Frame_Shift_Ins_p.D552fs|PTPRN2_ENST00000404321.2_Frame_Shift_Ins_p.D592fs|PTPRN2_ENST00000389413.3_Frame_Shift_Ins_p.D540fs	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	569					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CCTTCTCCACATCCTCAGTGGT	0.515																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1706_1707insC	7.37:g.157874006_157874007insG	ENSP00000374069:p.Asp569fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Frame_Shift_Ins	INS	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V593fs	ENST00000389418.4	37	c.1776_1775	CCDS5947.1	7																																																																																			PTPRN2	-	pfam_Receptor_IA-2	ENSG00000155093		0.515	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	78	0.00	0	-			157874006	157874007	-1	no_errors	ENST00000404321	ensembl	human	known	69_37n	frame_shift_ins	104	29.25	43	INS	0.010:0.084	G
RB1	5925	genome.wustl.edu	37	13	49050933	49050933	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr13:49050933A>G	ENST00000267163.4	+	25	2755	c.2617A>G	c.(2617-2619)Aaa>Gaa	p.K873E	RB1_ENST00000484879.1_3'UTR	NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	873	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)|p.K873E(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TAAACCACTGAAAAAACTACG	0.428		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	28	Whole gene deletion(15)|Unknown(11)|Substitution - Missense(2)	bone(11)|breast(6)|haematopoietic_and_lymphoid_tissue(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)											121.0	120.0	120.0					13																	49050933		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2617A>G	13.37:g.49050933A>G	ENSP00000267163:p.Lys873Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.K873E	ENST00000267163.4	37	c.2617	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	A	28.6	4.934190	0.92458	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.84800	-1.9	5.84	5.84	0.93424	Rb C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90528	0.7032	L	0.55990	1.75	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.90894	0.4763	10	0.56958	D	0.05	.	15.8743	0.79151	1.0:0.0:0.0:0.0	.	873	P06400	RB_HUMAN	E	852;873	ENSP00000267163:K873E	ENSP00000267163:K873E	K	+	1	0	RB1	47948934	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.256000	0.89848	2.220000	0.72140	0.482000	0.46254	AAA	RB1	-	pfam_Rb_C	ENSG00000139687		0.428	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	192	0.00	0	A			49050933	49050933	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	missense	76	32.14	36	SNP	1.000	G
RELN	5649	genome.wustl.edu	37	7	103276003	103276003	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr7:103276003G>T	ENST00000428762.1	-	19	2493	c.2334C>A	c.(2332-2334)agC>agA	p.S778R	RELN_ENST00000343529.5_Missense_Mutation_p.S778R|RELN_ENST00000424685.2_Missense_Mutation_p.S778R	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	778					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.S778R(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GAACAGATTTGCTCCCCAGTC	0.393																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	96.0	94.0					7																	103276003		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.2334C>A	7.37:g.103276003G>T	ENSP00000392423:p.Ser778Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.S778R	ENST00000428762.1	37	c.2334	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974865	0.53720	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.27402	1.67;1.67;1.67	6.08	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.45776	0.1359	L	0.46157	1.445	0.49299	D	0.999773	D;D	0.76494	0.999;0.996	D;D	0.83275	0.996;0.974	T	0.40365	-0.9567	10	0.59425	D	0.04	.	10.4302	0.44403	0.2009:0.0:0.7991:0.0	.	778;778	P78509-2;P78509	.;RELN_HUMAN	R	778	ENSP00000392423:S778R;ENSP00000345694:S778R;ENSP00000388446:S778R	ENSP00000345694:S778R	S	-	3	2	RELN	103063239	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.973000	0.49264	1.575000	0.49775	0.591000	0.81541	AGC	RELN	-	superfamily_Neuraminidase	ENSG00000189056		0.393	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	124	0.00	0	G	NM_005045		103276003	103276003	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	70	40.17	47	SNP	1.000	T
SI	6476	genome.wustl.edu	37	3	164781250	164781250	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr3:164781250delA	ENST00000264382.3	-	8	949	c.887delT	c.(886-888)ttafs	p.L296fs		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	296	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.L296fs*4(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GCTATTCATTAAAAAAACACC	0.259										HNSCC(35;0.089)																												dbGAP											1	Insertion - Frameshift(1)	pancreas(1)											44.0	52.0	49.0					3																	164781250		2172	4236	6408	-	-	-	SO:0001589	frameshift_variant	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.887delT	3.37:g.164781250delA	ENSP00000264382:p.Leu296fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Frame_Shift_Del	DEL	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.L296fs	ENST00000264382.3	37	c.887	CCDS3196.1	3																																																																																			SI	-	superfamily_Glyco_hydro-type_carb-bd	ENSG00000090402		0.259	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	41	0.00	0	A	NM_001041		164781250	164781250	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	frame_shift_del	14	17.65	3	DEL	1.000	-
SLC35F3	148641	genome.wustl.edu	37	1	234452419	234452419	+	Silent	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr1:234452419C>T	ENST00000366617.3	+	4	921	c.693C>T	c.(691-693)tcC>tcT	p.S231S	SLC35F3_ENST00000366618.3_Silent_p.S300S			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	231			S -> C (in dbSNP:rs17853780). {ECO:0000269|PubMed:15489334}.		thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.S300S(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			ACAGCCACTCCGTCATCGGCA	0.587																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											177.0	160.0	165.0					1																	234452419		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.693C>T	1.37:g.234452419C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDD6|Q8N9C9	Silent	SNP	pfam_DMT,pfam_DUF250,pfam_DUF914_euk	p.S300	ENST00000366617.3	37	c.900		1																																																																																			SLC35F3	-	pfam_DUF914_euk	ENSG00000183780		0.587	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	SLC35F3	HGNC	protein_coding	OTTHUMT00000128322.1	98	0.00	0	C	NM_173508		234452419	234452419	+1	no_errors	ENST00000366618	ensembl	human	known	69_37n	silent	121	38.58	76	SNP	0.001	T
SYT4	6860	genome.wustl.edu	37	18	40853841	40853841	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr18:40853841C>T	ENST00000255224.3	-	2	921	c.553G>A	c.(553-555)Gag>Aag	p.E185K	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.E167K	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	185	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.E185*(2)|p.E185K(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						ATCGACTGCTCATCCATGGCT	0.453																																					NSCLC(85;81 1419 2855 22820 35912)	dbGAP											4	Substitution - Nonsense(2)|Substitution - Missense(2)	lung(2)|breast(2)											65.0	66.0	66.0					18																	40853841		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.553G>A	18.37:g.40853841C>T	ENSP00000255224:p.Glu185Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEU3|Q9P2K4	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.E185K	ENST00000255224.3	37	c.553	CCDS11922.1	18	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850074	0.51270	.	.	ENSG00000132872	ENST00000255224	T	0.07688	3.17	5.87	5.87	0.94306	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.044606	0.85682	D	0.000000	T	0.07548	0.0190	N	0.20610	0.595	0.80722	D	1	B;B	0.27316	0.175;0.175	B;B	0.31547	0.132;0.132	T	0.20773	-1.0265	10	0.06625	T	0.88	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	167;185	B4DEU3;Q9H2B2	.;SYT4_HUMAN	K	185	ENSP00000255224:E185K	ENSP00000255224:E185K	E	-	1	0	SYT4	39107839	1.000000	0.71417	0.991000	0.47740	0.948000	0.59901	7.729000	0.84864	2.941000	0.99782	0.655000	0.94253	GAG	SYT4	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	ENSG00000132872		0.453	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	186	0.00	0	C	NM_020783		40853841	40853841	-1	no_errors	ENST00000255224	ensembl	human	known	69_37n	missense	85	27.97	33	SNP	1.000	T
TBC1D10A	83874	genome.wustl.edu	37	22	30688471	30688471	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr22:30688471delA	ENST00000215790.7	-	9	1584	c.1420delT	c.(1420-1422)tcafs	p.S474fs	GATSL3_ENST00000407689.3_5'Flank|GATSL3_ENST00000404953.3_5'Flank|RP1-130H16.18_ENST00000447976.1_Intron|TBC1D10A_ENST00000403477.3_Frame_Shift_Del_p.S481fs|TBC1D10A_ENST00000403362.1_Frame_Shift_Del_p.S386fs	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	474					activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						TTGGGGGCTGAGTCCTTCGGG	0.642																																						dbGAP											0													79.0	89.0	86.0					22																	30688471		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.1420delT	22.37:g.30688471delA	ENSP00000215790:p.Ser474fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXT8|O76053|Q20WK7|Q543A2	Frame_Shift_Del	DEL	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S474fs	ENST00000215790.7	37	c.1420	CCDS13874.1	22																																																																																			TBC1D10A	-	NULL	ENSG00000099992		0.642	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TBC1D10A	HGNC	protein_coding	OTTHUMT00000320550.1	12	0.00	0	A	NM_031937		30688471	30688471	-1	no_errors	ENST00000215790	ensembl	human	known	69_37n	frame_shift_del	3	40.00	2	DEL	0.155	-
TM9SF1	10548	genome.wustl.edu	37	14	24664018	24664018	+	Missense_Mutation	SNP	C	C	T	rs148543793		TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr14:24664018C>T	ENST00000261789.4	-	2	566	c.208G>A	c.(208-210)Gag>Aag	p.E70K	TM9SF1_ENST00000524835.1_5'UTR|TM9SF1_ENST00000556387.1_Missense_Mutation_p.E279K|TM9SF1_ENST00000528669.1_Missense_Mutation_p.E70K|TM9SF1_ENST00000396854.4_Missense_Mutation_p.E70K|TM9SF1_ENST00000530611.1_Missense_Mutation_p.E279K	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	70					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.E70K(1)		NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		CGTATCTTCTCAGGGCAGCAG	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											390.0	388.0	389.0					14																	24664018		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.208G>A	14.37:g.24664018C>T	ENSP00000261789:p.Glu70Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	pfam_EMP70,pfam_Snf7	p.E279K	ENST00000261789.4	37	c.835	CCDS9617.1	14	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103303	0.56183	.	.	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000396854;ENST00000528895;ENST00000530468;ENST00000525592;ENST00000528010;ENST00000530611	T;T;T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85;0.85;0.85	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.31420	0.0796	N	0.11927	0.2	0.53005	D	0.999966	B;B	0.19583	0.037;0.001	B;B	0.21360	0.034;0.02	T	0.08229	-1.0732	10	0.22706	T	0.39	-11.4306	16.2171	0.82237	0.0:1.0:0.0:0.0	.	70;70	Q86SZ6;O15321	.;TM9S1_HUMAN	K	70;70;279;70;70;70;70;70;279	ENSP00000261789:E70K;ENSP00000432997:E70K;ENSP00000451949:E279K;ENSP00000380063:E70K;ENSP00000431447:E70K;ENSP00000435857:E70K;ENSP00000432435:E70K;ENSP00000433792:E70K;ENSP00000433967:E279K	ENSP00000433967:E279K	E	-	1	0	TM9SF1;RP11-468E2.1	23733858	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	2.486000	0.45259	2.700000	0.92200	0.563000	0.77884	GAG	TM9SF1	-	pfam_EMP70	ENSG00000100926		0.507	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	TM9SF1	HGNC	protein_coding	OTTHUMT00000073136.2	109	0.00	0	C	NM_006405		24664018	24664018	-1	no_errors	ENST00000556387	ensembl	human	known	69_37n	missense	87	26.27	31	SNP	1.000	T
ZNF76	7629	genome.wustl.edu	37	6	35262385	35262386	+	Intron	INS	-	-	T			TCGA-B6-A0IG-01A-11W-A050-09	TCGA-B6-A0IG-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8046519-d928-4fd3-b3e2-84585aa4f022	aa1686ba-bc50-4b76-9a59-9971c176876e	g.chr6:35262385_35262386insT	ENST00000373953.3	+	13	1874				ZNF76_ENST00000440666.2_Intron|ZNF76_ENST00000339411.5_Intron	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76						regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						TCCCACGGCCAGAGAAGTCAAC	0.51											OREG0017373	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(52;92 1039 20612 23956 34676)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1608+39->T	6.37:g.35262385_35262386insT		Somatic	854	WXS	Illumina GAIIx	Phase_IV	Q9BQB2	Frame_Shift_Ins	INS	NULL	p.Q82fs	ENST00000373953.3	37	c.245_246	CCDS4801.1	6																																																																																			ZNF76	-	NULL	ENSG00000065029		0.510	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	HGNC	protein_coding	OTTHUMT00000040279.2	73	0.00	0	-	NM_003427		35262385	35262386	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000498555	ensembl	human	putative	69_37n	frame_shift_ins	49	18.33	11	INS	0.000:0.000	T
