#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABLIM2	84448	genome.wustl.edu	37	4	8089995	8089996	+	Frame_Shift_Ins	INS	-	-	G	rs527914427		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr4:8089995_8089996insG	ENST00000341937.5	-	4	418_419	c.354_355insC	c.(352-357)cccgggfs	p.G119fs	ABLIM2_ENST00000407564.3_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000361581.5_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000505872.1_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000545242.1_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000546334.1_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000361737.5_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000428004.2_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000447017.2_Frame_Shift_Ins_p.G119fs|ABLIM2_ENST00000296372.8_Frame_Shift_Ins_p.G119fs	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	119	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						ACTCGGTCCCCGGGGGGGAAGG	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.355dupC	4.37:g.8090002_8090002dupG	ENSP00000342813:p.Gly119fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Frame_Shift_Ins	INS	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.G118fs	ENST00000341937.5	37	c.355_354	CCDS47013.1	4																																																																																			ABLIM2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000163995		0.653	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABLIM2	HGNC	protein_coding	OTTHUMT00000358862.2	21	0.00	0	-	NM_001130083		8089995	8089996	-1	no_errors	ENST00000447017	ensembl	human	known	69_37n	frame_shift_ins	24	14.29	4	INS	1.000:0.001	G
APC	324	genome.wustl.edu	37	5	112175144	112175144	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr5:112175144delG	ENST00000457016.1	+	16	4233	c.3853delG	c.(3853-3855)gatfs	p.D1285fs	APC_ENST00000508376.2_Frame_Shift_Del_p.D1285fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.D1285fs			P25054	APC_HUMAN	adenomatous polyposis coli	1285	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ATCAGCTGAAGATGAAATAGG	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	2	Unknown(1)|Deletion - Frameshift(1)	soft_tissue(1)|skin(1)											54.0	56.0	55.0					5																	112175144		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3853delG	5.37:g.112175144delG	ENSP00000413133:p.Asp1285fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.D1285fs	ENST00000457016.1	37	c.3853	CCDS4107.1	5																																																																																			APC	-	NULL	ENSG00000134982		0.343	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	150	0.00	0	G	NM_000038		112175144	112175144	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	frame_shift_del	113	33.33	58	DEL	1.000	-
C1QTNF4	114900	genome.wustl.edu	37	11	47611487	47611487	+	Silent	SNP	G	G	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr11:47611487G>A	ENST00000302514.3	-	2	1392	c.876C>T	c.(874-876)gaC>gaT	p.D292D		NM_031909.2	NP_114115.2	Q9BXJ3	C1QT4_HUMAN	C1q and tumor necrosis factor related protein 4	292	C1q 2. {ECO:0000255|PROSITE- ProRule:PRU00368}.					extracellular space (GO:0005615)		p.D292D(1)		breast(2)|endometrium(1)|kidney(1)|lung(2)	6						CGCCGTAGCCGTCGTGGTCGT	0.731																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											48.0	69.0	62.0					11																	47611487		2143	4134	6277	-	-	-	SO:0001819	synonymous_variant	0			AF329838	CCDS7942.1	11q11	2008-07-18				ENSG00000172247			14346	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 4"""	614911				16094384	Standard	NM_031909		Approved	CTRP4, ZACRP4	uc001ngc.2	Q9BXJ3		ENST00000302514.3:c.876C>T	11.37:g.47611487G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IV25	Silent	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.D292	ENST00000302514.3	37	c.876	CCDS7942.1	11																																																																																			C1QTNF4	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q	ENSG00000172247		0.731	C1QTNF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF4	HGNC	protein_coding	OTTHUMT00000391772.1	54	0.00	0	G	NM_031909		47611487	47611487	-1	no_errors	ENST00000302514	ensembl	human	known	69_37n	silent	32	30.43	14	SNP	0.962	A
C5orf42	65250	genome.wustl.edu	37	5	37213798	37213798	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr5:37213798C>G	ENST00000508244.1	-	15	2876	c.2783G>C	c.(2782-2784)gGc>gCc	p.G928A	C5orf42_ENST00000274258.7_5'UTR|C5orf42_ENST00000425232.2_Missense_Mutation_p.G928A			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	928						integral component of membrane (GO:0016021)		p.G928A(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ATGAACACCGCCCACCATTCC	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	101.0	106.0					5																	37213798		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.2783G>C	5.37:g.37213798C>G	ENSP00000421690:p.Gly928Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.G928A	ENST00000508244.1	37	c.2783	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	1.167	-0.642199	0.03531	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.22134	1.97;1.97	5.44	0.548	0.17208	.	1.240080	0.05629	N	0.581451	T	0.12561	0.0305	L	0.31294	0.92	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.29027	-1.0025	10	0.02654	T	1	-1.5267	5.8905	0.18911	0.0:0.2537:0.4103:0.3359	.	928	E9PH94	.	A	928	ENSP00000421690:G928A;ENSP00000389014:G928A	ENSP00000389014:G928A	G	-	2	0	C5orf42	37249555	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.160000	0.16462	0.008000	0.14787	-0.424000	0.05967	GGC	C5orf42	-	NULL	ENSG00000197603		0.448	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	171	0.00	0	C	NM_023073		37213798	37213798	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	81	31.36	37	SNP	0.000	G
CELSR1	9620	genome.wustl.edu	37	22	46795613	46795613	+	Splice_Site	SNP	C	C	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr22:46795613C>A	ENST00000262738.3	-	10	5412		c.e10+1			NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1						anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.?(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGCCAGCTCACCTGGTCCATC	0.577																																						dbGAP											1	Unknown(1)	breast(1)											189.0	134.0	153.0					22																	46795613		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5412+1G>T	22.37:g.46795613C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Splice_Site	SNP	-	e10+1	ENST00000262738.3	37	c.5412+1	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503877	0.85176	.	.	ENSG00000075275	ENST00000262738	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2996	0.94138	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CELSR1	45174277	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.033000	0.76504	2.664000	0.90586	0.563000	0.77884	.	CELSR1	-	-	ENSG00000075275		0.577	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	119	0.00	0	C	NM_014246	Intron	46795613	46795613	-1	no_errors	ENST00000262738	ensembl	human	known	69_37n	splice_site	43	33.85	22	SNP	1.000	A
E2F4	1874	genome.wustl.edu	37	16	67229793	67229794	+	In_Frame_Ins	INS	-	-	CAG	rs3830472|rs552823502|rs562856782		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr16:67229793_67229794insCAG	ENST00000379378.3	+	7	976_977	c.917_918insCAG	c.(916-921)gacagc>gaCAGcagc	p.319_320insS		NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	319	Poly-Ser.		S -> SSSS.		blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S319_N320insS(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		GCCCTGCTGGAcagcagcagca	0.604																																						dbGAP											1	Insertion - In frame(1)	breast(1)																																								-	-	-	SO:0001652	inframe_insertion	0			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.954_956dupCAG	16.37:g.67229800_67229802dupCAG	ENSP00000368686:p.Ser320_Ser321dup	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGR8|B5BU56|Q12991|Q15328	In_Frame_Ins	INS	pfam_E2F_TDP	p.310in_frame_insS	ENST00000379378.3	37	c.917_918	CCDS32464.1	16																																																																																			E2F4	-	NULL	ENSG00000205250		0.604	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	E2F4	HGNC	protein_coding	OTTHUMT00000421565.1	35	0.00	0	-	NM_001950		67229793	67229794	+1	no_errors	ENST00000379378	ensembl	human	known	69_37n	in_frame_ins	25	28.57	10	INS	1.000:0.995	CAG
EFHB	151651	genome.wustl.edu	37	3	19975051	19975051	+	Missense_Mutation	SNP	C	C	T	rs536838707		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr3:19975051C>T	ENST00000295824.9	-	1	621	c.460G>A	c.(460-462)Gta>Ata	p.V154I	EFHB_ENST00000498089.1_5'UTR|EFHB_ENST00000344838.4_Intron	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	154							calcium ion binding (GO:0005509)	p.V154I(1)|p.V152I(1)		breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						AATTCCTCTACCCCTTCAGGG	0.483																																						dbGAP											2	Substitution - Missense(2)	breast(2)											81.0	86.0	85.0					3																	19975051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.460G>A	3.37:g.19975051C>T	ENSP00000295824:p.Val154Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.V154I	ENST00000295824.9	37	c.460	CCDS33715.2	3	.	.	.	.	.	.	.	.	.	.	C	2.787	-0.252145	0.05829	.	.	ENSG00000163576	ENST00000295824;ENST00000389256	T;T	0.22945	1.93;2.21	3.73	0.0135	0.14096	.	.	.	.	.	T	0.12860	0.0312	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31752	-0.9932	8	.	.	.	0.7384	2.7311	0.05227	0.3182:0.3012:0.0:0.3806	.	154	Q8N7U6	EFHB_HUMAN	I	154	ENSP00000295824:V154I;ENSP00000373908:V154I	.	V	-	1	0	EFHB	19950055	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.503000	0.06383	0.003000	0.14656	-0.367000	0.07326	GTA	EFHB	-	NULL	ENSG00000163576		0.483	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHB	HGNC	protein_coding	OTTHUMT00000318673.2	136	0.00	0	C	NM_144715		19975051	19975051	-1	no_errors	ENST00000295824	ensembl	human	known	69_37n	missense	63	41.67	45	SNP	0.000	T
FAM86C2P	645332	genome.wustl.edu	37	11	67564238	67564238	+	RNA	SNP	C	C	T	rs77785393	byFrequency	TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr11:67564238C>T	ENST00000528089.1	-	0	902							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		CTGGTGCTCCCGGCAGGCAGC	0.612													.|||	3215	0.641973	0.3994	0.7507	5008	,	,		13412	0.7659		0.6412	False		,,,				2504	0.7658					dbGAP											0																																										-	-	-			0					11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67564238C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000528089.1	37	NULL		11																																																																																			FAM86C2P	-	-	ENSG00000160172		0.612	FAM86C2P-004	KNOWN	basic	processed_transcript	FAM86C2P	HGNC	pseudogene	OTTHUMT00000393796.1	8	0.00	0	C			67564238	67564238	-1	no_errors	ENST00000525180	ensembl	human	known	69_37n	rna	5	54.55	6	SNP	0.003	T
FAM86C2P	645332	genome.wustl.edu	37	11	67564241	67564241	+	RNA	SNP	C	C	T	rs80309804	byFrequency	TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr11:67564241C>T	ENST00000528089.1	-	0	899							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		GTGCTCCCGGCAGGCAGCCAG	0.612													.|||	3216	0.642173	0.3994	0.7507	5008	,	,		13381	0.7669		0.6431	False		,,,				2504	0.7638					dbGAP											0																																										-	-	-			0					11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67564241C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000528089.1	37	NULL		11																																																																																			FAM86C2P	-	-	ENSG00000160172		0.612	FAM86C2P-004	KNOWN	basic	processed_transcript	FAM86C2P	HGNC	pseudogene	OTTHUMT00000393796.1	8	0.00	0	C			67564241	67564241	-1	no_errors	ENST00000525180	ensembl	human	known	69_37n	rna	5	54.55	6	SNP	0.219	T
GATA3	2625	genome.wustl.edu	37	10	8115873	8115874	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr10:8115873_8115874insC	ENST00000346208.3	+	6	1674_1675	c.1219_1220insC	c.(1219-1221)tcgfs	p.S407fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.S408fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	407					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.P409fs*>37(5)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GAGCCACATCTCGCCCTTCAGC	0.599			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	5	Insertion - Frameshift(5)	breast(5)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1220dupC	10.37:g.8115874_8115874dupC	ENSP00000341619:p.Ser407fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.P409fs	ENST00000346208.3	37	c.1222_1223	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.599	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	74	0.00	0	-	NM_001002295		8115873	8115874	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	95	24.00	30	INS	0.876:0.903	C
GLI3	2737	genome.wustl.edu	37	7	42007317	42007317	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr7:42007317C>G	ENST00000395925.3	-	14	2392	c.2308G>C	c.(2308-2310)Gca>Cca	p.A770P	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	770					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A770P(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TTGGTCCCTGCCGGGTTTCTC	0.502									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													dbGAP											1	Substitution - Missense(1)	breast(1)											203.0	195.0	198.0					7																	42007317		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2308G>C	7.37:g.42007317C>G	ENSP00000379258:p.Ala770Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A770P	ENST00000395925.3	37	c.2308	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181274	0.57800	.	.	ENSG00000106571	ENST00000395925	T	0.14022	2.54	5.58	3.48	0.39840	.	0.200483	0.52532	D	0.000070	T	0.10035	0.0246	L	0.40543	1.245	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.13683	-1.0500	10	0.44086	T	0.13	.	4.2343	0.10618	0.0:0.4866:0.0:0.5134	.	770	P10071	GLI3_HUMAN	P	770	ENSP00000379258:A770P	ENSP00000379258:A770P	A	-	1	0	GLI3	41973842	0.997000	0.39634	0.899000	0.35326	0.985000	0.73830	2.443000	0.44881	1.312000	0.45043	0.655000	0.94253	GCA	GLI3	-	NULL	ENSG00000106571		0.502	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	385	0.00	0	C	NM_000168		42007317	42007317	-1	no_errors	ENST00000395925	ensembl	human	known	69_37n	missense	144	52.46	160	SNP	0.972	G
GOLGA6L10	647042	genome.wustl.edu	37	15	82635510	82635510	+	Missense_Mutation	SNP	C	C	A	rs555019600		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr15:82635510C>A	ENST00000439287.4	-	8	1369	c.1270G>T	c.(1270-1272)Gtc>Ttc	p.V424F		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	424										endometrium(1)|kidney(4)	5						CCTTGTGGGACTGGGGCTCCA	0.647																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.1270G>T	15.37:g.82635510C>A	ENSP00000388606:p.Val424Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V424F	ENST00000439287.4	37	c.1270	CCDS45325.1	15	.	.	.	.	.	.	.	.	.	.	.	10.54	1.377898	0.24944	.	.	ENSG00000205281	ENST00000439287	T	0.37235	1.21	.	.	.	.	.	.	.	.	T	0.14570	0.0352	N	0.08118	0	0.50467	P	1.2999999999996348E-4	.	.	.	.	.	.	T	0.16041	-1.0416	4	0.66056	D	0.02	.	.	.	.	.	.	.	.	F	424	ENSP00000388606:V424F	ENSP00000388606:V424F	V	-	1	0	GOLGA6L10	80422565	0.952000	0.32445	0.012000	0.15200	0.012000	0.07955	0.570000	0.23653	-1.660000	0.01486	-1.643000	0.00768	GTC	GOLGA6L10	-	NULL	ENSG00000205281		0.647	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L10	HGNC	protein_coding	OTTHUMT00000419403.2	11	0.00	0	C	NM_001164465		82635510	82635510	-1	no_errors	ENST00000439287	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	0.879	A
GPS2	2874	genome.wustl.edu	37	17	7217398	7217398	+	Splice_Site	DEL	C	C	-			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr17:7217398delC	ENST00000380728.2	-	5	698		c.e5+1		GPS2_ENST00000389167.5_Splice_Site|GPS2_ENST00000391950.3_Splice_Site|RP11-542C16.2_ENST00000575474.1_Splice_Site			Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)	p.?(1)		breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				TTAGTCCTCACCCTGCATGCT	0.537																																						dbGAP											1	Unknown(1)	breast(1)											177.0	163.0	168.0					17																	7217398		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.397+1G>-	17.37:g.7217398delC		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXA1|Q6FHM8	Splice_Site	DEL	-	e4+1	ENST00000380728.2	37	c.397+1	CCDS11100.1	17																																																																																			GPS2	-	-	ENSG00000132522		0.537	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	340	0.00	0	C	NM_004489	Intron	7217398	7217398	-1	no_errors	ENST00000380728	ensembl	human	known	69_37n	splice_site_del	34	56.82	50	DEL	1.000	-
INPPL1	3636	genome.wustl.edu	37	11	71948208	71948209	+	Frame_Shift_Ins	INS	-	-	C	rs561416155		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr11:71948208_71948209insC	ENST00000298229.2	+	26	3124_3125	c.2920_2921insC	c.(2920-2922)gccfs	p.A974fs	INPPL1_ENST00000538751.1_Frame_Shift_Ins_p.A732fs|INPPL1_ENST00000541756.1_Frame_Shift_Ins_p.A732fs|PHOX2A_ENST00000544057.1_5'Flank	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	974	Pro-rich.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)	p.P977fs*7(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						AGGGGTGGCGGCCCCCCCACCC	0.634																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.2927dupC	11.37:g.71948215_71948215dupC	ENSP00000298229:p.Ala974fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX5|Q13577|Q13578	Frame_Shift_Ins	INS	pfam_Endo/exonuclease/phosphatase,pfam_SH2,pfam_SAM_2,pfam_SAM_type1,superfamily_Endo/exonuclease/phosphatase,superfamily_SAM/pointed,smart_SH2,smart_IPPc,smart_SAM,pfscan_SAM,pfscan_SH2,prints_SH2	p.P977fs	ENST00000298229.2	37	c.2920_2921	CCDS8213.1	11																																																																																			INPPL1	-	NULL	ENSG00000165458		0.634	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPPL1	HGNC	protein_coding	OTTHUMT00000396789.1	29	0.00	0	-	NM_001567		71948208	71948209	+1	no_errors	ENST00000298229	ensembl	human	known	69_37n	frame_shift_ins	29	12.12	4	INS	0.025:0.066	C
KCNH1	3756	genome.wustl.edu	37	1	210857470	210857470	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr1:210857470C>T	ENST00000271751.4	-	11	2150	c.2123G>A	c.(2122-2124)cGg>cAg	p.R708Q	KCNH1_ENST00000367007.4_Missense_Mutation_p.R681Q			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	708	Calmodulin-binding.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.R708Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GCTGATCTTCCGGAACACAAT	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	53.0	55.0					1																	210857470		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2123G>A	1.37:g.210857470C>T	ENSP00000271751:p.Arg708Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.R708Q	ENST00000271751.4	37	c.2123	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772797	0.90108	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	T;T	0.16073	2.37;2.37	4.64	4.64	0.57946	.	0.059775	0.64402	N	0.000003	T	0.34716	0.0907	L	0.49778	1.585	0.80722	D	1	D;D	0.89917	0.999;1.0	P;P	0.62184	0.899;0.899	T	0.11665	-1.0578	10	0.66056	D	0.02	.	17.5192	0.87782	0.0:1.0:0.0:0.0	.	681;708	Q14CL3;O95259	.;KCNH1_HUMAN	Q	708;681	ENSP00000271751:R708Q;ENSP00000355974:R681Q	ENSP00000271751:R708Q	R	-	2	0	KCNH1	208924093	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.503000	0.81632	2.121000	0.65114	0.462000	0.41574	CGG	KCNH1	-	prints_K_chnl_volt-dep_EAG	ENSG00000143473		0.567	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	150	0.66	1	C	NM_002238		210857470	210857470	-1	no_errors	ENST00000271751	ensembl	human	known	69_37n	missense	58	31.76	27	SNP	1.000	T
LMBR1	64327	genome.wustl.edu	37	7	156521383	156521383	+	Silent	SNP	T	T	C			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr7:156521383T>C	ENST00000353442.5	-	11	1106	c.870A>G	c.(868-870)agA>agG	p.R290R	LMBR1_ENST00000540390.1_Silent_p.R269R|LMBR1_ENST00000354505.4_Silent_p.R331R|LMBR1_ENST00000359422.4_Silent_p.R138R	NM_022458.3	NP_071903.2	Q8WVP7	LMBR1_HUMAN	limb development membrane protein 1	290					embryonic digit morphogenesis (GO:0042733)	integral component of membrane (GO:0016021)		p.R290R(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	18	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		ACACCAAATTTCTTTCCCATG	0.299																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											97.0	101.0	100.0					7																	156521383		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF107454	CCDS5945.1	7q36.3	2013-08-05	2013-08-05	2005-07-25	ENSG00000105983	ENSG00000105983			13243	protein-coding gene	gene with protein product		605522	"""chromosome 7 open reading frame 2"", ""limb region 1 homolog (mouse)"""	C7orf2		10329000, 11090342	Standard	NM_022458		Approved	ACHP, FLJ11665, ZRS	uc003wmw.4	Q8WVP7	OTTHUMG00000151510	ENST00000353442.5:c.870A>G	7.37:g.156521383T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D242|Q8N3E3|Q96QZ5|Q9H5N0|Q9HAG9|Q9UDN5|Q9Y6U2	Silent	SNP	pfam_LMBR1-like_membr_prot,prints_Lipcalin_1_rcpt	p.R331	ENST00000353442.5	37	c.993	CCDS5945.1	7																																																																																			LMBR1	-	pfam_LMBR1-like_membr_prot	ENSG00000105983		0.299	LMBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1	HGNC	protein_coding	OTTHUMT00000347939.3	414	0.00	0	T	NM_022458		156521383	156521383	-1	no_errors	ENST00000354505	ensembl	human	known	69_37n	silent	284	22.13	81	SNP	1.000	C
MAN1B1	11253	genome.wustl.edu	37	9	139995547	139995548	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr9:139995547_139995548insG	ENST00000371589.4	+	7	1080_1081	c.1007_1008insG	c.(1006-1011)ctggggfs	p.LG336fs	MAN1B1_ENST00000474902.1_Frame_Shift_Ins_p.LG39fs	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	336					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ATCCGCATCCTGGGGGGGCTCC	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1014dupG	9.37:g.139995554_139995554dupG	ENSP00000360645:p.Leu336fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSG3|Q9BRS9|Q9Y5K7	Frame_Shift_Ins	INS	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.L339fs	ENST00000371589.4	37	c.1007_1008	CCDS7029.1	9																																																																																			MAN1B1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	ENSG00000177239		0.540	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	50	0.00	0	-	NM_016219		139995547	139995548	+1	no_errors	ENST00000371589	ensembl	human	known	69_37n	frame_shift_ins	30	14.29	5	INS	1.000:0.999	G
MAP3K1	4214	genome.wustl.edu	37	5	56176548	56176548	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr5:56176548C>T	ENST00000399503.3	+	12	2098	c.2098C>T	c.(2098-2100)Cag>Tag	p.Q700*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	700					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.Q537*(1)|p.Q700*(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CCGCACAAGTCAGCTGTCCAT	0.393																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											117.0	105.0	109.0					5																	56176548		1947	4151	6098	-	-	-	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2098C>T	5.37:g.56176548C>T	ENSP00000382423:p.Gln700*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.Q700*	ENST00000399503.3	37	c.2098	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.476399	0.98309	.	.	ENSG00000095015	ENST00000399503	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	X	700	.	ENSP00000382423:Q700X	Q	+	1	0	MAP3K1	56212305	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.640000	0.61368	2.941000	0.99782	0.655000	0.94253	CAG	MAP3K1	-	superfamily_ARM-type_fold	ENSG00000095015		0.393	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	215	0.46	1	C	XM_042066		56176548	56176548	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	nonsense	120	29.82	51	SNP	1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56189442	56189442	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr5:56189442delC	ENST00000399503.3	+	20	4474	c.4474delC	c.(4474-4476)caafs	p.Q1492fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1492	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.Q1329fs*12(1)|p.Q1492fs*12(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TTTAGAACTTCAACCTCAGGA	0.448																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)											126.0	119.0	121.0					5																	56189442		1963	4163	6126	-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4474delC	5.37:g.56189442delC	ENSP00000382423:p.Gln1492fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.Q1492fs	ENST00000399503.3	37	c.4474	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095015		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	131	0.00	0	C	XM_042066		56189442	56189442	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	64	27.37	26	DEL	1.000	-
MAPK8IP3	23162	genome.wustl.edu	37	16	1798259	1798259	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr16:1798259G>T	ENST00000250894.4	+	7	1163	c.1006G>T	c.(1006-1008)Gac>Tac	p.D336Y	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.D336Y|MAPK8IP3_ENST00000568271.1_3'UTR	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	336					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.D337Y(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GGGCAGCAGTGACGAGTGGTC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	65.0	64.0					16																	1798259		2047	4195	6242	-	-	-	SO:0001583	missense	0			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.1006G>T	16.37:g.1798259G>T	ENSP00000250894:p.Asp336Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.D336Y	ENST00000250894.4	37	c.1006	CCDS10442.2	16	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793287	0.90453	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.32988	1.43;1.43	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.52175	0.1718	L	0.51422	1.61	0.80722	D	1	D;D;D	0.89917	0.975;0.995;1.0	P;D;D	0.91635	0.629;0.931;0.999	T	0.53606	-0.8415	10	0.87932	D	0	-30.1877	18.5316	0.90995	0.0:0.0:1.0:0.0	.	337;336;336	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	Y	336	ENSP00000250894:D336Y;ENSP00000348290:D336Y	ENSP00000250894:D336Y	D	+	1	0	MAPK8IP3	1738260	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.686000	0.98664	2.546000	0.85860	0.549000	0.68633	GAC	MAPK8IP3	-	NULL	ENSG00000138834		0.617	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	25	0.00	0	G	NM_001040439		1798259	1798259	+1	no_errors	ENST00000250894	ensembl	human	known	69_37n	missense	10	56.52	13	SNP	1.000	T
NLRP5	126206	genome.wustl.edu	37	19	56538873	56538873	+	Missense_Mutation	SNP	G	G	A	rs199475774		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr19:56538873G>A	ENST00000390649.3	+	7	1274	c.1274G>A	c.(1273-1275)cGt>cAt	p.R425H		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	425	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.R425H(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GTGTCTCCCCGTTACCTGTTA	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20601	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											46.0	48.0	47.0					19																	56538873		2053	4201	6254	-	-	-	SO:0001583	missense	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1274G>A	19.37:g.56538873G>A	ENSP00000375063:p.Arg425His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R425H	ENST00000390649.3	37	c.1274	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	G	8.922	0.961247	0.18583	.	.	ENSG00000171487	ENST00000390649	T	0.78924	-1.22	3.35	-2.62	0.06152	.	0.621973	0.12531	N	0.460749	T	0.62865	0.2463	L	0.46614	1.455	0.09310	N	1	B	0.22604	0.072	B	0.28465	0.09	T	0.48958	-0.8988	10	0.11794	T	0.64	.	4.1012	0.10014	0.2322:0.0:0.515:0.2528	.	425	P59047	NALP5_HUMAN	H	425	ENSP00000375063:R425H	ENSP00000375063:R425H	R	+	2	0	NLRP5	61230685	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.017000	0.12590	-0.432000	0.07297	0.655000	0.94253	CGT	NLRP5	-	NULL	ENSG00000171487		0.557	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	59	0.00	0	G	NM_153447		56538873	56538873	+1	no_errors	ENST00000390649	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	0.019	A
NNT	23530	genome.wustl.edu	37	5	43702838	43702838	+	Splice_Site	SNP	G	G	C			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr5:43702838G>C	ENST00000264663.5	+	21	3332	c.3111G>C	c.(3109-3111)caG>caC	p.Q1037H	NNT_ENST00000512996.2_Splice_Site_p.Q906H|NNT_ENST00000344920.4_Splice_Site_p.Q1037H	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	1037					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.Q1037H(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					AATCAAAGCAGGTAAAGTTTC	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	66.0	68.0					5																	43702838		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.3111+1G>C	5.37:g.43702838G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	pfam_NADH_DH_b,pfam_AlaDH/PNT_NAD(H)-bd,pfam_AlaDH/PNT_N,tigrfam_NADP_transhyd_a	p.Q1037H	ENST00000264663.5	37	c.3111	CCDS3949.1	5	.	.	.	.	.	.	.	.	.	.	G	19.15	3.772054	0.69992	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.86164	-2.08;-2.08;-2.08	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.82848	0.5126	L	0.46741	1.465	0.80722	D	1	P	0.39404	0.672	B	0.28849	0.095	T	0.82466	-0.0443	10	0.40728	T	0.16	-10.0449	20.0036	0.97427	0.0:0.0:1.0:0.0	.	1037	Q13423	NNTM_HUMAN	H	552;1037;1037;906	ENSP00000264663:Q1037H;ENSP00000343873:Q1037H;ENSP00000426343:Q906H	ENSP00000264663:Q1037H	Q	+	3	2	NNT	43738595	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.824000	0.97209	0.655000	0.94253	CAG	NNT	-	pfam_NADH_DH_b	ENSG00000112992		0.363	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	HGNC	protein_coding	OTTHUMT00000214026.1	77	0.00	0	G	NM_182977	Missense_Mutation	43702838	43702838	+1	no_errors	ENST00000264663	ensembl	human	known	69_37n	missense	51	33.77	26	SNP	1.000	C
OR2F1	26211	genome.wustl.edu	37	7	143657386	143657386	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr7:143657386G>A	ENST00000392899.1	+	1	360	c.323G>A	c.(322-324)gGt>gAt	p.G108D	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	108					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G108D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					CTGGCCTTGGGTGGGATTGAG	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											169.0	148.0	155.0					7																	143657386		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.323G>A	7.37:g.143657386G>A	ENSP00000376633:p.Gly108Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G108D	ENST00000392899.1	37	c.323	CCDS5887.1	7	.	.	.	.	.	.	.	.	.	.	G	16.85	3.237164	0.58886	.	.	ENSG00000213215	ENST00000392899	T	0.00912	5.55	5.41	5.41	0.78517	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000044	T	0.11067	0.0270	H	0.98487	4.245	0.36318	D	0.858088	D	0.89917	1.0	D	0.97110	1.0	T	0.03739	-1.1008	10	0.87932	D	0	-17.3964	12.2786	0.54751	0.0:0.1701:0.8298:0.0	.	108	Q13607	OR2F1_HUMAN	D	108	ENSP00000376633:G108D	ENSP00000376633:G108D	G	+	2	0	OR2F1	143288319	0.001000	0.12720	0.751000	0.31187	0.867000	0.49689	0.443000	0.21644	2.809000	0.96659	0.655000	0.94253	GGT	OR2F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000213215		0.532	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F1	HGNC	protein_coding	OTTHUMT00000349581.1	342	0.00	0	G			143657386	143657386	+1	no_errors	ENST00000392899	ensembl	human	known	69_37n	missense	219	51.55	233	SNP	0.690	A
PNCK	139728	genome.wustl.edu	37	X	152937334	152937334	+	Splice_Site	SNP	C	C	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chrX:152937334C>A	ENST00000370150.1	-	5	593		c.e5+1		PNCK_ENST00000340888.3_Splice_Site|PNCK_ENST00000393831.2_Splice_Site|PNCK_ENST00000475172.1_Splice_Site|PNCK_ENST00000370145.4_Splice_Site|PNCK_ENST00000447676.2_Splice_Site|PNCK_ENST00000370142.1_Splice_Site			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.?(2)		breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGCCAGGCACCTTGAGGTCC	0.657																																						dbGAP											2	Unknown(2)	breast(2)											20.0	20.0	20.0					X																	152937334		2203	4292	6495	-	-	-	SO:0001630	splice_region_variant	0			BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.414+1G>T	X.37:g.152937334C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Splice_Site	SNP	-	e5+1	ENST00000370150.1	37	c.663+1		X	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083281	0.76642	.	.	ENSG00000130822	ENST00000340888;ENST00000370150;ENST00000393831;ENST00000370142;ENST00000370145;ENST00000447676;ENST00000439087;ENST00000422811	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1385	0.81506	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PNCK	152590528	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	7.660000	0.83776	2.060000	0.61445	0.529000	0.55759	.	PNCK	-	-	ENSG00000130822		0.657	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	PNCK	HGNC	protein_coding	OTTHUMT00000061044.2	29	0.00	0	C	NM_198452	Intron	152937334	152937334	-1	no_errors	ENST00000447676	ensembl	human	known	69_37n	splice_site	38	26.92	14	SNP	1.000	A
PRND	23627	genome.wustl.edu	37	20	4705266	4705266	+	Silent	SNP	G	G	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr20:4705266G>A	ENST00000305817.2	+	2	140	c.69G>A	c.(67-69)gcG>gcA	p.A23A		NM_012409.2	NP_036541.2	Q9UKY0	PRND_HUMAN	prion protein 2 (dublet)	23					protein homooligomerization (GO:0051260)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.A23A(2)		breast(3)|endometrium(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	13						ACCTCTCTGCGGTCCAGACGA	0.632																																						dbGAP											2	Substitution - coding silent(2)	lung(1)|breast(1)											62.0	57.0	59.0					20																	4705266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF106918	CCDS13081.1	20p13	2013-09-19			ENSG00000171864	ENSG00000171864			15748	protein-coding gene	gene with protein product	"""prion-like protein doppel"""	604263				10525406, 10577243	Standard	NM_012409		Approved	DPL, dJ1068H6.4, DOPPEL, PrPLP	uc002wkz.3	Q9UKY0	OTTHUMG00000031789	ENST00000305817.2:c.69G>A	20.37:g.4705266G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7U7M5|Q9H311|Q9H312|Q9NTM4	Silent	SNP	pfam_Prion/Doppel_prot_b-ribbon_dom,pfam_Doppel,superfamily_Prion/Doppel_prot_b-ribbon_dom	p.A23	ENST00000305817.2	37	c.69	CCDS13081.1	20																																																																																			PRND	-	pfam_Doppel	ENSG00000171864		0.632	PRND-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRND	HGNC	protein_coding	OTTHUMT00000077827.2	35	0.00	0	G	NM_012409		4705266	4705266	+1	no_errors	ENST00000305817	ensembl	human	known	69_37n	silent	29	30.95	13	SNP	0.000	A
RAD50	10111	genome.wustl.edu	37	5	131926953	131926953	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr5:131926953T>C	ENST00000265335.6	+	10	1877	c.1490T>C	c.(1489-1491)gTa>gCa	p.V497A	RAD50_ENST00000378823.3_Missense_Mutation_p.V358A			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	497					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.V497A(1)|p.V358A(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AACAGCAATGTAGAAACCTTA	0.348								Homologous recombination																														dbGAP											2	Substitution - Missense(2)	breast(2)											89.0	85.0	87.0					5																	131926953		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1490T>C	5.37:g.131926953T>C	ENSP00000265335:p.Val497Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	pfam_Rad50_Zn_hook,superfamily_Prefoldin,pfscan_Zn_hook_Rad50,tigrfam_Rad50	p.V497A	ENST00000265335.6	37	c.1490	CCDS34233.1	5	.	.	.	.	.	.	.	.	.	.	T	17.44	3.390177	0.62066	.	.	ENSG00000113522	ENST00000378823;ENST00000265335	T;T	0.05139	3.49;3.73	5.7	5.7	0.88788	.	0.280991	0.39834	N	0.001256	T	0.06508	0.0167	L	0.38175	1.15	0.45477	D	0.998441	B	0.14012	0.009	B	0.15484	0.013	T	0.24297	-1.0164	10	0.08599	T	0.76	-4.306	15.9745	0.80049	0.0:0.0:0.0:1.0	.	497	Q92878	RAD50_HUMAN	A	358;497	ENSP00000368100:V358A;ENSP00000265335:V497A	ENSP00000265335:V497A	V	+	2	0	RAD50	131954852	1.000000	0.71417	0.958000	0.39756	0.836000	0.47400	7.499000	0.81566	2.168000	0.68352	0.533000	0.62120	GTA	RAD50	-	tigrfam_Rad50	ENSG00000113522		0.348	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD50	HGNC	protein_coding	OTTHUMT00000132566.5	112	0.00	0	T	NM_005732		131926953	131926953	+1	no_errors	ENST00000265335	ensembl	human	known	69_37n	missense	70	34.58	37	SNP	0.996	C
RIN1	9610	genome.wustl.edu	37	11	66100832	66100832	+	Frame_Shift_Del	DEL	C	C	-	rs375956582		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr11:66100832delC	ENST00000311320.4	-	9	1898	c.1772delG	c.(1771-1773)ggcfs	p.G591fs	RIN1_ENST00000530056.1_Frame_Shift_Del_p.G425fs|RIN1_ENST00000524804.1_5'UTR|RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000424433.2_Frame_Shift_Del_p.G486fs	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	591	Ras and 14-3-3 protein binding region.|VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						CTGACCCAGGCCACTCAGCAG	0.687																																						dbGAP											0													26.0	31.0	29.0					11																	66100832		2200	4295	6495	-	-	-	SO:0001589	frameshift_variant	0			L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.1772delG	11.37:g.66100832delC	ENSP00000310406:p.Gly591fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15010|Q00427|Q96CC8	Frame_Shift_Del	DEL	pfam_VPS9,pfam_Ras-assoc,smart_SH2,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.G591fs	ENST00000311320.4	37	c.1772	CCDS31614.1	11																																																																																			RIN1	-	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	ENSG00000174791		0.687	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN1	HGNC	protein_coding	OTTHUMT00000392980.2	12	0.00	0	C	NM_004292		66100832	66100832	-1	no_errors	ENST00000311320	ensembl	human	known	69_37n	frame_shift_del	15	46.67	14	DEL	0.509	-
SAMD9	54809	genome.wustl.edu	37	7	92733180	92733180	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr7:92733180G>C	ENST00000379958.2	-	3	2500	c.2231C>G	c.(2230-2232)aCt>aGt	p.T744S		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	744						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.T744S(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			AGCCAAGGTAGTTCCCCCACA	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											228.0	216.0	220.0					7																	92733180		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2231C>G	7.37:g.92733180G>C	ENSP00000369292:p.Thr744Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.T744S	ENST00000379958.2	37	c.2231	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569322	0.65765	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	D;D	0.90788	-2.73;-2.73	4.44	4.44	0.53790	.	0.179641	0.34828	U	0.003642	D	0.87545	0.6204	L	0.38531	1.155	0.36063	D	0.841575	D	0.56968	0.978	P	0.47134	0.539	D	0.87838	0.2649	10	0.20519	T	0.43	.	15.7702	0.78162	0.0:0.0:1.0:0.0	.	744	Q5K651	SAMD9_HUMAN	S	744	ENSP00000369292:T744S;ENSP00000414529:T744S	ENSP00000369292:T744S	T	-	2	0	SAMD9	92571116	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.002000	0.70693	2.303000	0.77524	0.609000	0.83330	ACT	SAMD9	-	NULL	ENSG00000205413		0.388	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	151	0.00	0	G	NM_017654		92733180	92733180	-1	no_errors	ENST00000379958	ensembl	human	known	69_37n	missense	45	34.78	24	SNP	1.000	C
SREBF2	6721	genome.wustl.edu	37	22	42281016	42281016	+	Splice_Site	SNP	G	G	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr22:42281016G>A	ENST00000361204.4	+	11	2374		c.e11+1			NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2						cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CTTCCTGGCCGTGAGTACCCT	0.567																																						dbGAP											1	Unknown(1)	breast(1)											97.0	75.0	82.0					22																	42281016		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.2208+1G>A	22.37:g.42281016G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Splice_Site	SNP	-	e11+1	ENST00000361204.4	37	c.2208+1	CCDS14023.1	22	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021684	0.54576	.	.	ENSG00000198911	ENST00000361204;ENST00000457567	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5702	0.91132	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SREBF2	40610962	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	6.985000	0.76193	2.412000	0.81896	0.491000	0.48974	.	SREBF2	-	-	ENSG00000198911		0.567	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	HGNC	protein_coding	OTTHUMT00000321956.1	292	0.00	0	G	NM_004599	Intron	42281016	42281016	+1	no_errors	ENST00000361204	ensembl	human	known	69_37n	splice_site	149	39.43	97	SNP	1.000	A
STARD8	9754	genome.wustl.edu	37	X	67938433	67938433	+	Silent	SNP	C	C	T			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chrX:67938433C>T	ENST00000252336.6	+	5	1809	c.1437C>T	c.(1435-1437)cgC>cgT	p.R479R	STARD8_ENST00000374599.3_Silent_p.R559R|STARD8_ENST00000374597.3_Silent_p.R479R	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	479					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.R479R(4)|p.R559R(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GTGAACGGCGCGATTCAGGTG	0.607																																						dbGAP											5	Substitution - coding silent(5)	breast(3)|prostate(2)											39.0	34.0	36.0					X																	67938433		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1437C>T	X.37:g.67938433C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Silent	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.R559	ENST00000252336.6	37	c.1677	CCDS14390.1	X																																																																																			STARD8	-	NULL	ENSG00000130052		0.607	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	87	0.00	0	C	NM_014725		67938433	67938433	+1	no_errors	ENST00000374599	ensembl	human	known	69_37n	silent	43	30.65	19	SNP	0.259	T
STK25	10494	genome.wustl.edu	37	2	242440175	242440175	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr2:242440175C>T	ENST00000316586.4	-	4	647	c.298G>A	c.(298-300)Ggc>Agc	p.G100S	STK25_ENST00000535007.1_Missense_Mutation_p.G6S|STK25_ENST00000403346.3_Missense_Mutation_p.G100S|STK25_ENST00000401869.1_Missense_Mutation_p.G100S|STK25_ENST00000405883.3_Missense_Mutation_p.G23S|STK25_ENST00000405585.1_Missense_Mutation_p.G23S|STK25_ENST00000478403.1_5'Flank|STK25_ENST00000543554.1_Missense_Mutation_p.G6S	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G100S(1)		breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GCTGAGCCGCCGCCCAGGTAC	0.617																																					NSCLC(99;1100 1566 7679 28647 48345)	dbGAP											1	Substitution - Missense(1)	breast(1)											123.0	111.0	115.0					2																	242440175		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.298G>A	2.37:g.242440175C>T	ENSP00000325748:p.Gly100Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G100S	ENST00000316586.4	37	c.298	CCDS2549.1	2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504405	0.85176	.	.	ENSG00000115694	ENST00000316586;ENST00000403346;ENST00000401869;ENST00000405883;ENST00000545437;ENST00000405585;ENST00000543554;ENST00000535007;ENST00000450497;ENST00000442307;ENST00000413760;ENST00000429279;ENST00000436402;ENST00000440109;ENST00000435225;ENST00000439101	T;T;T;T;T;T;T;T;T;T;D;T;D;D	0.85773	1.43;1.43;1.43;1.43;1.43;1.43;1.43;2.22;2.22;2.22;-2.03;0.72;-2.03;-2.03	4.98	4.98	0.66077	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93478	0.7919	M	0.86805	2.84	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.998;0.999	D	0.94499	0.7708	10	0.87932	D	0	.	18.6235	0.91330	0.0:1.0:0.0:0.0	.	100;26;23;100	B4DZ52;B4DVS7;A8K6Z3;O00506	.;.;.;STK25_HUMAN	S	100;100;100;23;6;23;6;6;6;6;6;6;100;6;6;6	ENSP00000325748:G100S;ENSP00000384162:G100S;ENSP00000385687:G100S;ENSP00000384444:G23S;ENSP00000385541:G23S;ENSP00000444886:G6S;ENSP00000446008:G6S;ENSP00000399212:G6S;ENSP00000403607:G6S;ENSP00000395104:G6S;ENSP00000404960:G6S;ENSP00000412617:G100S;ENSP00000403866:G6S;ENSP00000401114:G6S	ENSP00000325748:G100S	G	-	1	0	STK25	242088848	1.000000	0.71417	0.618000	0.29105	0.178000	0.23041	7.548000	0.82154	2.478000	0.83669	0.462000	0.41574	GGC	STK25	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000115694		0.617	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK25	HGNC	protein_coding	OTTHUMT00000257265.4	33	0.00	0	C	NM_006374		242440175	242440175	-1	no_errors	ENST00000316586	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	1.000	T
TRIM71	131405	genome.wustl.edu	37	3	32933156	32933156	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr3:32933156G>T	ENST00000383763.5	+	4	2523	c.2460G>T	c.(2458-2460)atG>atT	p.M820I		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	820					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M820I(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGGTACAGATGTTTGAATCCA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	124.0	121.0					3																	32933156		2054	4212	6266	-	-	-	SO:0001583	missense	0				CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.2460G>T	3.37:g.32933156G>T	ENSP00000373272:p.Met820Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.M820I	ENST00000383763.5	37	c.2460	CCDS43060.1	3	.	.	.	.	.	.	.	.	.	.	G	3.507	-0.100575	0.06967	.	.	ENSG00000206557	ENST00000383763	D	0.89270	-2.49	5.67	3.62	0.41486	Six-bladed beta-propeller, TolB-like (1);	0.143965	0.64402	D	0.000008	T	0.66356	0.2781	N	0.01824	-0.7	0.33810	D	0.627767	B	0.02656	0.0	B	0.01281	0.0	T	0.64249	-0.6452	10	0.17832	T	0.49	-54.5111	3.613	0.08067	0.2016:0.241:0.5573:0.0	.	820	Q2Q1W2	LIN41_HUMAN	I	820	ENSP00000373272:M820I	ENSP00000373272:M820I	M	+	3	0	TRIM71	32908160	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.469000	0.35343	2.663000	0.90544	0.655000	0.94253	ATG	TRIM71	-	pfscan_NHL_repeat_subgr	ENSG00000206557		0.602	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM71	HGNC	protein_coding	OTTHUMT00000341565.3	36	0.00	0	G	NM_001039111		32933156	32933156	+1	no_errors	ENST00000383763	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	T
TRIP4	9325	genome.wustl.edu	37	15	64701983	64701983	+	Silent	SNP	G	G	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr15:64701983G>A	ENST00000261884.3	+	7	1059	c.999G>A	c.(997-999)agG>agA	p.R333R	TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	333					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R333R(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						TTGCAGGAAGGAAGATCCTGG	0.468																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											104.0	104.0	104.0					15																	64701983		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.999G>A	15.37:g.64701983G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	NULL	p.E23K	ENST00000261884.3	37	c.67	CCDS10194.1	15																																																																																			TRIP4	-	NULL	ENSG00000103671		0.468	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP4	HGNC	protein_coding	OTTHUMT00000256635.2	198	0.50	1	G	NM_016213		64701983	64701983	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000560475	ensembl	human	putative	69_37n	missense	110	26.67	40	SNP	1.000	A
TRO	7216	genome.wustl.edu	37	X	54955782	54955782	+	Silent	SNP	G	G	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chrX:54955782G>A	ENST00000173898.7	+	12	2737	c.2625G>A	c.(2623-2625)acG>acA	p.T875T	TRO_ENST00000375022.4_Intron|TRO_ENST00000375041.2_Silent_p.T478T|TRO_ENST00000399736.1_Intron|TRO_ENST00000420798.2_Silent_p.T406T|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000319167.8_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	875	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T875T(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CACCCACAACGAGCACAGTCT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											56.0	51.0	53.0					X																	54955782		2119	4217	6336	-	-	-	SO:0001819	synonymous_variant	0			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.2625G>A	X.37:g.54955782G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.T875	ENST00000173898.7	37	c.2625	CCDS43959.1	X																																																																																			TRO	-	NULL	ENSG00000067445		0.572	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	HGNC	protein_coding	OTTHUMT00000056837.3	47	0.00	0	G	NM_016157		54955782	54955782	+1	no_errors	ENST00000173898	ensembl	human	known	69_37n	silent	37	24.49	12	SNP	0.000	A
UNC13B	10497	genome.wustl.edu	37	9	35376118	35376118	+	Missense_Mutation	SNP	C	C	G	rs542947932		TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr9:35376118C>G	ENST00000378495.3	+	14	1684	c.1462C>G	c.(1462-1464)Cca>Gca	p.P488A	UNC13B_ENST00000378496.4_Missense_Mutation_p.P488A|UNC13B_ENST00000396787.1_Missense_Mutation_p.P500A	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	488					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.P488A(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GGCCACTACCCCAACCTACTG	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		17176	0.0		0.001	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	111.0	112.0					9																	35376118		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1462C>G	9.37:g.35376118C>G	ENSP00000367756:p.Pro488Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.P500A	ENST00000378495.3	37	c.1498	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	C	33	5.195621	0.94960	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.93488	-3.23;-3.23;-3.23	6.07	6.07	0.98685	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.97148	0.9068	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96937	0.9685	10	0.87932	D	0	-14.2656	20.6439	0.99570	0.0:1.0:0.0:0.0	.	488;488	F8W8M9;O14795	.;UN13B_HUMAN	A	500;488;488;75	ENSP00000380006:P500A;ENSP00000367756:P488A;ENSP00000367757:P488A	ENSP00000367756:P488A	P	+	1	0	UNC13B	35366118	1.000000	0.71417	0.980000	0.43619	0.969000	0.65631	7.818000	0.86416	2.890000	0.99128	0.650000	0.86243	CCA	UNC13B	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000198722		0.542	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	56	0.00	0	C	NM_006377		35376118	35376118	+1	no_errors	ENST00000396787	ensembl	human	known	69_37n	missense	26	25.00	9	SNP	1.000	G
USP42	84132	genome.wustl.edu	37	7	6194543	6194546	+	Frame_Shift_Del	DEL	GGCG	GGCG	-			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	GGCG	GGCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr7:6194543_6194546delGGCG	ENST00000306177.5	+	15	3516_3519	c.3358_3361delGGCG	c.(3358-3363)ggcgcgfs	p.GA1120fs		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	1120					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCCCCGCGCAGGCGCGCCCCACGC	0.711																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.3358_3361delGGCG	7.37:g.6194543_6194546delGGCG	ENSP00000301962:p.Gly1120fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Frame_Shift_Del	DEL	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.G1120fs	ENST00000306177.5	37	c.3358_3361	CCDS47535.1	7																																																																																			USP42	-	NULL	ENSG00000106346		0.711	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	USP42	HGNC	protein_coding	OTTHUMT00000324262.3	19	0.00	0	GGCG	XM_166526		6194543	6194546	+1	no_errors	ENST00000306177	ensembl	human	known	69_37n	frame_shift_del	11	26.67	4	DEL	0.004:0.002:0.001:0.000	-
VEZF1	7716	genome.wustl.edu	37	17	56056604	56056605	+	In_Frame_Ins	INS	-	-	TGC	rs61731354|rs57786397|rs138088904|rs369163670	byFrequency	TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr17:56056604_56056605insTGC	ENST00000581208.1	-	5	1086_1087	c.1046_1047insGCA	c.(1045-1047)caa>caGCAa	p.349_349Q>QQ	VEZF1_ENST00000584396.1_In_Frame_Ins_p.340_340Q>QQ	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	349	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgctgctgctg	0.465																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1044_1046dupGCA	17.37:g.56056611_56056613dupTGC	ENSP00000462337:p.Gln354dup	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.353in_frame_insQ	ENST00000581208.1	37	c.1047_1046	CCDS32687.1	17																																																																																			VEZF1	-	NULL	ENSG00000136451		0.465	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VEZF1	HGNC	protein_coding	OTTHUMT00000443321.1	55	0.00	0	-			56056604	56056605	-1	no_errors	ENST00000581208	ensembl	human	known	69_37n	in_frame_ins	61	10.29	7	INS	0.934:0.940	TGC
ZNF277	11179	genome.wustl.edu	37	7	111982649	111982649	+	Silent	SNP	C	C	G			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr7:111982649C>G	ENST00000361822.3	+	12	1347	c.1218C>G	c.(1216-1218)ctC>ctG	p.L406L	AC004112.4_ENST00000431064.1_RNA|AC004112.4_ENST00000411413.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	406					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.L406L(1)		breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						ATGACACTCTCCTGTGTACAC	0.368																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											84.0	76.0	79.0					7																	111982649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.1218C>G	7.37:g.111982649C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MZ2|Q75MZ3|Q8WY14	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L406	ENST00000361822.3	37	c.1218	CCDS5755.2	7																																																																																			ZNF277	-	NULL	ENSG00000198839		0.368	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF277	HGNC	protein_coding	OTTHUMT00000316843.2	66	0.00	0	C	NM_021994		111982649	111982649	+1	no_errors	ENST00000361822	ensembl	human	known	69_37n	silent	47	47.19	42	SNP	0.983	G
ZNF416	55659	genome.wustl.edu	37	19	58083540	58083540	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IM-01A-11W-A050-09	TCGA-B6-A0IM-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e99a4753-10db-4823-953d-e878a90e6b01	c473b5c1-e471-4517-bdaf-6491c768f5c4	g.chr19:58083540G>A	ENST00000196489.3	-	4	1954	c.1732C>T	c.(1732-1734)Cgt>Tgt	p.R578C		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	578					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R578C(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CTGCTGTCACGAGGCCTCTCC	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											183.0	170.0	175.0					19																	58083540		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1732C>T	19.37:g.58083540G>A	ENSP00000196489:p.Arg578Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NWW8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R578C	ENST00000196489.3	37	c.1732	CCDS12954.1	19	.	.	.	.	.	.	.	.	.	.	G	10.66	1.412191	0.25465	.	.	ENSG00000083817	ENST00000196489	T	0.60548	0.18	3.4	-4.87	0.03123	.	.	.	.	.	T	0.22859	0.0552	N	0.01649	-0.78	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.14643	-1.0465	9	0.87932	D	0	.	3.2297	0.06744	0.574:0.1288:0.1671:0.1301	.	578	Q9BWM5	ZN416_HUMAN	C	578	ENSP00000196489:R578C	ENSP00000196489:R578C	R	-	1	0	ZNF416	62775352	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	0.414000	0.21164	-0.775000	0.04584	-0.305000	0.09177	CGT	ZNF416	-	NULL	ENSG00000083817		0.473	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF416	HGNC	protein_coding	OTTHUMT00000466787.1	165	0.00	0	G	NM_017879		58083540	58083540	-1	no_errors	ENST00000196489	ensembl	human	known	69_37n	missense	67	30.93	30	SNP	0.000	A
