#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48285575	48285575	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:48285575A>G	ENST00000435803.1	+	13	1631	c.1607A>G	c.(1606-1608)aAc>aGc	p.N536S		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	536					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGCTATTGTAACTCCTCTGAG	0.458																																						dbGAP											0													78.0	72.0	74.0					7																	48285575		1883	4115	5998	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.1607A>G	7.37:g.48285575A>G	ENSP00000411096:p.Asn536Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.N536S	ENST00000435803.1	37	c.1607	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	A	9.798	1.179783	0.21787	.	.	ENSG00000179869	ENST00000435803	D	0.88431	-2.38	5.06	-5.5	0.02576	.	1.762110	0.03311	N	0.190555	T	0.74038	0.3664	N	0.12182	0.205	0.09310	N	1	B	0.25105	0.118	B	0.21917	0.037	T	0.61855	-0.6977	10	0.36615	T	0.2	.	1.4361	0.02344	0.399:0.1878:0.0811:0.332	.	536	Q86UQ4	ABCAD_HUMAN	S	536	ENSP00000411096:N536S	ENSP00000411096:N536S	N	+	2	0	ABCA13	48256121	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.029000	0.13666	-1.401000	0.02058	0.533000	0.62120	AAC	ABCA13	-	NULL	ENSG00000179869		0.458	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	39	0.00	0	A	NM_152701		48285575	48285575	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	0.000	G
ABCF2	10061	genome.wustl.edu	37	7	150913108	150913108	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:150913108G>T	ENST00000287844.2	-	12	1455	c.1346C>A	c.(1345-1347)cCc>cAc	p.P449H	ABCF2_ENST00000473874.1_5'Flank|ABCF2_ENST00000222388.2_Missense_Mutation_p.P449H	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	449	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCATCTGTGGGTAGTAGCTA	0.478																																						dbGAP											0													105.0	93.0	97.0					7																	150913108		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1346C>A	7.37:g.150913108G>T	ENSP00000287844:p.Pro449His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P449H	ENST00000287844.2	37	c.1346	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889908	0.72524	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.95238	-3.65;-3.65	5.5	5.5	0.81552	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98220	0.9411	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99338	1.0911	10	0.87932	D	0	-2.5346	18.3928	0.90489	0.0:0.0:1.0:0.0	.	449;449	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	H	449	ENSP00000222388:P449H;ENSP00000287844:P449H	ENSP00000222388:P449H	P	-	2	0	ABCF2	150544041	1.000000	0.71417	0.946000	0.38457	0.294000	0.27393	6.911000	0.75746	2.566000	0.86566	0.655000	0.94253	CCC	ABCF2	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000033050		0.478	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	132	0.00	0	G	NM_005692		150913108	150913108	-1	no_errors	ENST00000222388	ensembl	human	known	69_37n	missense	74	22.11	21	SNP	1.000	T
ACCS	84680	genome.wustl.edu	37	11	44104793	44104793	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr11:44104793C>T	ENST00000263776.8	+	13	1620	c.1186C>T	c.(1186-1188)Ctt>Ttt	p.L396F		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	396					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						CTCAGAAGAGCTTAGGGCATT	0.557																																					Esophageal Squamous(158;148 1889 8077 23160 41213)	dbGAP											0													114.0	109.0	110.0					11																	44104793		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1186C>T	11.37:g.44104793C>T	ENSP00000263776:p.Leu396Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	p.L396F	ENST00000263776.8	37	c.1186	CCDS7907.1	11	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830168	0.71258	.	.	ENSG00000110455	ENST00000263776	D	0.95342	-3.68	5.77	5.77	0.91146	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.97660	0.9233	M	0.87097	2.86	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	D	0.97639	1.0147	10	0.56958	D	0.05	-24.5036	19.5934	0.95525	0.0:1.0:0.0:0.0	.	396	Q96QU6	1A1L1_HUMAN	F	396	ENSP00000263776:L396F	ENSP00000263776:L396F	L	+	1	0	ACCS	44061369	1.000000	0.71417	0.997000	0.53966	0.177000	0.22998	5.602000	0.67612	2.724000	0.93272	0.561000	0.74099	CTT	ACCS	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000110455		0.557	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	178	0.00	0	C	NM_032592		44104793	44104793	+1	no_errors	ENST00000263776	ensembl	human	known	69_37n	missense	190	28.20	75	SNP	1.000	T
ADAM15	8751	genome.wustl.edu	37	1	155029738	155029740	+	In_Frame_Del	DEL	GCT	GCT	-	rs138792963		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:155029738_155029740delGCT	ENST00000356955.2	+	12	1324_1326	c.1223_1225delGCT	c.(1222-1227)agctgc>agc	p.C409del	ADAM15_ENST00000368410.2_In_Frame_Del_p.C115del|ADAM15_ENST00000447332.3_In_Frame_Del_p.C393del|ADAM15_ENST00000368412.3_In_Frame_Del_p.C409del|ADAM15_ENST00000271836.6_In_Frame_Del_p.C409del|ADAM15_ENST00000360674.4_In_Frame_Del_p.C409del|ADAM15_ENST00000531455.1_In_Frame_Del_p.C419del|ADAM15_ENST00000355956.2_In_Frame_Del_p.C409del|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000449910.2_In_Frame_Del_p.C409del|ADAM15_ENST00000359280.4_In_Frame_Del_p.C409del|ADAM15_ENST00000368413.1_In_Frame_Del_p.C115del	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	409	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GGAATGGGCAGCTGCCTCTTCGA	0.601																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1223_1225delGCT	1.37:g.155029738_155029740delGCT	ENSP00000349436:p.Cys409del	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	In_Frame_Del	DEL	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.C409in_frame_del	ENST00000356955.2	37	c.1223_1225	CCDS1087.1	1																																																																																			ADAM15	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000143537		0.601	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM15	HGNC	protein_coding	OTTHUMT00000387168.1	52	0.00	0	GCT	NM_003815		155029738	155029740	+1	no_errors	ENST00000356955	ensembl	human	known	69_37n	in_frame_del	36	11.90	5	DEL	1.000:1.000:1.000	-
ADAMTS17	170691	genome.wustl.edu	37	15	100801809	100801809	+	Silent	SNP	C	C	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr15:100801809C>A	ENST00000268070.4	-	6	1011	c.906G>T	c.(904-906)cgG>cgT	p.R302R	ADAMTS17_ENST00000559976.1_5'Flank	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	302	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TCTCCAGGGACCGCTCACCAT	0.552																																						dbGAP											0													60.0	46.0	51.0					15																	100801809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.906G>T	15.37:g.100801809C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2I7G4|Q6ZN75	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R302	ENST00000268070.4	37	c.906	CCDS10383.1	15																																																																																			ADAMTS17	-	pfscan_Peptidase_M12B	ENSG00000140470		0.552	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	HGNC	protein_coding	OTTHUMT00000313595.1	31	0.00	0	C	NM_139057		100801809	100801809	-1	no_errors	ENST00000268070	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	1.000	A
AFF2	2334	genome.wustl.edu	37	X	148037858	148037858	+	Silent	SNP	T	T	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chrX:148037858T>C	ENST00000370460.2	+	11	2762	c.2283T>C	c.(2281-2283)agT>agC	p.S761S	AFF2_ENST00000370457.5_Silent_p.S728S|AFF2_ENST00000286437.5_Silent_p.S402S|AFF2_ENST00000342251.3_Silent_p.S728S	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	761					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CCTTAATGAGTAGCAGTGGCA	0.463																																						dbGAP											0													94.0	85.0	88.0					X																	148037858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2283T>C	X.37:g.148037858T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	pfam_TF_AF4/FMR2	p.S761	ENST00000370460.2	37	c.2283	CCDS14684.1	X																																																																																			AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.463	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	246	0.00	0	T	NM_002025		148037858	148037858	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	silent	149	22.68	44	SNP	0.961	C
ALAS1	211	genome.wustl.edu	37	3	52239960	52239960	+	Silent	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:52239960G>C	ENST00000394965.2	+	7	1266	c.906G>C	c.(904-906)ggG>ggC	p.G302G	ALAS1_ENST00000310271.2_Silent_p.G302G|ALAS1_ENST00000469224.1_Silent_p.G302G|ALAS1_ENST00000484952.1_Silent_p.G302G	NM_000688.5	NP_000679.1	P13196	HEM1_HUMAN	aminolevulinate, delta-, synthase 1	302					cellular lipid metabolic process (GO:0044255)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5-aminolevulinate synthase activity (GO:0003870)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(3)|large_intestine(7)|liver(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)	ACCTCCATGGGAAAGATGCCG	0.498																																						dbGAP											0													161.0	156.0	158.0					3																	52239960		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X56351	CCDS2847.1	3p21	2004-11-18			ENSG00000023330	ENSG00000023330	2.3.1.37		396	protein-coding gene	gene with protein product		125290		ALAS3, ALAS			Standard	NM_000688		Approved		uc003dcz.2	P13196	OTTHUMG00000158108	ENST00000394965.2:c.906G>C	3.37:g.52239960G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Aminotransferase_I/II,pfam_5aminolev_synth_preseq,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4pyrrol_synth_NH2levulA_synth	p.G302	ENST00000394965.2	37	c.906	CCDS2847.1	3																																																																																			ALAS1	-	pfam_Aminotransferase_I/II,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4pyrrol_synth_NH2levulA_synth	ENSG00000023330		0.498	ALAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS1	HGNC	protein_coding	OTTHUMT00000350207.1	167	0.00	0	G			52239960	52239960	+1	no_errors	ENST00000310271	ensembl	human	known	69_37n	silent	105	26.06	37	SNP	0.867	C
ALDH1L1	10840	genome.wustl.edu	37	3	125877412	125877412	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:125877412C>G	ENST00000393434.2	-	3	547	c.198G>C	c.(196-198)ttG>ttC	p.L66F	U1_ENST00000606575.1_RNA|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.L66F|ALDH1L1_ENST00000413612.1_5'Flank|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.L66F|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.L66F|ALDH1L1_ENST00000455064.2_Intron|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.L76F	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	66	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CCACATCAGGCAAAGCCTGTC	0.577																																						dbGAP											0													112.0	104.0	107.0					3																	125877412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.198G>C	3.37:g.125877412C>G	ENSP00000377083:p.Leu66Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.L66F	ENST00000393434.2	37	c.198	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002091	0.35320	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431;ENST00000490367;ENST00000460368;ENST00000488356;ENST00000509952	T;T;T;T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	4.65	1.81	0.25067	Formyl transferase, N-terminal (3);	0.189434	0.35407	N	0.003239	T	0.81254	0.4784	M	0.64260	1.97	0.80722	D	1	P;D;D	0.60575	0.922;0.988;0.988	P;D;D	0.67548	0.678;0.952;0.952	T	0.77507	-0.2562	10	0.87932	D	0	.	3.5255	0.07757	0.3489:0.459:0.0:0.1921	.	66;118;66	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	F	76;66;66;66;66;66;66;66;66	ENSP00000273450:L76F;ENSP00000420293:L66F;ENSP00000395881:L66F;ENSP00000377083:L66F;ENSP00000377081:L66F;ENSP00000418711:L66F;ENSP00000419826:L66F;ENSP00000419955:L66F;ENSP00000426594:L66F	ENSP00000273450:L76F	L	-	3	2	ALDH1L1	127360102	0.967000	0.33354	0.991000	0.47740	0.259000	0.26198	0.122000	0.15687	0.185000	0.20105	0.491000	0.48974	TTG	ALDH1L1	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,pirsf_10_FTHF_DH	ENSG00000144908		0.577	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	89	0.00	0	C	NM_012190		125877412	125877412	-1	no_errors	ENST00000393434	ensembl	human	known	69_37n	missense	28	28.21	11	SNP	0.998	G
APOB	338	genome.wustl.edu	37	2	21241873	21241873	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr2:21241873G>A	ENST00000233242.1	-	20	3239	c.3112C>T	c.(3112-3114)Caa>Taa	p.Q1038*		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1038					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTTCTGCTTGAGTTACAAAC	0.458																																						dbGAP											0													128.0	119.0	122.0					2																	21241873		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3112C>T	2.37:g.21241873G>A	ENSP00000233242:p.Gln1038*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.Q1038*	ENST00000233242.1	37	c.3112	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	42	9.439111	0.99171	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	.	.	.	4.3	4.3	0.51218	.	0.000000	0.49305	D	0.000152	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	17.6365	0.88123	0.0:0.0:1.0:0.0	.	.	.	.	X	1038	.	ENSP00000233242:Q1038X	Q	-	1	0	APOB	21095378	0.997000	0.39634	0.998000	0.56505	0.976000	0.68499	4.553000	0.60753	2.325000	0.78763	0.460000	0.39030	CAA	APOB	-	pfam_Lipid_transpt_open_b-sht	ENSG00000084674		0.458	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	260	0.00	0	G			21241873	21241873	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	nonsense	144	47.45	130	SNP	0.983	A
ARID4A	5926	genome.wustl.edu	37	14	58831916	58831916	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr14:58831916C>G	ENST00000355431.3	+	20	3482	c.3109C>G	c.(3109-3111)Caa>Gaa	p.Q1037E	ARID4A_ENST00000348476.3_Missense_Mutation_p.Q1037E|ARID4A_ENST00000395168.3_Missense_Mutation_p.Q1037E|ARID4A_ENST00000431317.2_Missense_Mutation_p.Q1037E	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	1037					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TGAAGAATCTCAAGAAGGTCT	0.398																																						dbGAP											0													90.0	93.0	92.0					14																	58831916		2203	4299	6502	-	-	-	SO:0001583	missense	0			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.3109C>G	14.37:g.58831916C>G	ENSP00000347602:p.Gln1037Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15991|Q15992|Q15993	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,smart_Chromo_domain/shadow,pfscan_ARID/BRIGHT_DNA-bd	p.Q1037E	ENST00000355431.3	37	c.3109	CCDS9732.1	14	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966397	0.53507	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.22743	2.27;2.3;2.22;2.3;1.94	5.64	5.64	0.86602	.	0.325633	0.32769	N	0.005680	T	0.28001	0.0690	L	0.52364	1.645	0.51233	D	0.999914	P;B;B	0.36837	0.571;0.189;0.287	B;B;B	0.39027	0.288;0.107;0.153	T	0.02901	-1.1096	10	0.87932	D	0	-12.9314	19.7082	0.96082	0.0:1.0:0.0:0.0	.	1037;1037;1037	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	E	1037;1037;1037;1037;715	ENSP00000347602:Q1037E;ENSP00000344556:Q1037E;ENSP00000378597:Q1037E;ENSP00000397368:Q1037E;ENSP00000416053:Q715E	ENSP00000344556:Q1037E	Q	+	1	0	ARID4A	57901669	0.974000	0.33945	0.928000	0.36995	0.996000	0.88848	3.819000	0.55686	2.676000	0.91093	0.557000	0.71058	CAA	ARID4A	-	NULL	ENSG00000032219		0.398	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4A	HGNC	protein_coding	OTTHUMT00000276927.2	104	0.00	0	C	NM_023001		58831916	58831916	+1	no_errors	ENST00000355431	ensembl	human	known	69_37n	missense	78	55.11	97	SNP	0.997	G
ASB15	142685	genome.wustl.edu	37	7	123256326	123256326	+	Splice_Site	SNP	A	A	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:123256326A>G	ENST00000451558.1	+	7	680	c.159A>G	c.(157-159)caA>caG	p.Q53Q	ASB15_ENST00000540573.1_Splice_Site_p.Q53Q|RP11-390E23.3_ENST00000418409.1_RNA|ASB15_ENST00000451215.1_Splice_Site_p.Q53Q|RP11-390E23.3_ENST00000422401.1_RNA|ASB15_ENST00000275699.3_Splice_Site_p.Q53Q|ASB15_ENST00000434204.1_Splice_Site_p.Q53Q|RP11-390E23.3_ENST00000440504.1_RNA			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	53					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						CCATAAAACAAGGTAAATGGG	0.353																																						dbGAP											0													96.0	97.0	96.0					7																	123256326		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.160+1A>G	7.37:g.123256326A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCP3|Q3ZCP5|Q68D37	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.Q53	ENST00000451558.1	37	c.159	CCDS34742.1	7																																																																																			ASB15	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000146809		0.353	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB15	HGNC	protein_coding	OTTHUMT00000347493.1	54	0.00	0	A		Silent	123256326	123256326	+1	no_errors	ENST00000275699	ensembl	human	known	69_37n	silent	68	53.42	78	SNP	1.000	G
BAI1	575	genome.wustl.edu	37	8	143569787	143569787	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr8:143569787T>G	ENST00000517894.1	+	14	3265	c.2371T>G	c.(2371-2373)Tgg>Ggg	p.W791G	BAI1_ENST00000323289.5_Missense_Mutation_p.W791G			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	791					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CATGAAGGGCTGGCGGGCCAC	0.632																																						dbGAP											0													69.0	80.0	77.0					8																	143569787		2037	4191	6228	-	-	-	SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2371T>G	8.37:g.143569787T>G	ENSP00000430945:p.Trp791Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.W791G	ENST00000517894.1	37	c.2371		8	.	.	.	.	.	.	.	.	.	.	T	18.58	3.653728	0.67472	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.26373	1.74;1.74	4.35	3.18	0.36537	.	0.080704	0.53938	U	0.000049	T	0.27629	0.0679	L	0.50333	1.59	0.58432	D	0.999995	D	0.53312	0.959	P	0.48952	0.596	T	0.01848	-1.1261	10	0.36615	T	0.2	.	8.4214	0.32703	0.0:0.0964:0.0:0.9036	.	791	E9PBK0	.	G	791	ENSP00000430945:W791G;ENSP00000313046:W791G	ENSP00000313046:W791G	W	+	1	0	BAI1	143566789	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.943000	0.49026	1.738000	0.51689	0.260000	0.18958	TGG	BAI1	-	pfam_DUF3497,prints_GPCR_2_brain-spec_angio_inhib	ENSG00000181790		0.632	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	14	0.00	0	T	NM_001702		143569787	143569787	+1	no_errors	ENST00000323289	ensembl	human	known	69_37n	missense	15	48.28	14	SNP	1.000	G
BAZ1A	11177	genome.wustl.edu	37	14	35245596	35245596	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr14:35245596C>T	ENST00000382422.2	-	17	2689	c.2362G>A	c.(2362-2364)Gag>Aag	p.E788K	BAZ1A_ENST00000360310.1_Missense_Mutation_p.E788K|BAZ1A_ENST00000358716.4_Missense_Mutation_p.E756K			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	788	Interaction with SMARCA5.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TCTAAGAGCTCTTTCTCTTTT	0.418																																						dbGAP											0													139.0	136.0	137.0					14																	35245596		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.2362G>A	14.37:g.35245596C>T	ENSP00000371859:p.Glu788Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.E788K	ENST00000382422.2	37	c.2362	CCDS9651.1	14	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962922	0.92791	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.73789	-0.78;-0.76;-0.76	5.75	5.75	0.90469	.	0.255121	0.39341	N	0.001389	T	0.80597	0.4653	L	0.59436	1.845	0.80722	D	1	D;P	0.56968	0.978;0.9	P;P	0.52109	0.69;0.516	T	0.81104	-0.1084	10	0.56958	D	0.05	.	19.9525	0.97208	0.0:1.0:0.0:0.0	.	756;788	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	K	756;788;788;440	ENSP00000351555:E756K;ENSP00000371859:E788K;ENSP00000353458:E788K	ENSP00000351555:E756K	E	-	1	0	BAZ1A	34315347	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	7.515000	0.81761	2.719000	0.93026	0.655000	0.94253	GAG	BAZ1A	-	NULL	ENSG00000198604		0.418	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1A	HGNC	protein_coding	OTTHUMT00000276646.1	158	0.00	0	C			35245596	35245596	-1	no_errors	ENST00000360310	ensembl	human	known	69_37n	missense	68	54.36	81	SNP	1.000	T
BCKDK	10295	genome.wustl.edu	37	16	31122020	31122022	+	In_Frame_Del	DEL	CGG	CGG	-	rs368040635		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	CGG	CGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr16:31122020_31122022delCGG	ENST00000394951.1	+	9	1277_1279	c.654_656delCGG	c.(652-657)gtcggc>gtc	p.G219del	BCKDK_ENST00000287507.3_In_Frame_Del_p.G219del|BCKDK_ENST00000219794.6_In_Frame_Del_p.G219del|BCKDK_ENST00000394950.3_In_Frame_Del_p.G219del|AC135050.1_ENST00000517000.2_RNA			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	219	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						CTGACTTTGTCGGCATCATCTGT	0.576																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.654_656delCGG	16.37:g.31122020_31122022delCGG	ENSP00000378405:p.Gly219del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY43|Q6FGL4|Q96G95|Q96IN5	In_Frame_Del	DEL	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core,prints_Sig_transdc_His_kin-like_C	p.G219in_frame_del	ENST00000394951.1	37	c.654_656	CCDS10705.1	16																																																																																			BCKDK	-	pfam_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd	ENSG00000103507		0.576	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCKDK	HGNC	protein_coding	OTTHUMT00000108514.1	54	0.00	0	CGG	NM_005881		31122020	31122022	+1	no_errors	ENST00000219794	ensembl	human	known	69_37n	in_frame_del	26	10.00	3	DEL	0.970:1.000:1.000	-
BLK	640	genome.wustl.edu	37	8	11400751	11400752	+	Frame_Shift_Ins	INS	-	-	A	rs113656715		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr8:11400751_11400752insA	ENST00000259089.4	+	2	610_611	c.18_19insA	c.(19-21)aaafs	p.K7fs	BLK_ENST00000529894.1_Intron	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	7					B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		TGGTAAGTAGCAAAAAGCCGGA	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.23dupA	8.37:g.11400756_11400756dupA	ENSP00000259089:p.Lys7fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16291|Q96IN1	Frame_Shift_Ins	INS	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.P8fs	ENST00000259089.4	37	c.18_19	CCDS5982.1	8																																																																																			BLK	-	NULL	ENSG00000136573		0.609	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLK	HGNC	protein_coding	OTTHUMT00000207460.1	48	0.00	0	-			11400751	11400752	+1	no_errors	ENST00000259089	ensembl	human	known	69_37n	frame_shift_ins	42	20.75	11	INS	1.000:1.000	A
C19orf43	79002	genome.wustl.edu	37	19	12841864	12841864	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:12841864C>T	ENST00000242784.4	-	3	559	c.442G>A	c.(442-444)Gac>Aac	p.D148N	C19orf43_ENST00000592273.1_Missense_Mutation_p.D122N|C19orf43_ENST00000588213.1_3'UTR	NM_024038.2	NP_076943.1	Q9BQ61	CS043_HUMAN	chromosome 19 open reading frame 43	148										endometrium(2)|large_intestine(2)	4						GCCCACGCGTCACCTTTACTT	0.557																																						dbGAP											0													149.0	130.0	137.0					19																	12841864		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027588	CCDS12279.1	19p13.2	2011-11-24			ENSG00000123144	ENSG00000123144			28424	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 18"""					12477932	Standard	NM_024038		Approved	MGC2803, fSAP18	uc002muu.3	Q9BQ61		ENST00000242784.4:c.442G>A	19.37:g.12841864C>T	ENSP00000242784:p.Asp148Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D148N	ENST00000242784.4	37	c.442	CCDS12279.1	19	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241836	0.79912	.	.	ENSG00000123144	ENST00000242784	.	.	.	4.85	4.85	0.62838	.	0.066618	0.64402	D	0.000013	T	0.75287	0.3829	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	D	0.64321	0.924	T	0.78173	-0.2307	9	0.62326	D	0.03	-16.2861	16.7561	0.85499	0.0:1.0:0.0:0.0	.	148	Q9BQ61	CS043_HUMAN	N	148	.	ENSP00000242784:D148N	D	-	1	0	C19orf43	12702864	1.000000	0.71417	0.990000	0.47175	0.613000	0.37349	7.105000	0.77031	2.226000	0.72624	0.591000	0.81541	GAC	C19orf43	-	NULL	ENSG00000123144		0.557	C19orf43-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	C19orf43	HGNC	protein_coding	OTTHUMT00000450856.1	184	0.00	0	C	NM_024038		12841864	12841864	-1	no_errors	ENST00000242784	ensembl	human	known	69_37n	missense	33	32.00	16	SNP	1.000	T
CCDC180	100499483	genome.wustl.edu	37	9	100075583	100075583	+	Missense_Mutation	SNP	A	A	C	rs17855671		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr9:100075583A>C	ENST00000357054.1	+	19	1899	c.964A>C	c.(964-966)Agc>Cgc	p.S322R	CCDC180_ENST00000375202.2_Missense_Mutation_p.S183R|CCDC180_ENST00000460482.2_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000395220.1_Missense_Mutation_p.S322R|CCDC180_ENST00000411667.2_Missense_Mutation_p.S183R|CCDC180_ENST00000529487.1_Missense_Mutation_p.S183R			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	322			S -> R (in dbSNP:rs17855671).			extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GAGCTACGAGAGCGCTCTGGC	0.542																																						dbGAP											0													140.0	112.0	122.0					9																	100075583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.964A>C	9.37:g.100075583A>C	ENSP00000349562:p.Ser322Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.S183R	ENST00000357054.1	37	c.547		9	.	.	.	.	.	.	.	.	.	.	A	6.174	0.400260	0.11696	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94	5.71	-1.38	0.09027	.	1.896230	0.01782	N	0.031827	T	0.15262	0.0368	L	0.35723	1.085	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.15578	-1.0432	10	0.12766	T	0.61	1.559	5.2196	0.15362	0.4635:0.2657:0.2708:0.0	rs17855671;rs17855671	183;322;183;322	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	R	322;322;183;183;206;183	ENSP00000349562:S322R;ENSP00000378646:S322R;ENSP00000364348:S183R;ENSP00000414000:S183R;ENSP00000434727:S183R	ENSP00000349562:S322R	S	+	1	0	C9orf174	99115404	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.350000	0.20079	-0.325000	0.08577	-2.912000	0.00091	AGC	C9orf174	-	NULL	ENSG00000197816		0.542	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		66	0.00	0	A	NM_020893		100075583	100075583	+1	no_errors	ENST00000375202	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.000	C
CBL	867	genome.wustl.edu	37	11	119142562	119142562	+	Silent	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr11:119142562G>A	ENST00000264033.4	+	3	937	c.561G>A	c.(559-561)gcG>gcA	p.A187A		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	187	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|EF-hand-like.|Sufficient for interaction with EPHB1.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CAGATGCTGCGGAATTTTGGA	0.373			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																													dbGAP		"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													86.0	94.0	91.0					11																	119142562		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.561G>A	11.37:g.119142562G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMP8	Silent	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.A187	ENST00000264033.4	37	c.561	CCDS8418.1	11																																																																																			CBL	-	pfam_Adaptor_Cbl_EF_hand-like	ENSG00000110395		0.373	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	165	0.60	1	G	NM_005188		119142562	119142562	+1	no_errors	ENST00000264033	ensembl	human	known	69_37n	silent	211	22.14	60	SNP	0.516	A
CCHCR1	54535	genome.wustl.edu	37	6	31117874	31117874	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr6:31117874T>C	ENST00000376266.5	-	8	1186	c.1064A>G	c.(1063-1065)cAc>cGc	p.H355R	CCHCR1_ENST00000396263.2_Missense_Mutation_p.H355R|CCHCR1_ENST00000451521.2_Missense_Mutation_p.H408R|CCHCR1_ENST00000480060.1_Intron|CCHCR1_ENST00000396268.3_Missense_Mutation_p.H444R	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	355					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						AGAGTCACTGTGTTCCAGCTC	0.567																																						dbGAP											0													125.0	107.0	113.0					6																	31117874		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1064A>G	6.37:g.31117874T>C	ENSP00000365442:p.His355Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	SNP	pfam_HCR	p.H444R	ENST00000376266.5	37	c.1331	CCDS4695.1	6	.	.	.	.	.	.	.	.	.	.	T	16.89	3.247644	0.59103	.	.	ENSG00000204536	ENST00000396268;ENST00000376266;ENST00000396263;ENST00000440185;ENST00000451521	T;T;T;T	0.05925	3.37;3.37;3.37;3.37	5.27	4.08	0.47627	.	0.326711	0.29892	N	0.010934	T	0.06508	0.0167	M	0.67953	2.075	0.24401	N	0.99471	D;P;P;D;D	0.58970	0.983;0.714;0.928;0.984;0.963	P;P;P;P;P	0.59424	0.857;0.479;0.73;0.81;0.698	T	0.22556	-1.0213	10	0.15952	T	0.53	-21.9569	9.2273	0.37414	0.0:0.0:0.1827:0.8173	.	355;355;355;408;444	B4DIA2;A8K081;Q8TD31;E9PE84;Q8TD31-2	.;.;CCHCR_HUMAN;.;.	R	444;355;355;355;408	ENSP00000379566:H444R;ENSP00000365442:H355R;ENSP00000379561:H355R;ENSP00000401039:H408R	ENSP00000365442:H355R	H	-	2	0	CCHCR1	31225853	1.000000	0.71417	0.848000	0.33437	0.951000	0.60555	4.467000	0.60155	0.826000	0.34661	0.443000	0.29094	CAC	CCHCR1	-	pfam_HCR	ENSG00000204536		0.567	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCHCR1	HGNC	protein_coding	OTTHUMT00000076190.5	122	0.00	0	T	NM_019052		31117874	31117874	-1	no_errors	ENST00000396268	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.590	C
CDH19	28513	genome.wustl.edu	37	18	64197168	64197168	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr18:64197168C>G	ENST00000540086.1	-	9	1618	c.1372G>C	c.(1372-1374)Gtg>Ctg	p.V458L	CDH19_ENST00000262150.2_Missense_Mutation_p.V458L	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	566	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				AGAACTTGCACATACAGTGGG	0.328																																						dbGAP											0													121.0	117.0	118.0					18																	64197168		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.1372G>C	18.37:g.64197168C>G	ENSP00000439593:p.Val458Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15098	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V458L	ENST00000540086.1	37	c.1372	CCDS59325.1	18	.	.	.	.	.	.	.	.	.	.	C	9.162	1.019018	0.19355	.	.	ENSG00000071991	ENST00000262150;ENST00000540086	T;T	0.61040	0.14;0.14	5.53	2.78	0.32641	Cadherin (5);Cadherin-like (1);	0.059707	0.64402	D	0.000006	T	0.60483	0.2272	L	0.61218	1.895	0.31126	N	0.708296	P;P	0.46859	0.798;0.885	B;P	0.51701	0.184;0.677	T	0.64630	-0.6362	10	0.87932	D	0	.	6.5741	0.22555	0.0:0.5853:0.0:0.4147	.	458;458	F5H1K0;Q9H159	.;CAD19_HUMAN	L	458	ENSP00000262150:V458L;ENSP00000439593:V458L	ENSP00000262150:V458L	V	-	1	0	CDH19	62348148	1.000000	0.71417	0.976000	0.42696	0.577000	0.36160	0.867000	0.27968	0.707000	0.31934	-0.157000	0.13467	GTG	CDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000071991		0.328	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000442285.1	37	0.00	0	C	NM_021153		64197168	64197168	-1	no_errors	ENST00000262150	ensembl	human	known	69_37n	missense	89	28.23	35	SNP	0.989	G
CENPF	1063	genome.wustl.edu	37	1	214819500	214819500	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:214819500G>A	ENST00000366955.3	+	13	6755	c.6587G>A	c.(6586-6588)aGa>aAa	p.R2196K		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2292	Interaction with NDE1 and NDEL1.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAGATGGCCAGAAGCCTGAAA	0.373																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													56.0	62.0	60.0					1																	214819500		2202	4300	6502	-	-	-	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.6587G>A	1.37:g.214819500G>A	ENSP00000355922:p.Arg2196Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.R2196K	ENST00000366955.3	37	c.6587	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	G	4.126	0.021634	0.08006	.	.	ENSG00000117724	ENST00000366955	T	0.39229	1.09	5.33	0.528	0.17089	Centromere protein Cenp-F, leucine-rich repeat-containing domain (1);	1.288110	0.05716	N	0.596829	T	0.11110	0.0271	N	0.00778	-1.195	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31166	-0.9953	10	0.02654	T	1	.	1.6462	0.02762	0.3688:0.1488:0.3386:0.1439	.	2292	P49454	CENPF_HUMAN	K	2196	ENSP00000355922:R2196K	ENSP00000355922:R2196K	R	+	2	0	CENPF	212886123	0.000000	0.05858	0.004000	0.12327	0.478000	0.33099	0.815000	0.27253	0.053000	0.16036	-0.492000	0.04666	AGA	CENPF	-	pfam_Centromere_CenpF_leu-rich_rpt	ENSG00000117724		0.373	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	197	0.00	0	G	NM_016343		214819500	214819500	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	missense	269	36.62	156	SNP	0.000	A
CRYBG3	131544	genome.wustl.edu	37	3	97598935	97598935	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:97598935T>C	ENST00000182096.4	+	3	1215	c.1151T>C	c.(1150-1152)gTa>gCa	p.V384A		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2332							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						ATAAAAGTTGTAAGGGGCTGG	0.284																																						dbGAP											0													71.0	68.0	69.0					3																	97598935		1794	4061	5855	-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1151T>C	3.37:g.97598935T>C	ENSP00000182096:p.Val384Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.V384A	ENST00000182096.4	37	c.1151		3	.	.	.	.	.	.	.	.	.	.	T	16.72	3.200571	0.58126	.	.	ENSG00000080200	ENST00000182096	T	0.76060	-0.99	5.57	5.57	0.84162	Beta/gamma crystallin (3);Gamma-crystallin-related (1);	0.531585	0.18445	N	0.141030	T	0.75882	0.3910	M	0.80422	2.495	0.80722	D	1	B	0.31655	0.334	B	0.33846	0.171	T	0.72577	-0.4251	10	0.21014	T	0.42	.	14.6744	0.68969	0.0:0.0:0.0:1.0	.	384	Q68DQ2	CRBG3_HUMAN	A	384	ENSP00000182096:V384A	ENSP00000182096:V384A	V	+	2	0	CRYBG3	99081625	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.114000	0.64648	2.277000	0.76020	0.529000	0.55759	GTA	CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin	ENSG00000080200		0.284	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	38	0.00	0	T	NM_153605		97598935	97598935	+1	no_errors	ENST00000182096	ensembl	human	known	69_37n	missense	84	21.50	23	SNP	1.000	C
CYP26A1	1592	genome.wustl.edu	37	10	94834968	94834968	+	Silent	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr10:94834968C>T	ENST00000224356.4	+	4	813	c.768C>T	c.(766-768)tgC>tgT	p.C256C	CYP26A1_ENST00000394139.1_Silent_p.C187C|CYP26A1_ENST00000371531.1_Silent_p.C187C	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	256					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	CCAAGATCTGCGGGCTGCGGG	0.667																																						dbGAP											0													31.0	32.0	32.0					10																	94834968		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.768C>T	10.37:g.94834968C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNI4|Q5VXH9|Q5VXI0	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.C256	ENST00000224356.4	37	c.768	CCDS7426.1	10																																																																																			CYP26A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000095596		0.667	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP26A1	HGNC	protein_coding	OTTHUMT00000049408.3	15	0.00	0	C			94834968	94834968	+1	no_errors	ENST00000224356	ensembl	human	known	69_37n	silent	5	82.14	23	SNP	0.001	T
CYP4A11	1579	genome.wustl.edu	37	1	47407052	47407052	+	Silent	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:47407052G>T	ENST00000310638.4	-	1	85	c.54C>A	c.(52-54)atC>atA	p.I18I	CYP4A11_ENST00000371905.1_Silent_p.I18I|CYP4A11_ENST00000371904.4_Silent_p.I18I|CYP4A11_ENST00000462347.1_Silent_p.I18I|CYP4A11_ENST00000457840.2_5'UTR	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	18					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CCGCTTGGAGGATTCCAGAGA	0.587																																						dbGAP											0													99.0	97.0	98.0					1																	47407052		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.54C>A	1.37:g.47407052G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.I18	ENST00000310638.4	37	c.54	CCDS543.1	1																																																																																			CYP4A11	-	NULL	ENSG00000187048		0.587	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4A11	HGNC	protein_coding	OTTHUMT00000022022.1	167	0.00	0	G	NM_000778		47407052	47407052	-1	no_errors	ENST00000371904	ensembl	human	known	69_37n	silent	160	10.11	18	SNP	0.981	T
DOT1L	84444	genome.wustl.edu	37	19	2220127	2220127	+	Silent	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:2220127G>T	ENST00000398665.3	+	23	2748	c.2712G>T	c.(2710-2712)gtG>gtT	p.V904V		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	904					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGTCCCGTGCTGCAGCCCC	0.622																																						dbGAP											0													46.0	54.0	51.0					19																	2220127		1995	4161	6156	-	-	-	SO:0001819	synonymous_variant	0			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2712G>T	19.37:g.2220127G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60379|Q96JL1	Missense_Mutation	SNP	pfam_DOT1,pirsf_Histone_H3-K79_MeTrfase_met	p.C691F	ENST00000398665.3	37	c.2072	CCDS42460.1	19	.	.	.	.	.	.	.	.	.	.	G	2.986	-0.209156	0.06140	.	.	ENSG00000104885	ENST00000440640	.	.	.	4.62	3.55	0.40652	.	.	.	.	.	T	0.48804	0.1520	.	.	.	0.47065	D	0.999303	.	.	.	.	.	.	T	0.44390	-0.9331	4	.	.	.	-8.0797	4.9743	0.14133	0.1148:0.0:0.5616:0.3236	.	.	.	.	F	691	.	.	C	+	2	0	DOT1L	2171127	0.969000	0.33509	0.516000	0.27786	0.357000	0.29423	0.931000	0.28871	2.122000	0.65172	0.462000	0.41574	TGC	DOT1L	-	pirsf_Histone_H3-K79_MeTrfase_met	ENSG00000104885		0.622	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	HGNC	protein_coding	OTTHUMT00000318066.1	15	0.00	0	G	NM_032482		2220127	2220127	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000440640	ensembl	human	novel	69_37n	missense	3	62.50	5	SNP	0.714	T
DPEP3	64180	genome.wustl.edu	37	16	68010014	68010014	+	Silent	SNP	G	G	C	rs150691835		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr16:68010014G>C	ENST00000268793.4	-	9	1660	c.1287C>G	c.(1285-1287)gtC>gtG	p.V429V	DPEP3_ENST00000574342.1_5'Flank	NM_001129758.1|NM_022357.3	NP_001123230.1|NP_071752.3	Q9H4B8	DPEP3_HUMAN	dipeptidase 3	404					male meiosis (GO:0007140)	anchored component of membrane (GO:0031225)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			breast(4)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		CTTGTCTGAAGACCCGCAGCA	0.552																																						dbGAP											0													174.0	179.0	177.0					16																	68010014		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AJ291679	CCDS10856.1	16q22.1	2011-07-22			ENSG00000141096	ENSG00000141096	3.4.13.19		23029	protein-coding gene	gene with protein product		609926					Standard	NM_022357		Approved		uc002evc.4	Q9H4B8	OTTHUMG00000137544	ENST00000268793.4:c.1287C>G	16.37:g.68010014G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ48|Q6PEZ5|Q6UXE4	Silent	SNP	pfam_Peptidase_M19	p.V429	ENST00000268793.4	37	c.1287	CCDS10856.1	16																																																																																			DPEP3	-	pfam_Peptidase_M19	ENSG00000141096		0.552	DPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPEP3	HGNC	protein_coding	OTTHUMT00000268875.3	267	0.00	0	G	NM_022357		68010014	68010014	-1	no_errors	ENST00000268793	ensembl	human	known	69_37n	silent	26	71.74	66	SNP	1.000	C
EHD2	30846	genome.wustl.edu	37	19	48229232	48229232	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:48229232C>G	ENST00000263277.3	+	4	917	c.666C>G	c.(664-666)gaC>gaG	p.D222E	EHD2_ENST00000538399.1_Missense_Mutation_p.D86E|CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	222	Dynamin-type G.				blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		ACAAGGCCGACATGGTGGAGA	0.647																																						dbGAP											0													48.0	37.0	41.0					19																	48229232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.666C>G	19.37:g.48229232C>G	ENSP00000263277:p.Asp222Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDH9|B4DNU6|Q96CB6	Missense_Mutation	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.D222E	ENST00000263277.3	37	c.666	CCDS12704.1	19	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098342	0.76870	.	.	ENSG00000024422	ENST00000263277;ENST00000539439;ENST00000540364;ENST00000538399	D;D	0.99735	-6.58;-6.58	3.66	3.66	0.41972	.	0.058107	0.64402	D	0.000004	D	0.99680	0.9880	M	0.89785	3.06	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	D	0.97401	0.9996	10	0.87932	D	0	-34.1825	13.284	0.60232	0.0:1.0:0.0:0.0	.	222	Q9NZN4	EHD2_HUMAN	E	222;222;212;86	ENSP00000263277:D222E;ENSP00000439036:D86E	ENSP00000263277:D222E	D	+	3	2	EHD2	52921044	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.933000	0.56545	1.793000	0.52555	0.456000	0.33151	GAC	EHD2	-	NULL	ENSG00000024422		0.647	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD2	HGNC	protein_coding	OTTHUMT00000465851.1	155	0.00	0	C			48229232	48229232	+1	no_errors	ENST00000263277	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	G
EIF4G2	1982	genome.wustl.edu	37	11	10827548	10827548	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr11:10827548G>A	ENST00000526148.1	-	4	664	c.154C>T	c.(154-156)Cct>Tct	p.P52S	EIF4G2_ENST00000339995.5_Missense_Mutation_p.P52S|EIF4G2_ENST00000396525.2_Missense_Mutation_p.P52S|EIF4G2_ENST00000525681.1_Missense_Mutation_p.P52S|EIF4G2_ENST00000525995.1_5'UTR	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CTTCGTGCAGGAATCCATTTC	0.428																																						dbGAP											0													183.0	168.0	173.0					11																	10827548		2201	4294	6495	-	-	-	SO:0001583	missense	0			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.154C>T	11.37:g.10827548G>A	ENSP00000433664:p.Pro52Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_W2_domain,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.P52S	ENST00000526148.1	37	c.154	CCDS31428.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.310916	0.95629	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531416;ENST00000532082;ENST00000524932;ENST00000532570;ENST00000526591;ENST00000530211;ENST00000527526;ENST00000530702	T;T;T;T;T;T;T;T	0.59638	1.34;1.34;1.34;1.39;1.16;1.41;1.38;0.25	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.68137	0.2968	L	0.29908	0.895	0.51233	D	0.999911	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.71876	-0.4460	9	0.87932	D	0	-5.8402	19.0829	0.93190	0.0:0.0:1.0:0.0	.	52;125	P78344;B4DZF2	IF4G2_HUMAN;.	S	52;52;52;52;125;52;52;52;52;52;52;52;30	ENSP00000433664:P52S;ENSP00000433371:P52S;ENSP00000340281:P52S;ENSP00000379778:P52S;ENSP00000431583:P52S;ENSP00000433121:P52S;ENSP00000435523:P52S;ENSP00000431511:P52S	ENSP00000340281:P52S	P	-	1	0	EIF4G2	10784124	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.498000	0.84270	0.557000	0.71058	CCT	EIF4G2	-	NULL	ENSG00000110321		0.428	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	EIF4G2	HGNC	protein_coding	OTTHUMT00000386603.1	150	0.00	0	G	NM_001418		10827548	10827548	-1	no_start_codon	ENST00000339995	ensembl	human	known	69_37n	missense	77	10.47	9	SNP	1.000	A
ENTPD6	955	genome.wustl.edu	37	20	25198181	25198181	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr20:25198181G>A	ENST00000376652.4	+	9	1005	c.842G>A	c.(841-843)cGg>cAg	p.R281Q	ENTPD6_ENST00000433259.2_Missense_Mutation_p.R281Q|ENTPD6_ENST00000360031.2_Missense_Mutation_p.R280Q|ENTPD6_ENST00000354989.5_Missense_Mutation_p.R264Q|Y_RNA_ENST00000365544.1_RNA			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	281					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						ACGGCACTGCGGATGTTTAAC	0.582																																						dbGAP											0													107.0	100.0	102.0					20																	25198181		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.842G>A	20.37:g.25198181G>A	ENSP00000365840:p.Arg281Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.R281Q	ENST00000376652.4	37	c.842	CCDS13170.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.860|0.860	-0.735480|-0.735480	0.03111|0.03111	.|.	.|.	ENSG00000197586|ENSG00000197586	ENST00000433417;ENST00000427553;ENST00000447877|ENST00000354989;ENST00000360031;ENST00000525986;ENST00000376641;ENST00000376652;ENST00000439162;ENST00000417467;ENST00000433259;ENST00000425813	.|T;T;T;T;T;T;T	.|0.12255	.|2.7;2.7;2.7;2.7;2.7;2.7;2.7	5.71|5.71	4.55|4.55	0.56014|0.56014	.|.	.|0.291672	.|0.40385	.|N	.|0.001101	T|T	0.05227|0.05227	0.0139|0.0139	N|N	0.03084|0.03084	-0.415|-0.415	0.24776|0.24776	N|N	0.992843|0.992843	.|B;B;B;B;B;B;B;B;B	.|0.18461	.|0.001;0.017;0.008;0.008;0.017;0.004;0.009;0.028;0.016	.|B;B;B;B;B;B;B;B;B	.|0.15484	.|0.001;0.004;0.001;0.01;0.004;0.002;0.003;0.013;0.013	T|T	0.41052|0.41052	-0.9530|-0.9530	5|10	.|0.09338	.|T	.|0.73	-16.3223|-16.3223	9.2897|9.2897	0.37780|0.37780	0.9047:0.0:0.0953:0.0|0.9047:0.0:0.0953:0.0	.|.	.|63;263;281;281;281;264;280;280;281	.|B4DHS2;B4DDM7;B4DNK6;E7EP89;Q5QPI9;O75354-2;D3DW49;Q5QPJ2;O75354	.|.;.;.;.;.;.;.;.;ENTP6_HUMAN	R|Q	202;139;174|264;280;201;177;281;263;215;281;233	.|ENSP00000347084:R264Q;ENSP00000353131:R280Q;ENSP00000365840:R281Q;ENSP00000408098:R263Q;ENSP00000395064:R215Q;ENSP00000401895:R281Q;ENSP00000390646:R233Q	.|ENSP00000347084:R264Q	G|R	+|+	1|2	0|0	ENTPD6|ENTPD6	25146181|25146181	1.000000|1.000000	0.71417|0.71417	0.823000|0.823000	0.32752|0.32752	0.044000|0.044000	0.14063|0.14063	4.230000|4.230000	0.58632|0.58632	0.910000|0.910000	0.36722|0.36722	0.462000|0.462000	0.41574|0.41574	GGA|CGG	ENTPD6	-	pfam_GDA1_CD39_NTPase	ENSG00000197586		0.582	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENTPD6	HGNC	protein_coding	OTTHUMT00000078414.2	100	0.00	0	G			25198181	25198181	+1	no_errors	ENST00000376652	ensembl	human	known	69_37n	missense	28	36.36	16	SNP	0.925	A
EPS8L1	54869	genome.wustl.edu	37	19	55598981	55598981	+	Nonstop_Mutation	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:55598981G>C	ENST00000201647.6	+	20	2227	c.2171G>C	c.(2170-2172)tGa>tCa	p.*724S	EPS8L1_ENST00000586329.1_Nonstop_Mutation_p.*549S|EPS8L1_ENST00000540810.1_Nonstop_Mutation_p.*660S|EPS8L1_ENST00000245618.5_Nonstop_Mutation_p.*597S|EPS8L1_ENST00000588359.1_Nonstop_Mutation_p.*410S	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	0					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GAGGTCATTTGACCTGCCAGG	0.572																																					Ovarian(149;255 1863 3636 27051 29647)	dbGAP											0													111.0	108.0	109.0					19																	55598981		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.2171G>C	19.37:g.55598981G>C	ENSP00000201647:p.*724Serext*24	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Nonstop_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_SH3_domain	p.*724S	ENST00000201647.6	37	c.2171	CCDS12914.1	19	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517598	0.27123	.	.	ENSG00000131037	ENST00000310075;ENST00000201647;ENST00000540810;ENST00000245618;ENST00000539118	.	.	.	3.41	3.41	0.39046	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1148	0.59294	0.0:0.0:1.0:0.0	.	.	.	.	S	552;724;660;597;410	.	.	X	+	2	2	EPS8L1	60290793	1.000000	0.71417	0.996000	0.52242	0.392000	0.30506	3.308000	0.51896	1.859000	0.53934	0.313000	0.20887	TGA	EPS8L1	-	NULL	ENSG00000131037		0.572	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8L1	HGNC	protein_coding	OTTHUMT00000451713.1	106	0.00	0	G	NM_017729		55598981	55598981	+1	no_errors	ENST00000201647	ensembl	human	known	69_37n	nonstop	39	20.41	10	SNP	1.000	C
ERCC5	2073	genome.wustl.edu	37	13	103506681	103506681	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr13:103506681G>C	ENST00000355739.4	+	4	1847	c.424G>C	c.(424-426)Gac>Cac	p.D142H	BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.R567P|ERCC5_ENST00000535557.1_Missense_Mutation_p.D142H	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	142					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AAGAGAAAACGACCTCTATGT	0.368			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	0													131.0	123.0	126.0					13																	103506681		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.424G>C	13.37:g.103506681G>C	ENSP00000347978:p.Asp142His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	pfam_XPG_DNA_repair_N,pfam_XPG/RAD2_endonuclease,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_DNA_repair,prints_XPGC_Rad_DNA_repair,tigrfam_XPGC_DNA_repair	p.D142H	ENST00000355739.4	37	c.424	CCDS32004.1	13	.	.	.	.	.	.	.	.	.	.	G	15.18	2.755593	0.49362	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000535557	T;T	0.27720	2.96;1.65	5.49	5.49	0.81192	.	0.105570	0.64402	D	0.000005	T	0.59293	0.2183	M	0.80746	2.51	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.996;0.999	T	0.63924	-0.6527	10	0.87932	D	0	-31.5741	16.5528	0.84476	0.0:0.0:1.0:0.0	.	142;142;567	B4DSI5;P28715;Q59FZ7	.;ERCC5_HUMAN;.	H	567;142;142	ENSP00000347978:D142H;ENSP00000442117:D142H	ENSP00000347978:D142H	D	+	1	0	ERCC5	102304682	1.000000	0.71417	0.994000	0.49952	0.047000	0.14425	6.413000	0.73308	2.565000	0.86533	0.655000	0.94253	GAC	ERCC5	-	tigrfam_XPGC_DNA_repair	ENSG00000134899		0.368	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ERCC5	HGNC	protein_coding	OTTHUMT00000045708.1	119	0.00	0	G			103506681	103506681	+1	no_errors	ENST00000355739	ensembl	human	known	69_37n	missense	213	24.38	69	SNP	1.000	C
EXTL3	2137	genome.wustl.edu	37	8	28574385	28574386	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr8:28574385_28574386insC	ENST00000220562.4	+	3	1711_1712	c.809_810insC	c.(808-813)ggacacfs	p.H271fs	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	271					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CGGACGGATGGACACAACCATG	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	Exception_encountered	8.37:g.28574385_28574386insC	ENSP00000220562:p.His271fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DST8|O00225|Q53XT3	Frame_Shift_Ins	INS	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.H271fs	ENST00000220562.4	37	c.809_810	CCDS6070.1	8																																																																																			EXTL3	-	pfam_Exostosin	ENSG00000012232		0.540	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL3	HGNC	protein_coding	OTTHUMT00000219987.3	92	0.00	0	-	NM_001440		28574385	28574386	+1	no_errors	ENST00000220562	ensembl	human	known	69_37n	frame_shift_ins	138	49.26	134	INS	1.000:0.986	C
FAM41C	284593	genome.wustl.edu	37	1	809839	809840	+	lincRNA	INS	-	-	C	rs571917577	byFrequency	TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:809839_809840insC	ENST00000446136.1	-	0	853_854					NR_027055.1				family with sequence similarity 41, member C																		TCCTCCTGCTGCATTTTAAAGC	0.45																																						dbGAP											0																																										-	-	-			0			BC047940		1p36.33	2013-01-16	2011-08-31	2011-08-31	ENSG00000230368	ENSG00000230368		"""Long non-coding RNAs"""	27635	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_027055		Approved		uc001abt.4		OTTHUMG00000002469		1.37:g.809840_809840dupC		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000446136.1	37	NULL		1																																																																																			FAM41C	-	-	ENSG00000230368		0.450	FAM41C-001	KNOWN	basic	lincRNA	FAM41C	HGNC	lincRNA	OTTHUMT00000007021.1	33	0.00	0	-	NR_027055		809839	809840	-1	no_errors	ENST00000446136	ensembl	human	known	69_37n	rna	24	35.14	13	INS	0.044:0.041	C
FANCD2	2177	genome.wustl.edu	37	3	10107101	10107101	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:10107101C>T	ENST00000419585.1	+	24	2353	c.2192C>T	c.(2191-2193)gCt>gTt	p.A731V	FANCD2_ENST00000383806.1_Missense_Mutation_p.A731V|FANCD2_ENST00000287647.3_Missense_Mutation_p.A731V|FANCD2_ENST00000383807.1_Missense_Mutation_p.A731V			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	731					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CTGTGCCTGGCTCCGTATTTC	0.448			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													165.0	162.0	163.0					3																	10107101		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2192C>T	3.37:g.10107101C>T	ENSP00000398754:p.Ala731Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A731V	ENST00000419585.1	37	c.2192	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989450	0.93106	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.53	5.53	0.82687	.	0.157877	0.64402	D	0.000018	T	0.60996	0.2312	M	0.64997	1.995	0.32669	N	0.517008	P;P	0.52061	0.95;0.95	P;P	0.54889	0.763;0.763	T	0.70828	-0.4766	10	0.62326	D	0.03	.	17.0107	0.86405	0.0:1.0:0.0:0.0	.	731;731	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	V	731	ENSP00000287647:A731V;ENSP00000373318:A731V;ENSP00000373317:A731V;ENSP00000398754:A731V	ENSP00000287647:A731V	A	+	2	0	FANCD2	10082101	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	4.446000	0.60014	2.618000	0.88619	0.585000	0.79938	GCT	FANCD2	-	NULL	ENSG00000144554		0.448	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	202	0.00	0	C			10107101	10107101	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	missense	101	38.04	62	SNP	1.000	T
FCAR	2204	genome.wustl.edu	37	19	55399642	55399642	+	Silent	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:55399642C>G	ENST00000355524.3	+	4	640	c.630C>G	c.(628-630)gcC>gcG	p.A210A	FCAR_ENST00000345937.4_Intron|FCAR_ENST00000391724.3_Intron|FCAR_ENST00000391725.3_Intron|FCAR_ENST00000353758.4_Silent_p.A101A|FCAR_ENST00000391726.3_Intron|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000359272.4_Silent_p.A198A|FCAR_ENST00000469767.1_Silent_p.A210A|FCAR_ENST00000482092.2_Intron|FCAR_ENST00000391723.3_Intron	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	210					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		CCAGTAATGCCTTGGAGCTTG	0.577																																						dbGAP											0													75.0	66.0	69.0					19																	55399642		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.630C>G	19.37:g.55399642C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Silent	SNP	smart_Ig_sub	p.A210	ENST00000355524.3	37	c.630	CCDS12907.1	19																																																																																			FCAR	-	smart_Ig_sub	ENSG00000186431		0.577	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCAR	HGNC	protein_coding	OTTHUMT00000141243.1	61	0.00	0	C	NM_002000		55399642	55399642	+1	no_errors	ENST00000355524	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	0.543	G
FZD3	7976	genome.wustl.edu	37	8	28413307	28413307	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr8:28413307C>A	ENST00000240093.3	+	7	2084	c.1606C>A	c.(1606-1608)Ctc>Atc	p.L536I	FZD3_ENST00000537916.1_Missense_Mutation_p.L536I	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	536					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TGCTCAGTCTCTCCTGAGGGA	0.438																																						dbGAP											0													108.0	100.0	103.0					8																	28413307		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.1606C>A	8.37:g.28413307C>A	ENSP00000240093:p.Leu536Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K615	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,prints_Frizzled,pfscan_Frizzled_dom,pfscan_GPCR_2-like	p.L536I	ENST00000240093.3	37	c.1606	CCDS6069.1	8	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115267	0.77210	.	.	ENSG00000104290	ENST00000537916;ENST00000240093	T;T	0.77877	-1.13;-1.13	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.77445	0.4131	L	0.32530	0.975	0.58432	D	0.999999	P	0.47302	0.893	P	0.50136	0.632	T	0.77877	-0.2424	10	0.45353	T	0.12	.	18.1689	0.89737	0.0:1.0:0.0:0.0	.	536	Q9NPG1	FZD3_HUMAN	I	536	ENSP00000437489:L536I;ENSP00000240093:L536I	ENSP00000240093:L536I	L	+	1	0	FZD3	28469226	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.706000	0.68362	2.512000	0.84698	0.585000	0.79938	CTC	FZD3	-	NULL	ENSG00000104290		0.438	FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD3	HGNC	protein_coding	OTTHUMT00000219986.2	102	0.00	0	C	NM_145866		28413307	28413307	+1	no_errors	ENST00000240093	ensembl	human	known	69_37n	missense	117	11.36	15	SNP	1.000	A
GABRR3	200959	genome.wustl.edu	37	3	97731370	97731370	+	RNA	SNP	G	G	C	rs368459164		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:97731370G>C	ENST00000472788.1	-	0	349					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	AGAGCCTCTCGTCTTTCCAGT	0.403																																						dbGAP											0													137.0	128.0	131.0					3																	97731370		1842	4094	5936	-	-	-			0			Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97731370G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UIV9	Missense_Mutation	SNP	NULL	p.D116E	ENST00000472788.1	37	c.348		3																																																																																			GABRR3	-	NULL	ENSG00000183185		0.403	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	GABRR3	HGNC	polymorphic_pseudogene	OTTHUMT00000353445.2	120	0.00	0	G			97731370	97731370	-1	pseudogene	ENST00000472788	ensembl	human	known	69_37n	missense	74	44.36	59	SNP	1.000	C
GAS6	2621	genome.wustl.edu	37	13	114542717	114542718	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr13:114542717_114542718insC	ENST00000327773.6	-	5	595_596	c.449_450insG	c.(448-450)ggcfs	p.G150fs	GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000355761.4_Frame_Shift_Ins_p.G96fs|GAS6_ENST00000357389.3_Frame_Shift_Ins_p.G150fs	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	150	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CGCAGAGCCGGCCCCCCCAGCC	0.649																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.450dupG	13.37:g.114542724_114542724dupC	ENSP00000331831:p.Gly150fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Frame_Shift_Ins	INS	pfam_Laminin_G,pfam_EGF-like_Ca-bd,pfam_GLA_domain,superfamily_ConA-like_lec_gl,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.R151fs	ENST00000327773.6	37	c.450_449	CCDS45072.1	13																																																																																			GAS6	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000183087		0.649	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAS6	HGNC	protein_coding	OTTHUMT00000045946.2	12	0.00	0	-	NM_000820		114542717	114542718	-1	no_errors	ENST00000357389	ensembl	human	known	69_37n	frame_shift_ins	20	20.00	5	INS	0.842:0.997	C
GLA	2717	genome.wustl.edu	37	X	100658891	100658891	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chrX:100658891C>G	ENST00000218516.3	-	2	298	c.277G>C	c.(277-279)Gac>Cac	p.D93H	GLA_ENST00000479445.1_5'UTR|RPL36A-HNRNPH2_ENST00000409170.3_Intron	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	93			D -> G (in FD). {ECO:0000269|PubMed:8875188}.|D -> N (in FD; has no enzyme activity). {ECO:0000269|PubMed:15712228, ECO:0000269|PubMed:19621417}.		glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						ATCCAACAGTCATCAATGCAG	0.483																																					Colon(193;776 2816 31189 44474)	dbGAP											0			GRCh37	CM051063	GLA	M							197.0	179.0	185.0					X																	100658891		2203	4300	6503	-	-	-	SO:0001583	missense	0			X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.277G>C	X.37:g.100658891C>G	ENSP00000218516:p.Asp93His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LER7	Missense_Mutation	SNP	pfam_Glyco_hydro_GHD,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_27	p.D93H	ENST00000218516.3	37	c.277	CCDS14484.1	X	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916162	0.92178	.	.	ENSG00000102393	ENST00000218516	D	0.99933	-8.25	5.79	5.79	0.91817	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99935	0.9971	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.95682	0.8733	9	0.87932	D	0	-22.4156	19.0369	0.92982	0.0:1.0:0.0:0.0	.	93;93	B4DLT5;P06280	.;AGAL_HUMAN	H	93	ENSP00000218516:D93H	ENSP00000218516:D93H	D	-	1	0	GLA	100545547	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.793000	0.85851	2.444000	0.82710	0.594000	0.82650	GAC	GLA	-	pfam_Glyco_hydro_GHD,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_27	ENSG00000102393		0.483	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLA	HGNC	protein_coding	OTTHUMT00000057540.1	159	0.00	0	C			100658891	100658891	-1	no_errors	ENST00000218516	ensembl	human	known	69_37n	missense	163	10.93	20	SNP	1.000	G
GNPNAT1	64841	genome.wustl.edu	37	14	53251239	53251239	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr14:53251239G>C	ENST00000216410.3	-	2	317	c.130C>G	c.(130-132)Ctt>Gtt	p.L44V	GNPNAT1_ENST00000554230.1_Intron|RN7SL588P_ENST00000583393.1_RNA	NM_198066.3	NP_932332.1	Q96EK6	GNA1_HUMAN	glucosamine-phosphate N-acetyltransferase 1	44	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|glucosamine metabolic process (GO:0006041)|liver development (GO:0001889)|N-acetylglucosamine metabolic process (GO:0006044)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|membrane (GO:0016020)	glucosamine 6-phosphate N-acetyltransferase activity (GO:0004343)|monosaccharide binding (GO:0048029)			liver(1)|lung(1)|prostate(1)|skin(1)	4	Breast(41;0.176)					GCAGTACAAAGAGGCCTCAAA	0.388																																						dbGAP											0													71.0	65.0	67.0					14																	53251239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001469	CCDS9712.1	14q22.1	2011-11-16			ENSG00000100522	ENSG00000100522	2.3.1.4		19980	protein-coding gene	gene with protein product							Standard	NM_198066		Approved	Gpnat1, FLJ10607	uc001xab.3	Q96EK6	OTTHUMG00000152334	ENST00000216410.3:c.130C>G	14.37:g.53251239G>C	ENSP00000216410:p.Leu44Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.L44V	ENST00000216410.3	37	c.130	CCDS9712.1	14	.	.	.	.	.	.	.	.	.	.	G	24.5	4.539535	0.85917	.	.	ENSG00000100522	ENST00000216410;ENST00000557604	.	.	.	5.46	5.46	0.80206	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.82697	0.5093	M	0.77313	2.365	0.80722	D	1	D	0.69078	0.997	D	0.76575	0.988	T	0.82267	-0.0542	9	0.46703	T	0.11	-16.0562	19.6691	0.95903	0.0:0.0:1.0:0.0	.	44	Q96EK6	GNA1_HUMAN	V	44	.	ENSP00000216410:L44V	L	-	1	0	GNPNAT1	52320989	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.281000	0.95811	2.721000	0.93114	0.591000	0.81541	CTT	GNPNAT1	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000100522		0.388	GNPNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPNAT1	HGNC	protein_coding	OTTHUMT00000276898.1	20	0.00	0	G			53251239	53251239	-1	no_errors	ENST00000216410	ensembl	human	known	69_37n	missense	11	62.07	18	SNP	1.000	C
HECW1	23072	genome.wustl.edu	37	7	43548589	43548589	+	Silent	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:43548589G>A	ENST00000395891.2	+	24	4493	c.3888G>A	c.(3886-3888)tcG>tcA	p.S1296S	HECW1_ENST00000453890.1_Silent_p.S1262S|AC011738.4_ENST00000436105.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1296	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S1275S(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GTGGCCCCTCGCGGGAGTTCT	0.537																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											131.0	129.0	130.0					7																	43548589		1867	4105	5972	-	-	-	SO:0001819	synonymous_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3888G>A	7.37:g.43548589G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.S1296	ENST00000395891.2	37	c.3888	CCDS5469.2	7																																																																																			HECW1	-	superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000002746		0.537	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	180	0.00	0	G	NM_015052		43548589	43548589	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	silent	203	13.56	32	SNP	0.585	A
HEMGN	55363	genome.wustl.edu	37	9	100689708	100689708	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr9:100689708C>G	ENST00000259456.3	-	5	1556	c.1413G>C	c.(1411-1413)gaG>gaC	p.E471D		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	471					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CTGGATGACTCTCATTCAGAA	0.308																																						dbGAP											0													172.0	171.0	171.0					9																	100689708		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.1413G>C	9.37:g.100689708C>G	ENSP00000259456:p.Glu471Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	NULL	p.E471D	ENST00000259456.3	37	c.1413	CCDS6731.1	9	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004807	0.35320	.	.	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	4.15	1.31	0.21738	.	0.242690	0.31381	N	0.007744	T	0.32194	0.0821	L	0.55481	1.735	0.09310	N	1	B	0.28552	0.215	B	0.32022	0.139	T	0.15464	-1.0436	9	0.32370	T	0.25	-3.5944	3.7205	0.08454	0.1928:0.6025:0.0:0.2047	.	471	Q9BXL5	HEMGN_HUMAN	D	471	.	ENSP00000259456:E471D	E	-	3	2	HEMGN	99729529	0.065000	0.20965	0.031000	0.17742	0.493000	0.33554	-0.033000	0.12246	0.299000	0.22661	0.491000	0.48974	GAG	HEMGN	-	NULL	ENSG00000136929		0.308	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEMGN	HGNC	protein_coding	OTTHUMT00000053344.2	46	0.00	0	C	NM_197978		100689708	100689708	-1	no_errors	ENST00000259456	ensembl	human	known	69_37n	missense	25	67.95	53	SNP	0.039	G
HSPG2	3339	genome.wustl.edu	37	1	22179535	22179535	+	Silent	SNP	G	G	T	rs369970075		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:22179535G>T	ENST00000374695.3	-	51	6547	c.6468C>A	c.(6466-6468)atC>atA	p.I2156I	HSPG2_ENST00000430507.1_Silent_p.I102I	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2156	Ig-like C2-type 7.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	AGGAGGGCTCGATGCGGATGG	0.677																																						dbGAP											0													52.0	57.0	55.0					1																	22179535		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6468C>A	1.37:g.22179535G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.I2156	ENST00000374695.3	37	c.6468	CCDS30625.1	1																																																																																			HSPG2	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000142798		0.677	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	12	0.00	0	G	NM_005529		22179535	22179535	-1	no_errors	ENST00000374695	ensembl	human	known	69_37n	silent	5	61.54	8	SNP	1.000	T
HPDL	84842	genome.wustl.edu	37	1	45793708	45793708	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:45793708G>C	ENST00000334815.3	+	1	1164	c.888G>C	c.(886-888)caG>caC	p.Q296H		NM_032756.2	NP_116145.1	Q96IR7	HPDL_HUMAN	4-hydroxyphenylpyruvate dioxygenase-like	296					aromatic amino acid family metabolic process (GO:0009072)		4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(166;0.155)					AGGAGAGGCAGATCCGAGCTG	0.592																																						dbGAP											0													65.0	68.0	67.0					1																	45793708		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007293	CCDS519.1	1p34.1	2008-02-05	2007-03-14	2007-03-14	ENSG00000186603	ENSG00000186603			28242	protein-coding gene	gene with protein product			"""glyoxalase domain containing 1"""	GLOXD1		12477932	Standard	NM_032756		Approved	MGC15668, 4-HPPD-L	uc001cne.3	Q96IR7	OTTHUMG00000007681	ENST00000334815.3:c.888G>C	1.37:g.45793708G>C	ENSP00000335060:p.Gln296His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9B0	Missense_Mutation	SNP	pirsf_4OHPhenylPyrv_dOase	p.Q296H	ENST00000334815.3	37	c.888	CCDS519.1	1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.534862	0.27475	.	.	ENSG00000186603	ENST00000334815	T	0.63417	-0.04	5.14	0.0583	0.14327	.	0.057288	0.64402	D	0.000003	T	0.72120	0.3421	M	0.73598	2.24	0.32783	N	0.502199	D	0.71674	0.998	P	0.61658	0.892	T	0.76895	-0.2790	10	0.62326	D	0.03	-23.1139	11.0772	0.48038	0.402:0.0:0.598:0.0	.	296	Q96IR7	HPDL_HUMAN	H	296	ENSP00000335060:Q296H	ENSP00000335060:Q296H	Q	+	3	2	HPDL	45566295	1.000000	0.71417	0.445000	0.26908	0.068000	0.16541	1.195000	0.32186	-0.379000	0.07906	-1.134000	0.01955	CAG	HPDL	-	pirsf_4OHPhenylPyrv_dOase	ENSG00000186603		0.592	HPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPDL	HGNC	protein_coding	OTTHUMT00000020527.1	87	0.00	0	G	NM_032756		45793708	45793708	+1	no_errors	ENST00000334815	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	0.956	C
HIST2H2AC	8338	genome.wustl.edu	37	1	149858596	149858596	+	Silent	SNP	C	C	A	rs201558423		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:149858596C>A	ENST00000331380.2	+	1	72	c.72C>A	c.(70-72)ctC>ctA	p.L24L	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	24						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCGCTGGCCTCCAGTTCCCGG	0.652																																						dbGAP											0													69.0	76.0	73.0					1																	149858596		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.72C>A	1.37:g.149858596C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DRA7|Q8IUE5	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.L24	ENST00000331380.2	37	c.72	CCDS937.1	1																																																																																			HIST2H2AC	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000184260		0.652	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AC	HGNC	protein_coding	OTTHUMT00000087128.1	126	0.00	0	C	NM_003517		149858596	149858596	+1	no_errors	ENST00000331380	ensembl	human	known	69_37n	silent	136	12.82	20	SNP	0.863	A
IFT122	55764	genome.wustl.edu	37	3	129225321	129225321	+	Missense_Mutation	SNP	C	C	G	rs377690924		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:129225321C>G	ENST00000348417.2	+	22	2797	c.2720C>G	c.(2719-2721)gCg>gGg	p.A907G	IFT122_ENST00000347300.2_Missense_Mutation_p.A848G|IFT122_ENST00000507564.1_Missense_Mutation_p.A899G|IFT122_ENST00000504021.1_Missense_Mutation_p.A783G|IFT122_ENST00000349441.2_Missense_Mutation_p.A796G|IFT122_ENST00000296266.3_Missense_Mutation_p.A958G|IFT122_ENST00000431818.2_Missense_Mutation_p.A757G|IFT122_ENST00000440957.2_Missense_Mutation_p.A698G	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	907				A -> V (in Ref. 1; AAG15428). {ECO:0000305}.	camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.A958V(1)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						AATGCCGTGGCGGAGAGCAGG	0.522																																						dbGAP											1	Substitution - Missense(1)	lung(1)											221.0	175.0	190.0					3																	129225321		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2720C>G	3.37:g.129225321C>G	ENSP00000324005:p.Ala907Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A958G	ENST00000348417.2	37	c.2873	CCDS3061.1	3	.	.	.	.	.	.	.	.	.	.	C	8.920	0.960778	0.18583	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000454840;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	T;T;T;T;T;T;T;T	0.61040	0.78;0.14;0.26;0.33;0.91;0.92;0.78;1.78	5.62	3.29	0.37713	.	0.186251	0.46442	D	0.000297	T	0.40546	0.1121	N	0.24115	0.695	0.24878	N	0.992243	B;B;B;B;B;B;B;B;B;P	0.39181	0.352;0.132;0.32;0.08;0.001;0.001;0.0;0.0;0.24;0.663	B;B;B;B;B;B;B;B;B;B	0.39465	0.156;0.152;0.109;0.127;0.001;0.001;0.001;0.003;0.075;0.3	T	0.17471	-1.0368	10	0.23302	T	0.38	-4.3514	9.1995	0.37249	0.0:0.149:0.0:0.851	.	698;233;899;294;783;747;796;848;907;958	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	G	848;958;899;848;757;783;796;907;747;698	ENSP00000323973:A848G;ENSP00000296266:A958G;ENSP00000425536:A899G;ENSP00000410946:A757G;ENSP00000422179:A783G;ENSP00000324165:A796G;ENSP00000324005:A907G;ENSP00000401569:A698G	ENSP00000296266:A958G	A	+	2	0	IFT122	130708011	0.987000	0.35691	0.918000	0.36340	0.427000	0.31564	2.066000	0.41452	0.438000	0.26450	-0.378000	0.06908	GCG	IFT122	-	NULL	ENSG00000163913		0.522	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT122	HGNC	protein_coding	OTTHUMT00000355852.1	136	0.00	0	C	NM_018262		129225321	129225321	+1	no_errors	ENST00000296266	ensembl	human	known	69_37n	missense	77	18.09	17	SNP	0.956	G
IP6K3	117283	genome.wustl.edu	37	6	33693353	33693353	+	Missense_Mutation	SNP	A	A	T	rs139534699		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr6:33693353A>T	ENST00000293756.4	-	5	956	c.630T>A	c.(628-630)caT>caA	p.H210Q	IP6K3_ENST00000451316.1_Missense_Mutation_p.H210Q	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	210					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						GGACACAGGGATGCGTGTACT	0.552																																						dbGAP											0													99.0	86.0	90.0					6																	33693353		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.630T>A	6.37:g.33693353A>T	ENSP00000293756:p.His210Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MQ9	Missense_Mutation	SNP	pfam_IPK	p.H210Q	ENST00000293756.4	37	c.630	CCDS34435.1	6	.	.	.	.	.	.	.	.	.	.	A	10.41	1.341963	0.24339	.	.	ENSG00000161896	ENST00000451316;ENST00000293756	T;T	0.16324	2.35;2.35	5.82	-11.6	0.00059	.	0.703752	0.13918	N	0.353768	T	0.02047	0.0064	N	0.12422	0.21	0.09310	N	0.999999	B	0.17667	0.023	B	0.15052	0.012	T	0.33189	-0.9878	10	0.30854	T	0.27	-4.7577	14.7401	0.69448	0.2158:0.2326:0.5517:0.0	.	210	Q96PC2	IP6K3_HUMAN	Q	210	ENSP00000398861:H210Q;ENSP00000293756:H210Q	ENSP00000293756:H210Q	H	-	3	2	IP6K3	33801331	0.000000	0.05858	0.002000	0.10522	0.608000	0.37181	-0.739000	0.04866	-2.993000	0.00279	-1.151000	0.01829	CAT	IP6K3	-	pfam_IPK	ENSG00000161896		0.552	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K3	HGNC	protein_coding	OTTHUMT00000040203.1	96	0.00	0	A	NM_054111		33693353	33693353	-1	no_errors	ENST00000293756	ensembl	human	known	69_37n	missense	59	26.25	21	SNP	0.000	T
KCNA5	3741	genome.wustl.edu	37	12	5154568	5154568	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr12:5154568G>T	ENST00000252321.3	+	1	1484	c.1255G>T	c.(1255-1257)Ggg>Tgg	p.G419W		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	419					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CCACTCCAAGGGGCTGCAGAT	0.627																																						dbGAP											0													32.0	33.0	33.0					12																	5154568		2202	4278	6480	-	-	-	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1255G>T	12.37:g.5154568G>T	ENSP00000252321:p.Gly419Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.G419W	ENST00000252321.3	37	c.1255	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334170	0.60853	.	.	ENSG00000130037	ENST00000252321	D	0.98567	-5.0	4.87	3.99	0.46301	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99393	0.9786	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98168	1.0450	10	0.87932	D	0	.	12.4131	0.55478	0.0804:0.0:0.9196:0.0	.	419	P22460	KCNA5_HUMAN	W	419	ENSP00000252321:G419W	ENSP00000252321:G419W	G	+	1	0	KCNA5	5024829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.552000	0.98115	1.292000	0.44672	0.561000	0.74099	GGG	KCNA5	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_K_chnl	ENSG00000130037		0.627	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	74	0.00	0	G	NM_002234		5154568	5154568	+1	no_errors	ENST00000252321	ensembl	human	known	69_37n	missense	70	36.36	40	SNP	1.000	T
KRT222	125113	genome.wustl.edu	37	17	38816255	38816255	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr17:38816255C>G	ENST00000476049.1	-	3	471	c.430G>C	c.(430-432)Gaa>Caa	p.E144Q	KRT222_ENST00000394052.3_Missense_Mutation_p.E144Q			Q8N1A0	KT222_HUMAN	keratin 222	144						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(2)|skin(1)	15						TCTTCTTTTTCTAGGAGGTGG	0.423																																						dbGAP											0													248.0	230.0	236.0					17																	38816255		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092967	CCDS11371.1	17q21.2	2013-06-25	2009-08-25	2009-08-25	ENSG00000213424	ENSG00000213424		"""-"""	28695	protein-coding gene	gene with protein product			"""keratin 222 pseudogene"""	KRT222P		16831889	Standard	NM_152349		Approved	KA21, MGC45562	uc002hvc.2	Q8N1A0	OTTHUMG00000133374	ENST00000476049.1:c.430G>C	17.37:g.38816255C>G	ENSP00000463483:p.Glu144Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z368	Missense_Mutation	SNP	pfam_F,prints_Keratin_I	p.E144Q	ENST00000476049.1	37	c.430	CCDS11371.1	17	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973487	0.92919	.	.	ENSG00000213424	ENST00000394049;ENST00000394052	D	0.94497	-3.44	5.69	5.69	0.88448	Filament (1);Intermediate filament protein, conserved site (1);	0.138594	0.46758	U	0.000263	D	0.98065	0.9362	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98633	1.0672	10	0.87932	D	0	-14.7859	19.8084	0.96538	0.0:1.0:0.0:0.0	.	104;144	Q8N1A0-2;Q8N1A0	.;KT222_HUMAN	Q	104;144	ENSP00000377616:E144Q	ENSP00000377613:E104Q	E	-	1	0	KRT222	36069781	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.487000	0.81328	2.687000	0.91594	0.462000	0.41574	GAA	KRT222	-	pfam_F	ENSG00000213424		0.423	KRT222-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	KRT222	HGNC	protein_coding	OTTHUMT00000447539.1	128	0.78	1	C	NM_152349		38816255	38816255	-1	no_errors	ENST00000394052	ensembl	human	known	69_37n	missense	89	61.51	147	SNP	1.000	G
LAMA4	3910	genome.wustl.edu	37	6	112437070	112437070	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr6:112437070C>A	ENST00000230538.7	-	36	5505	c.5108G>T	c.(5107-5109)gGa>gTa	p.G1703V	LAMA4_ENST00000389463.4_Missense_Mutation_p.G1696V|LAMA4_ENST00000424408.2_Missense_Mutation_p.G1696V|LAMA4_ENST00000522006.1_Missense_Mutation_p.G1696V	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1703	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CACTACCTGTCCATTTTTCAT	0.398																																						dbGAP											0													208.0	196.0	200.0					6																	112437070		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.5108G>T	6.37:g.112437070C>A	ENSP00000230538:p.Gly1703Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EGF-like,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.G1703V	ENST00000230538.7	37	c.5108	CCDS43491.1	6	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598638	0.66332	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.18	5.18	0.71444	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.053414	0.85682	D	0.000000	D	0.93468	0.7916	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93772	0.7076	10	0.66056	D	0.02	.	19.0646	0.93104	0.0:1.0:0.0:0.0	.	1703;1696	Q16363;Q16363-2	LAMA4_HUMAN;.	V	1703;1696;1696;1696	ENSP00000230538:G1703V;ENSP00000429488:G1696V;ENSP00000374114:G1696V;ENSP00000416470:G1696V	ENSP00000230538:G1703V	G	-	2	0	LAMA4	112543763	1.000000	0.71417	0.994000	0.49952	0.380000	0.30137	6.388000	0.73195	2.573000	0.86826	0.650000	0.86243	GGA	LAMA4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000112769		0.398	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	285	0.00	0	C	NM_001105206		112437070	112437070	-1	no_errors	ENST00000230538	ensembl	human	known	69_37n	missense	467	10.69	56	SNP	1.000	A
LAMP2	3920	genome.wustl.edu	37	X	119565295	119565295	+	Silent	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chrX:119565295G>A	ENST00000200639.4	-	9	1252	c.1116C>T	c.(1114-1116)gaC>gaT	p.D372D	LAMP2_ENST00000434600.2_Intron|LAMP2_ENST00000538785.1_Intron			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	372	Second lumenal domain.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						GGAAGTTGTCGTCATCTGCAC	0.438																																						dbGAP											0													167.0	152.0	157.0					X																	119565295		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.1116C>T	X.37:g.119565295G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Silent	SNP	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.D372	ENST00000200639.4	37	c.1116	CCDS14599.1	X																																																																																			LAMP2	-	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	ENSG00000005893		0.438	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LAMP2	HGNC	protein_coding	OTTHUMT00000058099.1	156	0.00	0	G			119565295	119565295	-1	no_errors	ENST00000200639	ensembl	human	known	69_37n	silent	184	30.30	80	SNP	0.631	A
LAPTM4B	55353	genome.wustl.edu	37	8	98817648	98817648	+	Nonsense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr8:98817648C>G	ENST00000521545.2	+	2	401	c.167C>G	c.(166-168)tCa>tGa	p.S56*	LAPTM4B_ENST00000445593.2_Nonsense_Mutation_p.S147*			Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta	200					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			TATAACTTTTCAAGTTCTGAA	0.388																																						dbGAP											0													153.0	147.0	149.0					8																	98817648		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000521545.2:c.167C>G	8.37:g.98817648C>G	ENSP00000428409:p.Ser56*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCV5|Q7L909|Q86VH8|Q9H060	Nonsense_Mutation	SNP	pfam_LAPTM4/5	p.S147*	ENST00000521545.2	37	c.440		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.274282|10.274282	0.99373|0.99373	.|.	.|.	ENSG00000104341|ENSG00000104341	ENST00000517924|ENST00000445593;ENST00000378722;ENST00000521545	.|.	.|.	.|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	.|0.068769	.|0.64402	.|D	.|0.000013	T|.	0.64125|.	0.2570|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.65207|.	-0.6224|.	3|.	.|0.28530	.|T	.|0.3	-12.1274|-12.1274	15.7363|15.7363	0.77846|0.77846	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	110|147;193;56	.|.	.|ENSP00000367995:S193X	Q|S	+|+	1|2	0|0	LAPTM4B|LAPTM4B	98886824|98886824	0.445000|0.445000	0.25657|0.25657	0.957000|0.957000	0.39632|0.39632	0.972000|0.972000	0.66771|0.66771	4.736000|4.736000	0.62059|0.62059	2.517000|2.517000	0.84864|0.84864	0.655000|0.655000	0.94253|0.94253	CAA|TCA	LAPTM4B	-	NULL	ENSG00000104341		0.388	LAPTM4B-002	KNOWN	basic|appris_principal	protein_coding	LAPTM4B	HGNC	protein_coding	OTTHUMT00000380016.2	175	0.00	0	C			98817648	98817648	+1	no_errors	ENST00000445593	ensembl	human	known	69_37n	nonsense	128	22.42	37	SNP	0.996	G
LARS	51520	genome.wustl.edu	37	5	145539015	145539015	+	Silent	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr5:145539015C>T	ENST00000394434.2	-	8	892	c.726G>A	c.(724-726)ccG>ccA	p.P242P	LARS_ENST00000545646.1_Silent_p.P196P|LARS_ENST00000511505.1_5'UTR|LARS_ENST00000510191.1_Silent_p.P188P|LARS_ENST00000274562.9_Silent_p.P215P	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	242					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	GTCCATCTTTCGGAGAGTAAA	0.318																																						dbGAP											0													74.0	72.0	73.0					5																	145539015		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.726G>A	5.37:g.145539015C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Silent	SNP	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Cys-tRNA/MSH_ligase,tigrfam_Leu-tRNA-synth_Ia_arc/euk	p.P242	ENST00000394434.2	37	c.726	CCDS34265.1	5																																																																																			LARS	-	pfam_aa-tRNA-synth_Ia,tigrfam_Leu-tRNA-synth_Ia_arc/euk	ENSG00000133706		0.318	LARS-001	KNOWN	basic|CCDS	protein_coding	LARS	HGNC	protein_coding	OTTHUMT00000373367.1	77	0.00	0	C	NM_020117		145539015	145539015	-1	no_errors	ENST00000394434	ensembl	human	known	69_37n	silent	68	17.07	14	SNP	0.975	T
LCP1	3936	genome.wustl.edu	37	13	46701779	46701779	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr13:46701779T>A	ENST00000398576.2	-	19	2219	c.1831A>T	c.(1831-1833)Atg>Ttg	p.M611L	LCP1_ENST00000323076.2_Missense_Mutation_p.M611L|LCP1_ENST00000435666.2_Missense_Mutation_p.M180L			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	611	Actin-binding 2.|CH 4. {ECO:0000255|PROSITE- ProRule:PRU00044}.			M -> T (in Ref. 11; AA sequence). {ECO:0000305}.	actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		GTCATGACCATTTTGGGGTTC	0.532			T	BCL6	NHL																																	dbGAP		Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	0													199.0	180.0	187.0					13																	46701779		2203	4300	6503	-	-	-	SO:0001583	missense	0			M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1831A>T	13.37:g.46701779T>A	ENSP00000381581:p.Met611Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	pfam_CH-domain,pfam_EF-hand,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.M611L	ENST00000398576.2	37	c.1831	CCDS9403.1	13	.	.	.	.	.	.	.	.	.	.	T	32	5.171558	0.94807	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000435666	D;D;D	0.95342	-3.68;-3.68;-3.68	5.72	5.72	0.89469	Calponin homology domain (5);	0.034624	0.85682	D	0.000000	D	0.96194	0.8759	L	0.43646	1.37	0.80722	D	1	B;P	0.36733	0.006;0.567	B;D	0.69307	0.047;0.963	D	0.94869	0.8028	10	0.31617	T	0.26	-29.8259	15.4793	0.75511	0.0:0.0:0.0:1.0	.	180;611	B4DUA0;P13796	.;PLSL_HUMAN	L	611;611;180	ENSP00000315757:M611L;ENSP00000381581:M611L;ENSP00000405134:M180L	ENSP00000315757:M611L	M	-	1	0	LCP1	45599780	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.997000	0.88414	2.311000	0.77944	0.533000	0.62120	ATG	LCP1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000136167		0.532	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP1	HGNC	protein_coding	OTTHUMT00000044800.3	289	0.00	0	T	NM_002298		46701779	46701779	-1	no_errors	ENST00000323076	ensembl	human	known	69_37n	missense	175	14.22	29	SNP	1.000	A
LRIF1	55791	genome.wustl.edu	37	1	111492643	111492643	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:111492643C>G	ENST00000369763.4	-	3	2089	c.1699G>C	c.(1699-1701)Gat>Cat	p.D567H	RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000494675.1_Missense_Mutation_p.D31H|LRIF1_ENST00000485275.2_Missense_Mutation_p.D31H	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						AATTCAGCATCACTCTTCAGA	0.388																																						dbGAP											0													133.0	120.0	124.0					1																	111492643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1699G>C	1.37:g.111492643C>G	ENSP00000358778:p.Asp567His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	NULL	p.D567H	ENST00000369763.4	37	c.1699	CCDS30800.1	1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184678	0.57909	.	.	ENSG00000121931	ENST00000369763;ENST00000494675;ENST00000485275	T;T;T	0.36340	1.68;1.26;1.26	5.59	4.6	0.57074	.	0.288263	0.29956	N	0.010775	T	0.45975	0.1369	M	0.61703	1.905	0.33542	D	0.595034	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.943	T	0.44159	-0.9346	10	0.51188	T	0.08	-14.755	12.4446	0.55643	0.1785:0.8215:0.0:0.0	.	31;567	Q5T3J3-2;Q5T3J3	.;LRIF1_HUMAN	H	567;31;31	ENSP00000358778:D567H;ENSP00000435259:D31H;ENSP00000432290:D31H	ENSP00000358778:D567H	D	-	1	0	LRIF1	111294166	0.885000	0.30320	0.989000	0.46669	0.887000	0.51463	1.301000	0.33447	2.635000	0.89317	0.563000	0.77884	GAT	LRIF1	-	NULL	ENSG00000121931		0.388	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRIF1	HGNC	protein_coding	OTTHUMT00000032932.2	206	0.00	0	C	NM_018372		111492643	111492643	-1	no_errors	ENST00000369763	ensembl	human	known	69_37n	missense	286	12.50	41	SNP	0.922	G
LRP1	4035	genome.wustl.edu	37	12	57592310	57592310	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr12:57592310C>T	ENST00000243077.3	+	60	9999	c.9533C>T	c.(9532-9534)tCc>tTc	p.S3178F		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3178					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ATGGATGGGTCCAGCCGCAGC	0.622																																						dbGAP											0													92.0	68.0	76.0					12																	57592310		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9533C>T	12.37:g.57592310C>T	ENSP00000243077:p.Ser3178Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S3178F	ENST00000243077.3	37	c.9533	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	17.35	3.368686	0.61624	.	.	ENSG00000123384	ENST00000243077	D	0.91945	-2.94	4.39	4.39	0.52855	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.165021	0.39615	N	0.001313	D	0.93064	0.7792	L	0.58101	1.795	0.80722	D	1	P	0.47484	0.896	P	0.51742	0.678	D	0.93744	0.7053	10	0.62326	D	0.03	.	16.2482	0.82460	0.0:1.0:0.0:0.0	.	3178	Q07954	LRP1_HUMAN	F	3178	ENSP00000243077:S3178F	ENSP00000243077:S3178F	S	+	2	0	LRP1	55878577	0.973000	0.33851	0.941000	0.38009	0.988000	0.76386	2.414000	0.44627	2.434000	0.82447	0.561000	0.74099	TCC	LRP1	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000123384		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	12	0.00	0	C	NM_002332		57592310	57592310	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	1	85.71	6	SNP	0.996	T
LSM4	25804	genome.wustl.edu	37	19	18426844	18426844	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:18426844delT	ENST00000593829.1	-	2	288	c.35delA	c.(34-36)aatfs	p.N12fs	LSM4_ENST00000252816.6_Intron	NM_001252129.1|NM_012321.4	NP_001239058.1|NP_036453.1	Q9Y4Z0	LSM4_HUMAN	LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)	12					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U6 snRNP (GO:0005688)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|lung(3)	6						CATGGGGTGATTCTGAGCCGT	0.577																																						dbGAP											0													93.0	82.0	86.0					19																	18426844		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF117235	CCDS12374.1, CCDS62601.1	19p13.1	2008-02-05				ENSG00000130520			17259	protein-coding gene	gene with protein product		607284				10369684, 10523320	Standard	NM_012321		Approved	YER112W	uc002niq.3	Q9Y4Z0		ENST00000593829.1:c.35delA	19.37:g.18426844delT	ENSP00000469468:p.Asn12fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.N12fs	ENST00000593829.1	37	c.35	CCDS12374.1	19																																																																																			LSM4	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000130520		0.577	LSM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM4	HGNC	protein_coding	OTTHUMT00000466321.1	72	0.00	0	T			18426844	18426844	-1	no_errors	ENST00000252816	ensembl	human	known	69_37n	frame_shift_del	33	49.23	32	DEL	1.000	-
MCM4	4173	genome.wustl.edu	37	8	48887464	48887464	+	Silent	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr8:48887464G>A	ENST00000262105.2	+	14	2516	c.2307G>A	c.(2305-2307)ctG>ctA	p.L769L	MCM4_ENST00000523944.1_Silent_p.L769L	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	769					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GGGAAGCTCTGAAGCAGTCTG	0.433																																						dbGAP											0													117.0	127.0	124.0					8																	48887464		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.2307G>A	8.37:g.48887464G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEH1|Q99658	Silent	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_4,prints_MCM_DNA-dep_ATPase	p.L769	ENST00000262105.2	37	c.2307	CCDS6143.1	8																																																																																			MCM4	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase	ENSG00000104738		0.433	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM4	HGNC	protein_coding	OTTHUMT00000377791.1	201	0.00	0	G	NM_005914		48887464	48887464	+1	no_errors	ENST00000262105	ensembl	human	known	69_37n	silent	163	18.09	36	SNP	0.262	A
MIR412	574433	genome.wustl.edu	37	14	101531674	101531674	+	RNA	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr14:101531674C>G	ENST00000362142.2	+	0	0				MIR369_ENST00000362155.3_RNA|MIR656_ENST00000385224.1_RNA|MIR410_ENST00000362222.2_RNA|MIR409_ENST00000362237.1_RNA|MIR541_ENST00000401360.1_RNA	NR_030155.1				microRNA 412																		AACTTTGCATCTGGACGACGA	0.587																																						dbGAP											0													64.0	65.0	65.0					14																	101531674		1568	3582	5150	-	-	-			0					14q32.31	2011-09-12		2008-12-18	ENSG00000199012	ENSG00000199012		"""ncRNAs / Micro RNAs"""	32064	non-coding RNA	RNA, micro				MIRN412			Standard	NR_030155		Approved	hsa-mir-412	uc021sds.1				14.37:g.101531674C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000362142.2	37	NULL		14																																																																																			MIR409	-	-	ENSG00000199107		0.587	MIR412-201	KNOWN	basic	miRNA	MIR409	HGNC	miRNA		52	0.00	0	C	NR_030155		101531674	101531674	+1	no_errors	ENST00000362237	ensembl	human	known	69_37n	rna	8	33.33	4	SNP	1.000	G
CXorf57	55086	genome.wustl.edu	37	X	105883114	105883115	+	Intron	INS	-	-	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chrX:105883114_105883115insC	ENST00000372548.4	+	9	1843				CXorf57_ENST00000372544.2_Intron|MIR548AN_ENST00000408286.2_RNA	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57								poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						aattccttttgcaccaacctaa	0.351																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1734+197->C	X.37:g.105883115_105883115dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	RNA	INS	-	NULL	ENST00000372548.4	37	NULL	CCDS14519.1	X																																																																																			MIR548AN	-	-	ENSG00000263515		0.351	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR548AN	HGNC	protein_coding	OTTHUMT00000057800.2	23	0.00	0	-	NM_018015		105883114	105883115	+1	no_errors	ENST00000408286	ensembl	human	known	69_37n	rna	9	30.77	4	INS	0.050:0.054	C
MMP17	4326	genome.wustl.edu	37	12	132325312	132325313	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr12:132325312_132325313insT	ENST00000360564.1	+	4	719_720	c.617_618insT	c.(616-621)accgtgfs	p.V207fs	MMP17_ENST00000535182.1_3'UTR|MMP17_ENST00000535291.1_Frame_Shift_Ins_p.V123fs	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	207					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	CCCGGCGGCACCGTGGCCCACG	0.688																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	Exception_encountered	12.37:g.132325312_132325313insT	ENSP00000353767:p.Val207fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14850	Frame_Shift_Ins	INS	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.V207fs	ENST00000360564.1	37	c.617_618	CCDS31927.1	12																																																																																			MMP17	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	ENSG00000198598		0.688	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP17	HGNC	protein_coding	OTTHUMT00000397757.1	10	0.00	0	-	NM_016155		132325312	132325313	+1	no_errors	ENST00000360564	ensembl	human	known	69_37n	frame_shift_ins	5	85.71	30	INS	0.994:0.372	T
MRPS30	10884	genome.wustl.edu	37	5	44809572	44809573	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr5:44809572_44809573insA	ENST00000507110.1	+	1	546_547	c.508_509insA	c.(508-510)gagfs	p.E170fs	RP11-53O19.1_ENST00000505401.1_RNA|RP11-53O19.1_ENST00000503179.1_RNA|RP11-53O19.1_ENST00000508123.1_RNA|RP11-53O19.1_ENST00000503452.1_RNA|RP11-53O19.1_ENST00000514597.1_RNA|RP11-53O19.1_ENST00000505637.1_RNA|RP11-53O19.1_ENST00000505302.1_RNA|RP11-53O19.1_ENST00000508945.1_RNA	NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	170					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					CGAGGAGAGCGAGGTCATATCT	0.688																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.509dupA	5.37:g.44809573_44809573dupA	ENSP00000424328:p.Glu170fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Frame_Shift_Ins	INS	pfam_Ribosomal_L37/S30	p.V171fs	ENST00000507110.1	37	c.508_509	CCDS3951.1	5																																																																																			MRPS30	-	pfam_Ribosomal_L37/S30	ENSG00000112996		0.688	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS30	HGNC	protein_coding	OTTHUMT00000214033.2	10	0.00	0	-	NM_016640		44809572	44809573	+1	no_errors	ENST00000507110	ensembl	human	known	69_37n	frame_shift_ins	16	48.39	15	INS	0.031:0.041	A
MYB	4602	genome.wustl.edu	37	6	135520054	135520054	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr6:135520054C>G	ENST00000367814.4	+	10	1398	c.1212C>G	c.(1210-1212)aaC>aaG	p.N404K	MYB_ENST00000534044.1_Missense_Mutation_p.N404K|MYB_ENST00000316528.8_Missense_Mutation_p.N404K|MYB_ENST00000528774.1_Missense_Mutation_p.N522K|MYB_ENST00000525369.1_Missense_Mutation_p.N319K|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000341911.5_Missense_Mutation_p.N525K|MYB_ENST00000442647.2_Missense_Mutation_p.N401K|MYB_ENST00000534121.1_Missense_Mutation_p.N509K|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000527615.1_Missense_Mutation_p.N404K|MYB_ENST00000533624.1_Missense_Mutation_p.N369K	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	404	Negative regulatory domain. {ECO:0000250}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AGTTCTTAAACACTTCCAGTA	0.338			T	NFIB	adenoid cystic carcinoma																																	dbGAP		Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0													73.0	72.0	72.0					6																	135520054		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.1212C>G	6.37:g.135520054C>G	ENSP00000356788:p.Asn404Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.N525K	ENST00000367814.4	37	c.1575	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156848	0.57259	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624	T;T;T;T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45	5.88	4.13	0.48395	C-myb, C-terminal (1);	0.039930	0.85682	D	0.000000	T	0.40645	0.1125	M	0.77103	2.36	0.31079	N	0.712097	P;P;P;D;P;D;D;P;P	0.76494	0.737;0.863;0.763;0.999;0.574;0.996;0.999;0.72;0.863	B;B;B;D;B;D;D;B;B	0.87578	0.338;0.438;0.173;0.998;0.388;0.967;0.997;0.355;0.438	T	0.39663	-0.9603	10	0.31617	T	0.26	-17.8208	12.6613	0.56815	0.0:0.8667:0.0:0.1333	.	369;404;401;522;319;509;525;404;404	E9PI07;E9PLZ5;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;.;MYB_HUMAN;.	K	525;401;404;404;404;404;319;522;509;404;369	ENSP00000339992:N525K;ENSP00000410825:N401K;ENSP00000326328:N404K;ENSP00000356788:N404K;ENSP00000433227:N404K;ENSP00000435938:N319K;ENSP00000434723:N522K;ENSP00000432851:N509K;ENSP00000435055:N404K;ENSP00000436605:N369K	ENSP00000237302:N404K	N	+	3	2	MYB	135561747	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.997000	0.40786	0.835000	0.34877	-0.140000	0.14226	AAC	MYB	-	pfam_C-myb_C	ENSG00000118513		0.338	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	61	0.00	0	C			135520054	135520054	+1	no_errors	ENST00000341911	ensembl	human	known	69_37n	missense	60	16.67	12	SNP	1.000	G
MYO5B	4645	genome.wustl.edu	37	18	47500828	47500828	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr18:47500828G>A	ENST00000285039.7	-	10	1513	c.1214C>T	c.(1213-1215)gCg>gTg	p.A405V		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	405	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GATGTGCTTCGCCAGGGCGTT	0.587																																						dbGAP											0													148.0	157.0	154.0					18																	47500828		2178	4274	6452	-	-	-	SO:0001583	missense	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1214C>T	18.37:g.47500828G>A	ENSP00000285039:p.Ala405Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A405V	ENST00000285039.7	37	c.1214	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.452491	0.96223	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.89746	-2.56	5.5	5.5	0.81552	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.94291	0.8166	M	0.85099	2.735	0.80722	D	1	P;D	0.58268	0.949;0.982	P;P	0.57720	0.826;0.707	D	0.94663	0.7850	10	0.72032	D	0.01	.	19.3767	0.94512	0.0:0.0:1.0:0.0	.	404;405	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	V	405;404	ENSP00000285039:A405V	ENSP00000285039:A405V	A	-	2	0	MYO5B	45754826	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.751000	0.98889	2.735000	0.93741	0.655000	0.94253	GCG	MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000167306		0.587	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	256	0.39	1	G			47500828	47500828	-1	no_errors	ENST00000285039	ensembl	human	known	69_37n	missense	166	18.23	37	SNP	1.000	A
NEDD4	4734	genome.wustl.edu	37	15	56140722	56140723	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr15:56140722_56140723insC	ENST00000508342.1	-	12	3035_3036	c.2736_2737insG	c.(2734-2739)aatcacfs	p.H913fs	NEDD4_ENST00000435532.3_Frame_Shift_Ins_p.H494fs|NEDD4_ENST00000338963.2_Frame_Shift_Ins_p.H841fs|NEDD4_ENST00000506154.1_Frame_Shift_Ins_p.H897fs	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	913	Mediates interaction with TNIK. {ECO:0000250}.|WW 4. {ECO:0000255|PROSITE- ProRule:PRU00224}.				adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		CACATACTGTGATTTATGTAGA	0.307																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.2736_2737insG	15.37:g.56140722_56140723insC	ENSP00000424827:p.His913fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Frame_Shift_Ins	INS	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.H912fs	ENST00000508342.1	37	c.2737_2736		15																																																																																			NEDD4	-	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	ENSG00000069869		0.307	NEDD4-002	KNOWN	basic	protein_coding	NEDD4	HGNC	protein_coding	OTTHUMT00000359817.1	103	0.00	0	-	NM_198400		56140722	56140723	-1	no_errors	ENST00000508342	ensembl	human	known	69_37n	frame_shift_ins	140	48.72	133	INS	1.000:1.000	C
NLRP5	126206	genome.wustl.edu	37	19	56565089	56565089	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:56565089C>A	ENST00000390649.3	+	13	3214	c.3214C>A	c.(3214-3216)Ctc>Atc	p.L1072I		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1072					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GAGCCTGGATCTCACGGACAA	0.592																																						dbGAP											0													89.0	91.0	90.0					19																	56565089		2103	4227	6330	-	-	-	SO:0001583	missense	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3214C>A	19.37:g.56565089C>A	ENSP00000375063:p.Leu1072Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L1072I	ENST00000390649.3	37	c.3214	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111720	0.56398	.	.	ENSG00000171487	ENST00000390649	T	0.76709	-1.04	3.69	3.69	0.42338	.	0.000000	0.31188	N	0.008082	D	0.86477	0.5942	M	0.80616	2.505	0.09310	N	0.999996	D	0.71674	0.998	D	0.73380	0.98	T	0.77509	-0.2561	10	0.87932	D	0	.	11.2203	0.48851	0.0:1.0:0.0:0.0	.	1072	P59047	NALP5_HUMAN	I	1072	ENSP00000375063:L1072I	ENSP00000375063:L1072I	L	+	1	0	NLRP5	61256901	0.212000	0.23540	0.243000	0.24186	0.002000	0.02628	2.509000	0.45459	2.362000	0.80069	0.655000	0.94253	CTC	NLRP5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000171487		0.592	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	114	0.00	0	C	NM_153447		56565089	56565089	+1	no_errors	ENST00000390649	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	0.267	A
NOTCH2	4853	genome.wustl.edu	37	1	120458455	120458455	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:120458455delG	ENST00000256646.2	-	34	7109	c.6890delC	c.(6889-6891)cctfs	p.P2297fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2297					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGGCTCCCGAGGGGTGGTTAT	0.602			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													63.0	66.0	65.0					1																	120458455		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6890delC	1.37:g.120458455delG	ENSP00000256646:p.Pro2297fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P2297fs	ENST00000256646.2	37	c.6890	CCDS908.1	1																																																																																			NOTCH2	-	pirsf_Notch,prints_Notch_2	ENSG00000134250		0.602	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	171	0.00	0	G	NM_024408		120458455	120458455	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	frame_shift_del	67	47.06	64	DEL	0.252	-
OR10V1	390201	genome.wustl.edu	37	11	59481034	59481034	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr11:59481034G>C	ENST00000307552.2	-	1	303	c.285C>G	c.(283-285)atC>atG	p.I95M	STX3_ENST00000300150.7_5'UTR	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						CACATCCCGTGATGGAAACAG	0.473																																						dbGAP											0													72.0	68.0	69.0					11																	59481034		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.285C>G	11.37:g.59481034G>C	ENSP00000302199:p.Ile95Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFD9|Q96R50	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I95M	ENST00000307552.2	37	c.285	CCDS31565.1	11	.	.	.	.	.	.	.	.	.	.	G	8.394	0.840349	0.16891	.	.	ENSG00000172289	ENST00000307552	T	0.00414	7.52	4.36	2.47	0.30058	GPCR, rhodopsin-like superfamily (1);	0.420777	0.19882	N	0.103948	T	0.00210	0.0006	N	0.20401	0.57	0.20638	N	0.999878	P	0.40266	0.71	B	0.33750	0.169	T	0.50303	-0.8844	10	0.87932	D	0	.	4.1224	0.10111	0.196:0.0:0.6208:0.1832	.	95	Q8NGI7	O10V1_HUMAN	M	95	ENSP00000302199:I95M	ENSP00000302199:I95M	I	-	3	3	OR10V1	59237610	0.000000	0.05858	0.140000	0.22221	0.880000	0.50808	-1.240000	0.02914	0.606000	0.29965	0.543000	0.68304	ATC	OR10V1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172289		0.473	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10V1	HGNC	protein_coding	OTTHUMT00000394517.1	141	0.00	0	G	NM_001005324		59481034	59481034	-1	no_errors	ENST00000307552	ensembl	human	known	69_37n	missense	157	23.04	47	SNP	0.003	C
PDE4C	5143	genome.wustl.edu	37	19	18322580	18322580	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:18322580C>G	ENST00000355502.3	-	18	2651	c.1780G>C	c.(1780-1782)Gag>Cag	p.E594Q	AC068499.10_ENST00000599416.2_RNA|PDE4C_ENST00000262805.12_Missense_Mutation_p.E562Q|PDE4C_ENST00000597297.1_Missense_Mutation_p.E364Q|PDE4C_ENST00000594617.3_Missense_Mutation_p.E594Q|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000594465.3_Missense_Mutation_p.E594Q|PDE4C_ENST00000447275.3_Missense_Mutation_p.E488Q|PDE4C_ENST00000598111.2_Missense_Mutation_p.E309Q|PDE4C_ENST00000539010.1_Missense_Mutation_p.E363Q			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	594					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	TGGGACTTCTCCACTGAGGCC	0.622																																						dbGAP											0													90.0	83.0	85.0					19																	18322580		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1780G>C	19.37:g.18322580C>G	ENSP00000347689:p.Glu594Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.E594Q	ENST00000355502.3	37	c.1780	CCDS12373.1	19	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720387	0.89205	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47	4.85	4.85	0.62838	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.82949	0.5148	M	0.72624	2.21	0.45662	D	0.998587	D;D;D;D	0.89917	1.0;0.999;0.996;1.0	D;D;P;D	0.91635	0.998;0.967;0.887;0.999	D	0.85292	0.1068	10	0.87932	D	0	.	15.4628	0.75373	0.0:1.0:0.0:0.0	.	594;562;400;309	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	Q	673;594;582;562;488;400;308;363;703	ENSP00000347689:E594Q;ENSP00000262805:E562Q;ENSP00000402091:E488Q;ENSP00000439470:E363Q	ENSP00000262805:E562Q	E	-	1	0	PDE4C	18183580	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.422000	0.80217	2.249000	0.74217	0.561000	0.74099	GAG	PDE4C	-	pfam_PDEase_catalytic_dom	ENSG00000105650		0.622	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1	103	0.00	0	C			18322580	18322580	-1	no_errors	ENST00000355502	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	G
PGLYRP3	114771	genome.wustl.edu	37	1	153271673	153271673	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:153271673C>T	ENST00000290722.1	-	6	815	c.763G>A	c.(763-765)Ggg>Agg	p.G255R		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	255					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATCCAACCCCTTCATACACG	0.463																																						dbGAP											0													86.0	74.0	78.0					1																	153271673		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.763G>A	1.37:g.153271673C>T	ENSP00000290722:p.Gly255Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4U8|Q5SY65	Missense_Mutation	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.G255R	ENST00000290722.1	37	c.763	CCDS1035.1	1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390531	0.62066	.	.	ENSG00000159527	ENST00000290722	T	0.35048	1.33	4.59	4.59	0.56863	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.000000	0.64402	D	0.000015	T	0.68044	0.2958	H	0.98133	4.155	0.53688	D	0.999975	D	0.89917	1.0	D	0.97110	1.0	T	0.80315	-0.1434	10	0.87932	D	0	-47.8039	12.8946	0.58091	0.0:1.0:0.0:0.0	.	255	Q96LB9	PGRP3_HUMAN	R	255	ENSP00000290722:G255R	ENSP00000290722:G255R	G	-	1	0	PGLYRP3	151538297	1.000000	0.71417	0.998000	0.56505	0.616000	0.37450	3.879000	0.56138	2.094000	0.63399	0.313000	0.20887	GGG	PGLYRP3	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000159527		0.463	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	HGNC	protein_coding	OTTHUMT00000039488.1	347	0.00	0	C	NM_052891		153271673	153271673	-1	no_errors	ENST00000290722	ensembl	human	known	69_37n	missense	308	26.08	109	SNP	1.000	T
PIAS4	51588	genome.wustl.edu	37	19	4013263	4013263	+	Missense_Mutation	SNP	G	G	A	rs111928159		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:4013263G>A	ENST00000262971.2	+	2	485	c.370G>A	c.(370-372)Gcc>Acc	p.A124T		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	124	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGGTTGCCCGCCAAGACCCT	0.597																																						dbGAP											0													52.0	52.0	52.0					19																	4013263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.370G>A	19.37:g.4013263G>A	ENSP00000262971:p.Ala124Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75926|Q96G19|Q9UN16	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.A124T	ENST00000262971.2	37	c.370	CCDS12118.1	19	.	.	.	.	.	.	.	.	.	.	G	5.492	0.275835	0.10403	.	.	ENSG00000105229	ENST00000262971	T	0.30714	1.52	4.82	-6.26	0.02033	PINIT domain (1);	0.449748	0.25792	N	0.028276	T	0.11110	0.0271	L	0.29908	0.895	0.22253	N	0.999258	B	0.02656	0.0	B	0.04013	0.001	T	0.37957	-0.9683	10	0.06757	T	0.87	-17.6284	2.3929	0.04383	0.4992:0.1701:0.2042:0.1265	.	124	Q8N2W9	PIAS4_HUMAN	T	124	ENSP00000262971:A124T	ENSP00000262971:A124T	A	+	1	0	PIAS4	3964263	0.000000	0.05858	0.627000	0.29227	0.520000	0.34377	-0.416000	0.07097	-0.776000	0.04578	-0.254000	0.11334	GCC	PIAS4	-	NULL	ENSG00000105229		0.597	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS4	HGNC	protein_coding	OTTHUMT00000457496.1	24	0.00	0	G	NM_015897		4013263	4013263	+1	no_errors	ENST00000262971	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	0.475	A
PLK2	10769	genome.wustl.edu	37	5	57750425	57750425	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr5:57750425T>A	ENST00000274289.3	-	14	2343	c.2043A>T	c.(2041-2043)ttA>ttT	p.L681F	PLK2_ENST00000502671.1_Intron	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	681					G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		TACATCTTTGTAAGAGCATGT	0.403																																						dbGAP											0													147.0	141.0	143.0					5																	57750425		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.2043A>T	5.37:g.57750425T>A	ENSP00000274289:p.Leu681Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O60679|Q96CV7|Q9UE61	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_cat_dom	p.L681F	ENST00000274289.3	37	c.2043	CCDS3974.1	5	.	.	.	.	.	.	.	.	.	.	T	19.28	3.797105	0.70567	.	.	ENSG00000145632	ENST00000274289	T	0.30182	1.54	5.92	2.18	0.27775	.	0.000000	0.85682	D	0.000000	T	0.36991	0.0987	L	0.47716	1.5	0.80722	D	1	D	0.67145	0.996	P	0.59703	0.862	T	0.06607	-1.0817	10	0.41790	T	0.15	-9.6175	6.4076	0.21672	0.0:0.5194:0.0:0.4806	.	681	Q9NYY3	PLK2_HUMAN	F	681	ENSP00000274289:L681F	ENSP00000274289:L681F	L	-	3	2	PLK2	57786182	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.978000	0.40598	0.470000	0.27294	0.533000	0.62120	TTA	PLK2	-	NULL	ENSG00000145632		0.403	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK2	HGNC	protein_coding	OTTHUMT00000214150.1	101	0.00	0	T	NM_006622		57750425	57750425	-1	no_errors	ENST00000274289	ensembl	human	known	69_37n	missense	54	30.77	24	SNP	1.000	A
PRTG	283659	genome.wustl.edu	37	15	56032653	56032653	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr15:56032653T>A	ENST00000561292.1	-	2	482	c.324A>T	c.(322-324)gaA>gaT	p.E108D	PRTG_ENST00000389286.4_Missense_Mutation_p.E108D					protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GATAAAATCCTTCATCGGACT	0.398																																						dbGAP											0													193.0	183.0	186.0					15																	56032653		1887	4124	6011	-	-	-	SO:0001583	missense	0			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000561292.1:c.324A>T	15.37:g.56032653T>A	ENSP00000453335:p.Glu108Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E108D	ENST00000561292.1	37	c.324		15	.	.	.	.	.	.	.	.	.	.	T	19.45	3.829793	0.71258	.	.	ENSG00000166450	ENST00000389286	T	0.68903	-0.36	5.66	3.31	0.37934	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000002	T	0.72661	0.3488	L	0.52126	1.63	0.46061	D	0.99884	D	0.67145	0.996	D	0.67548	0.952	T	0.68413	-0.5415	10	0.39692	T	0.17	-17.7006	9.4673	0.38820	0.0:0.1451:0.0:0.8549	.	108	Q2VWP7	PRTG_HUMAN	D	108	ENSP00000373937:E108D	ENSP00000373937:E108D	E	-	3	2	PRTG	53819945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.437000	0.34991	0.403000	0.25479	0.528000	0.53228	GAA	PRTG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000166450		0.398	PRTG-004	PUTATIVE	basic|exp_conf	protein_coding	PRTG	HGNC	protein_coding	OTTHUMT00000419360.1	354	0.00	0	T	NM_173814		56032653	56032653	-1	no_errors	ENST00000389286	ensembl	human	known	69_37n	missense	200	32.89	98	SNP	1.000	A
PSMD3	5709	genome.wustl.edu	37	17	38140605	38140605	+	Silent	SNP	C	C	T	rs201112076		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr17:38140605C>T	ENST00000264639.4	+	2	453	c.279C>T	c.(277-279)ttC>ttT	p.F93F	PSMD3_ENST00000541736.1_Intron	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	93					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					AGCCGAGATTCGTGCTGCGGG	0.507																																					Ovarian(186;531 2051 6385 19668 48409)	dbGAP											0													80.0	74.0	76.0					17																	38140605		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.279C>T	17.37:g.38140605C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMW9|B4DT72|Q96EI2|Q9BQA4	Silent	SNP	pfam_26S_Psome_reg_C,pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.F93	ENST00000264639.4	37	c.279	CCDS11356.1	17																																																																																			PSMD3	-	NULL	ENSG00000108344		0.507	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD3	HGNC	protein_coding	OTTHUMT00000257018.1	111	0.00	0	C	NM_002809		38140605	38140605	+1	no_errors	ENST00000264639	ensembl	human	known	69_37n	silent	42	14.29	7	SNP	0.835	T
RAP2B	5912	genome.wustl.edu	37	3	152880727	152880727	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:152880727A>G	ENST00000323534.2	+	1	699	c.245A>G	c.(244-246)tAc>tGc	p.Y82C	RP11-529G21.2_ENST00000487827.1_RNA	NM_002886.2	NP_002877.2	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family	82					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			ATCCTGGTCTACAGCCTCGTC	0.627																																						dbGAP											0													109.0	100.0	103.0					3																	152880727		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3170.1	3q25.2	2014-05-09			ENSG00000181467	ENSG00000181467			9862	protein-coding gene	gene with protein product	"""Ras-related protein RAP-2B"", ""small GTP binding protein"", ""Ras family small GTP binding protein RAP2B"""	179541				2118648	Standard	NM_002886		Approved		uc003ezr.3	P61225	OTTHUMG00000159655	ENST00000323534.2:c.245A>G	3.37:g.152880727A>G	ENSP00000319096:p.Tyr82Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P17964|Q96EG5|Q9CXG0	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y82C	ENST00000323534.2	37	c.245	CCDS3170.1	3	.	.	.	.	.	.	.	.	.	.	A	19.56	3.850764	0.71719	.	.	ENSG00000181467	ENST00000323534	D	0.84070	-1.8	4.71	4.71	0.59529	Small GTP-binding protein domain (1);	0.000000	0.64402	U	0.000002	D	0.91975	0.7458	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.93449	0.6800	10	0.87932	D	0	.	13.1689	0.59587	1.0:0.0:0.0:0.0	.	82	P61225	RAP2B_HUMAN	C	82	ENSP00000319096:Y82C	ENSP00000319096:Y82C	Y	+	2	0	RAP2B	154363417	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.938000	0.92943	1.965000	0.57142	0.460000	0.39030	TAC	RAP2B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000181467		0.627	RAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP2B	HGNC	protein_coding	OTTHUMT00000356707.1	27	0.00	0	A	NM_002886		152880727	152880727	+1	no_errors	ENST00000323534	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	1.000	G
RP1	6101	genome.wustl.edu	37	8	55537315	55537315	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr8:55537315C>A	ENST00000220676.1	+	4	1021	c.873C>A	c.(871-873)gaC>gaA	p.D291E		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	291					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCTACTTAGACTATTCTTTTG	0.299																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													63.0	67.0	66.0					8																	55537315		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.873C>A	8.37:g.55537315C>A	ENSP00000220676:p.Asp291Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.D291E	ENST00000220676.1	37	c.873	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	9.970	1.225104	0.22457	.	.	ENSG00000104237	ENST00000220676	T	0.25579	1.79	5.19	-1.1	0.09872	.	0.000000	0.64402	D	0.000011	T	0.19967	0.0480	M	0.76002	2.32	0.09310	N	0.999995	B	0.27498	0.18	B	0.20577	0.03	T	0.25293	-1.0136	10	0.72032	D	0.01	.	0.491	0.00564	0.2198:0.187:0.2158:0.3774	.	291	P56715	RP1_HUMAN	E	291	ENSP00000220676:D291E	ENSP00000220676:D291E	D	+	3	2	RP1	55699868	0.005000	0.15991	0.491000	0.27477	0.976000	0.68499	-0.914000	0.04038	-0.292000	0.08999	-0.175000	0.13238	GAC	RP1	-	NULL	ENSG00000104237		0.299	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	71	0.00	0	C	NM_006269		55537315	55537315	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	69	22.47	20	SNP	0.051	A
RPL4	6124	genome.wustl.edu	37	15	66794137	66794137	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr15:66794137C>G	ENST00000307961.6	-	5	627	c.535G>C	c.(535-537)Gat>Cat	p.D179H	RPL4_ENST00000568588.1_Missense_Mutation_p.D85H|SNORD18A_ENST00000363753.1_RNA|SNORD16_ENST00000362803.1_RNA|SNORD18C_ENST00000362704.1_RNA|SNORD18B_ENST00000365659.1_RNA	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	179					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						TTTTTGATATCATTCCAGGCT	0.383																																						dbGAP											0													119.0	117.0	118.0					15																	66794137		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.535G>C	15.37:g.66794137C>G	ENSP00000311430:p.Asp179His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K502|P39029|Q4VBR0|Q969Z9	Missense_Mutation	SNP	pfam_Ribosomal_L4/L1e,superfamily_Ribosomal_L4_dom	p.D179H	ENST00000307961.6	37	c.535	CCDS10218.1	15	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590216	0.86851	.	.	ENSG00000174444	ENST00000307961;ENST00000432669	.	.	.	5.1	5.1	0.69264	Ribosomal protein L4 domain (2);	0.000000	0.85682	D	0.000000	D	0.90494	0.7022	H	0.98407	4.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	D	0.93927	0.7211	9	0.87932	D	0	-23.193	16.9134	0.86145	0.0:1.0:0.0:0.0	.	179;179	B4DFI6;P36578	.;RL4_HUMAN	H	179	.	ENSP00000311430:D179H	D	-	1	0	RPL4	64581191	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.076000	0.76806	2.652000	0.90054	0.655000	0.94253	GAT	RPL4	-	pfam_Ribosomal_L4/L1e,superfamily_Ribosomal_L4_dom	ENSG00000174444		0.383	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL4	HGNC	protein_coding	OTTHUMT00000256903.2	120	0.00	0	C	NM_000968		66794137	66794137	-1	no_errors	ENST00000307961	ensembl	human	known	69_37n	missense	47	57.27	63	SNP	1.000	G
RSPH9	221421	genome.wustl.edu	37	6	43624412	43624412	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr6:43624412G>A	ENST00000372163.4	+	4	675	c.622G>A	c.(622-624)Gac>Aac	p.D208N	RSPH9_ENST00000372165.4_Missense_Mutation_p.D193N	NM_152732.4	NP_689945.2	Q9H1X1	RSPH9_HUMAN	radial spoke head 9 homolog (Chlamydomonas)	208					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)				NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						GGCTGACCTGGACCCCTCCCT	0.512									Kartagener syndrome																													dbGAP											0													199.0	190.0	193.0					6																	43624412		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AK055407	CCDS4905.1, CCDS55005.1	6p21.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000172426	ENSG00000172426			21057	protein-coding gene	gene with protein product		612648	"""mitochondrial ribosomal protein S18A-like 1"", ""chromosome 6 open reading frame 206"""	MRPS18AL1, C6orf206		19200523	Standard	NM_152732		Approved	FLJ30845, CILD12	uc003ovx.2	Q9H1X1	OTTHUMG00000014746	ENST00000372163.4:c.622G>A	6.37:g.43624412G>A	ENSP00000361236:p.Asp208Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5T4|Q96NH9	Missense_Mutation	SNP	NULL	p.D193N	ENST00000372163.4	37	c.577	CCDS4905.1	6	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228085	0.58777	.	.	ENSG00000172426	ENST00000372165;ENST00000372163	T	0.42900	0.96	4.7	4.7	0.59300	.	0.265617	0.42053	D	0.000770	T	0.36880	0.0983	N	0.21583	0.68	0.43494	D	0.995737	D;B	0.76494	0.999;0.196	D;B	0.68353	0.957;0.095	T	0.15378	-1.0439	10	0.28530	T	0.3	-25.7784	15.14	0.72604	0.0:0.0:1.0:0.0	.	193;208	Q96NH9;Q9H1X1	.;RSPH9_HUMAN	N	193;208	ENSP00000361236:D208N	ENSP00000361236:D208N	D	+	1	0	RSPH9	43732390	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.444000	0.66587	2.150000	0.67090	0.563000	0.77884	GAC	RSPH9	-	NULL	ENSG00000172426		0.512	RSPH9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH9	HGNC	protein_coding	OTTHUMT00000040690.1	518	0.00	0	G	NM_152732		43624412	43624412	+1	no_errors	ENST00000372165	ensembl	human	known	69_37n	missense	197	40.12	132	SNP	1.000	A
SEC14L5	9717	genome.wustl.edu	37	16	5009367	5009367	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr16:5009367C>T	ENST00000251170.7	+	2	223	c.43C>T	c.(43-45)Ccg>Tcg	p.P15S		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	15	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						CTACAAGTACCCGTTTGAGCT	0.582																																						dbGAP											0													121.0	122.0	122.0					16																	5009367		2095	4231	6326	-	-	-	SO:0001583	missense	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.43C>T	16.37:g.5009367C>T	ENSP00000251170:p.Pro15Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.P15S	ENST00000251170.7	37	c.43	CCDS45403.1	16	.	.	.	.	.	.	.	.	.	.	C	16.81	3.224679	0.58668	.	.	ENSG00000103184	ENST00000251170	T	0.74737	-0.87	3.77	3.77	0.43336	PRELI/MSF1 (1);	0.000000	0.64402	D	0.000016	T	0.73125	0.3547	M	0.74881	2.28	0.58432	D	0.999995	P	0.38148	0.62	B	0.37239	0.244	T	0.78874	-0.2032	10	0.72032	D	0.01	-20.0528	12.9837	0.58579	0.0:1.0:0.0:0.0	.	15	O43304	S14L5_HUMAN	S	15	ENSP00000251170:P15S	ENSP00000251170:P15S	P	+	1	0	SEC14L5	4949368	0.998000	0.40836	0.974000	0.42286	0.790000	0.44656	3.270000	0.51600	2.114000	0.64651	0.462000	0.41574	CCG	SEC14L5	-	pfscan_PRELI/MSF1	ENSG00000103184		0.582	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	159	0.00	0	C			5009367	5009367	+1	no_errors	ENST00000251170	ensembl	human	known	69_37n	missense	16	60.98	25	SNP	0.999	T
SLC13A1	6561	genome.wustl.edu	37	7	122759197	122759197	+	Missense_Mutation	SNP	A	A	T	rs372571302		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:122759197A>T	ENST00000194130.2	-	13	1489	c.1450T>A	c.(1450-1452)Tta>Ata	p.L484I	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	484					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	ACCTCAGTTAAAGATGTCACC	0.373																																						dbGAP											0													103.0	103.0	103.0					7																	122759197		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.1450T>A	7.37:g.122759197A>T	ENSP00000194130:p.Leu484Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H5Z0	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.L484I	ENST00000194130.2	37	c.1450	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	A	15.31	2.796769	0.50208	.	.	ENSG00000081800	ENST00000194130	T	0.02837	4.14	5.68	3.17	0.36434	.	0.217376	0.37348	N	0.002125	T	0.03739	0.0106	L	0.52266	1.64	0.80722	D	1	B;B	0.29378	0.243;0.243	B;B	0.35655	0.207;0.207	T	0.49254	-0.8959	10	0.23891	T	0.37	-30.383	6.6999	0.23219	0.6126:0.3013:0.0861:0.0	.	484;484	A4D0X1;Q9BZW2	.;S13A1_HUMAN	I	484	ENSP00000194130:L484I	ENSP00000194130:L484I	L	-	1	2	SLC13A1	122546433	0.872000	0.30054	1.000000	0.80357	0.845000	0.48019	0.800000	0.27042	0.972000	0.38314	0.482000	0.46254	TTA	SLC13A1	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	ENSG00000081800		0.373	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	HGNC	protein_coding	OTTHUMT00000347404.1	47	0.00	0	A	NM_022444		122759197	122759197	-1	no_errors	ENST00000194130	ensembl	human	known	69_37n	missense	129	17.31	27	SNP	0.999	T
SLC2A10	81031	genome.wustl.edu	37	20	45354529	45354529	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr20:45354529T>C	ENST00000359271.2	+	2	1104	c.854T>C	c.(853-855)cTg>cCg	p.L285P		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	285					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GCAGCTACCCTGACCGCCATG	0.647																																						dbGAP											0													95.0	90.0	92.0					20																	45354529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.854T>C	20.37:g.45354529T>C	ENSP00000352216:p.Leu285Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.L285P	ENST00000359271.2	37	c.854	CCDS13402.1	20	.	.	.	.	.	.	.	.	.	.	T	13.02	2.110893	0.37242	.	.	ENSG00000197496	ENST00000359271	T	0.76448	-1.02	5.33	4.24	0.50183	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.218517	0.39909	N	0.001235	D	0.90584	0.7048	H	0.95850	3.73	0.33442	D	0.58248	D	0.76494	0.999	D	0.71870	0.975	D	0.94134	0.7391	10	0.72032	D	0.01	-6.2166	11.1742	0.48590	0.0:0.0715:0.0:0.9285	.	285	O95528	GTR10_HUMAN	P	285	ENSP00000352216:L285P	ENSP00000352216:L285P	L	+	2	0	SLC2A10	44787936	0.749000	0.28305	0.017000	0.16124	0.444000	0.32077	4.064000	0.57506	1.052000	0.40392	0.533000	0.62120	CTG	SLC2A10	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197496		0.647	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SLC2A10	HGNC	protein_coding	OTTHUMT00000079578.2	167	0.00	0	T			45354529	45354529	+1	no_errors	ENST00000359271	ensembl	human	known	69_37n	missense	67	15.19	12	SNP	0.031	C
SLC2A3	6515	genome.wustl.edu	37	12	8077007	8077007	+	Splice_Site	SNP	T	T	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr12:8077007T>C	ENST00000075120.7	-	8	1307	c.1067A>G	c.(1066-1068)aAg>aGg	p.K356R		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	356					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		AGCACCTACCTTTAATAACAA	0.453																																					Colon(96;424 1461 14416 20933 23688)	dbGAP											0													99.0	110.0	106.0					12																	8077007		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.1068+1A>G	12.37:g.8077007T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_3,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.K356R	ENST00000075120.7	37	c.1067	CCDS8586.1	12	.	.	.	.	.	.	.	.	.	.	T	4.693	0.128945	0.08981	.	.	ENSG00000059804	ENST00000075120;ENST00000540978	T	0.74421	-0.84	4.0	4.0	0.46444	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.669144	0.14864	N	0.293917	T	0.72906	0.3519	L	0.48986	1.54	0.47214	D	0.999356	B	0.33299	0.407	B	0.43018	0.405	T	0.66634	-0.5874	10	0.23302	T	0.38	.	11.197	0.48719	0.0:0.0:0.0:1.0	.	356	P11169	GTR3_HUMAN	R	356;282	ENSP00000075120:K356R	ENSP00000075120:K356R	K	-	2	0	SLC2A3	7968274	0.999000	0.42202	0.990000	0.47175	0.120000	0.20174	2.252000	0.43196	1.800000	0.52685	0.460000	0.39030	AAG	SLC2A3	-	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000059804		0.453	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A3	HGNC	protein_coding	OTTHUMT00000257914.1	245	0.00	0	T	NM_006931	Missense_Mutation	8077007	8077007	-1	no_errors	ENST00000075120	ensembl	human	known	69_37n	missense	282	17.30	59	SNP	0.994	C
SLCO2A1	6578	genome.wustl.edu	37	3	133661572	133661572	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:133661572G>T	ENST00000310926.4	-	11	1775	c.1502C>A	c.(1501-1503)tCa>tAa	p.S501*	SLCO2A1_ENST00000493729.1_Nonsense_Mutation_p.S425*	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	501					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	TGTCTTTGCTGAAGCGGATCC	0.522																																						dbGAP											0													120.0	117.0	118.0					3																	133661572		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1502C>A	3.37:g.133661572G>T	ENSP00000311291:p.Ser501*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V98|Q8IUN2	Nonsense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.S501*	ENST00000310926.4	37	c.1502	CCDS3084.1	3	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738492	0.89573	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	.	.	.	5.56	5.56	0.83823	.	0.497220	0.22204	N	0.063186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5387	0.95266	0.0:0.0:1.0:0.0	.	.	.	.	X	501;425	.	ENSP00000311291:S501X	S	-	2	0	SLCO2A1	135144262	0.997000	0.39634	0.177000	0.23020	0.130000	0.20726	4.495000	0.60353	2.634000	0.89283	0.561000	0.74099	TCA	SLCO2A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000174640		0.522	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO2A1	HGNC	protein_coding	OTTHUMT00000357131.1	64	0.00	0	G	NM_005630		133661572	133661572	-1	no_errors	ENST00000310926	ensembl	human	known	69_37n	nonsense	24	53.85	28	SNP	0.295	T
SLCO2A1	6578	genome.wustl.edu	37	3	133667494	133667494	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:133667494C>G	ENST00000310926.4	-	8	1264	c.991G>C	c.(991-993)Gtg>Ctg	p.V331L	SLCO2A1_ENST00000493729.1_Missense_Mutation_p.V255L	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	331					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	GCCAGGACCACCAGGACGAAG	0.577																																						dbGAP											0													171.0	163.0	165.0					3																	133667494		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.991G>C	3.37:g.133667494C>G	ENSP00000311291:p.Val331Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V98|Q8IUN2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.V331L	ENST00000310926.4	37	c.991	CCDS3084.1	3	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632682	0.47049	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	T;T	0.54675	0.56;0.56	5.31	4.44	0.53790	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.211078	0.41194	D	0.000922	T	0.26011	0.0634	N	0.04746	-0.17	0.36707	D	0.880451	B;B;B	0.29955	0.263;0.006;0.006	B;B;B	0.26770	0.073;0.007;0.014	T	0.18903	-1.0322	10	0.27082	T	0.32	.	6.1224	0.20159	0.1289:0.6553:0.1406:0.0753	.	150;255;331	B7Z8J8;E7EU40;Q92959	.;.;SO2A1_HUMAN	L	331;255	ENSP00000311291:V331L;ENSP00000418893:V255L	ENSP00000311291:V331L	V	-	1	0	SLCO2A1	135150184	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	2.041000	0.41213	1.378000	0.46305	0.650000	0.86243	GTG	SLCO2A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000174640		0.577	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO2A1	HGNC	protein_coding	OTTHUMT00000357131.1	169	0.00	0	C	NM_005630		133667494	133667494	-1	no_errors	ENST00000310926	ensembl	human	known	69_37n	missense	82	10.87	10	SNP	1.000	G
SP6	80320	genome.wustl.edu	37	17	45925604	45925604	+	Silent	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr17:45925604C>G	ENST00000536300.1	-	2	523	c.192G>C	c.(190-192)tcG>tcC	p.S64S	SP6_ENST00000342234.2_Silent_p.S64S	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	64					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						CATAGCCCTGCGAGAAGTCCA	0.692																																						dbGAP											0													14.0	17.0	16.0					17																	45925604		2189	4289	6478	-	-	-	SO:0001819	synonymous_variant	0				CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.192G>C	17.37:g.45925604C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXS4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S64	ENST00000536300.1	37	c.192	CCDS11520.1	17																																																																																			SP6	-	NULL	ENSG00000189120		0.692	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SP6	HGNC	protein_coding	OTTHUMT00000441395.1	14	0.00	0	C	NM_199262		45925604	45925604	-1	no_errors	ENST00000342234	ensembl	human	known	69_37n	silent	6	45.45	5	SNP	0.005	G
STEAP4	79689	genome.wustl.edu	37	7	87910332	87910332	+	Silent	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:87910332C>G	ENST00000380079.4	-	4	1148	c.1047G>C	c.(1045-1047)gtG>gtC	p.V349V	AC003991.3_ENST00000595121.1_RNA|AC003991.3_ENST00000600908.1_RNA|AC003991.3_ENST00000447758.1_RNA|AC003991.3_ENST00000434733.1_RNA|STEAP4_ENST00000301959.5_Silent_p.V173V	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	349	Ferric oxidoreductase.				copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					TTCCCAAAGCCACATATGAAT	0.393																																						dbGAP											0													91.0	90.0	90.0					7																	87910332		1885	4114	5999	-	-	-	SO:0001819	synonymous_variant	0			AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.1047G>C	7.37:g.87910332C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Silent	SNP	pfam_Fe3_Rdtase_TM_dom,pfam_NADP_OxRdtase_F420	p.V349	ENST00000380079.4	37	c.1047	CCDS43611.1	7																																																																																			STEAP4	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000127954		0.393	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP4	HGNC	protein_coding	OTTHUMT00000332712.4	66	0.00	0	C	NM_024636		87910332	87910332	-1	no_errors	ENST00000380079	ensembl	human	known	69_37n	silent	153	18.62	35	SNP	0.002	G
STK10	6793	genome.wustl.edu	37	5	171520913	171520913	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr5:171520913T>A	ENST00000176763.5	-	9	1400	c.1057A>T	c.(1057-1059)Aat>Tat	p.N353Y	STK10_ENST00000517775.1_5'Flank	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	353					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTGTCAGCATTGAGGCTTGGC	0.522																																						dbGAP											0													43.0	46.0	45.0					5																	171520913		2178	4289	6467	-	-	-	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1057A>T	5.37:g.171520913T>A	ENSP00000176763:p.Asn353Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.N353Y	ENST00000176763.5	37	c.1057	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	T	13.07	2.127647	0.37533	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.30182	1.54	4.78	-6.19	0.02078	Protein kinase-like domain (1);	1.479250	0.03849	N	0.271973	T	0.22898	0.0553	L	0.47716	1.5	0.09310	N	1	B	0.32203	0.36	B	0.26614	0.071	T	0.32508	-0.9904	10	0.62326	D	0.03	.	6.954	0.24560	0.0:0.491:0.2678:0.2412	.	353	O94804	STK10_HUMAN	Y	353	ENSP00000176763:N353Y	ENSP00000176763:N353Y	N	-	1	0	STK10	171453518	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.713000	0.05007	-1.140000	0.02877	0.533000	0.62120	AAT	STK10	-	superfamily_Kinase-like_dom	ENSG00000072786		0.522	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	68	0.00	0	T	NM_005990		171520913	171520913	-1	no_errors	ENST00000176763	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.000	A
SWT1	54823	genome.wustl.edu	37	1	185135759	185135759	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:185135759C>A	ENST00000367500.4	+	3	305	c.140C>A	c.(139-141)tCa>tAa	p.S47*	SWT1_ENST00000367501.3_Nonsense_Mutation_p.S47*	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	47										breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						TCTATAAGATCAGTTTCATCA	0.289																																						dbGAP											0													57.0	62.0	61.0					1																	185135759		2203	4293	6496	-	-	-	SO:0001587	stop_gained	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.140C>A	1.37:g.185135759C>A	ENSP00000356470:p.Ser47*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEK9|Q9BZQ7|Q9NXQ0	Nonsense_Mutation	SNP	smart_PINc_nuc-bd	p.S47*	ENST00000367500.4	37	c.140	CCDS1367.1	1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329439	0.60743	.	.	ENSG00000116668	ENST00000367501;ENST00000367500;ENST00000450350	.	.	.	4.26	4.26	0.50523	.	0.384411	0.19200	N	0.120209	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	12.3785	0.55293	0.0:1.0:0.0:0.0	.	.	.	.	X	47	.	ENSP00000356470:S47X	S	+	2	0	SWT1	183402382	0.487000	0.25988	0.004000	0.12327	0.574000	0.36063	2.989000	0.49393	2.334000	0.79466	0.557000	0.71058	TCA	SWT1	-	NULL	ENSG00000116668		0.289	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWT1	HGNC	protein_coding	OTTHUMT00000085790.1	138	0.00	0	C	NM_017673		185135759	185135759	+1	no_errors	ENST00000367500	ensembl	human	known	69_37n	nonsense	199	13.73	32	SNP	0.007	A
SWT1	54823	genome.wustl.edu	37	1	185153935	185153935	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:185153935A>T	ENST00000367500.4	+	9	1466	c.1301A>T	c.(1300-1302)aAg>aTg	p.K434M	SWT1_ENST00000367501.3_Missense_Mutation_p.K434M	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	434	PINc.									breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						GATCGTATGAAGGAAGGAAAA	0.353																																						dbGAP											0													110.0	109.0	110.0					1																	185153935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.1301A>T	1.37:g.185153935A>T	ENSP00000356470:p.Lys434Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	smart_PINc_nuc-bd	p.K434M	ENST00000367500.4	37	c.1301	CCDS1367.1	1	.	.	.	.	.	.	.	.	.	.	A	19.24	3.789427	0.70337	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.60424	0.19;0.19	5.34	4.2	0.49525	Nucleotide binding protein, PINc (1);	0.000000	0.85682	D	0.000000	T	0.78910	0.4358	M	0.92507	3.315	0.46749	D	0.999181	D	0.76494	0.999	D	0.67382	0.951	T	0.82186	-0.0582	10	0.87932	D	0	.	11.1782	0.48612	0.8458:0.1542:0.0:0.0	.	434	Q5T5J6	SWT1_HUMAN	M	434	ENSP00000356471:K434M;ENSP00000356470:K434M	ENSP00000356470:K434M	K	+	2	0	SWT1	183420558	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.204000	0.65180	0.838000	0.34948	0.455000	0.32223	AAG	SWT1	-	smart_PINc_nuc-bd	ENSG00000116668		0.353	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWT1	HGNC	protein_coding	OTTHUMT00000085790.1	74	0.00	0	A	NM_017673		185153935	185153935	+1	no_errors	ENST00000367500	ensembl	human	known	69_37n	missense	362	10.62	43	SNP	0.999	T
TGFB3	7043	genome.wustl.edu	37	14	76437505	76437505	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr14:76437505C>T	ENST00000238682.3	-	3	907	c.610G>A	c.(610-612)Gtc>Atc	p.V204I	RP11-270M14.5_ENST00000553732.1_lincRNA|TGFB3_ENST00000556285.1_Missense_Mutation_p.V204I	NM_003239.2	NP_003230.1	P10600	TGFB3_HUMAN	transforming growth factor, beta 3	204					activation of MAPK activity (GO:0000187)|aging (GO:0007568)|blood coagulation (GO:0007596)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|detection of hypoxia (GO:0070483)|digestive tract development (GO:0048565)|embryonic neurocranium morphogenesis (GO:0048702)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|mammary gland development (GO:0030879)|menstrual cycle phase (GO:0022601)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|odontogenesis (GO:0042476)|ossification involved in bone remodeling (GO:0043932)|palate development (GO:0060021)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell division (GO:0051781)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|salivary gland morphogenesis (GO:0007435)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|T-tubule (GO:0030315)	identical protein binding (GO:0042802)|transforming growth factor beta binding (GO:0050431)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			NS(1)|breast(1)|endometrium(4)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.0169)		GTGTCAGTGACATCAAAGGAC	0.522																																						dbGAP											0													109.0	93.0	99.0					14																	76437505		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9846.1	14q24	2014-09-17				ENSG00000119699		"""Endogenous ligands"""	11769	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-3"""	190230	"""arrhythmogenic right ventricular dysplasia 1"""	ARVD1, ARVD		16549496, 15639475	Standard	XM_005268028		Approved		uc001xsc.2	P10600		ENST00000238682.3:c.610G>A	14.37:g.76437505C>T	ENSP00000238682:p.Val204Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WV88	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_TGF-beta,prints_Transform_grow_fac_b3,prints_TGF-beta	p.V204I	ENST00000238682.3	37	c.610	CCDS9846.1	14	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890991	0.91889	.	.	ENSG00000119699	ENST00000238682;ENST00000556285	T;T	0.70749	-0.51;-0.51	5.55	5.55	0.83447	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77136	0.4086	M	0.61703	1.905	0.80722	D	1	P	0.48503	0.911	P	0.49561	0.615	T	0.78568	-0.2154	10	0.56958	D	0.05	-11.4624	19.5099	0.95137	0.0:1.0:0.0:0.0	.	204	P10600	TGFB3_HUMAN	I	204	ENSP00000238682:V204I;ENSP00000451110:V204I	ENSP00000238682:V204I	V	-	1	0	TGFB3	75507258	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	5.757000	0.68766	2.627000	0.88993	0.561000	0.74099	GTC	TGFB3	-	pfam_TGF-b_N,pirsf_TGF-beta,prints_TGF-beta	ENSG00000119699		0.522	TGFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB3	HGNC	protein_coding	OTTHUMT00000413685.1	115	0.85	1	C	NM_003239		76437505	76437505	-1	no_errors	ENST00000238682	ensembl	human	known	69_37n	missense	23	47.73	21	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577031	7577031	+	Frame_Shift_Del	DEL	T	T	-	rs587782391		TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr17:7577031delT	ENST00000269305.4	-	8	1096	c.907delA	c.(907-909)agcfs	p.S303fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.S303fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.S303fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.S303fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.S303fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	303	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		S -> C (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> N (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.S303C(2)|p.P301_S303delPGS(1)|p.L265_K305del41(1)|p.G302fs*2(1)|p.G293fs*1(1)|p.H296_S303delHHELPPGS(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCTTAGTGCTCCCTGGGGGC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	18	Whole gene deletion(8)|Unknown(3)|Deletion - In frame(3)|Substitution - Missense(2)|Deletion - Frameshift(2)	bone(5)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|central_nervous_system(2)|stomach(1)|urinary_tract(1)|lung(1)|oesophagus(1)|prostate(1)											114.0	100.0	105.0					17																	7577031		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.907delA	17.37:g.7577031delT	ENSP00000269305:p.Ser303fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S303fs	ENST00000269305.4	37	c.907	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	269	0.00	0	T	NM_000546		7577031	7577031	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	45	49.52	52	DEL	1.000	-
TRIM51	84767	genome.wustl.edu	37	11	55653610	55653610	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr11:55653610delA	ENST00000449290.2	+	3	515	c.423delA	c.(421-423)ctafs	p.L141fs	TRIM51_ENST00000244891.3_5'UTR	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	141						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										AGGAGCTCCTAAAAAAAATGC	0.403																																						dbGAP											0										1,23,4240		0,0,1,10,3,2118	50.0	47.0	48.0				0.0	11		48	1,23,8230		0,0,1,8,7,4111	no	codingComplex	SPRYD5	NM_032681.3		0,0,2,18,10,6229	A1A1,A1A2,A1R,A2A2,A2R,RR		0.2908,0.5629,0.3834			55653610	2,46,12470	692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.423delA	11.37:g.55653610delA	ENSP00000395086:p.Leu141fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMG2	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.M144fs	ENST00000449290.2	37	c.423		11																																																																																			TRIM51	-	NULL	ENSG00000124900		0.403	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	TRIM51	HGNC	protein_coding	OTTHUMT00000391522.1	71	0.00	0	A	NM_032681		55653610	55653610	+1	no_errors	ENST00000449290	ensembl	human	known	69_37n	frame_shift_del	117	12.32	17	DEL	0.001	-
TRIM67	440730	genome.wustl.edu	37	1	231344720	231344720	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr1:231344720C>G	ENST00000366653.5	+	8	1847	c.1847C>G	c.(1846-1848)tCt>tGt	p.S616C	TRIM67_ENST00000444294.3_Missense_Mutation_p.S614C|TRIM67_ENST00000449018.3_Missense_Mutation_p.S554C|TRIM67_ENST00000366652.2_Missense_Mutation_p.S616C			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	616	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GACCCCAACTCTGGGCATCGG	0.547																																						dbGAP											0													94.0	100.0	98.0					1																	231344720		2080	4228	6308	-	-	-	SO:0001583	missense	0			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1847C>G	1.37:g.231344720C>G	ENSP00000355613:p.Ser616Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.S616C	ENST00000366653.5	37	c.1847	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703439	0.88924	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88	5.73	5.73	0.89815	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.239256	0.43110	D	0.000616	T	0.81706	0.4879	M	0.76574	2.34	0.46396	D	0.999026	D	0.62365	0.991	P	0.51866	0.682	T	0.78568	-0.2154	10	0.27785	T	0.31	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	616	Q6ZTA4	TRI67_HUMAN	C	614;616;554;616	ENSP00000412124:S614C;ENSP00000355612:S616C;ENSP00000400163:S554C;ENSP00000355613:S616C	ENSP00000355612:S616C	S	+	2	0	TRIM67	229411343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.804000	0.62554	2.854000	0.98071	0.655000	0.94253	TCT	TRIM67	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY	ENSG00000119283		0.547	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	150	0.00	0	C	NM_001004342		231344720	231344720	+1	no_errors	ENST00000366652	ensembl	human	known	69_37n	missense	75	33.04	37	SNP	1.000	G
TRRAP	8295	genome.wustl.edu	37	7	98528369	98528369	+	Silent	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:98528369G>A	ENST00000359863.4	+	25	3716	c.3507G>A	c.(3505-3507)gaG>gaA	p.E1169E	TRRAP_ENST00000446306.3_Silent_p.E1168E|TRRAP_ENST00000355540.3_Silent_p.E1169E	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1169					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTCTCATGGAGCGGCTGCCTC	0.507																																						dbGAP											0													117.0	119.0	119.0					7																	98528369		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3507G>A	7.37:g.98528369G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S884N	ENST00000359863.4	37	c.2651	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	G	9.564	1.119174	0.20877	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.58	4.47	0.54385	.	.	.	.	.	T	0.56804	0.2010	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52968	-0.8504	4	.	.	.	.	7.1053	0.25360	0.2388:0.0:0.7612:0.0	.	.	.	.	N	884	.	.	S	+	2	0	TRRAP	98366305	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.266000	0.58871	2.781000	0.95711	0.591000	0.81541	AGC	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.507	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	200	0.00	0	G	NM_003496		98528369	98528369	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000456197	ensembl	human	novel	69_37n	missense	67	54.05	80	SNP	1.000	A
TRPV6	55503	genome.wustl.edu	37	7	142573589	142573589	+	Silent	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:142573589G>C	ENST00000359396.3	-	7	1076	c.831C>G	c.(829-831)ctC>ctG	p.L277L	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	277					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TGAGGTCATAGAGAGTCGAGG	0.532																																						dbGAP											0													208.0	160.0	176.0					7																	142573589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.831C>G	7.37:g.142573589G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Silent	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6_channel,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.L277	ENST00000359396.3	37	c.831	CCDS5874.1	7																																																																																			TRPV6	-	tigrfam_TRP_channel	ENSG00000165125		0.532	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1	198	0.00	0	G	NM_014274		142573589	142573589	-1	no_errors	ENST00000359396	ensembl	human	known	69_37n	silent	114	24.00	36	SNP	0.901	C
TSPEAR	54084	genome.wustl.edu	37	21	45948407	45948407	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr21:45948407G>T	ENST00000323084.4	-	6	915	c.850C>A	c.(850-852)Cag>Aag	p.Q284K	TSPEAR_ENST00000397916.1_Missense_Mutation_p.Q216K	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	284					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						AACCAGAACTGGGCGTCTTCC	0.597																																						dbGAP											0													144.0	120.0	128.0					21																	45948407		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.850C>A	21.37:g.45948407G>T	ENSP00000321987:p.Gln284Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_EAR	p.Q284K	ENST00000323084.4	37	c.850	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290677	0.40494	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000397916;ENST00000341581	T;T	0.39056	1.1;1.1	5.15	5.15	0.70609	.	0.110266	0.64402	D	0.000007	T	0.34658	0.0905	L	0.45137	1.4	0.53005	D	0.999965	B	0.29766	0.256	B	0.24155	0.051	T	0.13361	-1.0512	10	0.38643	T	0.18	-14.8285	13.5874	0.61940	0.0:0.0:0.8447:0.1553	.	284	Q8WU66	TSEAR_HUMAN	K	284;137;216;284	ENSP00000321987:Q284K;ENSP00000381012:Q216K	ENSP00000321987:Q284K	Q	-	1	0	TSPEAR	44772835	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	5.581000	0.67471	2.397000	0.81536	0.561000	0.74099	CAG	TSPEAR	-	NULL	ENSG00000175894		0.597	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	52	0.00	0	G	NM_144991		45948407	45948407	-1	no_errors	ENST00000323084	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	1.000	T
UBA7	7318	genome.wustl.edu	37	3	49845531	49845531	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:49845531G>T	ENST00000333486.3	-	20	2603	c.2445C>A	c.(2443-2445)aaC>aaA	p.N815K	MIR5193_ENST00000584510.1_RNA	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	815					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCACATGGAAGTTGCTGTCAT	0.557																																						dbGAP											0													96.0	89.0	91.0					3																	49845531		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.2445C>A	3.37:g.49845531G>T	ENSP00000333266:p.Asn815Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRB2	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_UBact_repeat,pfam_Ub-activating_enz_e1_C,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.N815K	ENST00000333486.3	37	c.2445	CCDS2805.1	3	.	.	.	.	.	.	.	.	.	.	G	16.83	3.229957	0.58777	.	.	ENSG00000182179	ENST00000333486	T	0.46451	0.87	5.01	2.23	0.28157	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.316790	0.34088	N	0.004265	T	0.67183	0.2866	M	0.91300	3.195	0.53688	D	0.999976	D	0.76494	0.999	D	0.81914	0.995	T	0.69247	-0.5195	10	0.87932	D	0	-19.4173	9.5446	0.39273	0.3363:0.0:0.6637:0.0	.	815	P41226	UBA7_HUMAN	K	815	ENSP00000333266:N815K	ENSP00000333266:N815K	N	-	3	2	UBA7	49820535	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	2.246000	0.43142	0.254000	0.21573	-0.258000	0.10820	AAC	UBA7	-	pfam_UBact_repeat,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000182179		0.557	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA7	HGNC	protein_coding	OTTHUMT00000350503.1	28	0.00	0	G	NM_003335		49845531	49845531	-1	no_errors	ENST00000333486	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	144837401	144837401	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr6:144837401G>T	ENST00000367545.3	+	37	5281	c.5281G>T	c.(5281-5283)Gtc>Ttc	p.V1761F		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1761	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CCAATGTTTGGTCACCACTGA	0.318																																						dbGAP											0													71.0	76.0	74.0					6																	144837401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.5281G>T	6.37:g.144837401G>T	ENSP00000356515:p.Val1761Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.V1761F	ENST00000367545.3	37	c.5281	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333440	0.41297	.	.	ENSG00000152818	ENST00000367545	T	0.60424	0.19	5.4	4.53	0.55603	.	0.660684	0.12537	N	0.460298	T	0.27765	0.0683	L	0.36672	1.1	0.25423	N	0.988254	B	0.33448	0.412	B	0.30855	0.121	T	0.17137	-1.0379	10	0.56958	D	0.05	.	8.8915	0.35437	0.0786:0.1499:0.7715:0.0	.	1761	P46939	UTRO_HUMAN	F	1761	ENSP00000356515:V1761F	ENSP00000356515:V1761F	V	+	1	0	UTRN	144879094	0.790000	0.28787	0.097000	0.21041	0.381000	0.30169	2.580000	0.46068	1.413000	0.46997	0.655000	0.94253	GTC	UTRN	-	pirsf_Dystrophin/utrophin	ENSG00000152818		0.318	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	66	0.00	0	G			144837401	144837401	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	missense	104	23.53	32	SNP	0.097	T
VPS8	23355	genome.wustl.edu	37	3	184577834	184577834	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr3:184577834A>G	ENST00000437079.3	+	15	1376	c.1205A>G	c.(1204-1206)tAt>tGt	p.Y402C	VPS8_ENST00000287546.4_Missense_Mutation_p.Y402C|VPS8_ENST00000446204.2_Missense_Mutation_p.Y400C|VPS8_ENST00000436792.2_Missense_Mutation_p.Y400C	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	402							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CACCTATACTATGACCTCATC	0.323																																						dbGAP											0													134.0	118.0	123.0					3																	184577834		1859	4090	5949	-	-	-	SO:0001583	missense	0			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.1205A>G	3.37:g.184577834A>G	ENSP00000397879:p.Tyr402Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y402C	ENST00000437079.3	37	c.1205	CCDS46971.1	3	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089419	0.55968	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	4.77	4.77	0.60923	.	0.055819	0.85682	D	0.000000	T	0.17323	0.0416	L	0.33485	1.01	0.40848	D	0.983725	B;B	0.23249	0.022;0.082	B;B	0.22386	0.02;0.039	T	0.04752	-1.0929	10	0.37606	T	0.19	0.4072	13.0183	0.58771	1.0:0.0:0.0:0.0	.	400;400	Q8N3P4-2;Q8N3P4-3	.;.	C	402;402;400;400	ENSP00000287546:Y402C;ENSP00000397879:Y402C;ENSP00000404704:Y400C;ENSP00000405483:Y400C	ENSP00000287546:Y402C	Y	+	2	0	VPS8	186060528	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.059000	0.71133	2.010000	0.58986	0.482000	0.46254	TAT	VPS8	-	superfamily_Quinonprotein_ADH-like	ENSG00000156931		0.323	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	HGNC	protein_coding		66	0.00	0	A	NM_015303		184577834	184577834	+1	no_errors	ENST00000287546	ensembl	human	known	69_37n	missense	59	36.56	34	SNP	1.000	G
WNT8B	7479	genome.wustl.edu	37	10	102239712	102239712	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr10:102239712C>T	ENST00000343737.5	+	3	312	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	62					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		TGCCTGGGACCGCTGGAACTG	0.562																																						dbGAP											0													84.0	78.0	80.0					10																	102239712		2203	4300	6503	-	-	-	SO:0001583	missense	0			X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.184C>T	10.37:g.102239712C>T	ENSP00000340677:p.Arg62Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt8	p.R62C	ENST00000343737.5	37	c.184	CCDS7494.1	10	.	.	.	.	.	.	.	.	.	.	C	15.16	2.752177	0.49362	.	.	ENSG00000075290	ENST00000343737	T	0.81163	-1.46	5.54	4.64	0.57946	.	0.046712	0.85682	D	0.000000	D	0.92420	0.7594	H	0.98005	4.125	0.58432	D	0.999999	D	0.76494	0.999	D	0.71414	0.973	D	0.93147	0.6546	10	0.87932	D	0	.	9.3458	0.38107	0.1431:0.7845:0.0:0.0724	.	62	Q93098	WNT8B_HUMAN	C	62	ENSP00000340677:R62C	ENSP00000340677:R62C	R	+	1	0	WNT8B	102229702	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	4.513000	0.60476	1.349000	0.45751	-0.266000	0.10368	CGC	WNT8B	-	pfam_Wnt,smart_Wnt	ENSG00000075290		0.562	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT8B	HGNC	protein_coding	OTTHUMT00000049867.1	190	0.00	0	C	NM_003393		102239712	102239712	+1	no_errors	ENST00000343737	ensembl	human	known	69_37n	missense	70	25.53	24	SNP	1.000	T
ZC3HC1	51530	genome.wustl.edu	37	7	129663533	129663533	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr7:129663533G>A	ENST00000358303.4	-	8	1135	c.1051C>T	c.(1051-1053)Cga>Tga	p.R351*	ZC3HC1_ENST00000481503.1_Nonsense_Mutation_p.R308*|RP11-306G20.1_ENST00000587038.1_RNA|ZC3HC1_ENST00000311873.5_Nonsense_Mutation_p.R330*|ZC3HC1_ENST00000360708.5_Intron|RP11-306G20.1_ENST00000480018.1_RNA	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	351					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					CTCCGAGTTCGAGAGACAATG	0.512																																					Melanoma(115;540 1606 16325 28853 48167)	dbGAP											0													67.0	62.0	64.0					7																	129663533		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.1051C>T	7.37:g.129663533G>A	ENSP00000351052:p.Arg351*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Nonsense_Mutation	SNP	pfam_Znf_C3HC-like,pfam_NIPA/Rsm1	p.R351*	ENST00000358303.4	37	c.1051	CCDS34753.1	7	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305782	0.81247	.	.	ENSG00000091732	ENST00000358303;ENST00000311873;ENST00000481503	.	.	.	5.49	3.59	0.41128	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.802	12.559	0.56271	0.0:0.0:0.5483:0.4517	.	.	.	.	X	351;330;308	.	ENSP00000309301:R330X	R	-	1	2	ZC3HC1	129450769	0.997000	0.39634	0.999000	0.59377	0.984000	0.73092	2.978000	0.49305	1.297000	0.44761	0.563000	0.77884	CGA	ZC3HC1	-	NULL	ENSG00000091732		0.512	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HC1	HGNC	protein_coding	OTTHUMT00000349316.1	76	0.00	0	G	NM_016478		129663533	129663533	-1	no_errors	ENST00000358303	ensembl	human	known	69_37n	nonsense	70	36.94	41	SNP	0.951	A
ZFP37	7539	genome.wustl.edu	37	9	115818872	115818872	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr9:115818872C>G	ENST00000374227.3	-	1	124	c.97G>C	c.(97-99)Gag>Cag	p.E33Q	ZFP37_ENST00000553380.1_Missense_Mutation_p.E33Q|ZFP37_ENST00000555206.1_Missense_Mutation_p.E33Q	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	33	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						ACAGCCATCTCCAGTGGTCGC	0.622																																						dbGAP											0													157.0	163.0	161.0					9																	115818872		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.97G>C	9.37:g.115818872C>G	ENSP00000363344:p.Glu33Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E33Q	ENST00000374227.3	37	c.97	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	c	16.74	3.207240	0.58343	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.05786	3.44;3.39;3.48	3.42	2.52	0.30459	Krueppel-associated box (2);	.	.	.	.	T	0.04407	0.0121	N	0.08118	0	0.22305	N	0.999214	D;D;P	0.55385	0.971;0.971;0.952	P;P;B	0.46026	0.501;0.501;0.305	T	0.38929	-0.9638	9	0.72032	D	0.01	2.0461	6.837	0.23941	0.0:0.8734:0.0:0.1266	.	33;33;33	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	Q	33	ENSP00000363344:E33Q;ENSP00000451310:E33Q;ENSP00000452552:E33Q	ENSP00000363344:E33Q	E	-	1	0	ZFP37	114858693	0.015000	0.18098	0.701000	0.30321	0.126000	0.20510	0.043000	0.13971	1.009000	0.39289	0.651000	0.88453	GAG	ZFP37	-	NULL	ENSG00000136866		0.622	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	HGNC	protein_coding	OTTHUMT00000055439.1	200	0.00	0	C	NM_003408		115818872	115818872	-1	no_errors	ENST00000553380	ensembl	human	known	69_37n	missense	91	10.78	11	SNP	0.716	G
ZNF714	148206	genome.wustl.edu	37	19	21299680	21299680	+	Silent	SNP	G	G	C			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:21299680G>C	ENST00000596143.1	+	5	535	c.210G>C	c.(208-210)gtG>gtC	p.V70V	ZNF714_ENST00000596053.1_Intron|ZNF714_ENST00000601416.1_Missense_Mutation_p.D77H|ZNF714_ENST00000291770.7_3'UTR	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	70					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V70V(1)|p.V175V(1)		endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						TTCAACAAGTGATACTGAGAA	0.353																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											67.0	67.0	67.0					19																	21299680		2193	4299	6492	-	-	-	SO:0001819	synonymous_variant	0			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.210G>C	19.37:g.21299680G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AI1|Q86W65|Q8ND40	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V70	ENST00000596143.1	37	c.210	CCDS54239.1	19																																																																																			ZNF714	-	NULL	ENSG00000160352		0.353	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF714	HGNC	protein_coding	OTTHUMT00000463930.1	143	0.00	0	G	NM_182515		21299680	21299680	+1	no_errors	ENST00000291770	ensembl	human	known	69_37n	silent	111	44.50	89	SNP	0.006	C
ZNF526	116115	genome.wustl.edu	37	19	42730170	42730170	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RE-01A-11W-A071-09	TCGA-B6-A0RE-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	db2bd5cf-f0a7-4874-89eb-15029447dae1	21d6d4ec-23c7-470d-8654-59d20f56c9a6	g.chr19:42730170C>G	ENST00000301215.3	+	3	1840	c.1615C>G	c.(1615-1617)Cag>Gag	p.Q539E		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				GCGCTTCACACAGAGCTCCAA	0.627																																						dbGAP											0													67.0	63.0	64.0					19																	42730170		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1615C>G	19.37:g.42730170C>G	ENSP00000301215:p.Gln539Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q539E	ENST00000301215.3	37	c.1615	CCDS12598.1	19	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240393	0.79912	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.61040	0.14	4.76	4.76	0.60689	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.180058	0.36665	N	0.002473	T	0.68165	0.2971	L	0.41415	1.275	0.37428	D	0.913892	D	0.76494	0.999	D	0.72625	0.978	T	0.71735	-0.4503	10	0.48119	T	0.1	-20.4891	17.0738	0.86581	0.0:1.0:0.0:0.0	.	539	Q8TF50	ZN526_HUMAN	E	395;539	ENSP00000301215:Q539E	ENSP00000301215:Q539E	Q	+	1	0	ZNF526	47422010	0.443000	0.25641	0.964000	0.40570	0.984000	0.73092	1.593000	0.36686	2.644000	0.89710	0.561000	0.74099	CAG	ZNF526	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167625		0.627	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF526	HGNC	protein_coding	OTTHUMT00000463681.2	86	0.00	0	C	XM_057401		42730170	42730170	+1	no_errors	ENST00000301215	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.998	G
