#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
C11orf85	283129	genome.wustl.edu	37	11	64715283	64715283	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr11:64715283T>C	ENST00000301896.5	-	7	431	c.358A>G	c.(358-360)Ata>Gta	p.I120V	C11orf85_ENST00000530444.1_Intron|C11orf85_ENST00000432175.1_Missense_Mutation_p.I120V|C11orf85_ENST00000536065.1_Missense_Mutation_p.I14V	NM_001037225.1	NP_001032302.1	Q3KP22	CK085_HUMAN	chromosome 11 open reading frame 85	120								p.I120V(1)		breast(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	7						CTGTCACTTATTGGTTTCCCT	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	74.0	75.0					11																	64715283		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK093130, BC033501	CCDS31603.1, CCDS73316.1	11q13.1	2012-08-10			ENSG00000168070	ENSG00000168070			27441	protein-coding gene	gene with protein product						14702039	Standard	XM_005273918		Approved		uc001ocb.1	Q3KP22		ENST00000301896.5:c.358A>G	11.37:g.64715283T>C	ENSP00000301896:p.Ile120Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS99	Missense_Mutation	SNP	NULL	p.I120V	ENST00000301896.5	37	c.358	CCDS31603.1	11	.	.	.	.	.	.	.	.	.	.	T	5.871	0.344838	0.11126	.	.	ENSG00000168070	ENST00000536065;ENST00000301896;ENST00000432175	.	.	.	4.77	-9.54	0.00572	.	1.319830	0.04931	N	0.456863	T	0.26774	0.0655	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48833	-0.9000	9	0.02654	T	1	-24.1916	15.8796	0.79193	0.0:0.7157:0.1116:0.1727	.	120	Q3KP22	CK085_HUMAN	V	14;120;120	.	ENSP00000301896:I120V	I	-	1	0	C11orf85	64471859	0.000000	0.05858	0.000000	0.03702	0.340000	0.28889	-2.050000	0.01404	-2.194000	0.00753	-2.519000	0.00185	ATA	C11orf85	-	NULL	ENSG00000168070		0.358	C11orf85-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf85	HGNC	protein_coding	OTTHUMT00000385477.1	88	0.00	0	T	NM_001037225		64715283	64715283	-1	no_errors	ENST00000301896	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	0.000	C
COL4A2	1284	genome.wustl.edu	37	13	111132707	111132707	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr13:111132707G>C	ENST00000360467.5	+	31	3034	c.2728G>C	c.(2728-2730)Gat>Cat	p.D910H		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	910	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TAAAGGAATTGATGGAATGCC	0.552																																						dbGAP											0													53.0	59.0	57.0					13																	111132707		1898	4111	6009	-	-	-	SO:0001583	missense	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.2728G>C	13.37:g.111132707G>C	ENSP00000353654:p.Asp910His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.D910H	ENST00000360467.5	37	c.2728	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	8.186	0.794896	0.16327	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93859	-3.3	4.84	-7.08	0.01558	.	3.733170	0.00738	N	0.000986	D	0.93766	0.8007	L	0.56280	1.765	0.09310	N	1	D	0.69078	0.997	D	0.72075	0.976	D	0.86939	0.2078	10	0.56958	D	0.05	.	2.6935	0.05127	0.3736:0.2019:0.3315:0.0931	.	910	P08572	CO4A2_HUMAN	H	910	ENSP00000353654:D910H	ENSP00000257309:D910H	D	+	1	0	COL4A2	109930708	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-0.050000	0.11904	-1.356000	0.02183	-0.502000	0.04539	GAT	COL4A2	-	pfam_Collagen	ENSG00000134871		0.552	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2	98	0.00	0	G	NM_001846		111132707	111132707	+1	no_errors	ENST00000360467	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	0.000	C
GPR173	54328	genome.wustl.edu	37	X	53106370	53106370	+	Silent	SNP	C	C	T			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chrX:53106370C>T	ENST00000332582.4	+	2	1058	c.567C>T	c.(565-567)ttC>ttT	p.F189F		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	189					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)	p.F189F(2)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						CGCTGGGCTTCATGCTTATGT	0.537																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											42.0	40.0	41.0					X																	53106370		2200	4298	6498	-	-	-	SO:0001819	synonymous_variant	0			AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.567C>T	X.37:g.53106370C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0A5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.F189	ENST00000332582.4	37	c.567	CCDS14349.1	X																																																																																			GPR173	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184194		0.537	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR173	HGNC	protein_coding	OTTHUMT00000056717.2	40	0.00	0	C	NM_018969		53106370	53106370	+1	no_errors	ENST00000332582	ensembl	human	known	69_37n	silent	73	10.98	9	SNP	1.000	T
FATE1	89885	genome.wustl.edu	37	X	150890415	150890415	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chrX:150890415G>C	ENST00000370350.3	+	4	467	c.382G>C	c.(382-384)Gag>Cag	p.E128Q		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.E128Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					TAGCCTGGAAGAGTTCAATGT	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											182.0	160.0	168.0					X																	150890415		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.382G>C	X.37:g.150890415G>C	ENSP00000359375:p.Glu128Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.E128Q	ENST00000370350.3	37	c.382	CCDS14700.1	X	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713783	0.30413	.	.	ENSG00000147378	ENST00000370350	T	0.57107	0.42	4.34	3.47	0.39725	.	0.295883	0.24474	N	0.038213	T	0.52693	0.1750	L	0.34521	1.04	0.22675	N	0.998863	D	0.63046	0.992	P	0.59221	0.854	T	0.39187	-0.9626	10	0.56958	D	0.05	-10.8065	7.3105	0.26471	0.1239:0.0:0.8761:0.0	.	128	Q969F0	FATE1_HUMAN	Q	128	ENSP00000359375:E128Q	ENSP00000359375:E128Q	E	+	1	0	FATE1	150641071	0.933000	0.31639	0.641000	0.29422	0.112000	0.19704	2.579000	0.46059	0.978000	0.38470	0.529000	0.55759	GAG	FATE1	-	pfam_FATE/Miff/Tango-11	ENSG00000147378		0.547	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	203	0.00	0	G	NM_033085		150890415	150890415	+1	no_errors	ENST00000370350	ensembl	human	known	69_37n	missense	186	17.70	40	SNP	0.572	C
GYLTL1B	120071	genome.wustl.edu	37	11	45945056	45945056	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr11:45945056T>G	ENST00000531526.1	+	3	429	c.318T>G	c.(316-318)caT>caG	p.H106Q	GYLTL1B_ENST00000529052.1_Missense_Mutation_p.H75Q|GYLTL1B_ENST00000401752.1_Missense_Mutation_p.H106Q|GYLTL1B_ENST00000389968.3_De_novo_Start_OutOfFrame|GYLTL1B_ENST00000325468.5_Missense_Mutation_p.H106Q|GYLTL1B_ENST00000536139.1_Missense_Mutation_p.H75Q	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	106					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.H106Q(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		GTGCGGGGCATAACTCCAGCC	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	111.0	121.0					11																	45945056		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	ENST00000531526.1:c.318T>G	11.37:g.45945056T>G	ENSP00000432869:p.His106Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.H106Q	ENST00000531526.1	37	c.318	CCDS31473.1	11	.	.	.	.	.	.	.	.	.	.	T	15.45	2.838110	0.50951	.	.	ENSG00000165905	ENST00000529052;ENST00000531526;ENST00000401752;ENST00000325468;ENST00000536139	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	5.41	-4.93	0.03066	.	0.551742	0.18071	N	0.152633	T	0.16214	0.0390	L	0.47716	1.5	0.80722	D	1	B;B	0.13145	0.007;0.006	B;B	0.15870	0.014;0.014	T	0.03278	-1.1053	10	0.54805	T	0.06	-3.4371	12.1703	0.54155	0.0:0.6663:0.1147:0.219	.	75;106	E9PIZ2;Q8N3Y3	.;LARG2_HUMAN	Q	75;106;106;106;75	ENSP00000431932:H75Q;ENSP00000432869:H106Q;ENSP00000385235:H106Q;ENSP00000324570:H106Q;ENSP00000445044:H75Q	ENSP00000324570:H106Q	H	+	3	2	GYLTL1B	45901632	0.748000	0.28294	0.182000	0.23118	0.511000	0.34104	0.027000	0.13621	-0.824000	0.04295	-0.250000	0.11733	CAT	GYLTL1B	-	NULL	ENSG00000165905		0.627	GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GYLTL1B	HGNC	protein_coding	OTTHUMT00000392572.1	64	0.00	0	T	NM_152312		45945056	45945056	+1	no_errors	ENST00000325468	ensembl	human	known	69_37n	missense	74	12.94	11	SNP	0.886	G
HSPA12B	116835	genome.wustl.edu	37	20	3721471	3721471	+	Missense_Mutation	SNP	C	C	T	rs199871927		TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr20:3721471C>T	ENST00000254963.2	+	3	198	c.53C>T	c.(52-54)cCg>cTg	p.P18L	HSPA12B_ENST00000542646.1_Intron	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	18							ATP binding (GO:0005524)	p.P18L(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						GGCTCCAGCCCGGAGCGGTCC	0.657																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	37.0	37.0					20																	3721471		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.53C>T	20.37:g.3721471C>T	ENSP00000254963:p.Pro18Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVX7|Q2TAK3|Q9BR52	Missense_Mutation	SNP	NULL	p.P18L	ENST00000254963.2	37	c.53	CCDS13061.1	20	.	.	.	.	.	.	.	.	.	.	C	17.25	3.340698	0.60963	.	.	ENSG00000132622	ENST00000254963	T	0.03004	4.08	4.3	3.28	0.37604	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	0.80722	D	1	D;D	0.55800	0.973;0.973	P;P	0.49708	0.62;0.62	T	0.62992	-0.6736	9	0.28530	T	0.3	.	9.5953	0.39569	0.0:0.7862:0.2138:0.0	.	18;18	B7ZLP2;Q96MM6	.;HS12B_HUMAN	L	18	ENSP00000254963:P18L	ENSP00000254963:P18L	P	+	2	0	HSPA12B	3669471	0.930000	0.31532	0.996000	0.52242	0.730000	0.41778	2.790000	0.47821	2.402000	0.81655	0.655000	0.94253	CCG	HSPA12B	-	NULL	ENSG00000132622		0.657	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12B	HGNC	protein_coding	OTTHUMT00000077756.2	40	0.00	0	C	NM_052970		3721471	3721471	+1	no_errors	ENST00000254963	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.883	T
KCNH6	81033	genome.wustl.edu	37	17	61619707	61619707	+	Frame_Shift_Del	DEL	G	G	-	rs374221331		TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr17:61619707delG	ENST00000583023.1	+	9	2071	c.2060delG	c.(2059-2061)cggfs	p.R687fs	KCNH6_ENST00000581784.1_Frame_Shift_Del_p.R634fs|KCNH6_ENST00000314672.5_Frame_Shift_Del_p.R687fs|KCNH6_ENST00000456941.2_Frame_Shift_Del_p.R634fs	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	687					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.A688fs*99(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AAGATCCAGCGGGCAGATCTG	0.607																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											103.0	87.0	93.0					17																	61619707		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2060delG	17.37:g.61619707delG	ENSP00000463533:p.Arg687fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRD7	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.A688fs	ENST00000583023.1	37	c.2060	CCDS11638.1	17																																																																																			KCNH6	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000173826		0.607	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	77	0.00	0	G	NM_030779		61619707	61619707	+1	no_errors	ENST00000583023	ensembl	human	known	69_37n	frame_shift_del	90	16.67	18	DEL	1.000	-
MXRA5	25878	genome.wustl.edu	37	X	3228364	3228364	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chrX:3228364C>T	ENST00000217939.6	-	7	8034	c.7880G>A	c.(7879-7881)aGg>aAg	p.R2627K		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2627	Ig-like C2-type 10.					extracellular vesicular exosome (GO:0070062)		p.R2627K(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GGAGACCAGCCTCTCCGTGTG	0.602																																						dbGAP											2	Substitution - Missense(2)	breast(2)											31.0	30.0	31.0					X																	3228364		2194	4282	6476	-	-	-	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7880G>A	X.37:g.3228364C>T	ENSP00000217939:p.Arg2627Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R2627K	ENST00000217939.6	37	c.7880	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	C	13.02	2.112952	0.37242	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.64260	-0.09	4.23	4.23	0.50019	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34750	U	0.003706	T	0.60248	0.2254	L	0.39397	1.21	0.25459	N	0.987933	P	0.44776	0.843	P	0.53549	0.729	T	0.49808	-0.8900	10	0.12766	T	0.61	.	10.0589	0.42261	0.0:0.9036:0.0:0.0964	.	2627	Q9NR99	MXRA5_HUMAN	K	2627	ENSP00000217939:R2627K	ENSP00000217939:R2627K	R	-	2	0	MXRA5	3238364	0.910000	0.30920	0.412000	0.26496	0.006000	0.05464	2.360000	0.44151	1.736000	0.51660	0.597000	0.82753	AGG	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000101825		0.602	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	30	0.00	0	C	NM_015419		3228364	3228364	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	missense	59	13.24	9	SNP	0.855	T
NLRP13	126204	genome.wustl.edu	37	19	56423854	56423854	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr19:56423854G>C	ENST00000342929.3	-	5	1328	c.1329C>G	c.(1327-1329)taC>taG	p.Y443*	NLRP13_ENST00000588751.1_Nonsense_Mutation_p.Y443*	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	443	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)	p.Y443Y(1)|p.Y443*(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ACTGGAGATCGTAATACCTCA	0.478																																						dbGAP											2	Substitution - Nonsense(1)|Substitution - coding silent(1)	breast(2)											101.0	102.0	102.0					19																	56423854		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1329C>G	19.37:g.56423854G>C	ENSP00000343891:p.Tyr443*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTR5	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Y443*	ENST00000342929.3	37	c.1329	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452369	0.43531	.	.	ENSG00000173572	ENST00000342929	.	.	.	2.55	-5.1	0.02911	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	6.6915	0.23174	0.1926:0.3134:0.4939:0.0	.	.	.	.	X	443	.	ENSP00000343891:Y443X	Y	-	3	2	NLRP13	61115666	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.597000	0.00210	-1.778000	0.01282	-1.239000	0.01543	TAC	NLRP13	-	NULL	ENSG00000173572		0.478	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	79	0.00	0	G	NM_176810		56423854	56423854	-1	no_errors	ENST00000342929	ensembl	human	known	69_37n	nonsense	82	10.87	10	SNP	0.000	C
TMEM57	55219	genome.wustl.edu	37	1	25785067	25785067	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr1:25785067G>C	ENST00000374343.4	+	6	1017	c.838G>C	c.(838-840)Gac>Cac	p.D280H	TMEM57_ENST00000399766.3_Intron|TMEM57_ENST00000399763.3_Intron|TMEM57_ENST00000470035.1_3'UTR	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	280					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)		p.D280H(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		ACAACCTGTAGACTCTAAAAT	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	99.0	97.0					1																	25785067		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.838G>C	1.37:g.25785067G>C	ENSP00000363463:p.Asp280His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Missense_Mutation	SNP	pfam_Macoilin,superfamily_Prefoldin	p.D280H	ENST00000374343.4	37	c.838	CCDS30638.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200187	0.79015	.	.	ENSG00000204178	ENST00000374343	T	0.14144	2.53	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.40171	0.1106	M	0.75264	2.295	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.06232	-1.0838	10	0.52906	T	0.07	-18.6623	19.0021	0.92838	0.0:0.0:1.0:0.0	.	280	Q8N5G2	MACOI_HUMAN	H	280	ENSP00000363463:D280H	ENSP00000363463:D280H	D	+	1	0	TMEM57	25657654	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.444000	0.97578	2.724000	0.93272	0.563000	0.77884	GAC	TMEM57	-	pfam_Macoilin	ENSG00000204178		0.323	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	HGNC	protein_coding	OTTHUMT00000009659.2	142	0.00	0	G	NM_018202		25785067	25785067	+1	no_errors	ENST00000374343	ensembl	human	known	69_37n	missense	63	10.00	7	SNP	1.000	C
TARBP1	6894	genome.wustl.edu	37	1	234565071	234565071	+	Splice_Site	SNP	C	C	A			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr1:234565071C>A	ENST00000040877.1	-	17	2871		c.e17-1			NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1						regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.?(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AAGTCAGAAGCTGGTAGGAAA	0.363																																						dbGAP											1	Unknown(1)	breast(1)											44.0	48.0	47.0					1																	234565071		2199	4298	6497	-	-	-	SO:0001630	splice_region_variant	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.2872-1G>T	1.37:g.234565071C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H581	Splice_Site	SNP	-	e17-1	ENST00000040877.1	37	c.2872-1	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834308	0.50951	.	.	ENSG00000059588	ENST00000040877	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9274	0.97108	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TARBP1	232631694	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	5.634000	0.67833	2.785000	0.95823	0.655000	0.94253	.	TARBP1	-	-	ENSG00000059588		0.363	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	77	0.00	0	C	NM_005646	Intron	234565071	234565071	-1	no_errors	ENST00000040877	ensembl	human	known	69_37n	splice_site	25	16.67	5	SNP	1.000	A
TNS1	7145	genome.wustl.edu	37	2	218712887	218712889	+	In_Frame_Del	DEL	GCT	GCT	-	rs375721540|rs574153391		TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr2:218712887_218712889delGCT	ENST00000171887.4	-	17	2428_2430	c.1976_1978delAGC	c.(1975-1980)cagcct>cct	p.Q659del	TNS1_ENST00000419504.1_In_Frame_Del_p.Q659del|TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000430930.1_In_Frame_Del_p.Q659del	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	659	Gln-rich.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGTGGGCGAGgctgctgctgctg	0.66																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1976_1978delAGC	2.37:g.218712896_218712898delGCT	ENSP00000171887:p.Gln659del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG71|Q6IPI5	In_Frame_Del	DEL	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.Q659in_frame_del	ENST00000171887.4	37	c.1978_1976	CCDS2407.1	2																																																																																			TNS1	-	NULL	ENSG00000079308		0.660	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	54	0.00	0	GCT	NM_022648		218712887	218712889	-1	no_errors	ENST00000171887	ensembl	human	known	69_37n	in_frame_del	32	11.11	4	DEL	1.000:1.000:0.994	-
WNT9A	7483	genome.wustl.edu	37	1	228113112	228113112	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0RT-01A-21D-A099-09	TCGA-B6-A0RT-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e1a297ed-1951-4d97-978c-56b452111ba5	61f83071-b7fd-4037-aaf2-1db0349d8238	g.chr1:228113112C>A	ENST00000272164.5	-	2	214	c.204G>T	c.(202-204)caG>caT	p.Q68H		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	68					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.Q68H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				ACATGCGCCGCTGCTTCCGCT	0.697																																						dbGAP											1	Substitution - Missense(1)	breast(1)											13.0	14.0	14.0					1																	228113112		2195	4295	6490	-	-	-	SO:0001583	missense	0			AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.204G>T	1.37:g.228113112C>A	ENSP00000272164:p.Gln68His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt14	p.Q68H	ENST00000272164.5	37	c.204	CCDS31045.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987875	0.74589	.	.	ENSG00000143816	ENST00000272164	T	0.79749	-1.3	4.91	0.875	0.19130	.	0.130025	0.53938	D	0.000044	D	0.89118	0.6624	M	0.92268	3.29	0.54753	D	0.999986	D	0.62365	0.991	P	0.61722	0.893	D	0.88160	0.2857	10	0.87932	D	0	.	9.978	0.41795	0.0:0.7498:0.0:0.2502	.	68	O14904	WNT9A_HUMAN	H	68	ENSP00000272164:Q68H	ENSP00000272164:Q68H	Q	-	3	2	WNT9A	226179735	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	2.657000	0.46724	-0.088000	0.12506	0.478000	0.44815	CAG	WNT9A	-	pfam_Wnt,smart_Wnt	ENSG00000143816		0.697	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT9A	HGNC	protein_coding	OTTHUMT00000091646.1	10	0.00	0	C	NM_003395		228113112	228113112	-1	no_errors	ENST00000272164	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.999	A
