#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALG10	84920	genome.wustl.edu	37	12	34177061	34177061	+	Nonsense_Mutation	SNP	T	T	G			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr12:34177061T>G	ENST00000266483.2	+	2	655	c.336T>G	c.(334-336)taT>taG	p.Y112*	ALG10_ENST00000538927.1_Nonsense_Mutation_p.Y112*|RP11-847H18.2_ENST00000501954.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	112					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)	p.Y112*(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				ATTTACTATATTTGCTTTTCT	0.353																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											205.0	199.0	201.0					12																	34177061		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.336T>G	12.37:g.34177061T>G	ENSP00000266483:p.Tyr112*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NS98|Q96DU0|Q96SM6	Nonsense_Mutation	SNP	pfam_Glycosyltransferase_ALG10,pirsf_Alpha1_2_glucosyltferase_Alg10	p.Y112*	ENST00000266483.2	37	c.336	CCDS41769.1	12	.	.	.	.	.	.	.	.	.	.	T	36	5.817975	0.96982	.	.	ENSG00000139133	ENST00000266483;ENST00000538927	.	.	.	3.57	1.12	0.20585	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3544	0.21393	0.0:0.2297:0.0:0.7703	.	.	.	.	X	112	.	ENSP00000266483:Y112X	Y	+	3	2	ALG10	34068328	1.000000	0.71417	0.750000	0.31169	0.776000	0.43924	0.804000	0.27098	0.017000	0.15025	0.155000	0.16302	TAT	ALG10	-	pfam_Glycosyltransferase_ALG10,pirsf_Alpha1_2_glucosyltferase_Alg10	ENSG00000139133		0.353	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10	HGNC	protein_coding	OTTHUMT00000403309.1	395	0.00	0	T	NM_032834		34177061	34177061	+1	no_errors	ENST00000266483	ensembl	human	known	69_37n	nonsense	191	29.00	78	SNP	0.999	G
APC	324	genome.wustl.edu	37	5	112177345	112177345	+	Silent	SNP	A	A	G			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr5:112177345A>G	ENST00000457016.1	+	16	6434	c.6054A>G	c.(6052-6054)ccA>ccG	p.P2018P	APC_ENST00000508376.2_Silent_p.P2018P|APC_ENST00000257430.4_Silent_p.P2018P|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	2018	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.P2018P(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		aagataccccagtttgtttct	0.418		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	2	Unknown(1)|Substitution - coding silent(1)	breast(1)|skin(1)											87.0	87.0	87.0					5																	112177345		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.6054A>G	5.37:g.112177345A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT03|Q15162|Q15163|Q93042	Silent	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.P2018	ENST00000457016.1	37	c.6054	CCDS4107.1	5																																																																																			APC	-	pfam_APC_Cys-rich_rpt	ENSG00000134982		0.418	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	115	0.00	0	A	NM_000038		112177345	112177345	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	silent	57	38.71	36	SNP	0.325	G
ARID1B	57492	genome.wustl.edu	37	6	157454190	157454190	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr6:157454190delT	ENST00000350026.5	+	7	2362	c.2361delT	c.(2359-2361)cctfs	p.P787fs	ARID1B_ENST00000367148.1_Frame_Shift_Del_p.P787fs|ARID1B_ENST00000346085.5_Frame_Shift_Del_p.P800fs|ARID1B_ENST00000275248.4_Frame_Shift_Del_p.P729fs	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	787					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.Q801fs*44(1)|p.Q730fs*44(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AAAGAAACCCTCAGATGGCTC	0.448																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)											89.0	81.0	84.0					6																	157454190		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.2361delT	6.37:g.157454190delT	ENSP00000055163:p.Pro787fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Frame_Shift_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q788fs	ENST00000350026.5	37	c.2361	CCDS5251.2	6																																																																																			ARID1B	-	NULL	ENSG00000049618		0.448	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	73	0.00	0	T	NM_020732		157454190	157454190	+1	no_errors	ENST00000367148	ensembl	human	known	69_37n	frame_shift_del	31	40.74	22	DEL	0.997	-
COL14A1	7373	genome.wustl.edu	37	8	121282319	121282319	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr8:121282319C>T	ENST00000297848.3	+	26	3389	c.3119C>T	c.(3118-3120)tCc>tTc	p.S1040F	COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.S1040F|COL14A1_ENST00000247781.3_Missense_Mutation_p.S945F	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.S1040F(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GTGGATGGATCCTGGAGCATT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	124.0	129.0					8																	121282319		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3119C>T	8.37:g.121282319C>T	ENSP00000297848:p.Ser1040Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S1040F	ENST00000297848.3	37	c.3119	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789945	0.90367	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.98666	-5.06;-5.06;-5.06	5.08	5.08	0.68730	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.99459	0.9808	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98331	1.0533	10	0.87932	D	0	.	18.6682	0.91499	0.0:1.0:0.0:0.0	.	1040	Q05707	COEA1_HUMAN	F	1040;1040;945	ENSP00000311809:S1040F;ENSP00000297848:S1040F;ENSP00000247781:S945F	ENSP00000247781:S945F	S	+	2	0	COL14A1	121351500	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.639000	0.83342	2.648000	0.89879	0.462000	0.41574	TCC	COL14A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000187955		0.423	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	176	0.00	0	C	NM_021110		121282319	121282319	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	119	31.61	55	SNP	1.000	T
CROCCP2	84809	genome.wustl.edu	37	1	16946437	16946437	+	lincRNA	SNP	C	C	T	rs2262202	byFrequency	TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr1:16946437C>T	ENST00000412962.1	-	0	1082				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGCCTTCCGCCGGGCCAGCAG	0.672													.|||	800	0.159744	0.1067	0.1571	5008	,	,		61077	0.2659		0.1511	False		,,,				2504	0.1329					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946437C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.672	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	16	0.00	0	C	NR_026752.1		16946437	16946437	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	28	20.00	7	SNP	1.000	T
SYNE2	23224	genome.wustl.edu	37	14	64694310	64694310	+	IGR	SNP	G	G	C			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr14:64694310G>C	ENST00000344113.4	+	0	21777				ESR2_ENST00000555278.1_3'UTR|ESR2_ENST00000554572.1_Missense_Mutation_p.L477V|ESR2_ENST00000358599.5_Missense_Mutation_p.L477V|ESR2_ENST00000542956.1_Intron|ESR2_ENST00000353772.3_Missense_Mutation_p.L477V	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.L477V(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AATGAGGTGAGTGTTTGAGAG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											153.0	147.0	149.0					14																	64694310		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349		14.37:g.64694310G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_Estrogen_rcpt_beta_N,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.L477V	ENST00000344113.4	37	c.1429	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353396	0.24512	.	.	ENSG00000140009	ENST00000554572;ENST00000353772;ENST00000358599	D;D;D	0.93953	-3.32;-3.32;-3.32	2.75	-1.76	0.08006	.	.	.	.	.	D	0.92655	0.7666	M	0.88105	2.93	0.09310	N	1	P	0.35700	0.516	B	0.40534	0.332	D	0.86078	0.1542	9	0.87932	D	0	.	2.0583	0.03586	0.1463:0.2209:0.4626:0.1703	.	477	F1D8N3	.	V	477	ENSP00000450699:L477V;ENSP00000335551:L477V;ENSP00000351412:L477V	ENSP00000335551:L477V	L	-	1	0	ESR2	63764063	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-0.008000	0.12788	-0.423000	0.07394	0.467000	0.42956	CTC	ESR2	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000140009		0.443	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR2	HGNC	protein_coding	OTTHUMT00000276994.2	97	0.00	0	G	NM_182914		64694310	64694310	-1	no_errors	ENST00000353772	ensembl	human	known	69_37n	missense	59	35.16	32	SNP	0.000	C
ENTPD5	957	genome.wustl.edu	37	14	74436746	74436746	+	Silent	SNP	A	A	G			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr14:74436746A>G	ENST00000334696.6	-	15	1486	c.1167T>C	c.(1165-1167)gaT>gaC	p.D389D	ENTPD5_ENST00000557325.1_Silent_p.D389D	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	389					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)	p.D389D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		AGCCAAAGCCATCCTTTAACA	0.473																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											159.0	136.0	144.0					14																	74436746		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.1167T>C	14.37:g.74436746A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4C5|Q96RX0	Missense_Mutation	SNP	NULL	p.M64T	ENST00000334696.6	37	c.191	CCDS9825.1	14	.	.	.	.	.	.	.	.	.	.	A	10.30	1.313393	0.23908	.	.	ENSG00000187097	ENST00000555829	.	.	.	5.65	-6.9	0.01655	.	.	.	.	.	T	0.46483	0.1395	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50600	-0.8809	4	.	.	.	-15.5241	6.3856	0.21559	0.2572:0.0:0.3175:0.4253	.	.	.	.	T	64	.	.	M	-	2	0	ENTPD5	73506499	0.586000	0.26782	0.928000	0.36995	0.993000	0.82548	-0.152000	0.10159	-0.963000	0.03600	0.533000	0.62120	ATG	ENTPD5	-	NULL	ENSG00000187097		0.473	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD5	HGNC	protein_coding	OTTHUMT00000412637.1	67	0.00	0	A	NM_001249		74436746	74436746	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000555829	ensembl	human	putative	69_37n	missense	59	32.18	28	SNP	0.756	G
EXOC7	23265	genome.wustl.edu	37	17	74084953	74084953	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr17:74084953G>A	ENST00000335146.7	-	10	1305	c.1252C>T	c.(1252-1254)Cgg>Tgg	p.R418W	EXOC7_ENST00000332065.5_Missense_Mutation_p.R336W|EXOC7_ENST00000589210.1_Missense_Mutation_p.R367W|EXOC7_ENST00000607838.1_Missense_Mutation_p.R390W|EXOC7_ENST00000411744.2_Missense_Mutation_p.R359W|EXOC7_ENST00000405575.4_Missense_Mutation_p.R390W|EXOC7_ENST00000467929.2_Missense_Mutation_p.R326W			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	418					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)		p.R367W(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			ATGGCCTTCCGGGCAGCAGAC	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	70.0	74.0					17																	74084953		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.1252C>T	17.37:g.74084953G>A	ENSP00000334100:p.Arg418Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	pfam_Exo70,superfamily_Cullin_repeat-like_dom	p.R418W	ENST00000335146.7	37	c.1252	CCDS45782.1	17	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091158	0.76756	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	5.3	4.3	0.51218	Cullin repeat-like-containing domain (1);	0.055575	0.64402	D	0.000001	T	0.69637	0.3133	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0;1.0;0.999	D;D;D;D;D;D;P	0.70227	0.943;0.916;0.968;0.918;0.966;0.951;0.881	T	0.72320	-0.4329	9	0.87932	D	0	-25.9042	12.7159	0.57115	0.0:0.0:0.6911:0.3089	.	359;390;326;326;418;336;367	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	W	336;256;390;418;367;326;359	.	ENSP00000333806:R336W	R	-	1	2	EXOC7	71596548	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	6.072000	0.71238	1.159000	0.42565	0.650000	0.86243	CGG	EXOC7	-	pfam_Exo70,superfamily_Cullin_repeat-like_dom	ENSG00000182473		0.612	EXOC7-006	KNOWN	basic|CCDS	protein_coding	EXOC7	HGNC	protein_coding	OTTHUMT00000319768.2	10	0.00	0	G	NM_015219		74084953	74084953	-1	no_errors	ENST00000335146	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	1.000	A
GCC2	9648	genome.wustl.edu	37	2	109099566	109099566	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr2:109099566C>A	ENST00000309863.6	+	12	4108	c.3394C>A	c.(3394-3396)Caa>Aaa	p.Q1132K		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1132					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.Q1132K(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						GGTACAACTTCAAAAGCAAAA	0.318																																						dbGAP											1	Substitution - Missense(1)	breast(1)											67.0	67.0	67.0					2																	109099566		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3394C>A	2.37:g.109099566C>A	ENSP00000307939:p.Gln1132Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.Q1132K	ENST00000309863.6	37	c.3394	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048698	0.55110	.	.	ENSG00000135968	ENST00000309863	T	0.33216	1.42	4.98	4.98	0.66077	.	0.127142	0.53938	D	0.000048	T	0.34019	0.0883	M	0.69823	2.125	0.44660	D	0.997643	B	0.30406	0.278	B	0.25140	0.058	T	0.17048	-1.0382	10	0.18710	T	0.47	.	18.6165	0.91304	0.0:1.0:0.0:0.0	.	1132	Q8IWJ2	GCC2_HUMAN	K	1132	ENSP00000307939:Q1132K	ENSP00000307939:Q1132K	Q	+	1	0	GCC2	108465998	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.532000	0.45659	2.482000	0.83794	0.484000	0.47621	CAA	GCC2	-	NULL	ENSG00000135968		0.318	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	180	0.00	0	C	NM_014635		109099566	109099566	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	missense	71	34.26	37	SNP	1.000	A
GOLGA6L17P	642402	genome.wustl.edu	37	15	85053188	85053188	+	RNA	SNP	C	C	G	rs201559925	byFrequency	TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr15:85053188C>G	ENST00000414190.2	-	0	264					NR_003246.2																						CCCTGTTCTCCGCAGCCCGAA	0.488																																						dbGAP											0																																										-	-	-			0																															15.37:g.85053188C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000414190.2	37	NULL		15																																																																																			GOLGA6L5	-	-	ENSG00000230373		0.488	GOLGA6L5-003	KNOWN	mRNA_end_NF|basic	processed_transcript	GOLGA6L5	HGNC	pseudogene	OTTHUMT00000418579.1	8	0.00	0	C			85053188	85053188	-1	no_errors	ENST00000414190	ensembl	human	known	69_37n	rna	21	38.24	13	SNP	0.002	G
IFRD1	3475	genome.wustl.edu	37	7	112112289	112112289	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr7:112112289A>G	ENST00000403825.3	+	10	1318	c.1057A>G	c.(1057-1059)Aca>Gca	p.T353A	IFRD1_ENST00000535603.1_Missense_Mutation_p.T303A|IFRD1_ENST00000005558.4_Missense_Mutation_p.T353A	NM_001550.3	NP_001541.2	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	353					adult somatic muscle development (GO:0007527)|multicellular organismal development (GO:0007275)|myoblast fate determination (GO:0007518)	nucleus (GO:0005634)		p.T353A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|urinary_tract(1)	15						GGATTTTCCAACAGAAACCAT	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	122.0	122.0					7																	112112289		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10313	CCDS34736.1, CCDS56504.1	7q31.1	2005-10-17			ENSG00000006652	ENSG00000006652			5456	protein-coding gene	gene with protein product		603502				9722946	Standard	NM_001550		Approved	PC4, TIS7	uc003vgh.3	O00458	OTTHUMG00000155124	ENST00000403825.3:c.1057A>G	7.37:g.112112289A>G	ENSP00000384477:p.Thr353Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5G1|O75234|Q5U013|Q9BVE4	Missense_Mutation	SNP	pfam_Interferon-rel_develop_reg_N,pfam_Interferon-rel_develop_reg_C,superfamily_ARM-type_fold	p.T353A	ENST00000403825.3	37	c.1057	CCDS34736.1	7	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843841	0.51164	.	.	ENSG00000006652	ENST00000005558;ENST00000403825;ENST00000536259;ENST00000535603;ENST00000421296;ENST00000462155	T;T;T	0.44083	0.97;0.97;0.93	5.93	5.93	0.95920	.	0.168070	0.52532	D	0.000067	T	0.31263	0.0791	N	0.22421	0.69	0.38569	D	0.949902	B;B	0.24092	0.097;0.097	B;B	0.26517	0.07;0.07	T	0.18777	-1.0326	10	0.42905	T	0.14	-18.2571	12.2554	0.54621	0.8584:0.1416:0.0:0.0	.	353;353	A4D0U1;O00458	.;IFRD1_HUMAN	A	353;353;88;303;88;16	ENSP00000005558:T353A;ENSP00000384477:T353A;ENSP00000439188:T303A	ENSP00000005558:T353A	T	+	1	0	IFRD1	111899525	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.131000	0.42074	2.267000	0.75376	0.533000	0.62120	ACA	IFRD1	-	NULL	ENSG00000006652		0.388	IFRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IFRD1	HGNC	protein_coding	OTTHUMT00000338700.1	195	0.00	0	A	NM_001550		112112289	112112289	+1	no_errors	ENST00000005558	ensembl	human	known	69_37n	missense	90	37.93	55	SNP	1.000	G
ITGB3BP	23421	genome.wustl.edu	37	1	63955841	63955841	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr1:63955841A>T	ENST00000271002.10	-	3	178	c.97T>A	c.(97-99)Tct>Act	p.S33T	ITGB3BP_ENST00000283568.8_Missense_Mutation_p.S33T|ITGB3BP_ENST00000371092.3_Missense_Mutation_p.S72T	NM_014288.4	NP_055103.3	Q13352	CENPR_HUMAN	integrin beta 3 binding protein (beta3-endonexin)	33	DD1.				apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)	p.S33T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9						GTTGTTGGAGAATAAGTTATA	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											112.0	113.0	113.0					1																	63955841		2203	4297	6500	-	-	-	SO:0001583	missense	0			U37139	CCDS30736.1, CCDS55603.1	1p31.3	2013-11-05			ENSG00000142856	ENSG00000142856			6157	protein-coding gene	gene with protein product	"""centromere protein R"""	605494				7593198, 10490654	Standard	NM_014288		Approved	NRIF3, HSU37139, TAP20, CENPR	uc001dbb.2	Q13352	OTTHUMG00000013364	ENST00000271002.10:c.97T>A	1.37:g.63955841A>T	ENSP00000271002:p.Ser33Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7D8|Q13353|Q5RJ42|Q5RJ44|Q5RJ45|Q7KYX2|Q96CD5|Q9UKB6	Missense_Mutation	SNP	pfam_NRIF3_coact_rcpt	p.S72T	ENST00000271002.10	37	c.214	CCDS30736.1	1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.954062	0.53293	.	.	ENSG00000142856	ENST00000271002;ENST00000371092;ENST00000283568	T;T;T	0.62232	0.04;0.04;0.04	5.45	5.45	0.79879	.	0.000000	0.53938	D	0.000054	T	0.63212	0.2492	L	0.32530	0.975	0.39208	D	0.963279	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.997;0.994	T	0.69566	-0.5111	10	0.87932	D	0	-8.8261	13.7066	0.62644	1.0:0.0:0.0:0.0	.	33;72;33	Q13352-2;Q13352-5;Q13352	.;.;CENPR_HUMAN	T	33;72;33	ENSP00000271002:S33T;ENSP00000360133:S72T;ENSP00000283568:S33T	ENSP00000271002:S33T	S	-	1	0	ITGB3BP	63728429	1.000000	0.71417	0.934000	0.37439	0.329000	0.28539	5.206000	0.65192	2.371000	0.80710	0.533000	0.62120	TCT	ITGB3BP	-	NULL	ENSG00000142856		0.323	ITGB3BP-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGB3BP	HGNC	protein_coding	OTTHUMT00000037242.2	278	0.00	0	A	NM_014288		63955841	63955841	-1	no_errors	ENST00000371092	ensembl	human	known	69_37n	missense	111	30.63	49	SNP	0.981	T
LRP4	4038	genome.wustl.edu	37	11	46916348	46916348	+	Silent	SNP	G	G	A			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr11:46916348G>A	ENST00000378623.1	-	12	1574	c.1332C>T	c.(1330-1332)ttC>ttT	p.F444F		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	444					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.F444F(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TGCGATTGGCGAACAGCAGCA	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											90.0	91.0	91.0					11																	46916348		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.1332C>T	11.37:g.46916348G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN39|Q4AC85|Q5KTZ5	Silent	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.F444	ENST00000378623.1	37	c.1332	CCDS31478.1	11																																																																																			LRP4	-	superfamily_Growth_fac_rcpt	ENSG00000134569		0.562	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	23	0.00	0	G	NM_002334		46916348	46916348	-1	no_errors	ENST00000378623	ensembl	human	known	69_37n	silent	41	46.05	35	SNP	1.000	A
N4BP3	23138	genome.wustl.edu	37	5	177548592	177548592	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr5:177548592C>T	ENST00000274605.5	+	5	1584	c.1225C>T	c.(1225-1227)Cgg>Tgg	p.R409W		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	409						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)		p.R409W(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCGGGGCAGCCGGGCACAAGC	0.657																																						dbGAP											1	Substitution - Missense(1)	breast(1)											48.0	56.0	53.0					5																	177548592		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.1225C>T	5.37:g.177548592C>T	ENSP00000274605:p.Arg409Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	pfam_Fez1	p.R409W	ENST00000274605.5	37	c.1225	CCDS34307.1	5	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331708	0.60853	.	.	ENSG00000145911	ENST00000274605	T	0.56275	0.47	5.05	4.18	0.49190	.	0.119545	0.51477	D	0.000082	T	0.69788	0.3150	M	0.66297	2.02	0.44295	D	0.997161	D	0.89917	1.0	D	0.91635	0.999	T	0.71388	-0.4608	10	0.87932	D	0	-33.5835	13.6766	0.62458	0.1559:0.8441:0.0:0.0	.	409	O15049	N4BP3_HUMAN	W	409	ENSP00000274605:R409W	ENSP00000274605:R409W	R	+	1	2	N4BP3	177481198	0.986000	0.35501	0.989000	0.46669	0.834000	0.47266	0.614000	0.24314	0.550000	0.28991	-1.367000	0.01198	CGG	N4BP3	-	pfam_Fez1	ENSG00000145911		0.657	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP3	HGNC	protein_coding	OTTHUMT00000373552.2	10	0.00	0	C	NM_015111		177548592	177548592	+1	no_errors	ENST00000274605	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	1.000	T
NSUN5	55695	genome.wustl.edu	37	7	72718330	72718330	+	Silent	SNP	A	A	G			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr7:72718330A>G	ENST00000252594.6	-	7	846	c.831T>C	c.(829-831)tcT>tcC	p.S277S	NSUN5_ENST00000428206.1_Silent_p.S239S|NSUN5_ENST00000438747.2_Silent_p.S277S|NSUN5_ENST00000310326.8_Silent_p.S277S			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5	277					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.S277S(2)		breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				GTTCACAGCAAGAGACGCCAG	0.612																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											42.0	42.0	42.0					7																	72718330		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.831T>C	7.37:g.72718330A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Silent	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.S277	ENST00000252594.6	37	c.831	CCDS5547.1	7																																																																																			NSUN5	-	pfam_Fmu/NOL1/Nop2p	ENSG00000130305		0.612	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NSUN5	HGNC	protein_coding	OTTHUMT00000252113.1	11	0.00	0	A	NM_148956		72718330	72718330	-1	no_errors	ENST00000438747	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	0.005	G
OR5W2	390148	genome.wustl.edu	37	11	55681318	55681318	+	Silent	SNP	C	C	T	rs547924373		TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr11:55681318C>T	ENST00000344514.1	-	1	740	c.741G>A	c.(739-741)gcG>gcA	p.A247A		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A247A(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AAATTGCAACCGCAGATAAGT	0.403																																					Melanoma(48;171 1190 15239 43886 49348)	dbGAP											1	Substitution - coding silent(1)	breast(1)											83.0	95.0	91.0					11																	55681318		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.741G>A	11.37:g.55681318C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A247	ENST00000344514.1	37	c.741	CCDS31513.1	11																																																																																			OR5W2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187612		0.403	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1	122	0.00	0	C	NM_001001960		55681318	55681318	-1	no_errors	ENST00000344514	ensembl	human	known	69_37n	silent	74	37.82	45	SNP	0.003	T
PLCD1	5333	genome.wustl.edu	37	3	38061760	38061760	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr3:38061760G>A	ENST00000334661.4	-	2	340	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	PLCD1_ENST00000463876.1_Missense_Mutation_p.R61C|PLCD1_ENST00000479619.1_5'Flank	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	40	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Substrate binding. {ECO:0000250}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)	p.R61C(1)|p.R40W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TTGTAGAAGCGCTCTCTCCTC	0.602																																						dbGAP											2	Substitution - Missense(2)	breast(2)											98.0	87.0	91.0					3																	38061760		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.118C>T	3.37:g.38061760G>A	ENSP00000335600:p.Arg40Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR14|Q86VN8	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R61C	ENST00000334661.4	37	c.181	CCDS2671.1	3	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520380	0.44866	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	T;T	0.70164	-0.46;-0.46	5.22	3.12	0.35913	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.79423	0.4443	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82008	-0.0670	10	0.66056	D	0.02	.	13.6246	0.62157	0.0:0.0:0.5706:0.4294	.	40;61	P51178;B3KR14	PLCD1_HUMAN;.	C	61;40	ENSP00000430344:R61C;ENSP00000335600:R40C	ENSP00000335600:R40C	R	-	1	0	PLCD1	38036764	1.000000	0.71417	0.994000	0.49952	0.001000	0.01503	4.087000	0.57671	1.315000	0.45114	-0.314000	0.08810	CGC	PLCD1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000187091		0.602	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCD1	HGNC	protein_coding	OTTHUMT00000253359.2	17	0.00	0	G			38061760	38061760	-1	no_errors	ENST00000463876	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	0.965	A
RHEBL1	121268	genome.wustl.edu	37	12	49459216	49459216	+	Splice_Site	SNP	T	T	C			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr12:49459216T>C	ENST00000301068.6	-	7	620		c.e7-2			NM_144593.1	NP_653194.1	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1						GTP catabolic process (GO:0006184)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|small GTPase mediated signal transduction (GO:0007264)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.?(1)		breast(2)|large_intestine(2)|lung(5)	9						TGTACCTCTCTGGAAGCAAAT	0.483																																						dbGAP											1	Unknown(1)	breast(1)											99.0	90.0	93.0					12																	49459216		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK098663	CCDS8778.1	12q13.12	2014-05-09				ENSG00000167550			21166	protein-coding gene	gene with protein product						12477932	Standard	NM_144593		Approved	MGC34869, FLJ25797	uc001rtc.1	Q8TAI7	OTTHUMG00000170407	ENST00000301068.6:c.381-2A>G	12.37:g.49459216T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q56VH8	Splice_Site	SNP	-	e7-2	ENST00000301068.6	37	c.381-2	CCDS8778.1	12	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336399	0.60963	.	.	ENSG00000167550	ENST00000301068	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8126	0.40833	0.0:0.0:0.1726:0.8274	.	.	.	.	.	-1	.	.	.	-	.	.	RHEBL1	47745483	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	3.640000	0.54350	2.114000	0.64651	0.533000	0.62120	.	RHEBL1	-	-	ENSG00000167550		0.483	RHEBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHEBL1	HGNC	protein_coding	OTTHUMT00000408969.1	27	0.00	0	T	NM_144593	Intron	49459216	49459216	-1	no_errors	ENST00000301068	ensembl	human	known	69_37n	splice_site	38	45.71	32	SNP	0.997	C
SF3B1	23451	genome.wustl.edu	37	2	198266834	198266834	+	Missense_Mutation	SNP	T	T	C	rs559063155		TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr2:198266834T>C	ENST00000335508.6	-	15	2189	c.2098A>G	c.(2098-2100)Aaa>Gaa	p.K700E	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'UTR	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K700E(179)|p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTCCGAACTTTCTGCTGCTCA	0.408			Mis		myelodysplastic syndrome								T|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	181	Substitution - Missense(179)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(153)|NS(20)|breast(5)|pancreas(2)|central_nervous_system(1)																																								-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2098A>G	2.37:g.198266834T>C	ENSP00000335321:p.Lys700Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K700E	ENST00000335508.6	37	c.2098	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.243295	0.95272	.	.	ENSG00000115524	ENST00000335508	T	0.63580	-0.05	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89820	0.3988	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	E	700	ENSP00000335321:K700E	ENSP00000335321:K700E	K	-	1	0	SF3B1	197975079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.408	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	57	0.00	0	T			198266834	198266834	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	1.000	C
SLFN14	342618	genome.wustl.edu	37	17	33884703	33884703	+	Missense_Mutation	SNP	G	G	A	rs538967367		TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr17:33884703G>A	ENST00000415846.3	-	1	414	c.379C>T	c.(379-381)Cgc>Tgc	p.R127C	RP11-1094M14.12_ENST00000588445.1_RNA	NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	127							ATP binding (GO:0005524)	p.R127C(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						AAATTGGAGCGCAAGCTGCAA	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		20275	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	31.0	33.0					17																	33884703		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.379C>T	17.37:g.33884703G>A	ENSP00000391101:p.Arg127Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTW9	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.R127C	ENST00000415846.3	37	c.379	CCDS45650.1	17	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904761	0.33628	.	.	ENSG00000236320	ENST00000415846	T	0.01933	4.55	4.19	2.16	0.27623	.	.	.	.	.	T	0.02807	0.0084	L	0.31664	0.95	0.28091	N	0.931804	D	0.76494	0.999	P	0.50791	0.65	T	0.47433	-0.9118	9	0.33940	T	0.23	-0.142	4.5688	0.12200	0.1133:0.0:0.6666:0.2202	.	127	P0C7P3	SLN14_HUMAN	C	127	ENSP00000391101:R127C	ENSP00000391101:R127C	R	-	1	0	SLFN14	30908816	0.001000	0.12720	0.796000	0.32109	0.597000	0.36814	0.115000	0.15540	1.073000	0.40885	0.655000	0.94253	CGC	SLFN14	-	NULL	ENSG00000236320		0.483	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN14	HGNC	protein_coding	OTTHUMT00000448928.1	51	0.00	0	G	NM_001129820		33884703	33884703	-1	no_errors	ENST00000415846	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	0.794	A
SUPT5H	6829	genome.wustl.edu	37	19	39949655	39949655	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0WT-01A-11D-A10G-09	TCGA-B6-A0WT-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5fb780fb-12bc-4195-8f0c-2c6e3cc36b49	e31846e7-c2f6-4f0c-9240-dbbc9cbb795b	g.chr19:39949655G>A	ENST00000599117.1	+	8	767	c.400G>A	c.(400-402)Gaa>Aaa	p.E134K	SUPT5H_ENST00000402194.2_Missense_Mutation_p.E130K|SUPT5H_ENST00000598725.1_Missense_Mutation_p.E134K|SUPT5H_ENST00000359191.6_Missense_Mutation_p.E130K|SUPT5H_ENST00000432763.2_Missense_Mutation_p.E134K			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	134					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.E134K(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGACCAGCGAGAAGAAGAACT	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											123.0	112.0	116.0					19																	39949655		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.400G>A	19.37:g.39949655G>A	ENSP00000470252:p.Glu134Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43279|Q59G52|Q99639	Missense_Mutation	SNP	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N,smart_KOW,pirsf_TF_Spt5	p.E134K	ENST00000599117.1	37	c.400	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	G	35	5.436753	0.96168	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	4.48	4.48	0.54585	Spt5 transcription elongation factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75162	0.3812	L	0.58810	1.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.988;0.993	T	0.74725	-0.3568	8	.	.	.	-17.2333	16.4662	0.84079	0.0:0.0:1.0:0.0	.	130;134	O00267-2;O00267	.;SPT5H_HUMAN	K	134;130;112;134	.	.	E	+	1	0	SUPT5H	44641495	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.964000	0.76061	2.507000	0.84556	0.650000	0.86243	GAA	SUPT5H	-	pfam_Spt5_N,pirsf_TF_Spt5	ENSG00000196235		0.567	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	HGNC	protein_coding	OTTHUMT00000464918.1	35	0.00	0	G	NM_003169		39949655	39949655	+1	no_errors	ENST00000359191	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	A
