#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACACA	31	genome.wustl.edu	37	17	35506834	35506834	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr17:35506834A>G	ENST00000394406.2	-	45	5712	c.5522T>C	c.(5521-5523)gTt>gCt	p.V1841A	ACACA_ENST00000353139.5_Missense_Mutation_p.V1878A|ACACA_ENST00000360679.3_Missense_Mutation_p.V1783A|ACACA_ENST00000335166.5_Missense_Mutation_p.V1763A|ACACA_ENST00000361253.5_5'UTR	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1841	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGAATTCTCAACCTGGATGGT	0.423																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	dbGAP											0													101.0	102.0	102.0					17																	35506834		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5522T>C	17.37:g.35506834A>G	ENSP00000377928:p.Val1841Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.V1878A	ENST00000394406.2	37	c.5633	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	A	34	5.316807	0.95682	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.98178	-4.77;-4.77;-4.77;-4.77	5.95	5.95	0.96441	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98226	0.9413	M	0.75777	2.31	0.80722	D	1	P;P;P;P	0.46327	0.494;0.842;0.876;0.849	B;P;P;P	0.52109	0.16;0.618;0.69;0.678	D	0.98216	1.0475	10	0.33141	T	0.24	-20.7061	16.4159	0.83738	1.0:0.0:0.0:0.0	.	540;1878;1841;1783	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	A	1878;1783;1841;1865;1763;540	ENSP00000344789:V1878A;ENSP00000353898:V1783A;ENSP00000377928:V1841A;ENSP00000335323:V1763A	ENSP00000335323:V1763A	V	-	2	0	ACACA	32580947	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.279000	0.76181	0.533000	0.62120	GTT	ACACA	-	pfam_Carboxyl_trans,pfscan_COA_CT_N	ENSG00000132142		0.423	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	71	0.00	0	A	NM_198836		35506834	35506834	-1	no_errors	ENST00000353139	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	1.000	G
APC2	10297	genome.wustl.edu	37	19	1465789	1465789	+	Missense_Mutation	SNP	A	A	C	rs544613190	byFrequency	TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr19:1465789A>C	ENST00000535453.1	+	14	4202	c.2489A>C	c.(2488-2490)gAg>gCg	p.E830A	APC2_ENST00000233607.2_Missense_Mutation_p.E830A|C19orf25_ENST00000588427.1_Intron|APC2_ENST00000238483.4_Missense_Mutation_p.E556A			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGAGGCAGAGAAGGACACC	0.726																																						dbGAP											0													13.0	15.0	14.0					19																	1465789		2166	4284	6450	-	-	-	SO:0001583	missense	0				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.2489A>C	19.37:g.1465789A>C	ENSP00000442954:p.Glu830Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.E830A	ENST00000535453.1	37	c.2489	CCDS12068.1	19	.	.	.	.	.	.	.	.	.	.	A	6.751	0.507454	0.12883	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	D;D;D	0.92699	-3.09;-2.74;-3.09	4.36	4.36	0.52297	.	0.801110	0.11502	N	0.557561	D	0.90300	0.6966	L	0.60455	1.87	0.80722	D	1	B;B	0.30937	0.301;0.2	B;B	0.31495	0.131;0.062	D	0.87480	0.2420	10	0.46703	T	0.11	-16.9606	12.4989	0.55944	1.0:0.0:0.0:0.0	.	829;830	O95996-3;O95996	.;APC2_HUMAN	A	830;556;830	ENSP00000233607:E830A;ENSP00000238483:E556A;ENSP00000442954:E830A	ENSP00000233607:E830A	E	+	2	0	APC2	1416789	1.000000	0.71417	0.905000	0.35620	0.028000	0.11728	4.265000	0.58865	1.821000	0.53095	0.260000	0.18958	GAG	APC2	-	NULL	ENSG00000115266		0.726	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	14	0.00	0	A	NM_005883		1465789	1465789	+1	no_errors	ENST00000233607	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	1.000	C
ATP2A2	488	genome.wustl.edu	37	12	110778473	110778473	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr12:110778473A>G	ENST00000539276.2	+	14	1880	c.1771A>G	c.(1771-1773)Acc>Gcc	p.T591A	ATP2A2_ENST00000395494.2_Missense_Mutation_p.T564A|ATP2A2_ENST00000308664.6_Missense_Mutation_p.T591A			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	591	Interacts with HAX1.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						GACCAATCTGACCTTCGTTGG	0.483																																						dbGAP											0													95.0	102.0	99.0					12																	110778473		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1771A>G	12.37:g.110778473A>G	ENSP00000440045:p.Thr591Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.T591A	ENST00000539276.2	37	c.1771	CCDS9144.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.0|27.0	4.789368|4.789368	0.90367|0.90367	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000548169|ENST00000308664;ENST00000395494;ENST00000539276	.|D;D;D	.|0.99458	.|-5.93;-5.93;-5.93	6.07|6.07	6.07|6.07	0.98685|0.98685	.|ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99566|0.99566	0.9844|0.9844	M|M	0.89163|0.89163	3.01|3.01	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.69078	.|0.997;0.971;0.977	.|D;P;D	.|0.70935	.|0.971;0.854;0.933	D|D	0.98202|0.98202	1.0468|1.0468	5|10	.|0.72032	.|D	.|0.01	.|.	16.6406|16.6406	0.85098|0.85098	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|564;591;591	.|P16615-4;P16615-2;P16615	.|.;.;AT2A2_HUMAN	G|A	481|591;564;591	.|ENSP00000311186:T591A;ENSP00000378872:T564A;ENSP00000440045:T591A	.|ENSP00000311186:T591A	D|T	+|+	2|1	0|0	ATP2A2|ATP2A2	109262856|109262856	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.864000|0.864000	0.49448|0.49448	9.339000|9.339000	0.96797|0.96797	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	GAC|ACC	ATP2A2	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp	ENSG00000174437		0.483	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	ATP2A2	HGNC	protein_coding	OTTHUMT00000403539.1	63	0.00	0	A	NM_001681		110778473	110778473	+1	no_errors	ENST00000539276	ensembl	human	known	69_37n	missense	23	36.84	14	SNP	1.000	G
CEP131	22994	genome.wustl.edu	37	17	79180952	79180952	+	Silent	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr17:79180952G>A	ENST00000269392.4	-	4	607	c.360C>T	c.(358-360)agC>agT	p.S120S	AZI1_ENST00000575907.1_Silent_p.S120S|AZI1_ENST00000374782.3_Silent_p.S120S|AZI1_ENST00000450824.2_Silent_p.S120S	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		120					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTCCCTTCTCGCTGGGGGCTG	0.607																																						dbGAP											0													78.0	71.0	74.0					17																	79180952		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000269392.4:c.360C>T	17.37:g.79180952G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHI8|B2RN11|Q96F50	Silent	SNP	superfamily_t-SNARE	p.S120	ENST00000269392.4	37	c.360		17																																																																																			AZI1	-	NULL	ENSG00000141577		0.607	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	AZI1	HGNC	protein_coding	OTTHUMT00000256070.1	98	0.00	0	G			79180952	79180952	-1	no_errors	ENST00000269392	ensembl	human	known	69_37n	silent	78	25.71	27	SNP	0.000	A
BRAP	8315	genome.wustl.edu	37	12	112096541	112096541	+	Splice_Site	SNP	T	T	G			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr12:112096541T>G	ENST00000327551.6	-	9	1270	c.1130A>C	c.(1129-1131)gAg>gCg	p.E377A	BRAP_ENST00000419234.4_Splice_Site_p.E407A|BRAP_ENST00000539060.1_Splice_Site_p.E228A			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						ATCTCTTACCTCTAACTGTAA	0.333																																					Pancreas(146;846 1904 7830 25130 26065)	dbGAP											0													163.0	152.0	156.0					12																	112096541		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1131+1A>C	12.37:g.112096541T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	pfam_BRAP2,pfam_Znf_UBP,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_UBP,pfscan_Znf_RING,pfscan_Znf_UBP	p.E407A	ENST00000327551.6	37	c.1220		12	.	.	.	.	.	.	.	.	.	.	T	21.0	4.088138	0.76642	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	T;T;T	0.66815	-0.23;-0.23;-0.23	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.85487	0.5708	M	0.92507	3.315	0.80722	D	1	P;D	0.69078	0.956;0.997	P;D	0.77004	0.899;0.989	D	0.89283	0.3613	10	0.87932	D	0	-22.3204	15.0682	0.72014	0.0:0.0:0.0:1.0	.	228;407	B4DRM1;Q7Z569	.;BRAP_HUMAN	A	407;228;377;189	ENSP00000403524:E407A;ENSP00000441659:E228A;ENSP00000330813:E377A	ENSP00000330813:E377A	E	-	2	0	BRAP	110580924	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	7.435000	0.80391	1.970000	0.57323	0.528000	0.53228	GAG	BRAP	-	NULL	ENSG00000089234		0.333	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	BRAP	HGNC	protein_coding	OTTHUMT00000404994.2	155	0.00	0	T		Missense_Mutation	112096541	112096541	-1	no_errors	ENST00000419234	ensembl	human	known	69_37n	missense	76	31.53	35	SNP	1.000	G
C1GALT1	56913	genome.wustl.edu	37	7	7283157	7283157	+	Silent	SNP	T	T	G			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr7:7283157T>G	ENST00000223122.3	+	3	953	c.891T>G	c.(889-891)ggT>ggG	p.G297G	C1GALT1_ENST00000436587.2_Silent_p.G297G			Q9NS00	C1GLT_HUMAN	core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1	297					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|kidney development (GO:0001822)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity (GO:0016263)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(3)|prostate(1)|urinary_tract(1)	7				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		TTTTTTAGGGTCCTGGTTGCT	0.343																																						dbGAP											0													161.0	158.0	159.0					7																	7283157		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF155582	CCDS5355.1	7p21.3	2014-06-24	2014-06-24		ENSG00000106392	ENSG00000106392	2.4.1.122	"""Beta 3-glycosyltransferases"""	24337	protein-coding gene	gene with protein product	"""core 1 beta3-Gal-T"""	610555				10580128, 11677243	Standard	NM_020156		Approved	C1GALT, T-synthase	uc003srb.3	Q9NS00	OTTHUMG00000151912	ENST00000223122.3:c.891T>G	7.37:g.7283157T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96QH4|Q9BTU1	Silent	SNP	pfam_Fringe-like,pfam_Glyco_trans_31	p.G297	ENST00000223122.3	37	c.891	CCDS5355.1	7																																																																																			C1GALT1	-	NULL	ENSG00000106392		0.343	C1GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1GALT1	HGNC	protein_coding	OTTHUMT00000324379.2	170	0.00	0	T	NM_020156		7283157	7283157	+1	no_errors	ENST00000223122	ensembl	human	known	69_37n	silent	74	35.65	41	SNP	1.000	G
CD22	933	genome.wustl.edu	37	19	35828818	35828818	+	Silent	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr19:35828818G>A	ENST00000085219.5	+	5	945	c.879G>A	c.(877-879)acG>acA	p.T293T	CD22_ENST00000536635.2_Silent_p.T293T|CD22_ENST00000341773.6_Intron|CD22_ENST00000594250.1_Intron|CD22_ENST00000419549.2_Silent_p.T121T|CD22_ENST00000544992.2_Silent_p.T293T|CD22_ENST00000270311.6_Silent_p.T173T	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	293	Ig-like C2-type 2.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.T293T(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ATACATTCACGCTAAACCTGC	0.567																																					Ovarian(42;1009 1133 23674 26041)	dbGAP											1	Substitution - coding silent(1)	ovary(1)											111.0	77.0	88.0					19																	35828818		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.879G>A	19.37:g.35828818G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T293	ENST00000085219.5	37	c.879	CCDS12457.1	19																																																																																			CD22	-	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000012124		0.567	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1	58	0.00	0	G	NM_001771		35828818	35828818	+1	no_errors	ENST00000085219	ensembl	human	known	69_37n	silent	41	29.03	18	SNP	0.000	A
CDH1	999	genome.wustl.edu	37	16	68842647	68842647	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr16:68842647C>T	ENST00000261769.5	+	5	774	c.583C>T	c.(583-585)Caa>Taa	p.Q195*	CDH1_ENST00000422392.2_Nonsense_Mutation_p.Q195*|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	195	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.Q195K(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CATCACTGGCCAAGGAGCTGA	0.423			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Unknown(2)|Substitution - Missense(1)	breast(3)											62.0	60.0	61.0					16																	68842647		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.583C>T	16.37:g.68842647C>T	ENSP00000261769:p.Gln195*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q195*	ENST00000261769.5	37	c.583	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912197	0.52439	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.78	4.82	0.62117	.	0.277844	0.25701	N	0.028874	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	11.8395	0.52346	0.1272:0.7262:0.1466:0.0	.	.	.	.	X	195	.	ENSP00000261769:Q195X	Q	+	1	0	CDH1	67400148	0.847000	0.29606	1.000000	0.80357	0.832000	0.47134	2.320000	0.43797	1.572000	0.49736	0.655000	0.94253	CAA	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.423	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	61	0.00	0	C	NM_004360		68842647	68842647	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	20	33.33	10	SNP	1.000	T
CDKN1B	1027	genome.wustl.edu	37	12	12871244	12871244	+	Silent	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr12:12871244C>T	ENST00000228872.4	+	1	1187	c.471C>T	c.(469-471)acC>acT	p.T157T	CDKN1B_ENST00000396340.1_Silent_p.T157T|CDKN1B_ENST00000477087.1_Intron	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	157					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)			breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		GACCTGCAACCGACGGTAATG	0.537																																						dbGAP											0													30.0	27.0	28.0					12																	12871244		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.471C>T	12.37:g.12871244C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16307|Q5U0H2|Q9BUS6	Silent	SNP	pfam_CDI	p.T157	ENST00000228872.4	37	c.471	CCDS8653.1	12																																																																																			CDKN1B	-	NULL	ENSG00000111276		0.537	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1B	HGNC	protein_coding	OTTHUMT00000313878.2	12	0.00	0	C	NM_004064		12871244	12871244	+1	no_errors	ENST00000228872	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.090	T
DCAF8L1	139425	genome.wustl.edu	37	X	27999269	27999269	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chrX:27999269G>T	ENST00000441525.1	-	1	297	c.183C>A	c.(181-183)aaC>aaA	p.N61K		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	61										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TGCTGGCATCGTTCAGGAAAC	0.507																																						dbGAP											0													155.0	113.0	127.0					X																	27999269		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.183C>A	X.37:g.27999269G>T	ENSP00000405222:p.Asn61Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXX1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N61K	ENST00000441525.1	37	c.183	CCDS35222.1	X	.	.	.	.	.	.	.	.	.	.	G	0.421	-0.908316	0.02434	.	.	ENSG00000226372	ENST00000441525	T	0.63255	-0.03	0.842	-1.68	0.08212	.	1.028280	0.07689	N	0.938400	T	0.42988	0.1227	L	0.27053	0.805	0.09310	N	1	B	0.16603	0.018	B	0.17433	0.018	T	0.19484	-1.0304	9	0.51188	T	0.08	1.3116	.	.	.	.	61	A6NGE4	DC8L1_HUMAN	K	61	ENSP00000405222:N61K	ENSP00000405222:N61K	N	-	3	2	DCAF8L1	27909190	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-1.038000	0.03553	-1.279000	0.02405	-2.327000	0.00250	AAC	DCAF8L1	-	NULL	ENSG00000226372		0.507	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	HGNC	protein_coding	OTTHUMT00000056150.2	172	0.00	0	G	XM_066690		27999269	27999269	-1	no_errors	ENST00000441525	ensembl	human	known	69_37n	missense	85	33.59	43	SNP	0.000	T
DDX39A	10212	genome.wustl.edu	37	19	14523894	14523894	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr19:14523894G>A	ENST00000242776.4	-	2	240	c.139C>T	c.(139-141)Cgg>Tgg	p.R47W	DDX39A_ENST00000454233.2_Missense_Mutation_p.R47W|DDX39A_ENST00000592927.1_5'Flank	NM_005804.3	NP_005795.2	O00148	DX39A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A	47					mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|lung(2)|ovary(1)|pancreas(1)	11						AGAAAGTCCCGGAAGCCAGAG	0.572																																						dbGAP											0													78.0	82.0	80.0					19																	14523894		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90426	CCDS12308.1	19p13.12	2011-02-08	2011-02-08	2011-02-08	ENSG00000123136	ENSG00000123136		"""DEAD-boxes"""	17821	protein-coding gene	gene with protein product	"""UAP56-related helicase, 49 kDa"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 39"""	DDX39		7601445	Standard	NM_005804		Approved	DDXL, BAT1L, URH49	uc002myo.3	O00148		ENST00000242776.4:c.139C>T	19.37:g.14523894G>A	ENSP00000242776:p.Arg47Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5M0|Q9BVP6|Q9H5W0	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R47W	ENST00000242776.4	37	c.139	CCDS12308.1	19	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045474	0.75846	.	.	ENSG00000123136	ENST00000451994;ENST00000242776;ENST00000324340;ENST00000454233	T;T;T	0.46451	0.87;0.87;0.87	4.75	3.62	0.41486	RNA helicase, DEAD-box type, Q motif (1);	0.000000	0.85682	D	0.000000	T	0.65270	0.2675	M	0.91038	3.17	0.80722	D	1	D;D	0.76494	0.999;0.992	P;P	0.57960	0.827;0.83	T	0.75499	-0.3296	10	0.87932	D	0	-27.4679	13.1725	0.59606	0.0:0.0:0.8289:0.1711	.	47;47	B1Q2N1;O00148	.;DX39A_HUMAN	W	90;47;47;47	ENSP00000242776:R47W;ENSP00000322749:R47W;ENSP00000392929:R47W	ENSP00000242776:R47W	R	-	1	2	DDX39A	14384894	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.309000	0.51903	2.182000	0.69389	0.491000	0.48974	CGG	DDX39A	-	pfscan_RNA_helicase_DEAD_Q_motif	ENSG00000123136		0.572	DDX39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39A	HGNC	protein_coding	OTTHUMT00000459880.1	63	0.00	0	G	NM_138998		14523894	14523894	-1	no_errors	ENST00000242776	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	A
EMC1	23065	genome.wustl.edu	37	1	19577940	19577940	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr1:19577940C>T	ENST00000477853.1	-	1	106	c.64G>A	c.(64-66)Gtc>Atc	p.V22I	EMC1_ENST00000375199.3_Missense_Mutation_p.V22I|EMC1_ENST00000356068.2_Missense_Mutation_p.V22I|MRTO4_ENST00000330263.4_5'Flank|EMC1_ENST00000375208.3_Missense_Mutation_p.V22I	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	22						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TCTTCGTAGACCGCGGCCGCA	0.577																																						dbGAP											0													133.0	110.0	118.0					1																	19577940		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.64G>A	1.37:g.19577940C>T	ENSP00000420608:p.Val22Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	pfam_DUF1620,superfamily_Quinonprotein_ADH-like	p.V22I	ENST00000477853.1	37	c.64	CCDS190.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040353	0.75732	.	.	ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208;ENST00000356068	T;T;T	0.20069	2.1;2.1;2.1	5.17	5.17	0.71159	.	0.203120	0.41194	D	0.000925	T	0.22322	0.0538	L	0.35288	1.05	0.80722	D	1	B;B;B;B	0.30542	0.037;0.015;0.241;0.284	B;B;B;B	0.36567	0.033;0.023;0.146;0.228	T	0.03795	-1.1003	10	0.39692	T	0.17	.	17.2673	0.87090	0.0:1.0:0.0:0.0	.	22;22;22;22	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.;.;.;K0090_HUMAN	I	22	ENSP00000420608:V22I;ENSP00000364345:V22I;ENSP00000364354:V22I	ENSP00000364329:V22I	V	-	1	0	KIAA0090	19450527	1.000000	0.71417	0.991000	0.47740	0.828000	0.46876	5.513000	0.67037	2.407000	0.81776	0.455000	0.32223	GTC	EMC1	-	NULL	ENSG00000127463		0.577	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	101	0.00	0	C	NM_015047		19577940	19577940	-1	no_errors	ENST00000477853	ensembl	human	known	69_37n	missense	57	35.96	32	SNP	0.998	T
EMILIN2	84034	genome.wustl.edu	37	18	2913121	2913121	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr18:2913121G>A	ENST00000254528.3	+	8	3040	c.2881G>A	c.(2881-2883)Gag>Aag	p.E961K	EMILIN2_ENST00000308080.5_3'UTR	NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	961	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.E961K(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		CCTCACCCCCGAGAGAGACGC	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	59.0	58.0					18																	2913121		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.2881G>A	18.37:g.2913121G>A	ENSP00000254528:p.Glu961Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	pfam_EMI_domain,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.E961K	ENST00000254528.3	37	c.2881	CCDS11828.1	18	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336725	0.60963	.	.	ENSG00000132205	ENST00000254528;ENST00000308080	T	0.03441	3.93	5.61	5.61	0.85477	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.000000	0.85682	D	0.000000	T	0.13286	0.0322	L	0.44542	1.39	0.47994	D	0.999566	D	0.76494	0.999	D	0.66497	0.944	T	0.00505	-1.1700	10	0.48119	T	0.1	-45.8899	20.0086	0.97443	0.0:0.0:1.0:0.0	.	961	Q9BXX0	EMIL2_HUMAN	K	961;238	ENSP00000254528:E961K	ENSP00000254528:E961K	E	+	1	0	EMILIN2	2903121	1.000000	0.71417	0.967000	0.41034	0.362000	0.29581	4.800000	0.62524	2.808000	0.96608	0.655000	0.94253	GAG	EMILIN2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q	ENSG00000132205		0.622	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN2	HGNC	protein_coding	OTTHUMT00000250337.2	32	0.00	0	G	NM_032048		2913121	2913121	+1	no_errors	ENST00000254528	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.998	A
FN3K	64122	genome.wustl.edu	37	17	80708405	80708405	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr17:80708405C>T	ENST00000300784.7	+	6	766	c.704C>T	c.(703-705)cCg>cTg	p.P235L	TBCD_ENST00000397466.2_5'Flank|TBCD_ENST00000355528.4_5'Flank|TBCD_ENST00000539345.2_5'Flank	NM_022158.3	NP_071441.1	Q9H479	FN3K_HUMAN	fructosamine 3 kinase	235					epithelial cell differentiation (GO:0030855)|fructoselysine metabolic process (GO:0030393)		fructosamine-3-kinase activity (GO:0030387)			central_nervous_system(1)|kidney(1)|lung(1)|urinary_tract(1)	4	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			ATTTACGACCCGGCTTCCTTC	0.572																																					Melanoma(10;391 597 14592 32548 32749)	dbGAP											0													160.0	154.0	156.0					17																	80708405		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ404615	CCDS11818.1	17q25	2008-02-05				ENSG00000167363			24822	protein-coding gene	gene with protein product		608425				11522682, 14641062	Standard	NM_022158		Approved		uc010wvs.1	Q9H479		ENST00000300784.7:c.704C>T	17.37:g.80708405C>T	ENSP00000300784:p.Pro235Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase	p.P235L	ENST00000300784.7	37	c.704	CCDS11818.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.287781	0.95517	.	.	ENSG00000167363	ENST00000300784	T	0.53640	0.61	4.47	4.47	0.54385	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79269	0.4417	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87231	0.2260	9	.	.	.	-18.3821	16.4856	0.84183	0.0:1.0:0.0:0.0	.	235	Q9H479	FN3K_HUMAN	L	235	ENSP00000300784:P235L	.	P	+	2	0	FN3K	78301694	1.000000	0.71417	0.918000	0.36340	0.931000	0.56810	7.558000	0.82253	2.200000	0.70718	0.585000	0.79938	CCG	FN3K	-	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase	ENSG00000167363		0.572	FN3K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FN3K	HGNC	protein_coding	OTTHUMT00000439229.1	44	0.00	0	C	NM_022158		80708405	80708405	+1	no_errors	ENST00000300784	ensembl	human	known	69_37n	missense	68	19.05	16	SNP	1.000	T
GALK2	2585	genome.wustl.edu	37	15	49611904	49611904	+	Silent	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr15:49611904C>T	ENST00000560031.1	+	9	1378	c.1071C>T	c.(1069-1071)gtC>gtT	p.V357V	GALK2_ENST00000396509.2_Silent_p.V333V|GALK2_ENST00000561014.1_3'UTR|GALK2_ENST00000559454.1_Silent_p.V333V|GALK2_ENST00000327171.3_Silent_p.V346V|GALK2_ENST00000544523.1_Silent_p.V333V|GALK2_ENST00000543495.1_3'UTR			Q01415	GALK2_HUMAN	galactokinase 2	357					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		AAAACATGGTCCAGCTGCTGG	0.532																																						dbGAP											0													78.0	71.0	73.0					15																	49611904		2196	4295	6491	-	-	-	SO:0001819	synonymous_variant	0				CCDS32236.1, CCDS42034.1, CCDS73724.1	15q21.1-q21.2	2013-09-20			ENSG00000156958	ENSG00000156958	2.7.1.6		4119	protein-coding gene	gene with protein product		137028					Standard	XM_005254279		Approved	GK2	uc001zxj.1	Q01415	OTTHUMG00000172325	ENST00000560031.1:c.1071C>T	15.37:g.49611904C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z4Q4	Missense_Mutation	SNP	NULL	p.P110S	ENST00000560031.1	37	c.328	CCDS42034.1	15																																																																																			GALK2	-	NULL	ENSG00000156958		0.532	GALK2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GALK2	HGNC	protein_coding	OTTHUMT00000417854.1	107	0.00	0	C			49611904	49611904	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000558399	ensembl	human	putative	69_37n	missense	52	33.33	26	SNP	0.987	T
GUCY1A2	2977	genome.wustl.edu	37	11	106810212	106810212	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr11:106810212C>T	ENST00000526355.2	-	4	1648	c.1180G>A	c.(1180-1182)Gct>Act	p.A394T	GUCY1A2_ENST00000347596.2_Missense_Mutation_p.A394T|GUCY1A2_ENST00000282249.2_Missense_Mutation_p.A394T	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	394					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	GAGCCAGAAGCCTCAGGCTTG	0.443																																						dbGAP											0													88.0	93.0	91.0					11																	106810212		2201	4298	6499	-	-	-	SO:0001583	missense	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1180G>A	11.37:g.106810212C>T	ENSP00000431245:p.Ala394Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4C4|B7ZLT5	Missense_Mutation	SNP	pfam_Haem_no_assoc-bd,pfam_A/G_cyclase,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A394T	ENST00000526355.2	37	c.1180	CCDS8335.1	11	.	.	.	.	.	.	.	.	.	.	C	10.91	1.485627	0.26686	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.88664	-2.37;-2.37;-2.41	5.67	5.67	0.87782	Haem NO binding associated (1);	0.154508	0.29466	U	0.012074	D	0.87257	0.6132	L	0.58810	1.83	0.43403	D	0.995532	B;B;B	0.16166	0.009;0.016;0.007	B;B;B	0.20767	0.031;0.025;0.023	T	0.82364	-0.0494	10	0.15952	T	0.53	.	18.7434	0.91782	0.0:1.0:0.0:0.0	.	394;394;394	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	T	394	ENSP00000431245:A394T;ENSP00000282249:A394T;ENSP00000344874:A394T	ENSP00000282249:A394T	A	-	1	0	GUCY1A2	106315422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.181000	0.42547	2.679000	0.91253	0.591000	0.81541	GCT	GUCY1A2	-	pfam_Haem_no_assoc-bd	ENSG00000152402		0.443	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	HGNC	protein_coding	OTTHUMT00000389003.2	24	0.00	0	C			106810212	106810212	-1	no_errors	ENST00000282249	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	1.000	T
HLA-B	3106	genome.wustl.edu	37	6	31324601	31324602	+	Frame_Shift_Ins	INS	-	-	A	rs41562914|rs41541416|rs9281379	byFrequency	TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr6:31324601_31324602insA	ENST00000412585.2	-	2	234_235	c.206_207insT	c.(205-207)gagfs	p.E69fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	69	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.E69fs*30(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CCCGCGGCTCCTCTCTCGGACT	0.673									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				|||unknown(NO_COVERAGE)	34	0.00678914	0.0	0.0014	5008	,	,		7961	0.0188		0.0	False		,,,				2504	0.0143					dbGAP											2	Insertion - Frameshift(2)	large_intestine(2)								1399,160,2559		395,63,546,25,47,983						0.1	0.1		dbSNP_130	35	1793,477,5714		469,110,745,86,195,2387	no	codingComplex	HLA-B	NM_005514.6		864,173,1291,111,242,3370	A1A1,A1A2,A1R,A2A2,A2R,RR		28.4319,37.8582,31.6394				3192,637,8273				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.206_207insT	6.37:g.31324601_31324602insA	ENSP00000399168:p.Glu69fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q29764	Frame_Shift_Ins	INS	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.E69fs	ENST00000412585.2	37	c.207_206	CCDS34394.1	6																																																																																			HLA-B	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000234745		0.673	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	84	0.00	0	-	NM_005514		31324601	31324602	-1	no_errors	ENST00000412585	ensembl	human	known	69_37n	frame_shift_ins	86	14.00	14	INS	0.090:0.000	A
IGKV1-39	28930	genome.wustl.edu	37	2	89619806	89619806	+	RNA	SNP	G	G	A	rs114472229	byFrequency	TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr2:89619806G>A	ENST00000498574.1	-	0	98									immunoglobulin kappa variable 1-39 (gene/pseudogene)																		TCCTTACCTCGGAGCCAGAGT	0.522																																						dbGAP											0													6.0	7.0	7.0					2																	89619806		1093	2290	3383	-	-	-			0			X59315		2p11.2	2012-02-08	2008-09-12		ENSG00000242371	ENSG00000242371		"""Immunoglobulins / IGK locus"""	5740	other	immunoglobulin gene			"""immunoglobulin kappa variable 1-39"""				Standard	NG_000834		Approved				OTTHUMG00000151678		2.37:g.89619806G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R18*	ENST00000498574.1	37	c.52		2																																																																																			IGKV1-39	-	NULL	ENSG00000242371		0.522	IGKV1-39-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1-39	HGNC	IG_V_gene	OTTHUMT00000323476.1	19	0.00	0	G	NG_000834		89619806	89619806	-1	no_stop_codon	ENST00000498574	ensembl	human	known	69_37n	nonsense	28	22.22	8	SNP	0.010	A
KRTAP5-10	387273	genome.wustl.edu	37	11	71276951	71276951	+	Silent	SNP	T	T	C	rs76397897	byFrequency	TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr11:71276951T>C	ENST00000398531.1	+	1	343	c.318T>C	c.(316-318)tcT>tcC	p.S106S	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	106	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GCTGTGGTTCTTGTGGGGGCT	0.672																																						dbGAP											0													39.0	60.0	53.0					11																	71276951		2166	4268	6434	-	-	-	SO:0001819	synonymous_variant	0			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.318T>C	11.37:g.71276951T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EHA4	Silent	SNP	NULL	p.S106	ENST00000398531.1	37	c.318	CCDS41684.1	11																																																																																			KRTAP5-10	-	NULL	ENSG00000204572		0.672	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP5-10	HGNC	protein_coding	OTTHUMT00000127968.2	27	0.00	0	T			71276951	71276951	+1	no_errors	ENST00000398531	ensembl	human	known	69_37n	silent	46	16.36	9	SNP	0.000	C
MIR526B	574468	genome.wustl.edu	37	19	54198526	54198526	+	RNA	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr19:54198526C>T	ENST00000384848.1	+	0	83				MIR525_ENST00000384978.1_RNA|MIR519B_ENST00000385090.1_RNA	NR_030190.1				microRNA 526b																		GAAAGTGCATCCTTTTAGAGG	0.423																																						dbGAP											0													133.0	124.0	127.0					19																	54198526		1568	3582	5150	-	-	-			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207580	ENSG00000207580		"""ncRNAs / Micro RNAs"""	32100	non-coding RNA	RNA, micro				MIRN526B			Standard	NR_030190		Approved	hsa-mir-526b	uc021uzt.1				19.37:g.54198526C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000384848.1	37	NULL		19																																																																																			MIR519B	-	-	ENSG00000207825		0.423	MIR526B-201	KNOWN	basic	miRNA	MIR519B	HGNC	miRNA		79	0.00	0	C	NR_030190		54198526	54198526	+1	no_errors	ENST00000385090	ensembl	human	known	69_37n	rna	114	16.79	23	SNP	0.039	T
MXRA5	25878	genome.wustl.edu	37	X	3248432	3248432	+	Silent	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chrX:3248432G>A	ENST00000217939.6	-	4	490	c.336C>T	c.(334-336)taC>taT	p.Y112Y		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	112						extracellular vesicular exosome (GO:0070062)		p.Y112*(4)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TCAGCTTGTTGTAGCTGAACT	0.428																																						dbGAP											4	Substitution - Nonsense(4)	lung(4)											48.0	43.0	45.0					X																	3248432		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.336C>T	X.37:g.3248432G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Y112	ENST00000217939.6	37	c.336	CCDS14124.1	X																																																																																			MXRA5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000101825		0.428	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	48	0.00	0	G	NM_015419		3248432	3248432	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	silent	44	18.18	10	SNP	1.000	A
NRK	203447	genome.wustl.edu	37	X	105153759	105153759	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chrX:105153759C>T	ENST00000243300.9	+	13	2429	c.2126C>T	c.(2125-2127)tCa>tTa	p.S709L	NRK_ENST00000428173.2_Missense_Mutation_p.S710L	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	709					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GCAAAGTCATCATGGAGACCT	0.458										HNSCC(51;0.14)																												dbGAP											0													27.0	24.0	25.0					X																	105153759		1886	4099	5985	-	-	-	SO:0001583	missense	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2126C>T	X.37:g.105153759C>T	ENSP00000434830:p.Ser709Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.S710L	ENST00000243300.9	37	c.2129		X	.	.	.	.	.	.	.	.	.	.	C	4.143	0.024939	0.08054	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.79247	-1.24;-1.25	4.39	3.22	0.36961	.	0.387161	0.18834	N	0.129886	T	0.55146	0.1902	N	0.17082	0.46	0.20873	N	0.999831	B;B	0.12013	0.005;0.001	B;B	0.14578	0.011;0.002	T	0.39143	-0.9628	10	0.02654	T	1	.	7.9259	0.29874	0.0:0.8404:0.0:0.1596	.	377;709	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	L	709;710	ENSP00000434830:S709L;ENSP00000438378:S710L	ENSP00000434830:S709L	S	+	2	0	NRK	105040415	0.500000	0.26091	0.159000	0.22649	0.299000	0.27559	0.964000	0.29306	0.905000	0.36596	0.600000	0.82982	TCA	NRK	-	NULL	ENSG00000123572		0.458	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	36	0.00	0	C	NM_198465		105153759	105153759	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	0.137	T
NT5C3B	115024	genome.wustl.edu	37	17	39988648	39988648	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr17:39988648C>T	ENST00000435506.2	-	5	379	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	NT5C3B_ENST00000269534.8_Missense_Mutation_p.E96K|NT5C3B_ENST00000521789.1_Missense_Mutation_p.E71K			Q969T7	5NT3B_HUMAN	5'-nucleotidase, cytosolic IIIB	104					nucleotide metabolic process (GO:0009117)	cytoplasm (GO:0005737)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										ACTCACCATTCCACCATATGA	0.527																																						dbGAP											0													178.0	131.0	147.0					17																	39988648		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11410.1, CCDS11410.2	17q21.2	2013-01-31	2013-01-31	2013-01-31	ENSG00000141698	ENSG00000141698	3.1.3.5		28300	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic III-like"""	NT5C3L		23223233	Standard	NM_052935		Approved	MGC20781	uc021txo.1	Q969T7	OTTHUMG00000133499	ENST00000435506.2:c.310G>A	17.37:g.39988648C>T	ENSP00000389948:p.Glu104Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWB9|C9JKC4|Q7L3B7	Missense_Mutation	SNP	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	p.E96K	ENST00000435506.2	37	c.286	CCDS11410.2	17	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660645	0.67586	.	.	ENSG00000141698	ENST00000269534;ENST00000521789;ENST00000393911;ENST00000435506;ENST00000415460	D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97	5.5	4.51	0.55191	HAD-like domain (1);	0.053204	0.64402	D	0.000001	D	0.86543	0.5958	M	0.85859	2.78	0.80722	D	1	B;P;B	0.44429	0.045;0.835;0.045	B;B;B	0.39152	0.02;0.292;0.02	D	0.88221	0.2897	10	0.62326	D	0.03	.	15.6601	0.77178	0.0:0.8574:0.1426:0.0	.	104;71;96	C9JKC4;E5RH64;Q969T7	.;.;5NT3L_HUMAN	K	96;71;138;104;104	ENSP00000269534:E96K;ENSP00000429878:E71K;ENSP00000389948:E104K;ENSP00000397742:E104K	ENSP00000269534:E96K	E	-	1	0	NT5C3L	37242174	1.000000	0.71417	0.958000	0.39756	0.664000	0.39144	6.029000	0.70895	1.290000	0.44636	0.456000	0.33151	GAA	NT5C3L	-	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	ENSG00000141698		0.527	NT5C3B-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NT5C3L	HGNC	protein_coding	OTTHUMT00000257430.2	165	0.00	0	C	NM_052935		39988648	39988648	-1	no_errors	ENST00000269534	ensembl	human	known	69_37n	missense	94	35.17	51	SNP	1.000	T
NT5DC2	64943	genome.wustl.edu	37	3	52568585	52568585	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr3:52568585G>A	ENST00000307076.4	-	1	485	c.85C>T	c.(85-87)Cac>Tac	p.H29Y	SMIM4_ENST00000482728.1_3'UTR|NT5DC2_ENST00000459839.1_5'Flank|NT5DC2_ENST00000422318.2_5'Flank|SMIM4_ENST00000477703.1_5'Flank|SMIM4_ENST00000476842.1_5'Flank|SMIM4_ENST00000307106.3_5'Flank|NT5DC2_ENST00000307092.4_5'Flank|NT5DC2_ENST00000490681.1_5'Flank	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	29							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		CGCCCCTCGTGAGATGCTGTG	0.597																																						dbGAP											0													130.0	128.0	129.0					3																	52568585		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.85C>T	3.37:g.52568585G>A	ENSP00000302468:p.His29Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	p.H29Y	ENST00000307076.4	37	c.85	CCDS2858.1	3	.	.	.	.	.	.	.	.	.	.	G	9.462	1.093334	0.20471	.	.	ENSG00000168268	ENST00000307076	T	0.21191	2.02	2.7	1.82	0.25136	.	0.352176	0.29300	U	0.012541	T	0.07143	0.0181	N	0.08118	0	0.09310	N	0.999996	B	0.09022	0.002	B	0.12156	0.007	T	0.39742	-0.9599	10	0.02654	T	1	.	5.3713	0.16140	0.16:0.0:0.84:0.0	.	29	Q9H857	NT5D2_HUMAN	Y	29	ENSP00000302468:H29Y	ENSP00000302468:H29Y	H	-	1	0	NT5DC2	52543625	0.093000	0.21703	0.002000	0.10522	0.149000	0.21700	1.999000	0.40806	0.693000	0.31634	0.563000	0.77884	CAC	NT5DC2	-	pirsf_Pur_nucleotidase	ENSG00000168268		0.597	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NT5DC2	HGNC	protein_coding	OTTHUMT00000351509.1	46	0.00	0	G	NM_022908		52568585	52568585	-1	no_errors	ENST00000307076	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	0.002	A
OCSTAMP	128506	genome.wustl.edu	37	20	45174553	45174553	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr20:45174553C>T	ENST00000279028.2	-	2	473	c.460G>A	c.(460-462)Gag>Aag	p.E154K		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	154					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						AGGGAGCCCTCGGTGACACAC	0.662																																						dbGAP											0													44.0	50.0	48.0					20																	45174553		692	1591	2283	-	-	-	SO:0001583	missense	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.460G>A	20.37:g.45174553C>T	ENSP00000279028:p.Glu154Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DC_STAMP-like	p.E154K	ENST00000279028.2	37	c.460	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047099	0.55110	.	.	ENSG00000149635	ENST00000279028	T	0.52295	0.67	4.58	3.59	0.41128	.	1.030060	0.07679	N	0.936752	T	0.40498	0.1119	L	0.56769	1.78	0.38390	D	0.945384	P	0.48162	0.906	B	0.38296	0.27	T	0.53549	-0.8423	10	0.44086	T	0.13	-21.9846	5.1819	0.15165	0.0:0.4602:0.3971:0.1427	.	154	Q9BR26	CT123_HUMAN	K	154	ENSP00000279028:E154K	ENSP00000279028:E154K	E	-	1	0	C20orf123	44607960	0.730000	0.28100	0.992000	0.48379	0.948000	0.59901	1.778000	0.38614	2.363000	0.80096	0.555000	0.69702	GAG	OCSTAMP	-	NULL	ENSG00000149635		0.662	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	52	0.00	0	C	XM_496476		45174553	45174553	-1	no_errors	ENST00000279028	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	0.940	T
PCDH11X	27328	genome.wustl.edu	37	X	91131969	91131969	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chrX:91131969G>A	ENST00000373094.1	+	2	1575	c.730G>A	c.(730-732)Gac>Aac	p.D244N	PCDH11X_ENST00000373097.1_Missense_Mutation_p.D244N|PCDH11X_ENST00000373088.1_Missense_Mutation_p.D244N|PCDH11X_ENST00000361655.2_Missense_Mutation_p.D244N|PCDH11X_ENST00000361724.1_Missense_Mutation_p.D244N|PCDH11X_ENST00000298274.8_Missense_Mutation_p.D244N|PCDH11X_ENST00000406881.1_Missense_Mutation_p.D244N|PCDH11X_ENST00000395337.2_Missense_Mutation_p.D244N|PCDH11X_ENST00000504220.2_Missense_Mutation_p.D244N	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	244	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.			TND -> PNA (in Ref. 4; AAK82655/ AAK82656). {ECO:0000305}.	homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TGATACAAATGACAACCACCC	0.433																																					NSCLC(38;925 1092 2571 38200 45895)	dbGAP											0													183.0	160.0	168.0					X																	91131969		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.730G>A	X.37:g.91131969G>A	ENSP00000362186:p.Asp244Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D244N	ENST00000373094.1	37	c.730	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287621	0.80803	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58	4.63	4.63	0.57726	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.88239	0.6383	H	0.94658	3.565	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.999;0.997;0.999;0.999	D	0.91863	0.5501	10	0.87932	D	0	.	15.613	0.76740	0.0:0.0:1.0:0.0	.	244;244;244;244;244;244;244;244	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	N	244	ENSP00000378746:D244N;ENSP00000362186:D244N;ENSP00000362189:D244N;ENSP00000355040:D244N;ENSP00000362180:D244N;ENSP00000423762:D244N;ENSP00000355105:D244N;ENSP00000384758:D244N;ENSP00000298274:D244N	ENSP00000298274:D244N	D	+	1	0	PCDH11X	91018625	1.000000	0.71417	0.979000	0.43373	0.712000	0.41017	9.507000	0.97996	1.870000	0.54199	0.544000	0.68410	GAC	PCDH11X	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000102290		0.433	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	92	0.00	0	G	NM_032969		91131969	91131969	+1	no_errors	ENST00000373094	ensembl	human	known	69_37n	missense	83	16.16	16	SNP	1.000	A
PNMA5	114824	genome.wustl.edu	37	X	152159358	152159358	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chrX:152159358A>G	ENST00000439251.1	-	2	1223	c.785T>C	c.(784-786)tTc>tCc	p.F262S	PNMA5_ENST00000452693.1_Missense_Mutation_p.F262S|PNMA5_ENST00000361887.5_Missense_Mutation_p.F262S|PNMA5_ENST00000535214.1_Missense_Mutation_p.F262S	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	262					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					GCGCAGCAGGAAAGTGGAGAC	0.517																																						dbGAP											0													64.0	63.0	64.0					X																	152159358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.785T>C	X.37:g.152159358A>G	ENSP00000388850:p.Phe262Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	NULL	p.F262S	ENST00000439251.1	37	c.785	CCDS14718.1	X	.	.	.	.	.	.	.	.	.	.	a	16.06	3.016832	0.54576	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	2.82	0.118	0.14667	.	.	.	.	.	T	0.24160	0.0585	M	0.66939	2.045	0.09310	N	1	D	0.60575	0.988	P	0.58520	0.84	T	0.09552	-1.0669	9	0.48119	T	0.1	.	5.0752	0.14628	0.4806:0.0:0.0:0.5194	.	262	Q96PV4	PNMA5_HUMAN	S	262	ENSP00000354834:F262S;ENSP00000445775:F262S;ENSP00000388850:F262S;ENSP00000392342:F262S	ENSP00000354834:F262S	F	-	2	0	PNMA5	151910014	0.054000	0.20591	0.001000	0.08648	0.348000	0.29142	0.844000	0.27654	-0.047000	0.13423	0.237000	0.17872	TTC	PNMA5	-	NULL	ENSG00000198883		0.517	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA5	HGNC	protein_coding	OTTHUMT00000060925.1	24	0.00	0	A	NM_052926		152159358	152159358	-1	no_errors	ENST00000361887	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.002	G
PPARGC1B	133522	genome.wustl.edu	37	5	149212395	149212395	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr5:149212395C>G	ENST00000309241.5	+	5	791	c.759C>G	c.(757-759)gaC>gaG	p.D253E	PPARGC1B_ENST00000394320.3_Missense_Mutation_p.D253E|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.D189E|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.D214E	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	253					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CGGGTGAGGACTGCCCGAGCC	0.692																																						dbGAP											0													32.0	41.0	38.0					5																	149212395		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.759C>G	5.37:g.149212395C>G	ENSP00000312649:p.Asp253Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D253E	ENST00000309241.5	37	c.759	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360810	0.61403	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.10382	2.88;3.01;3.03;2.88	5.76	3.94	0.45596	.	0.000000	0.85682	D	0.000000	T	0.24851	0.0603	M	0.61703	1.905	0.32670	N	0.516878	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999	D;D;D;D;D	0.83275	0.996;0.996;0.996;0.991;0.986	T	0.19192	-1.0313	10	0.25106	T	0.35	-14.5617	9.0751	0.36515	0.0:0.7703:0.0:0.2297	.	232;232;214;253;253	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	E	214;253;253;189	ENSP00000353638:D214E;ENSP00000377855:D253E;ENSP00000312649:D253E;ENSP00000384403:D189E	ENSP00000312649:D253E	D	+	3	2	PPARGC1B	149192588	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.558000	0.36309	1.402000	0.46780	0.655000	0.94253	GAC	PPARGC1B	-	NULL	ENSG00000155846		0.692	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	21	0.00	0	C	NM_133263		149212395	149212395	+1	no_errors	ENST00000309241	ensembl	human	known	69_37n	missense	15	27.27	6	SNP	1.000	G
PPP1R32	220004	genome.wustl.edu	37	11	61252873	61252873	+	Splice_Site	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr11:61252873G>A	ENST00000338608.2	+	6	699	c.574G>A	c.(574-576)Gat>Aat	p.D192N	RP11-286N22.8_ENST00000544880.1_3'UTR|PPP1R32_ENST00000432063.2_Splice_Site_p.D192N	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	192							phosphatase binding (GO:0019902)										AGACCAGCCAGGTAGGCCCTG	0.592																																						dbGAP											0													109.0	96.0	101.0					11																	61252873		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.574+1G>A	11.37:g.61252873G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0P4|Q96M77	Missense_Mutation	SNP	NULL	p.D192N	ENST00000338608.2	37	c.574	CCDS8008.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.067788	0.93950	.	.	ENSG00000162148	ENST00000432063;ENST00000338608	T;T	0.47869	0.83;1.41	4.92	4.92	0.64577	.	0.089250	0.47093	D	0.000254	T	0.64294	0.2585	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.60875	-0.7176	10	0.27785	T	0.31	-27.019	15.0418	0.71796	0.0:0.0:1.0:0.0	.	192;192	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	N	192	ENSP00000391560:D192N;ENSP00000344140:D192N	ENSP00000344140:D192N	D	+	1	0	C11orf66	61009449	1.000000	0.71417	0.986000	0.45419	0.461000	0.32589	5.233000	0.65337	2.268000	0.75426	0.462000	0.41574	GAT	PPP1R32	-	NULL	ENSG00000162148		0.592	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R32	HGNC	protein_coding	OTTHUMT00000398621.1	86	0.00	0	G	NM_145017	Missense_Mutation	61252873	61252873	+1	no_errors	ENST00000338608	ensembl	human	known	69_37n	missense	58	21.62	16	SNP	1.000	A
RHBDL3	162494	genome.wustl.edu	37	17	30625209	30625209	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr17:30625209C>T	ENST00000269051.4	+	6	781	c.767C>T	c.(766-768)gCc>gTc	p.A256V	RHBDL3_ENST00000538145.1_Missense_Mutation_p.A248V|RHBDL3_ENST00000536287.1_Missense_Mutation_p.A158V	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	256						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				GTCTACGTGGCCGGTGTTGTG	0.642																																						dbGAP											0													129.0	107.0	114.0					17																	30625209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.767C>T	17.37:g.30625209C>T	ENSP00000269051:p.Ala256Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	pfam_Peptidase_S54_rhomboid_dom,pirsf_Peptidase_S54_rhomboid_met,pfscan_EF_HAND_2	p.A256V	ENST00000269051.4	37	c.767	CCDS32613.1	17	.	.	.	.	.	.	.	.	.	.	C	27.7	4.858344	0.91433	.	.	ENSG00000141314	ENST00000431505;ENST00000269051;ENST00000538145;ENST00000536287	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	5.72	5.72	0.89469	Peptidase S54, rhomboid domain (1);	0.103271	0.64402	D	0.000002	T	0.27866	0.0686	L	0.31476	0.935	0.49213	D	0.999769	D;D;D	0.71674	0.998;0.96;0.96	D;P;P	0.67725	0.953;0.755;0.755	T	0.00754	-1.1580	10	0.52906	T	0.07	-26.8504	19.8863	0.96913	0.0:1.0:0.0:0.0	.	256;248;256	E9PD28;Q495Y5;P58872	.;.;RHBL3_HUMAN	V	256;256;248;158	ENSP00000394849:A256V;ENSP00000269051:A256V;ENSP00000442092:A248V;ENSP00000466508:A158V	ENSP00000269051:A256V	A	+	2	0	RHBDL3	27649322	1.000000	0.71417	0.965000	0.40720	0.967000	0.64934	5.848000	0.69458	2.706000	0.92434	0.561000	0.74099	GCC	RHBDL3	-	pfam_Peptidase_S54_rhomboid_dom,pirsf_Peptidase_S54_rhomboid_met	ENSG00000141314		0.642	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RHBDL3	HGNC	protein_coding	OTTHUMT00000447120.1	97	0.00	0	C	NM_138328		30625209	30625209	+1	no_errors	ENST00000269051	ensembl	human	known	69_37n	missense	65	32.99	32	SNP	0.998	T
RILPL1	353116	genome.wustl.edu	37	12	124008165	124008165	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr12:124008165G>A	ENST00000376874.4	-	2	572	c.337C>T	c.(337-339)Cga>Tga	p.R113*		NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	113					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GCCTCCCCTCGCCACACATCC	0.632																																						dbGAP											0													37.0	41.0	39.0					12																	124008165		2119	4230	6349	-	-	-	SO:0001587	stop_gained	0			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.337C>T	12.37:g.124008165G>A	ENSP00000366070:p.Arg113*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q66K36|Q8N1M0	Nonsense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,pfam_RILP	p.R113*	ENST00000376874.4	37	c.337	CCDS45006.1	12	.	.	.	.	.	.	.	.	.	.	G	38	7.246504	0.98161	.	.	ENSG00000188026	ENST00000376874	.	.	.	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.3795	14.5506	0.68065	0.0:0.0:0.8446:0.1554	.	.	.	.	X	113	.	ENSP00000366070:R113X	R	-	1	2	RILPL1	122574118	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	1.835000	0.39181	2.488000	0.83962	0.655000	0.94253	CGA	RILPL1	-	pfam_JNK/Rab-associated_protein-1_N	ENSG00000188026		0.632	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RILPL1	HGNC	protein_coding	OTTHUMT00000400595.1	58	0.00	0	G	NM_178314		124008165	124008165	-1	no_errors	ENST00000376874	ensembl	human	known	69_37n	nonsense	26	35.71	15	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	33855084	33855084	+	Missense_Mutation	SNP	G	G	A	rs368395906		TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr15:33855084G>A	ENST00000389232.4	+	11	1089	c.1019G>A	c.(1018-1020)gGc>gAc	p.G340D	RYR3_ENST00000415757.3_Missense_Mutation_p.G340D	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	340					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GACATAGAAGGCATGGGAGTT	0.418																																						dbGAP											0													91.0	90.0	91.0					15																	33855084		1882	4118	6000	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1019G>A	15.37:g.33855084G>A	ENSP00000373884:p.Gly340Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.G340D	ENST00000389232.4	37	c.1019	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986114	0.93044	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.87887	-2.31;-2.31	5.27	5.27	0.74061	MIR motif (1);MIR (2);	0.000000	0.85682	D	0.000000	D	0.93579	0.7950	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.97110	1.0;0.767	D	0.93671	0.6990	10	0.62326	D	0.03	.	18.6774	0.91534	0.0:0.0:1.0:0.0	.	340;340	Q15413-2;Q15413	.;RYR3_HUMAN	D	340	ENSP00000373884:G340D;ENSP00000399610:G340D	ENSP00000354735:G340D	G	+	2	0	RYR3	31642376	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.491000	0.97954	2.748000	0.94277	0.655000	0.94253	GGC	RYR3	-	pfam_MIR,superfamily_MIR,smart_MIR_motif	ENSG00000198838		0.418	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	63	0.00	0	G			33855084	33855084	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	1.000	A
SIDT2	51092	genome.wustl.edu	37	11	117063014	117063014	+	Silent	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr11:117063014C>T	ENST00000324225.4	+	20	2448	c.1917C>T	c.(1915-1917)atC>atT	p.I639I	SIDT2_ENST00000431081.2_Silent_p.I636I|SIDT2_ENST00000532062.1_5'Flank	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	639					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TCTTCTCCATCATTCACATCA	0.632																																						dbGAP											0													124.0	104.0	110.0					11																	117063014		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1917C>T	11.37:g.117063014C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBY7|Q9Y357	Silent	SNP	NULL	p.I660	ENST00000324225.4	37	c.1980	CCDS31682.1	11																																																																																			SIDT2	-	NULL	ENSG00000149577		0.632	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1	58	0.00	0	C	NM_015996		117063014	117063014	+1	no_errors	ENST00000278951	ensembl	human	known	69_37n	silent	29	27.50	11	SNP	1.000	T
SMAD4	4089	genome.wustl.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H|SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																						dbGAP											50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	GRCh37	CM004254	SMAD4	M							167.0	138.0	148.0					18																	48591919		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	18.37:g.48591919G>A	ENSP00000341551:p.Arg361His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K405	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R361H	ENST00000342988.3	37	c.1082	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	112	0.00	0	G	NM_005359		48591919	48591919	+1	no_errors	ENST00000342988	ensembl	human	known	69_37n	missense	41	36.92	24	SNP	1.000	A
SSX9	280660	genome.wustl.edu	37	X	48164277	48164277	+	RNA	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chrX:48164277G>A	ENST00000608568.1	-	0	92					NR_073393.1		Q7RTT3	SSX9_HUMAN	synovial sarcoma, X breakpoint 9						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	8						CATCGTCTCCGTTCATGGCAC	0.552																																						dbGAP											0													223.0	198.0	206.0					X																	48164277		2203	4299	6502	-	-	-			0			BK000689		Xp11.23	2013-01-16			ENSG00000204648	ENSG00000204648			19655	other	unknown		300544				12216073	Standard	NR_073393		Approved		uc031tjk.1	Q7RTT3	OTTHUMG00000021490		X.37:g.48164277G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.N2	ENST00000608568.1	37	c.6		X																																																																																			SSX9	-	NULL	ENSG00000204648		0.552	SSX9-002	KNOWN	basic	retained_intron	SSX9	HGNC	pseudogene	OTTHUMT00000472372.1	174	0.00	0	G	NR_073393		48164277	48164277	-1	no_errors	ENST00000376909	ensembl	human	known	69_37n	silent	139	31.55	65	SNP	0.000	A
SYCP1	6847	genome.wustl.edu	37	1	115419390	115419390	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr1:115419390G>A	ENST00000369522.3	+	11	1000	c.760G>A	c.(760-762)Gaa>Aaa	p.E254K	SYCP1_ENST00000369518.1_Missense_Mutation_p.E254K	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	254					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAACACCTTGAACAAGAATA	0.224																																						dbGAP											0													20.0	23.0	22.0					1																	115419390		2107	4125	6232	-	-	-	SO:0001583	missense	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.760G>A	1.37:g.115419390G>A	ENSP00000358535:p.Glu254Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O14963|Q5VXJ6	Missense_Mutation	SNP	pfam_SCP-1	p.E254K	ENST00000369522.3	37	c.760	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910755	0.52439	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.56103	0.48;0.48;0.48	4.92	4.92	0.64577	.	0.107287	0.64402	D	0.000006	T	0.41858	0.1177	L	0.39898	1.24	0.39479	D	0.967857	D;D	0.53312	0.959;0.959	P;P	0.53689	0.732;0.732	T	0.20338	-1.0278	10	0.12430	T	0.62	-8.4804	15.9721	0.80027	0.0:0.0:1.0:0.0	.	254;254	B7ZLS9;Q15431	.;SYCP1_HUMAN	K	254	ENSP00000358535:E254K;ENSP00000410011:E254K;ENSP00000358531:E254K	ENSP00000358531:E254K	E	+	1	0	SYCP1	115220913	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.128000	0.50492	2.432000	0.82394	0.650000	0.86243	GAA	SYCP1	-	pfam_SCP-1	ENSG00000198765		0.224	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1	31	0.00	0	G	NM_003176		115419390	115419390	+1	no_errors	ENST00000369518	ensembl	human	known	69_37n	missense	43	32.81	21	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152529115	152529115	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr6:152529115C>A	ENST00000367255.5	-	125	23417	c.22816G>T	c.(22816-22818)Gaa>Taa	p.E7606*	SYNE1_ENST00000341594.5_Nonsense_Mutation_p.E7218*|SYNE1_ENST00000356820.4_Nonsense_Mutation_p.E2130*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.E7606*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.E7535*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.E7535*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7606					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACCTGCACTTCATCAAAGAGG	0.468										HNSCC(10;0.0054)																												dbGAP											0													181.0	148.0	159.0					6																	152529115		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.22816G>T	6.37:g.152529115C>A	ENSP00000356224:p.Glu7606*	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E7606*	ENST00000367255.5	37	c.22816	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	49	15.482442	0.99835	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	.	.	.	5.58	4.7	0.59300	.	0.221107	0.31312	N	0.007873	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	16.4823	0.84161	0.0:0.8688:0.1312:0.0	.	.	.	.	X	7606;252;7535;7606;7535;7218;2130;528	.	ENSP00000265368:E7606X	E	-	1	0	SYNE1	152570808	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.225000	0.51246	1.337000	0.45525	0.563000	0.77884	GAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.468	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	91	0.00	0	C	NM_182961		152529115	152529115	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	nonsense	50	12.28	7	SNP	1.000	A
TBC1D2	55357	genome.wustl.edu	37	9	100962632	100962632	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr9:100962632T>C	ENST00000375064.1	-	12	2520	c.2482A>G	c.(2482-2484)Att>Gtt	p.I828V	TBC1D2_ENST00000375066.5_Intron|TBC1D2_ENST00000375063.1_Missense_Mutation_p.I368V|TBC1D2_ENST00000342112.5_Missense_Mutation_p.I610V	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	828					positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TACTTGAAAATGGCCAAGGCA	0.577																																						dbGAP											0													80.0	59.0	66.0					9																	100962632		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.2482A>G	9.37:g.100962632T>C	ENSP00000364205:p.Ile828Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.I828V	ENST00000375064.1	37	c.2482		9	.	.	.	.	.	.	.	.	.	.	T	12.08	1.830347	0.32329	.	.	ENSG00000095383	ENST00000375064;ENST00000342112;ENST00000375063	T;T;T	0.27402	1.67;1.67;1.67	4.53	3.37	0.38596	Rab-GAP/TBC domain (3);	0.109877	0.37577	U	0.002033	T	0.26448	0.0646	.	.	.	0.21256	N	0.999741	P	0.38148	0.62	B	0.42995	0.404	T	0.09751	-1.0660	9	0.33940	T	0.23	.	6.7318	0.23387	0.1377:0.0835:0.0:0.7788	.	828	Q9BYX2	TBD2A_HUMAN	V	828;610;368	ENSP00000364205:I828V;ENSP00000341567:I610V;ENSP00000364203:I368V	ENSP00000341567:I610V	I	-	1	0	TBC1D2	100002453	1.000000	0.71417	0.999000	0.59377	0.727000	0.41649	2.940000	0.49003	0.231000	0.21079	-1.366000	0.01203	ATT	TBC1D2	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom	ENSG00000095383		0.577	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	TBC1D2	HGNC	protein_coding	OTTHUMT00000053366.1	66	0.00	0	T	NM_018421		100962632	100962632	-1	no_errors	ENST00000375064	ensembl	human	known	69_37n	missense	41	36.92	24	SNP	1.000	C
TGS1	96764	genome.wustl.edu	37	8	56686187	56686187	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr8:56686187G>A	ENST00000260129.5	+	1	487	c.10G>A	c.(10-12)Gag>Aag	p.E4K	TMEM68_ENST00000521229.1_5'Flank|TMEM68_ENST00000519784.1_5'Flank|TMEM68_ENST00000522576.1_5'Flank|TMEM68_ENST00000434581.2_5'Flank|TMEM68_ENST00000523073.1_5'Flank|TMEM68_ENST00000334667.2_5'Flank	NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	4					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AATGTGCTGCGAGAAGTGGAG	0.567																																					Esophageal Squamous(34;275 823 4842 34837 48447)	dbGAP											0													104.0	102.0	102.0					8																	56686187		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.10G>A	8.37:g.56686187G>A	ENSP00000260129:p.Glu4Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.E4K	ENST00000260129.5	37	c.10	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486626	0.63962	.	.	ENSG00000137574	ENST00000260129	T	0.11063	2.81	4.97	4.1	0.47936	.	0.341831	0.28448	N	0.015301	T	0.09247	0.0228	L	0.41027	1.25	0.25150	N	0.990436	B	0.18968	0.032	B	0.09377	0.004	T	0.23226	-1.0194	10	0.23891	T	0.37	-11.3004	10.8371	0.46694	0.0882:0.0:0.9118:0.0	.	4	Q96RS0	TGS1_HUMAN	K	4	ENSP00000260129:E4K	ENSP00000260129:E4K	E	+	1	0	TGS1	56848741	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.665000	0.46791	1.454000	0.47793	0.655000	0.94253	GAG	TGS1	-	NULL	ENSG00000137574		0.567	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	69	0.00	0	G	NM_024831		56686187	56686187	+1	no_errors	ENST00000260129	ensembl	human	known	69_37n	missense	74	11.90	10	SNP	1.000	A
UGGT2	55757	genome.wustl.edu	37	13	96506620	96506620	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr13:96506620C>T	ENST00000376747.3	-	35	4188	c.4118G>A	c.(4117-4119)tGg>tAg	p.W1373*		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1373	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TCCTGTTTTCCAGAAACGATA	0.383																																						dbGAP											0													118.0	113.0	115.0					13																	96506620		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.4118G>A	13.37:g.96506620C>T	ENSP00000365938:p.Trp1373*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Nonsense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.W1373*	ENST00000376747.3	37	c.4118	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	43	9.860604	0.99281	.	.	ENSG00000102595	ENST00000376747	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.1148	19.0987	0.93265	0.0:1.0:0.0:0.0	.	.	.	.	X	1373	.	ENSP00000365938:W1373X	W	-	2	0	UGGT2	95304621	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.487000	0.81328	2.512000	0.84698	0.591000	0.81541	TGG	UGGT2	-	pfam_Glyco_trans_8	ENSG00000102595		0.383	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	75	0.00	0	C	NM_020121		96506620	96506620	-1	no_errors	ENST00000376747	ensembl	human	known	69_37n	nonsense	29	23.68	9	SNP	1.000	T
UNC13A	23025	genome.wustl.edu	37	19	17756912	17756912	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr19:17756912C>T	ENST00000519716.2	-	18	2052	c.2053G>A	c.(2053-2055)Gcc>Acc	p.A685T	UNC13A_ENST00000552293.1_Missense_Mutation_p.A685T|UNC13A_ENST00000550896.1_Missense_Mutation_p.A683T|UNC13A_ENST00000551649.1_Missense_Mutation_p.A685T|UNC13A_ENST00000428389.2_Missense_Mutation_p.A773T|UNC13A_ENST00000252773.7_Missense_Mutation_p.A685T	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	685	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.A685T(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						AAGCCCTGGGCGCAGACCACT	0.557																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											67.0	66.0	66.0					19																	17756912		2078	4249	6327	-	-	-	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2053G>A	19.37:g.17756912C>T	ENSP00000429562:p.Ala685Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.A773T	ENST00000519716.2	37	c.2317	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052219	0.75960	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	3.47	3.47	0.39725	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000001	D	0.93598	0.7956	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94841	0.8005	10	0.87932	D	0	-20.1126	12.8397	0.57794	0.0:1.0:0.0:0.0	.	685	Q9UPW8	UN13A_HUMAN	T	685;773;685;685;685;683	ENSP00000429562:A685T;ENSP00000400409:A773T;ENSP00000252773:A685T;ENSP00000447236:A685T;ENSP00000447572:A685T;ENSP00000446831:A683T	ENSP00000252773:A685T	A	-	1	0	UNC13A	17617912	1.000000	0.71417	0.998000	0.56505	0.630000	0.37929	7.595000	0.82710	1.688000	0.51068	0.306000	0.20318	GCC	UNC13A	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000130477		0.557	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	62	0.00	0	C	XM_038604		17756912	17756912	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	missense	30	37.50	18	SNP	1.000	T
ZNF438	220929	genome.wustl.edu	37	10	31134088	31134088	+	Silent	SNP	A	A	G			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr10:31134088A>G	ENST00000361310.3	-	7	2618	c.2289T>C	c.(2287-2289)ccT>ccC	p.P763P	ZNF438_ENST00000538351.2_Silent_p.P714P|ZNF438_ENST00000444692.2_Silent_p.P753P|ZNF438_ENST00000452305.1_Silent_p.P753P|ZNF438_ENST00000436087.2_Silent_p.P763P|ZNF438_ENST00000413025.1_Silent_p.P763P|ZNF438_ENST00000375311.1_Silent_p.P327P|ZNF438_ENST00000442986.1_Silent_p.P763P|ZNF438_ENST00000331737.6_Silent_p.P753P			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	763					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TGTGGAGGCCAGGACACTCAG	0.547																																						dbGAP											0													145.0	150.0	148.0					10																	31134088		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.2289T>C	10.37:g.31134088A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P763	ENST00000361310.3	37	c.2289	CCDS7168.1	10																																																																																			ZNF438	-	NULL	ENSG00000183621		0.547	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1	94	0.00	0	A	NM_182755		31134088	31134088	-1	no_errors	ENST00000361310	ensembl	human	known	69_37n	silent	54	12.90	8	SNP	0.000	G
ZNF665	79788	genome.wustl.edu	37	19	53668566	53668566	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chr19:53668566G>A	ENST00000600412.1	-	2	1097	c.982C>T	c.(982-984)Cag>Tag	p.Q328*	ZNF665_ENST00000396424.3_Nonsense_Mutation_p.Q393*|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TGGATGATCTGATGCTTAGTT	0.393																																						dbGAP											0													101.0	105.0	103.0					19																	53668566		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.982C>T	19.37:g.53668566G>A	ENSP00000469154:p.Gln328*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5T8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q393*	ENST00000600412.1	37	c.1177		19	.	.	.	.	.	.	.	.	.	.	G	16.70	3.194957	0.58017	.	.	ENSG00000197497	ENST00000396424	.	.	.	2.41	0.0592	0.14331	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	5.3755	0.16162	0.1205:0.0:0.682:0.1976	.	.	.	.	X	393	.	ENSP00000379702:Q393X	Q	-	1	0	ZNF665	58360378	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.008000	0.13197	-0.041000	0.13558	-0.436000	0.05848	CAG	ZNF665	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197497		0.393	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	HGNC	protein_coding	OTTHUMT00000464179.1	103	0.00	0	G	NM_024733		53668566	53668566	-1	no_errors	ENST00000396424	ensembl	human	known	69_37n	nonsense	53	35.37	29	SNP	0.621	A
ZNF75D	7626	genome.wustl.edu	37	X	134427658	134427658	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A2IU-01A-32D-A19T-09	TCGA-B6-A2IU-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	90c8e3e4-644f-4275-9812-39fbce0aebe4	3956afe0-b1e4-4a21-ad52-7de27823ad88	g.chrX:134427658C>T	ENST00000370766.3	-	3	3118	c.409G>A	c.(409-411)Gag>Aag	p.E137K	ZNF75D_ENST00000370764.1_Missense_Mutation_p.E137K|ZNF75D_ENST00000494295.1_Intron	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	137					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E137K(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						CTTCTTACCTCATTCTTTGTT	0.438																																						dbGAP											1	Substitution - Missense(1)	lung(1)											89.0	90.0	89.0					X																	134427658		2203	4300	6503	-	-	-	SO:0001583	missense	0			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.409G>A	X.37:g.134427658C>T	ENSP00000359802:p.Glu137Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E137K	ENST00000370766.3	37	c.409	CCDS14648.1	X	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492918	0.26774	.	.	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.04234	3.67;5.72	2.98	2.12	0.27331	Transcription regulator SCAN (2);	.	.	.	.	T	0.04363	0.0120	L	0.29908	0.895	0.09310	N	1	B;B	0.17852	0.013;0.024	B;B	0.17098	0.014;0.017	T	0.38023	-0.9680	9	0.48119	T	0.1	.	7.5806	0.27963	0.0:0.8611:0.0:0.1389	.	137;137	P51815;A6NK62	ZN75D_HUMAN;.	K	137	ENSP00000359802:E137K;ENSP00000359800:E137K	ENSP00000359800:E137K	E	-	1	0	ZNF75D	134255324	0.956000	0.32656	0.023000	0.16930	0.109000	0.19521	0.201000	0.17276	0.670000	0.31165	0.509000	0.49947	GAG	ZNF75D	-	pfam_Tscrpt_reg_SCAN,smart_Tscrpt_reg_SCAN	ENSG00000186376		0.438	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF75D	HGNC	protein_coding	OTTHUMT00000058415.1	56	0.00	0	C	NM_007131		134427658	134427658	-1	no_errors	ENST00000370766	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.019	T
