#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCE1	6059	genome.wustl.edu	37	4	146044698	146044698	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr4:146044698C>T	ENST00000296577.4	+	16	2101	c.1586C>T	c.(1585-1587)gCg>gTg	p.A529V	OTUD4_ENST00000455611.2_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	529	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					ACCTATCTAGCGGATCGCGTC	0.333																																						dbGAP											0													71.0	66.0	68.0					4																	146044698		2203	4297	6500	-	-	-	SO:0001583	missense	0			X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.1586C>T	4.37:g.146044698C>T	ENSP00000296577:p.Ala529Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	pfam_ABC_transporter-like,pfam_RNaseL-inhib_metal-bd_dom,pfam_4Fe4S-bd_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,prints_ABC_E	p.A529V	ENST00000296577.4	37	c.1586	CCDS34071.1	4	.	.	.	.	.	.	.	.	.	.	C	33	5.259562	0.95368	.	.	ENSG00000164163	ENST00000296577	D	0.91407	-2.84	5.69	5.69	0.88448	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.94483	0.8224	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.65140	0.932	D	0.94378	0.7602	10	0.87932	D	0	-18.1757	20.181	0.98201	0.0:1.0:0.0:0.0	.	529	P61221	ABCE1_HUMAN	V	529	ENSP00000296577:A529V	ENSP00000296577:A529V	A	+	2	0	ABCE1	146264148	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	7.705000	0.84606	2.840000	0.97914	0.655000	0.94253	GCG	ABCE1	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000164163		0.333	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCE1	HGNC	protein_coding	OTTHUMT00000365104.1	33	0.00	0	C	NM_002940		146044698	146044698	+1	no_errors	ENST00000296577	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	T
ACTL9	284382	genome.wustl.edu	37	19	8807972	8807972	+	Silent	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:8807972G>A	ENST00000324436.3	-	1	1200	c.1080C>T	c.(1078-1080)cgC>cgT	p.R360R		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	360						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						CTGGCAGAGCGCGCAGCAGCT	0.672																																						dbGAP											0													20.0	23.0	22.0					19																	8807972		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1080C>T	19.37:g.8807972G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K893|Q6X960	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R360	ENST00000324436.3	37	c.1080	CCDS12207.1	19																																																																																			ACTL9	-	pfam_Actin-like,smart_Actin-like	ENSG00000181786		0.672	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	58	0.00	0	G	NM_178525		8807972	8807972	-1	no_errors	ENST00000324436	ensembl	human	known	69_37n	silent	28	22.22	8	SNP	0.000	A
ADAMTS18	170692	genome.wustl.edu	37	16	77353958	77353958	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr16:77353958C>T	ENST00000282849.5	-	16	2738	c.2320G>A	c.(2320-2322)Gcc>Acc	p.A774T		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	774	Spacer.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ATGCTTCGGGCGCCAGCTGGA	0.502																																						dbGAP											0													50.0	56.0	54.0					16																	77353958		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2320G>A	16.37:g.77353958C>T	ENSP00000282849:p.Ala774Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.A774T	ENST00000282849.5	37	c.2320	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	C	29.1	4.978250	0.92982	.	.	ENSG00000140873	ENST00000282849	T	0.69685	-0.42	5.54	5.54	0.83059	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	D	0.87645	0.6229	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.969;0.99	D	0.91020	0.4856	10	0.87932	D	0	.	18.4764	0.90793	0.0:1.0:0.0:0.0	.	774;774	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	T	774	ENSP00000282849:A774T	ENSP00000282849:A774T	A	-	1	0	ADAMTS18	75911459	1.000000	0.71417	0.992000	0.48379	0.674000	0.39518	7.412000	0.80091	2.618000	0.88619	0.563000	0.77884	GCC	ADAMTS18	-	pfam_ADAM_spacer1	ENSG00000140873		0.502	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	19	0.00	0	C			77353958	77353958	-1	no_errors	ENST00000282849	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	1.000	T
AGMAT	79814	genome.wustl.edu	37	1	15901273	15901273	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr1:15901273A>G	ENST00000375826.3	-	6	1106	c.964T>C	c.(964-966)Tca>Cca	p.S322P	DNAJC16_ENST00000375849.1_Nonstop_Mutation_p.*656W|DNAJC16_ENST00000483270.1_3'UTR	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	322					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TACGGTGGTGAAACTTCGACA	0.453																																					NSCLC(126;1678 1780 25805 43508 49531)	dbGAP											0													117.0	100.0	106.0					1																	15901273		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.964T>C	1.37:g.15901273A>G	ENSP00000364986:p.Ser322Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDH1|Q9H5J3	Missense_Mutation	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Agmatinase-rel	p.S322P	ENST00000375826.3	37	c.964	CCDS160.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.19|14.19	2.461385|2.461385	0.43736|0.43736	.|.	.|.	ENSG00000116771|ENSG00000116138	ENST00000375826|ENST00000375849	D|.	0.85629|.	-2.01|.	5.93|5.93	2.28|2.28	0.28536|0.28536	Ureohydrolase domain (1);|.	0.163209|.	0.53938|.	D|.	0.000044|.	D|.	0.88291|.	0.6397|.	H|H	0.98769|0.98769	4.325|4.325	0.36825|0.36825	D|D	0.886617|0.886617	D|.	0.58268|.	0.982|.	D|.	0.70487|.	0.969|.	D|.	0.92823|.	0.6274|.	10|.	0.87932|.	D|.	0|.	-3.7905|-3.7905	13.7105|13.7105	0.62665|0.62665	0.3569:0.6431:0.0:0.0|0.3569:0.6431:0.0:0.0	.|.	322|.	Q9BSE5|.	SPEB_HUMAN|.	P|W	322|656	ENSP00000364986:S322P|.	ENSP00000364986:S322P|.	S|X	-|+	1|3	0|0	AGMAT|DNAJC16	15773860|15773860	0.997000|0.997000	0.39634|0.39634	0.081000|0.081000	0.20488|0.20488	0.125000|0.125000	0.20455|0.20455	3.732000|3.732000	0.55021|0.55021	0.459000|0.459000	0.27016|0.27016	0.491000|0.491000	0.48974|0.48974	TCA|TGA	AGMAT	-	pfam_Ureohydrolase,tigrfam_Agmatinase-rel	ENSG00000116771		0.453	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMAT	HGNC	protein_coding	OTTHUMT00000006763.1	72	0.00	0	A	NM_024758		15901273	15901273	-1	no_errors	ENST00000375826	ensembl	human	known	69_37n	missense	82	24.07	26	SNP	0.589	G
AKR1C1	1645	genome.wustl.edu	37	10	5019960	5019960	+	3'UTR	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr10:5019960C>T	ENST00000380872.4	+	0	1190				AKR1C1_ENST00000434459.2_3'UTR|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1						bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	ATGAGGTCTGCCAGAAGGCCC	0.473																																					Colon(130;2054 2316 13360 15380)	dbGAP											0													35.0	35.0	35.0					10																	5019960		2202	4279	6481	-	-	-	SO:0001624	3_prime_UTR_variant	0			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.*26C>T	10.37:g.5019960C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P52896|Q5SR15|Q7M4N2|Q9UCX2	RNA	SNP	-	NULL	ENST00000380872.4	37	NULL	CCDS7061.1	10																																																																																			AKR1C1	-	-	ENSG00000187134		0.473	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C1	HGNC	protein_coding	OTTHUMT00000046523.2	35	0.00	0	C	NM_001353		5019960	5019960	+1	no_errors	ENST00000477661	ensembl	human	known	69_37n	rna	35	22.22	10	SNP	0.001	T
ANKRD18DP	348840	genome.wustl.edu	37	3	197797009	197797009	+	RNA	SNP	G	G	A	rs116600595	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr3:197797009G>A	ENST00000435620.2	-	0	814				RNU6-821P_ENST00000390995.1_RNA	NR_003291.1				ankyrin repeat domain 18D, pseudogene																		TTGTCATTTTGAAGATGATTT	0.269													g|||	27	0.00539137	0.0197	0.0	5008	,	,		17628	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			BC042518		3q29	2011-11-23			ENSG00000226435	ENSG00000226435			28016	pseudogene	pseudogene							Standard	NR_003291		Approved		uc003fyx.3		OTTHUMG00000150228		3.37:g.197797009G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000435620.2	37	NULL		3																																																																																			ANKRD18DP	-	-	ENSG00000226435		0.269	ANKRD18DP-001	KNOWN	basic	processed_transcript	ANKRD18DP	HGNC	pseudogene	OTTHUMT00000316910.2	8	0.00	0	G	NR_003291		197797009	197797009	-1	no_errors	ENST00000435620	ensembl	human	known	69_37n	rna	0	100.00	5	SNP	0.001	A
ANKRD61	100310846	genome.wustl.edu	37	7	6071096	6071096	+	Silent	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr7:6071096G>A	ENST00000409061.1	+	1	90	c.90G>A	c.(88-90)tcG>tcA	p.S30S	EIF2AK1_ENST00000199389.6_Intron|EIF2AK1_ENST00000536084.1_Intron	NM_001271700.1	NP_001258629.1	A6NGH8	ANR61_HUMAN	ankyrin repeat domain 61	30																	CACTTCACTCGAAACTCTATG	0.502																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS64590.1	7p22	2013-01-10			ENSG00000157999	ENSG00000157999		"""Ankyrin repeat domain containing"""	22467	protein-coding gene	gene with protein product							Standard	NM_001271700		Approved		uc031swn.1	A6NGH8	OTTHUMG00000154561	ENST00000409061.1:c.90G>A	7.37:g.6071096G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S30	ENST00000409061.1	37	c.90		7																																																																																			ANKRD61	-	NULL	ENSG00000157999		0.502	ANKRD61-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	ANKRD61	HGNC	protein_coding	OTTHUMT00000335991.1	48	0.00	0	G			6071096	6071096	+1	no_errors	ENST00000409061	ensembl	human	novel	69_37n	silent	26	35.00	14	SNP	0.000	A
AP2A2	161	genome.wustl.edu	37	11	1010694	1010694	+	3'UTR	SNP	C	C	T	rs1128413	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr11:1010694C>T	ENST00000448903.2	+	0	3030				AP2A2_ENST00000332231.5_3'UTR|AP2A2_ENST00000534328.1_Missense_Mutation_p.P375L	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCTTCGTGGCCATCCTGCAGA	0.592													C|||	2142	0.427716	0.3502	0.6628	5008	,	,		15795	0.2946		0.5686	False		,,,				2504	0.3579					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.*69C>T	11.37:g.1010694C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold	p.P375L	ENST00000448903.2	37	c.1124	CCDS44512.1	11	998	0.45695970695970695	168	0.34146341463414637	227	0.6270718232044199	180	0.3146853146853147	423	0.558047493403694	C	7.740	0.701069	0.15172	.	.	ENSG00000183020	ENST00000534328	T	0.24538	1.85	2.85	0.944	0.19537	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.999999999946489E-6	.	.	.	.	.	.	T	0.39333	-0.9619	5	0.87932	D	0	.	6.847	0.23994	0.0:0.7675:0.0:0.2325	rs1128413;rs3185348;rs60783032;rs1128413	.	.	.	L	375	ENSP00000436059:P375L	ENSP00000436059:P375L	P	+	2	0	AP2A2	1000694	0.003000	0.15002	0.002000	0.10522	0.002000	0.02628	1.569000	0.36428	0.270000	0.21984	0.478000	0.44815	CCA	AP2A2	-	NULL	ENSG00000183020		0.592	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	HGNC	protein_coding	OTTHUMT00000385431.2	52	0.00	0	C	NM_012305		1010694	1010694	+1	no_errors	ENST00000534328	ensembl	human	putative	69_37n	missense	24	17.24	5	SNP	0.003	T
ARID2	196528	genome.wustl.edu	37	12	46299067	46299067	+	3'UTR	DEL	A	A	-			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr12:46299067delA	ENST00000334344.6	+	0	5886				ARID2_ENST00000444670.1_3'UTR|ARID2_ENST00000457135.1_3'UTR|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		aagaaaaaggaaaaaaaaaaa	0.358			"""N, S, F"""		hepatocellular carcinoma																																	dbGAP		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.*206A>-	12.37:g.46299067delA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	RNA	DEL	-	NULL	ENST00000334344.6	37	NULL	CCDS31783.1	12																																																																																			ARID2	-	-	ENSG00000189079		0.358	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	8	0.00	0	A	XM_350875		46299067	46299067	+1	no_errors	ENST00000479608	ensembl	human	known	69_37n	rna	12	20.00	3	DEL	0.911	-
C10orf90	118611	genome.wustl.edu	37	10	128193182	128193182	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr10:128193182G>A	ENST00000284694.7	-	3	707	c.587C>T	c.(586-588)aCa>aTa	p.T196I	C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000454341.1_Missense_Mutation_p.T196I|C10orf90_ENST00000356858.3_Missense_Mutation_p.T149I|C10orf90_ENST00000544758.1_Missense_Mutation_p.T293I|C10orf90_ENST00000392694.1_Missense_Mutation_p.T149I	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	196	Required for interaction with HDAC1. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GGAGAACTCTGTGCAGGCAAA	0.617											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													61.0	66.0	64.0					10																	128193182		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.587C>T	10.37:g.128193182G>A	ENSP00000284694:p.Thr196Ile	Somatic	1563	WXS	Illumina GAIIx	Phase_IV	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	NULL	p.T293I	ENST00000284694.7	37	c.878	CCDS31310.1	10	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598991	0.66332	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.25085	2.13;2.13;2.14;2.13;1.82	5.0	4.03	0.46877	.	0.949950	0.08782	N	0.894491	T	0.42314	0.1197	L	0.56769	1.78	0.09310	N	1	D;D;D;P;D	0.63880	0.96;0.985;0.993;0.919;0.96	P;P;P;P;P	0.55391	0.748;0.714;0.775;0.587;0.748	T	0.26430	-1.0103	10	0.72032	D	0.01	-1.3543	12.9711	0.58513	0.0:0.0:0.8282:0.1718	.	293;293;149;196;196	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	I	149;196;196;293;196;149;149	ENSP00000284694:T196I;ENSP00000398786:T196I;ENSP00000444369:T293I;ENSP00000405995:T196I;ENSP00000376459:T149I	ENSP00000284694:T196I	T	-	2	0	C10orf90	128183172	0.000000	0.05858	0.162000	0.22713	0.195000	0.23768	0.691000	0.25467	2.595000	0.87683	0.655000	0.94253	ACA	C10orf90	-	NULL	ENSG00000154493		0.617	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf90	HGNC	protein_coding		37	0.00	0	G	NM_001004298		128193182	128193182	-1	no_errors	ENST00000544758	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.001	A
CCDC175	729665	genome.wustl.edu	37	14	59977201	59977201	+	Intron	SNP	T	T	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:59977201T>C	ENST00000537690.2	-	19	2361				CCDC175_ENST00000281581.4_Missense_Mutation_p.T812A|RP11-701B16.2_ENST00000554253.1_RNA	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175																		ACTACAAGAGTATTCAACCCC	0.274																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.2305+162A>G	14.37:g.59977201T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.T812A	ENST00000537690.2	37	c.2434	CCDS53898.1	14																																																																																			C14orf38	-	NULL	ENSG00000151838		0.274	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf38	HGNC	protein_coding	OTTHUMT00000471273.1	33	0.00	0	T	NM_001164399		59977201	59977201	-1	no_errors	ENST00000281581	ensembl	human	known	69_37n	missense	69	25.00	23	SNP	0.000	C
CFAP61	26074	genome.wustl.edu	37	20	20269357	20269357	+	Silent	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr20:20269357C>T	ENST00000245957.5	+	23	2977	c.2901C>T	c.(2899-2901)ttC>ttT	p.F967F	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		967										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		ATACCAACTTCCACACCAACG	0.433																																						dbGAP											0													180.0	166.0	171.0					20																	20269357		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000245957.5:c.2901C>T	20.37:g.20269357C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	superfamily_Acyl_CoA_acyltransferase	p.F967	ENST00000245957.5	37	c.2901	CCDS33447.1	20																																																																																			C20orf26	-	NULL	ENSG00000089101		0.433	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	54	0.00	0	C			20269357	20269357	+1	no_errors	ENST00000245957	ensembl	human	known	69_37n	silent	66	22.35	19	SNP	0.998	T
CACNA1I	8911	genome.wustl.edu	37	22	40057234	40057234	+	Silent	SNP	G	G	A	rs59624877		TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr22:40057234G>A	ENST00000402142.3	+	16	2820	c.2820G>A	c.(2818-2820)ccG>ccA	p.P940P	CACNA1I_ENST00000407673.1_Silent_p.P905P|CACNA1I_ENST00000401624.1_Silent_p.P940P|CACNA1I_ENST00000404898.1_Silent_p.P905P|CACNA1I_ENST00000400164.3_Silent_p.P905P|CACNA1I_ENST00000336649.4_Silent_p.P946P	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	940					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CACTGCAGCCGGACCCCATGC	0.662																																						dbGAP											0													30.0	35.0	33.0					22																	40057234		1962	4134	6096	-	-	-	SO:0001819	synonymous_variant	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.2820G>A	22.37:g.40057234G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.P946	ENST00000402142.3	37	c.2838	CCDS46710.1	22																																																																																			CACNA1I	-	NULL	ENSG00000100346		0.662	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	56	0.00	0	G	NM_001003406		40057234	40057234	+1	no_errors	ENST00000336649	ensembl	human	known	69_37n	silent	51	17.74	11	SNP	0.259	A
CATSPERB	79820	genome.wustl.edu	37	14	92102918	92102918	+	Silent	SNP	T	T	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:92102918T>C	ENST00000256343.3	-	17	1749	c.1593A>G	c.(1591-1593)ccA>ccG	p.P531P		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	531					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AGCCCATATCTGGAGGCTGGA	0.363																																						dbGAP											0													69.0	64.0	66.0					14																	92102918		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1593A>G	14.37:g.92102918T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV51	Silent	SNP	superfamily_Neuraminidase	p.P531	ENST00000256343.3	37	c.1593	CCDS32142.1	14																																																																																			CATSPERB	-	NULL	ENSG00000133962		0.363	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	HGNC	protein_coding	OTTHUMT00000411769.1	14	0.00	0	T	NM_024764		92102918	92102918	-1	no_errors	ENST00000256343	ensembl	human	known	69_37n	silent	13	40.91	9	SNP	0.203	C
CATSPERB	79820	genome.wustl.edu	37	14	92189493	92189493	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:92189493G>C	ENST00000256343.3	-	4	365	c.209C>G	c.(208-210)tCa>tGa	p.S70*		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	70					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.S70L(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				CATTGCTTTTGATGCAATTTC	0.353																																						dbGAP											1	Substitution - Missense(1)	skin(1)											131.0	122.0	125.0					14																	92189493		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.209C>G	14.37:g.92189493G>C	ENSP00000256343:p.Ser70*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV51	Nonsense_Mutation	SNP	superfamily_Neuraminidase	p.S70*	ENST00000256343.3	37	c.209	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099977	0.37048	.	.	ENSG00000133962	ENST00000256343;ENST00000554560;ENST00000556661;ENST00000553676	.	.	.	5.23	3.24	0.37175	.	0.989910	0.08192	N	0.983650	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-5.4197	6.3769	0.21513	0.1017:0.2376:0.6606:0.0	.	.	.	.	X	70	.	ENSP00000256343:S70X	S	-	2	0	CATSPERB	91259246	0.013000	0.17824	0.003000	0.11579	0.002000	0.02628	1.786000	0.38694	1.342000	0.45619	-0.136000	0.14681	TCA	CATSPERB	-	NULL	ENSG00000133962		0.353	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	HGNC	protein_coding	OTTHUMT00000411769.1	31	0.00	0	G	NM_024764		92189493	92189493	-1	no_errors	ENST00000256343	ensembl	human	known	69_37n	nonsense	54	10.00	6	SNP	0.001	C
CATSPERB	79820	genome.wustl.edu	37	14	92189515	92189515	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:92189515G>C	ENST00000256343.3	-	4	343	c.187C>G	c.(187-189)Caa>Gaa	p.Q63E		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	63					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TTTTCAGTTTGGAAGAAACAC	0.343																																						dbGAP											0													107.0	99.0	102.0					14																	92189515		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.187C>G	14.37:g.92189515G>C	ENSP00000256343:p.Gln63Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV51	Missense_Mutation	SNP	superfamily_Neuraminidase	p.Q63E	ENST00000256343.3	37	c.187	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422029	0.25639	.	.	ENSG00000133962	ENST00000256343;ENST00000554560;ENST00000556661;ENST00000553676	T	0.43294	0.95	5.23	0.858	0.19030	.	1.665140	0.03329	N	0.193048	T	0.34077	0.0885	L	0.44542	1.39	0.09310	N	1	B	0.17268	0.021	B	0.16289	0.015	T	0.22487	-1.0215	10	0.42905	T	0.14	-1.3114	2.9678	0.05913	0.0969:0.3258:0.3964:0.1808	.	63	Q9H7T0	CTSRB_HUMAN	E	63	ENSP00000256343:Q63E	ENSP00000256343:Q63E	Q	-	1	0	CATSPERB	91259268	0.060000	0.20803	0.560000	0.28344	0.778000	0.44026	0.168000	0.16622	0.609000	0.30018	0.655000	0.94253	CAA	CATSPERB	-	NULL	ENSG00000133962		0.343	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	HGNC	protein_coding	OTTHUMT00000411769.1	26	0.00	0	G	NM_024764		92189515	92189515	-1	no_errors	ENST00000256343	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	0.126	C
CCNJ	54619	genome.wustl.edu	37	10	97820339	97820339	+	3'UTR	SNP	G	G	T	rs1047370	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr10:97820339G>T	ENST00000265992.5	+	0	3827				ENTPD1-AS1_ENST00000458228.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000427846.1_RNA|CCNJ_ENST00000534974.1_3'UTR|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA	NM_001134375.1|NM_001134376.1|NM_019084.4	NP_001127847.1|NP_001127848.1|NP_061957.2	Q5T5M9	CCNJ_HUMAN	cyclin J							nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	11				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		GGAACATTGTGTGGGTTTTGT	0.348													G|||	1563	0.312101	0.1104	0.3559	5008	,	,		15377	0.5179		0.3171	False		,,,				2504	0.3364					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK001757	CCDS7445.1, CCDS44462.1, CCDS44463.1	10q23.33	2008-05-14			ENSG00000107443	ENSG00000107443			23434	protein-coding gene	gene with protein product						12477932	Standard	NM_019084		Approved	FLJ10895, bA690P14.1	uc010qoq.2	Q5T5M9	OTTHUMG00000018823	ENST00000265992.5:c.*2341G>T	10.37:g.97820339G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4E7|Q86XL1|Q9NV69	RNA	SNP	-	NULL	ENST00000265992.5	37	NULL	CCDS7445.1	10																																																																																			CCNJ	-	-	ENSG00000107443		0.348	CCNJ-003	KNOWN	basic|CCDS	protein_coding	CCNJ	HGNC	protein_coding	OTTHUMT00000090166.3	27	0.00	0	G	NM_019084		97820339	97820339	+1	no_errors	ENST00000471424	ensembl	human	known	69_37n	rna	18	14.29	3	SNP	0.956	T
CCR6	1235	genome.wustl.edu	37	6	167550465	167550465	+	Silent	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr6:167550465G>A	ENST00000341935.5	+	3	1299	c.747G>A	c.(745-747)agG>agA	p.R249R	CCR6_ENST00000349984.4_Silent_p.R249R|CCR6_ENST00000400926.2_Silent_p.R249R|RP11-517H2.6_ENST00000609590.1_RNA	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	249					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		ATTCTAAAAGGCACAAAGCCA	0.423																																						dbGAP											0													152.0	146.0	148.0					6																	167550465		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.747G>A	6.37:g.167550465G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5C6|P78553|Q92846	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CCR6,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CXC/IL8_rcpt	p.R249	ENST00000341935.5	37	c.747	CCDS5298.1	6																																																																																			CCR6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CXC/IL8_rcpt	ENSG00000112486		0.423	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCR6	HGNC	protein_coding	OTTHUMT00000043118.1	98	0.00	0	G			167550465	167550465	+1	no_errors	ENST00000341935	ensembl	human	known	69_37n	silent	116	25.64	40	SNP	1.000	A
CDC34	997	genome.wustl.edu	37	19	532054	532054	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:532054G>A	ENST00000215574.4	+	1	341	c.123G>A	c.(121-123)tgG>tgA	p.W41*		NM_004359.1	NP_004350.1	P49427	UB2R1_HUMAN	cell division cycle 34	41					cellular protein modification process (GO:0006464)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of neuron apoptotic process (GO:0043525)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|response to growth factor (GO:0070848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(1)	2		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TATACAACTGGGAGGTGGCCA	0.677																																						dbGAP											0													48.0	44.0	45.0					19																	532054		2196	4295	6491	-	-	-	SO:0001587	stop_gained	0			L22005	CCDS12030.1	19p13.3	2013-01-17	2013-01-17					"""Ubiquitin-conjugating enzymes E2"""	1734	protein-coding gene	gene with protein product		116948	"""cell division cycle 34"", ""cell division cycle 34 homolog (S. cerevisiae)"""			8248134, 16210246	Standard	NM_004359		Approved	E2-CDC34, UBE2R1, UBC3	uc002lov.3	P49427		ENST00000215574.4:c.123G>A	19.37:g.532054G>A	ENSP00000215574:p.Trp41*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K689	Nonsense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.W41*	ENST00000215574.4	37	c.123	CCDS12030.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.005487	0.97195	.	.	ENSG00000099804	ENST00000215574	.	.	.	4.01	1.78	0.24846	.	0.067833	0.64402	U	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7083	0.28663	0.0891:0.0:0.7492:0.1617	.	.	.	.	X	41	.	ENSP00000215574:W41X	W	+	3	0	CDC34	483054	1.000000	0.71417	0.998000	0.56505	0.417000	0.31264	6.694000	0.74587	0.271000	0.22005	0.306000	0.20318	TGG	CDC34	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000099804		0.677	CDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC34	HGNC	protein_coding	OTTHUMT00000451889.2	90	0.00	0	G	NM_004359		532054	532054	+1	no_errors	ENST00000215574	ensembl	human	known	69_37n	nonsense	56	13.85	9	SNP	1.000	A
CES5A	221223	genome.wustl.edu	37	16	55883638	55883638	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr16:55883638A>G	ENST00000290567.9	-	11	1442	c.1321T>C	c.(1321-1323)Tgc>Cgc	p.C441R	CES5A_ENST00000319165.9_Intron|CES5A_ENST00000518005.1_Missense_Mutation_p.C335R|CES5A_ENST00000520435.1_Missense_Mutation_p.C411R|CES5A_ENST00000521992.1_Missense_Mutation_p.C470R|CES5A_ENST00000541580.1_5'UTR	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	441						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TCTTCAAAGCACTGAGGCCGG	0.547																																						dbGAP											0													101.0	88.0	92.0					16																	55883638		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.1321T>C	16.37:g.55883638A>G	ENSP00000290567:p.Cys441Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.C470R	ENST00000290567.9	37	c.1408	CCDS45490.1	16	.	.	.	.	.	.	.	.	.	.	.	13.70	2.316270	0.40996	.	.	ENSG00000159398	ENST00000521992;ENST00000518005;ENST00000290567;ENST00000520435;ENST00000541580	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	5.03	3.91	0.45181	Carboxylesterase, type B (1);	0.136934	0.34460	N	0.003941	T	0.17109	0.0411	L	0.39245	1.2	0.48087	D	0.999581	D	0.71674	0.998	D	0.68621	0.959	T	0.01105	-1.1450	10	0.37606	T	0.19	.	10.6522	0.45655	0.8385:0.1615:0.0:0.0	.	441	Q6NT32	EST5A_HUMAN	R	470;335;441;411;221	ENSP00000428864:C470R;ENSP00000428571:C335R;ENSP00000290567:C441R;ENSP00000428887:C411R	ENSP00000290567:C441R	C	-	1	0	CES5A	54441139	0.000000	0.05858	0.717000	0.30585	0.429000	0.31625	0.100000	0.15231	0.983000	0.38602	0.379000	0.24179	TGC	CES5A	-	pfam_CarbesteraseB	ENSG00000159398		0.547	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES5A	HGNC	protein_coding	OTTHUMT00000256975.3	33	0.00	0	A	NM_145024		55883638	55883638	-1	no_errors	ENST00000521992	ensembl	human	known	69_37n	missense	18	45.71	16	SNP	0.747	G
CIDEA	1149	genome.wustl.edu	37	18	12254819	12254819	+	Intron	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr18:12254819C>T	ENST00000320477.9	+	1	103				CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a						apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						TTCCGCGATGCGAGGGGACCG	0.697																																						dbGAP											0													4.0	6.0	5.0					18																	12254819		2076	4132	6208	-	-	-	SO:0001627	intron_variant	0			AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.38+399C>T	18.37:g.12254819C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIY7|Q6UPR7	Missense_Mutation	SNP	NULL	p.A146V	ENST00000320477.9	37	c.437	CCDS11856.1	18																																																																																			CIDEA	-	NULL	ENSG00000176194		0.697	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDEA	HGNC	protein_coding	OTTHUMT00000254599.2	48	0.00	0	C	NM_001279		12254819	12254819	+1	no_errors	ENST00000522713	ensembl	human	known	69_37n	missense	12	67.57	25	SNP	0.000	T
CLRN1-AS1	116933	genome.wustl.edu	37	3	150780704	150780704	+	RNA	SNP	A	A	G	rs181688	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr3:150780704A>G	ENST00000476886.1	+	0	123				CLRN1-AS1_ENST00000465576.1_RNA					CLRN1 antisense RNA 1																		gctggctccaataatatagag	0.403													A|||	2483	0.495807	0.413	0.5231	5008	,	,		18708	0.2857		0.7565	False		,,,				2504	0.5368					dbGAP											0																																										-	-	-			0					3q25.1	2012-10-12	2012-08-15	2011-04-28	ENSG00000239265	ENSG00000239265		"""Long non-coding RNAs"""	30895	non-coding RNA	RNA, long non-coding			"""clarin 1 opposite strand"", ""CLRN1 antisense RNA 1 (non-protein coding)"""	CLRN1OS		11524702	Standard	NR_024066		Approved	UCRP	uc011bny.1		OTTHUMG00000159846		3.37:g.150780704A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000476886.1	37	NULL		3																																																																																			CLRN1-AS1	-	-	ENSG00000239265		0.403	CLRN1-AS1-001	KNOWN	basic	antisense	CLRN1-AS1	HGNC	antisense	OTTHUMT00000357695.2	35	0.00	0	A			150780704	150780704	+1	no_errors	ENST00000465576	ensembl	human	known	69_37n	rna	44	15.38	8	SNP	0.000	G
CYP4A22	284541	genome.wustl.edu	37	1	47603231	47603231	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr1:47603231T>G	ENST00000371891.3	+	1	105	c.74T>G	c.(73-75)cTc>cGc	p.L25R	CYP4A22_ENST00000294337.3_Missense_Mutation_p.L25R|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000371890.3_Missense_Mutation_p.L25R	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	25	Poly-Leu.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACCTCCCTGCTCATTCTGCTT	0.607																																					Pancreas(88;1240 1470 2099 14214 37557)	dbGAP											0													111.0	95.0	101.0					1																	47603231		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.74T>G	1.37:g.47603231T>G	ENSP00000360958:p.Leu25Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.L25R	ENST00000371891.3	37	c.74	CCDS30707.1	1	.	.	.	.	.	.	.	.	.	.	t	11.68	1.709703	0.30322	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.76448	-1.02;-0.71;-0.67	2.47	2.47	0.30058	.	0.302249	0.27773	N	0.017913	D	0.84243	0.5429	M	0.67953	2.075	0.37094	D	0.899597	D;D	0.89917	0.992;1.0	P;D	0.70227	0.831;0.968	D	0.86542	0.1829	10	0.87932	D	0	.	10.4964	0.44780	0.0:0.0:0.0:1.0	.	25;25	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	R	25	ENSP00000360957:L25R;ENSP00000360958:L25R;ENSP00000294337:L25R	ENSP00000294337:L25R	L	+	2	0	CYP4A22	47375818	0.823000	0.29233	0.927000	0.36925	0.234000	0.25298	4.707000	0.61852	0.887000	0.36136	0.172000	0.16884	CTC	CYP4A22	-	NULL	ENSG00000162365		0.607	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4A22	HGNC	protein_coding	OTTHUMT00000021635.1	88	0.00	0	T	XM_208213		47603231	47603231	+1	no_errors	ENST00000371891	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	0.795	G
CNTN2	6900	genome.wustl.edu	37	1	205039136	205039136	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr1:205039136G>A	ENST00000331830.4	+	18	2662	c.2378G>A	c.(2377-2379)cGc>cAc	p.R793H		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	793	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGCTACAACCGCCGCGGGGAT	0.662																																					Melanoma(183;2548 2817 37099 41192)	dbGAP											0													33.0	38.0	36.0					1																	205039136		2203	4297	6500	-	-	-	SO:0001583	missense	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2378G>A	1.37:g.205039136G>A	ENSP00000330633:p.Arg793His	Somatic		WXS	Illumina GAIIx	Phase_IV	P78432|Q5T054	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R793H	ENST00000331830.4	37	c.2378	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.765232	0.49574	.	.	ENSG00000184144	ENST00000331830	T	0.57595	0.39	5.07	3.19	0.36642	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.281849	0.24613	N	0.037035	T	0.41143	0.1146	L	0.41710	1.295	0.33304	D	0.56518	B;B	0.24533	0.004;0.105	B;B	0.24155	0.008;0.051	T	0.49041	-0.8980	10	0.56958	D	0.05	.	7.7573	0.28932	0.3298:0.0:0.6702:0.0	.	793;684	Q02246;Q68DA2	CNTN2_HUMAN;.	H	793	ENSP00000330633:R793H	ENSP00000330633:R793H	R	+	2	0	CNTN2	203305759	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	1.217000	0.32455	0.537000	0.28751	0.467000	0.42956	CGC	CNTN2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000184144		0.662	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	105	0.00	0	G	NM_005076		205039136	205039136	+1	no_errors	ENST00000331830	ensembl	human	known	69_37n	missense	229	15.07	41	SNP	0.998	A
DDX3X	1654	genome.wustl.edu	37	X	41202082	41202082	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chrX:41202082T>C	ENST00000399959.2	+	6	1391	c.536T>C	c.(535-537)aTt>aCt	p.I179T	DDX3X_ENST00000542215.1_Missense_Mutation_p.I223T|DDX3X_ENST00000441189.2_Intron|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000457138.2_Missense_Mutation_p.I163T|DDX3X_ENST00000478993.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	179	Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						CCTCCACATATTGAAAGTGTG	0.378										HNSCC(61;0.18)																												dbGAP											0													101.0	86.0	91.0					X																	41202082		1928	4130	6058	-	-	-	SO:0001583	missense	0			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.536T>C	X.37:g.41202082T>C	ENSP00000382840:p.Ile179Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.I179T	ENST00000399959.2	37	c.536	CCDS43931.1	X	.	.	.	.	.	.	.	.	.	.	T	16.70	3.195157	0.58017	.	.	ENSG00000215301	ENST00000399959;ENST00000457138;ENST00000542215	T;T;T	0.44482	1.82;1.79;0.92	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.66356	0.2781	M	0.81341	2.54	0.80722	D	1	D;P;B;P;P	0.76494	0.999;0.605;0.349;0.538;0.538	D;B;B;B;B	0.77004	0.989;0.399;0.275;0.396;0.396	T	0.71859	-0.4465	10	0.87932	D	0	-13.4437	14.5564	0.68103	0.0:0.0:0.0:1.0	.	179;163;179;191;179	B4DLU5;B4E3E8;B5BTY4;Q59GX6;O00571	.;.;.;.;DDX3X_HUMAN	T	179;163;223	ENSP00000382840:I179T;ENSP00000392494:I163T;ENSP00000439799:I223T	ENSP00000382840:I179T	I	+	2	0	DDX3X	41087026	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	1.818000	0.53035	0.441000	0.28932	ATT	DDX3X	-	NULL	ENSG00000215301		0.378	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	HGNC	protein_coding	OTTHUMT00000056253.1	48	0.00	0	T	NM_024005		41202082	41202082	+1	no_errors	ENST00000399959	ensembl	human	known	69_37n	missense	16	52.94	18	SNP	1.000	C
DPPA4	55211	genome.wustl.edu	37	3	109056310	109056310	+	Splice_Site	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr3:109056310C>T	ENST00000335658.6	-	1	109		c.e1+1		DPPA4_ENST00000478791.1_Splice_Site	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4						lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						ACTGTACTGACCTCCTTGCCT	0.453																																						dbGAP											0													180.0	143.0	156.0					3																	109056310		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.54+1G>A	3.37:g.109056310C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4M7|Q9H9N5|Q9NVI6	Splice_Site	SNP	-	e1+1	ENST00000335658.6	37	c.54+1	CCDS33814.1	3	.	.	.	.	.	.	.	.	.	.	C	11.61	1.690487	0.29962	.	.	ENSG00000121570	ENST00000335658	.	.	.	3.53	3.53	0.40419	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8808	0.46937	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPPA4	110539000	0.998000	0.40836	0.993000	0.49108	0.036000	0.12997	2.827000	0.48112	2.251000	0.74343	0.655000	0.94253	.	DPPA4	-	-	ENSG00000121570		0.453	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA4	HGNC	protein_coding	OTTHUMT00000353897.1	34	0.00	0	C	NM_018189	Intron	109056310	109056310	-1	no_errors	ENST00000335658	ensembl	human	known	69_37n	splice_site	31	36.73	18	SNP	0.995	T
DHX36	170506	genome.wustl.edu	37	3	153998628	153998628	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr3:153998628C>G	ENST00000496811.1	-	21	2480	c.2400G>C	c.(2398-2400)caG>caC	p.Q800H	DHX36_ENST00000329463.5_Missense_Mutation_p.Q786H|DHX36_ENST00000544526.1_Missense_Mutation_p.Q786H|DHX36_ENST00000308361.6_Missense_Mutation_p.Q771H	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	800					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GCTCAGCAAACTGTCCTTTCA	0.363																																						dbGAP											0													97.0	95.0	96.0					3																	153998628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.2400G>C	3.37:g.153998628C>G	ENSP00000417078:p.Gln800His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q800H	ENST00000496811.1	37	c.2400	CCDS3171.1	3	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290016	0.80914	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.06687	3.45;3.53;3.27;3.28;3.56	5.92	5.92	0.95590	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	M	0.93283	3.4	0.58432	D	0.999999	D;D;D	0.71674	0.988;0.998;0.998	D;D;D	0.75484	0.976;0.976;0.986	T	0.48502	-0.9030	10	0.87932	D	0	.	15.4575	0.75327	0.0:0.932:0.0:0.068	.	786;771;800	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	H	800;771;786;786;714	ENSP00000417078:Q800H;ENSP00000309296:Q771H;ENSP00000444247:Q786H;ENSP00000330113:Q786H;ENSP00000419862:Q714H	ENSP00000309296:Q771H	Q	-	3	2	DHX36	155481322	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.372000	0.44257	2.809000	0.96659	0.655000	0.94253	CAG	DHX36	-	NULL	ENSG00000174953		0.363	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX36	HGNC	protein_coding	OTTHUMT00000353349.1	25	0.00	0	C	NM_020865		153998628	153998628	-1	no_errors	ENST00000496811	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	G
ERGIC3	51614	genome.wustl.edu	37	20	34136682	34136682	+	Intron	SNP	G	G	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr20:34136682G>T	ENST00000348547.2	+	7	762				ERGIC3_ENST00000279052.6_Intron|ERGIC3_ENST00000447986.1_Intron|ERGIC3_ENST00000482338.1_Intron|ERGIC3_ENST00000357394.4_Intron	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3						vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			AGCTTGAGTGGTCCTCTTCTG	0.567																																						dbGAP											0													50.0	46.0	47.0					20																	34136682		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.685+64G>T	20.37:g.34136682G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	RNA	SNP	-	NULL	ENST00000348547.2	37	NULL	CCDS13257.1	20																																																																																			ERGIC3	-	-	ENSG00000125991		0.567	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC3	HGNC	protein_coding	OTTHUMT00000078880.2	15	0.00	0	G	NM_015966		34136682	34136682	+1	no_errors	ENST00000489071	ensembl	human	known	69_37n	rna	18	40.00	12	SNP	0.000	T
FAM73B	84895	genome.wustl.edu	37	9	131822821	131822821	+	Intron	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr9:131822821C>T	ENST00000358369.4	+	8	1019				FAM73B_ENST00000277475.5_Intron|FAM73B_ENST00000406926.2_Intron	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B						bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						TCTCACTGCTCTTCCCAGAGA	0.632																																						dbGAP											0													23.0	23.0	23.0					9																	131822821		2194	4294	6488	-	-	-	SO:0001627	intron_variant	0			AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.794-8C>T	9.37:g.131822821C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBM3|Q8TEJ6|Q969E6	RNA	SNP	-	NULL	ENST00000358369.4	37	NULL	CCDS6917.1	9																																																																																			FAM73B	-	-	ENSG00000148343		0.632	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM73B	HGNC	protein_coding	OTTHUMT00000054542.7	89	0.00	0	C	NM_032809		131822821	131822821	+1	no_errors	ENST00000474639	ensembl	human	known	69_37n	rna	47	27.69	18	SNP	0.000	T
FKBP5	2289	genome.wustl.edu	37	6	35544895	35544895	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr6:35544895T>C	ENST00000539068.1	-	10	1344	c.1142A>G	c.(1141-1143)aAc>aGc	p.N381S	FKBP5_ENST00000357266.4_Missense_Mutation_p.N381S|FKBP5_ENST00000536438.1_Missense_Mutation_p.N381S|FKBP5_ENST00000540787.1_Missense_Mutation_p.N202S	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	381					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						ATTCTGGGGGTTTACTTCCAG	0.512																																						dbGAP											0													183.0	153.0	163.0					6																	35544895		2203	4300	6503	-	-	-	SO:0001583	missense	0			U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.1142A>G	6.37:g.35544895T>C	ENSP00000441205:p.Asn381Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H7R1|Q59EB8|Q5TGM6	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.N381S	ENST00000539068.1	37	c.1142	CCDS4808.1	6	.	.	.	.	.	.	.	.	.	.	T	21.4	4.140388	0.77775	.	.	ENSG00000096060	ENST00000536438;ENST00000357266;ENST00000539068;ENST00000337746;ENST00000540787;ENST00000543400	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.63	5.63	0.86233	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.105878	0.64402	D	0.000007	T	0.39436	0.1078	L	0.38953	1.18	0.80722	D	1	P	0.51653	0.947	P	0.48524	0.58	T	0.19910	-1.0291	10	0.32370	T	0.25	-7.4094	15.8429	0.78864	0.0:0.0:0.0:1.0	.	381	Q13451	FKBP5_HUMAN	S	381;381;381;381;202;344	ENSP00000444810:N381S;ENSP00000349811:N381S;ENSP00000441205:N381S;ENSP00000445412:N202S	ENSP00000338160:N381S	N	-	2	0	FKBP5	35652873	1.000000	0.71417	0.527000	0.27925	0.990000	0.78478	7.698000	0.84413	2.145000	0.66743	0.533000	0.62120	AAC	FKBP5	-	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000096060		0.512	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP5	HGNC	protein_coding	OTTHUMT00000040309.2	74	0.00	0	T			35544895	35544895	-1	no_errors	ENST00000337746	ensembl	human	known	69_37n	missense	80	22.12	23	SNP	1.000	C
FUT1	2523	genome.wustl.edu	37	19	49254065	49254065	+	Silent	SNP	T	T	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:49254065T>C	ENST00000310160.3	-	4	1448	c.474A>G	c.(472-474)agA>agG	p.R158R	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	158					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		GGAAAGGATCTCTCAAGTCCG	0.612																																						dbGAP											0													124.0	136.0	132.0					19																	49254065		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.474A>G	19.37:g.49254065T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O14505|O14506|O14507	Silent	SNP	pfam_Glyco_trans_11	p.R158	ENST00000310160.3	37	c.474	CCDS12733.1	19																																																																																			FUT1	-	pfam_Glyco_trans_11	ENSG00000174951		0.612	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT1	HGNC	protein_coding	OTTHUMT00000466194.1	64	0.00	0	T	NM_000148		49254065	49254065	-1	no_errors	ENST00000310160	ensembl	human	known	69_37n	silent	39	33.90	20	SNP	0.000	C
HEATR5A	25938	genome.wustl.edu	37	14	31762674	31762674	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:31762674G>T	ENST00000389961.3	-	35	5959	c.5960C>A	c.(5959-5961)tCt>tAt	p.S1987Y	HEATR5A_ENST00000439348.1_Missense_Mutation_p.S1912Y|HEATR5A_ENST00000543095.2_Missense_Mutation_p.S1993Y|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439727.1_Missense_Mutation_p.S1700Y			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1987										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TTTAAAAACAGATGAATACTG	0.393																																						dbGAP											0													138.0	136.0	137.0					14																	31762674		1822	4074	5896	-	-	-	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5960C>A	14.37:g.31762674G>T	ENSP00000374611:p.Ser1987Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S1987Y	ENST00000389961.3	37	c.5960		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.277070|4.277070	0.80580|0.80580	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000538864|ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	.|T;T;T;T	.|0.69926	.|-0.26;-0.44;-0.26;-0.26	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.268388	.|0.36555	.|N	.|0.002531	T|T	0.73737|0.73737	0.3625|0.3625	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|P	.|0.42375	.|0.778	.|P	.|0.48425	.|0.577	T|T	0.75150|0.75150	-0.3419|-0.3419	5|10	.|0.62326	.|D	.|0.03	.|.	19.6777|19.6777	0.95943|0.95943	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1912	.|Q86XA9-2	.|.	M|Y	1546|1987;1912;1700;1993	.|ENSP00000374611:S1987Y;ENSP00000405407:S1912Y;ENSP00000408681:S1700Y;ENSP00000437968:S1993Y	.|ENSP00000374611:S1987Y	L|S	-|-	1|2	2|0	HEATR5A|HEATR5A	30832425|30832425	0.996000|0.996000	0.38824|0.38824	0.699000|0.699000	0.30290|0.30290	0.934000|0.934000	0.57294|0.57294	4.642000|4.642000	0.61383|0.61383	2.646000|2.646000	0.89796|0.89796	0.650000|0.650000	0.86243|0.86243	CTG|TCT	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.393	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		33	0.00	0	G	NM_015473		31762674	31762674	-1	no_errors	ENST00000389961	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	0.768	T
HEATR5A	25938	genome.wustl.edu	37	14	31762749	31762749	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:31762749G>T	ENST00000389961.3	-	35	5884	c.5885C>A	c.(5884-5886)tCa>tAa	p.S1962*	HEATR5A_ENST00000439348.1_Nonsense_Mutation_p.S1887*|HEATR5A_ENST00000543095.2_Nonsense_Mutation_p.S1968*|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439727.1_Nonsense_Mutation_p.S1675*			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1962										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GGAAGTTGCTGATCCCAGAGA	0.373																																						dbGAP											0													68.0	69.0	69.0					14																	31762749		1847	4087	5934	-	-	-	SO:0001587	stop_gained	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5885C>A	14.37:g.31762749G>T	ENSP00000374611:p.Ser1962*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.S1962*	ENST00000389961.3	37	c.5885		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	48|48	13.974070|13.974070	0.99773|0.99773	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000538864|ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	.|.	.|.	.|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.058915	.|0.64402	.|D	.|0.000001	T|.	0.48259|.	0.1490|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37267|.	-0.9713|.	4|.	.|0.02654	.|T	.|1	.|.	20.0006|20.0006	0.97406|0.97406	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|X	1521|1962;1887;1675;1968	.|.	.|ENSP00000374611:S1962X	Q|S	-|-	1|2	0|0	HEATR5A|HEATR5A	30832500|30832500	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.658000|5.658000	0.68003|0.68003	2.726000|2.726000	0.93360|0.93360	0.650000|0.650000	0.86243|0.86243	CAG|TCA	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.373	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		32	0.00	0	G	NM_015473		31762749	31762749	-1	no_errors	ENST00000389961	ensembl	human	known	69_37n	nonsense	43	18.87	10	SNP	1.000	T
HEATR5A	25938	genome.wustl.edu	37	14	31763215	31763215	+	Silent	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:31763215G>A	ENST00000389961.3	-	34	5696	c.5697C>T	c.(5695-5697)atC>atT	p.I1899I	HEATR5A_ENST00000439348.1_Silent_p.I1824I|HEATR5A_ENST00000543095.2_Silent_p.I1905I|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439727.1_Silent_p.I1612I			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1899										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GTTTTTCCATGATACAGGATG	0.398																																						dbGAP											0													127.0	109.0	114.0					14																	31763215		1852	4110	5962	-	-	-	SO:0001819	synonymous_variant	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5697C>T	14.37:g.31763215G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S1458L	ENST00000389961.3	37	c.4373		14	.	.	.	.	.	.	.	.	.	.	G	1.686	-0.505265	0.04261	.	.	ENSG00000129493	ENST00000538864	.	.	.	5.22	-7.76	0.01232	.	.	.	.	.	T	0.52933	0.1765	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59899	-0.7367	4	.	.	.	.	11.7535	0.51862	0.3574:0.0995:0.5431:0.0	.	.	.	.	L	1458	.	.	S	-	2	0	HEATR5A	30832966	0.057000	0.20700	0.174000	0.22961	0.176000	0.22953	-0.224000	0.09164	-1.756000	0.01318	-0.377000	0.06932	TCA	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.398	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		52	0.00	0	G	NM_015473		31763215	31763215	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000538864	ensembl	human	novel	69_37n	missense	95	15.18	17	SNP	0.872	A
HEATR5A	25938	genome.wustl.edu	37	14	31763259	31763259	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:31763259G>A	ENST00000389961.3	-	34	5652	c.5653C>T	c.(5653-5655)Cca>Tca	p.P1885S	HEATR5A_ENST00000439348.1_Missense_Mutation_p.P1810S|HEATR5A_ENST00000543095.2_Missense_Mutation_p.P1891S|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439727.1_Missense_Mutation_p.P1598S			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1885										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GAAACAGCTGGATTTGGATAC	0.348																																						dbGAP											0													96.0	85.0	89.0					14																	31763259		1834	4093	5927	-	-	-	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5653C>T	14.37:g.31763259G>A	ENSP00000374611:p.Pro1885Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.P1885S	ENST00000389961.3	37	c.5653		14	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692869	0.30052	.	.	ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	T;T;T;T	0.68903	-0.13;-0.36;-0.13;-0.13	5.22	5.22	0.72569	.	0.113656	0.64402	D	0.000012	T	0.69691	0.3139	L	0.60455	1.87	0.80722	D	1	P	0.42375	0.778	P	0.48189	0.57	T	0.69109	-0.5232	10	0.38643	T	0.18	.	13.6903	0.62542	0.0:0.0:0.8066:0.1934	.	1810	Q86XA9-2	.	S	1885;1810;1598;1891	ENSP00000374611:P1885S;ENSP00000405407:P1810S;ENSP00000408681:P1598S;ENSP00000437968:P1891S	ENSP00000374611:P1885S	P	-	1	0	HEATR5A	30833010	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.639000	0.54339	2.448000	0.82819	0.555000	0.69702	CCA	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.348	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		36	0.00	0	G	NM_015473		31763259	31763259	-1	no_errors	ENST00000389961	ensembl	human	known	69_37n	missense	73	19.78	18	SNP	1.000	A
MROH2A	339766	genome.wustl.edu	37	2	234737360	234737360	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr2:234737360G>C	ENST00000389758.3	+	36	4364	c.4198G>C	c.(4198-4200)Gac>Cac	p.D1400H				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	1432																	CCAGGAGGAAGACGAGGCCCT	0.667																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.4198G>C	2.37:g.234737360G>C	ENSP00000374408:p.Asp1400His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1402H	ENST00000389758.3	37	c.4204		2	.	.	.	.	.	.	.	.	.	.	g	9.962	1.223006	0.22457	.	.	ENSG00000185038	ENST00000389758	T	0.66995	-0.24	4.99	4.08	0.47627	.	0.317993	0.26650	N	0.023209	T	0.66982	0.2845	L	0.50919	1.6	0.24255	N	0.995308	.	.	.	.	.	.	T	0.62455	-0.6851	8	0.72032	D	0.01	.	10.453	0.44533	0.0:0.2137:0.7863:0.0	.	.	.	.	H	1402	ENSP00000374408:D1402H	ENSP00000374408:D1402H	D	+	1	0	HEATR7B1	234402099	0.997000	0.39634	0.974000	0.42286	0.166000	0.22503	2.700000	0.47085	2.597000	0.87782	0.558000	0.71614	GAC	HEATR7B1	-	superfamily_ARM-type_fold	ENSG00000185038		0.667	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	37	0.00	0	G	XM_291007		234737360	234737360	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	missense	62	11.43	8	SNP	0.609	C
MROH2A	339766	genome.wustl.edu	37	2	234737631	234737631	+	Silent	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr2:234737631G>A	ENST00000389758.3	+	37	4525	c.4359G>A	c.(4357-4359)ctG>ctA	p.L1453L				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	1485																	TGGAGGCCCTGACCAAGATCC	0.612																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.4359G>A	2.37:g.234737631G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_ARM-type_fold	p.L1455	ENST00000389758.3	37	c.4365		2																																																																																			HEATR7B1	-	superfamily_ARM-type_fold	ENSG00000185038		0.612	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	20	0.00	0	G	XM_291007		234737631	234737631	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	silent	31	18.42	7	SNP	0.998	A
MROH2A	339766	genome.wustl.edu	37	2	234737637	234737637	+	Silent	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr2:234737637G>A	ENST00000389758.3	+	37	4531	c.4365G>A	c.(4363-4365)aaG>aaA	p.K1455K				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	1487																	CCCTGACCAAGATCCTGGCTG	0.612																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.4365G>A	2.37:g.234737637G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_ARM-type_fold	p.K1457	ENST00000389758.3	37	c.4371		2																																																																																			HEATR7B1	-	superfamily_ARM-type_fold	ENSG00000185038		0.612	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	20	0.00	0	G	XM_291007		234737637	234737637	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	silent	33	19.51	8	SNP	0.590	A
HKR1	284459	genome.wustl.edu	37	19	37853116	37853116	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:37853116C>A	ENST00000324411.4	+	6	688	c.419C>A	c.(418-420)tCa>tAa	p.S140*	HKR1_ENST00000544914.1_5'UTR|HKR1_ENST00000392153.3_Nonsense_Mutation_p.S121*|HKR1_ENST00000591471.1_5'UTR|HKR1_ENST00000589392.1_Nonsense_Mutation_p.S122*|HKR1_ENST00000541583.2_Nonsense_Mutation_p.S79*|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000586897.1_3'UTR	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	140					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGCTGTTTTCAAGTTTATGG	0.468																																						dbGAP											0													94.0	95.0	95.0					19																	37853116		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.419C>A	19.37:g.37853116C>A	ENSP00000315505:p.Ser140*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S140*	ENST00000324411.4	37	c.419	CCDS12502.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.209523	0.95069	.	.	ENSG00000181666	ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	.	.	.	2.71	2.71	0.32032	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999986	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.6085	7.0792	0.25221	0.2688:0.7312:0.0:0.0	.	.	.	.	X	79;121;176;140;79	.	ENSP00000315505:S140X	S	+	2	0	HKR1	42544956	0.000000	0.05858	0.265000	0.24526	0.985000	0.73830	0.656000	0.24948	1.821000	0.53095	0.650000	0.86243	TCA	HKR1	-	NULL	ENSG00000181666		0.468	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HKR1	HGNC	protein_coding	OTTHUMT00000458375.1	75	0.00	0	C	NM_181786		37853116	37853116	+1	no_errors	ENST00000324411	ensembl	human	known	69_37n	nonsense	102	10.53	12	SNP	0.559	A
HMGB1P5	10354	genome.wustl.edu	37	3	22423998	22423998	+	RNA	SNP	C	C	T	rs13070522	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr3:22423998C>T	ENST00000451497.1	+	0	563									high mobility group box 1 pseudogene 5																		GCATTTAACCCCCCTGTACAC	0.333													-|||	2365	0.472244	0.2799	0.6354	5008	,	,		18259	0.4296		0.5388	False		,,,				2504	0.592					dbGAP											0																																										-	-	-			0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22423998C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1	19	0.00	0	C	NG_000897		22423998	22423998	+1	no_errors	ENST00000451497	ensembl	human	known	69_37n	rna	16	27.27	6	SNP	1.000	T
HMGXB3	22993	genome.wustl.edu	37	5	149386060	149386060	+	Silent	SNP	C	C	T	rs552079525		TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr5:149386060C>T	ENST00000502717.1	+	3	626	c.162C>T	c.(160-162)taC>taT	p.Y54Y	HMGXB3_ENST00000503427.1_Silent_p.Y54Y	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	300					phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						TGTACTATTACGACATCTACC	0.512																																						dbGAP											0													47.0	43.0	44.0					5																	149386060		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.162C>T	5.37:g.149386060C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9Y4|Q86UG3|Q9UMF4	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.Y54	ENST00000502717.1	37	c.162	CCDS54935.1	5																																																																																			HMGXB3	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000113716		0.512	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGXB3	HGNC	protein_coding	OTTHUMT00000373771.1	83	0.00	0	C	XM_001717202		149386060	149386060	+1	no_errors	ENST00000502717	ensembl	human	known	69_37n	silent	91	14.95	16	SNP	0.546	T
HOXB1	3211	genome.wustl.edu	37	17	46608135	46608135	+	Silent	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr17:46608135G>A	ENST00000239174.6	-	1	224	c.132C>T	c.(130-132)agC>agT	p.S44S	HOXB1_ENST00000577092.1_Silent_p.S44S	NM_002144.3	NP_002135.2	P14653	HXB1_HUMAN	homeobox B1	44					anatomical structure formation involved in morphogenesis (GO:0048646)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|multicellular organismal development (GO:0007275)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AGCGGCCCTCGCTTGCATAGC	0.677																																						dbGAP											0													41.0	49.0	46.0					17																	46608135		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32675.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120094	ENSG00000120094		"""Homeoboxes / ANTP class : HOXL subclass"""	5111	protein-coding gene	gene with protein product		142968	"""homeo box B1"""	HOX2, HOX2I		1973146, 1358459	Standard	NM_002144		Approved		uc002ink.1	P14653	OTTHUMG00000159929	ENST00000239174.6:c.132C>T	17.37:g.46608135G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VB03	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.S44	ENST00000239174.6	37	c.132	CCDS32675.1	17																																																																																			HOXB1	-	NULL	ENSG00000120094		0.677	HOXB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB1	HGNC	protein_coding	OTTHUMT00000358383.3	98	0.00	0	G			46608135	46608135	-1	no_errors	ENST00000239174	ensembl	human	known	69_37n	silent	45	54.46	55	SNP	0.847	A
INTS5	80789	genome.wustl.edu	37	11	62416636	62416636	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr11:62416636C>T	ENST00000330574.2	-	2	968	c.916G>A	c.(916-918)Gga>Aga	p.G306R	GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000346178.4_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	306					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						ATGCTATCTCCGTGGCGGGAG	0.622																																						dbGAP											0													50.0	56.0	54.0					11																	62416636		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.916G>A	11.37:g.62416636C>T	ENSP00000327889:p.Gly306Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6W5|Q9C0G5	Missense_Mutation	SNP	NULL	p.G306R	ENST00000330574.2	37	c.916	CCDS8027.1	11	.	.	.	.	.	.	.	.	.	.	C	12.94	2.087439	0.36855	.	.	ENSG00000185085	ENST00000330574	.	.	.	4.45	4.45	0.53987	.	0.147744	0.46758	D	0.000278	T	0.47544	0.1451	L	0.36672	1.1	0.38593	D	0.95048	D	0.61697	0.99	P	0.45753	0.492	T	0.56092	-0.8036	9	0.52906	T	0.07	.	14.6556	0.68831	0.0:1.0:0.0:0.0	.	306	Q6P9B9	INT5_HUMAN	R	306	.	ENSP00000327889:G306R	G	-	1	0	INTS5	62173212	0.952000	0.32445	0.999000	0.59377	0.119000	0.20118	2.186000	0.42593	2.320000	0.78422	0.650000	0.86243	GGA	INTS5	-	NULL	ENSG00000185085		0.622	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	HGNC	protein_coding	OTTHUMT00000395327.1	64	0.00	0	C	NM_030628		62416636	62416636	-1	no_errors	ENST00000330574	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	1.000	T
KLC2	64837	genome.wustl.edu	37	11	66034679	66034679	+	3'UTR	SNP	G	G	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr11:66034679G>T	ENST00000417856.1	+	0	2364				RAB1B_ENST00000527397.1_5'Flank|KLC2_ENST00000394066.2_3'UTR|RP11-867G23.3_ENST00000501708.1_lincRNA|RAB1B_ENST00000311481.6_5'Flank|KLC2_ENST00000394065.2_3'UTR|KLC2_ENST00000316924.5_3'UTR|RP11-867G23.1_ENST00000530805.1_RNA|RP11-867G23.2_ENST00000533287.1_RNA|KLC2_ENST00000394078.1_Missense_Mutation_p.A258S|KLC2_ENST00000421552.1_3'UTR|KLC2_ENST00000394067.2_3'UTR	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						AGCAGGAGGTGCCGGCTGGAG	0.652																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.*252G>T	11.37:g.66034679G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,prints_Kinesin_light	p.A258S	ENST00000417856.1	37	c.772	CCDS8130.1	11	.	.	.	.	.	.	.	.	.	.	G	7.711	0.695222	0.15039	.	.	ENSG00000174996	ENST00000394078	T	0.73258	-0.73	4.03	2.06	0.26882	.	.	.	.	.	T	0.56630	0.1998	.	.	.	0.09310	N	0.999999	B	0.23316	0.083	B	0.17433	0.018	T	0.52381	-0.8583	8	0.87932	D	0	.	5.0554	0.14529	0.1126:0.0:0.6827:0.2047	.	258	A8MX29	.	S	258	ENSP00000377641:A258S	ENSP00000377641:A258S	A	+	1	0	KLC2	65791255	0.008000	0.16893	0.005000	0.12908	0.067000	0.16453	1.407000	0.34657	0.896000	0.36366	0.561000	0.74099	GCC	KLC2	-	NULL	ENSG00000174996		0.652	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLC2	HGNC	protein_coding	OTTHUMT00000258200.1	50	0.00	0	G	NM_022822		66034679	66034679	+1	no_errors	ENST00000394078	ensembl	human	putative	69_37n	missense	12	77.78	42	SNP	0.001	T
KRT40	125115	genome.wustl.edu	37	17	39135122	39135122	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr17:39135122T>G	ENST00000398486.2	-	8	1290	c.1130A>C	c.(1129-1131)gAc>gCc	p.D377A	KRT40_ENST00000377755.4_Missense_Mutation_p.D377A|AC004231.2_ENST00000418393.1_RNA	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	377	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				GGCCTTCACGTCCAGGAGCAC	0.587																																						dbGAP											0													88.0	97.0	94.0					17																	39135122		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.1130A>C	17.37:g.39135122T>G	ENSP00000381500:p.Asp377Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFU5	Missense_Mutation	SNP	pfam_F,prints_Keratin_I	p.D377A	ENST00000398486.2	37	c.1130	CCDS42320.1	17	.	.	.	.	.	.	.	.	.	.	T	20.8	4.051692	0.75960	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	D;D	0.91351	-2.83;-2.83	5.56	5.56	0.83823	Filament (1);	0.000000	0.35677	N	0.003050	D	0.95996	0.8696	M	0.92169	3.28	0.45250	D	0.998253	D	0.76494	0.999	D	0.91635	0.999	D	0.96499	0.9370	10	0.87932	D	0	.	11.1808	0.48627	0.0:0.0745:0.0:0.9255	.	377	Q6A162	K1C40_HUMAN	A	377	ENSP00000366984:D377A;ENSP00000381500:D377A	ENSP00000366984:D377A	D	-	2	0	KRT40	36388648	1.000000	0.71417	0.969000	0.41365	0.782000	0.44232	4.160000	0.58164	2.246000	0.74042	0.533000	0.62120	GAC	KRT40	-	pfam_F	ENSG00000204889		0.587	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT40	HGNC	protein_coding	OTTHUMT00000257701.3	98	0.00	0	T	NM_182497		39135122	39135122	-1	no_errors	ENST00000377755	ensembl	human	known	69_37n	missense	65	17.72	14	SNP	1.000	G
KRT85	3891	genome.wustl.edu	37	12	52756655	52756655	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr12:52756655C>G	ENST00000257901.3	-	6	1135	c.1060G>C	c.(1060-1062)Gag>Cag	p.E354Q	KRT85_ENST00000544265.1_Missense_Mutation_p.E142Q	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	354	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TTGGCATTCTCAATCTCGGCC	0.592																																						dbGAP											0													141.0	116.0	125.0					12																	52756655		2203	4300	6503	-	-	-	SO:0001583	missense	0			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1060G>C	12.37:g.52756655C>G	ENSP00000257901:p.Glu354Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSB1	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.E354Q	ENST00000257901.3	37	c.1060	CCDS8824.1	12	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907801	0.92107	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	D;D	0.88818	-2.43;-2.43	4.49	4.49	0.54785	Filament (1);	0.000000	0.64402	D	0.000016	D	0.90287	0.6962	L	0.41356	1.27	0.41397	D	0.987654	P	0.34522	0.455	P	0.49477	0.612	D	0.91493	0.5213	10	0.87932	D	0	.	16.959	0.86267	0.0:1.0:0.0:0.0	.	354	P78386	KRT85_HUMAN	Q	354;142	ENSP00000257901:E354Q;ENSP00000440240:E142Q	ENSP00000257901:E354Q	E	-	1	0	KRT85	51042922	0.974000	0.33945	0.942000	0.38095	0.967000	0.64934	3.185000	0.50934	2.339000	0.79563	0.561000	0.74099	GAG	KRT85	-	pfam_F,superfamily_Prefoldin	ENSG00000135443		0.592	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	80	0.00	0	C	NM_002283		52756655	52756655	-1	no_errors	ENST00000257901	ensembl	human	known	69_37n	missense	45	31.82	21	SNP	0.999	G
LTBP4	8425	genome.wustl.edu	37	19	41133733	41133733	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:41133733G>A	ENST00000308370.7	+	33	4688	c.4688G>A	c.(4687-4689)cGc>cAc	p.R1563H	LTBP4_ENST00000243562.9_3'UTR|LTBP4_ENST00000396819.3_Missense_Mutation_p.R1496H|LTBP4_ENST00000204005.9_Missense_Mutation_p.R1526H|LTBP4_ENST00000545697.1_3'UTR|LTBP4_ENST00000602240.1_3'UTR	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1564	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GACGGCTACCGCCTGGACATG	0.706																																						dbGAP											0													9.0	12.0	11.0					19																	41133733		2051	4158	6209	-	-	-	SO:0001583	missense	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.4688G>A	19.37:g.41133733G>A	ENSP00000311905:p.Arg1563His	Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R1563H	ENST00000308370.7	37	c.4688		19	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007325	0.75046	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819;ENST00000318809	D;D;D	0.87491	-2.26;-2.26;-2.26	4.33	4.33	0.51752	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38326	N	0.001723	D	0.91751	0.7391	.	.	.	0.39395	D	0.966492	D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.999;0.999;0.998	P;P;P;P;P;P	0.60236	0.871;0.871;0.747;0.813;0.866;0.814	D	0.92708	0.6180	9	0.51188	T	0.08	.	16.097	0.81132	0.0:0.0:1.0:0.0	.	324;576;784;1496;1564;1526	F5GYA5;Q8N2S1-4;B3KXY6;E7EUU1;Q8N2S1;E7ENG9	.;.;.;.;LTBP4_HUMAN;.	H	1526;1563;1496;324	ENSP00000204005:R1526H;ENSP00000311905:R1563H;ENSP00000380031:R1496H	ENSP00000204005:R1526H	R	+	2	0	LTBP4	45825573	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.161000	0.42358	2.376000	0.81061	0.655000	0.94253	CGC	LTBP4	-	smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000090006		0.706	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		112	0.00	0	G	NM_003573		41133733	41133733	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	missense	74	32.73	36	SNP	1.000	A
MFAP2	4237	genome.wustl.edu	37	1	17301448	17301448	+	Silent	SNP	C	C	T	rs2235933	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr1:17301448C>T	ENST00000375535.3	-	9	808	c.519G>A	c.(517-519)gcG>gcA	p.A173A	MFAP2_ENST00000375534.3_Silent_p.A172A|MFAP2_ENST00000438542.1_Silent_p.A172A|MFAP2_ENST00000490075.1_5'UTR			P55001	MFAP2_HUMAN	microfibrillar-associated protein 2	173	ShKT. {ECO:0000255|PROSITE- ProRule:PRU01005}.				extracellular matrix organization (GO:0030198)|platelet formation (GO:0030220)	extracellular region (GO:0005576)|microfibril (GO:0001527)				kidney(1)|lung(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000118)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000538)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|COAD - Colon adenocarcinoma(227;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;3.04e-05)|Kidney(64;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00544)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CACAGGAGGCCGCCACGGATT	0.662													C|||	1708	0.341054	0.2057	0.389	5008	,	,		11792	0.6151		0.2833	False		,,,				2504	0.2669					dbGAP											0													3.0	4.0	4.0					1																	17301448		1911	3756	5667	-	-	-	SO:0001819	synonymous_variant	0			BC015039	CCDS174.1, CCDS44071.1	1p36.1-p35	2008-02-05			ENSG00000117122	ENSG00000117122			7033	protein-coding gene	gene with protein product		156790				7759096	Standard	NM_017459		Approved	MAGP, MAGP-1	uc001azw.3	P55001	OTTHUMG00000002290	ENST00000375535.3:c.519G>A	1.37:g.17301448C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X60|Q5JXY0	Silent	SNP	pfam_MAGP,pfam_ShK_toxin	p.A173	ENST00000375535.3	37	c.519	CCDS174.1	1																																																																																			MFAP2	-	pfam_ShK_toxin	ENSG00000117122		0.662	MFAP2-001	KNOWN	basic|CCDS	protein_coding	MFAP2	HGNC	protein_coding	OTTHUMT00000006609.1	36	0.00	0	C	NM_002403		17301448	17301448	-1	no_errors	ENST00000375535	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.520	T
OTOG	340990	genome.wustl.edu	37	11	17632306	17632306	+	Missense_Mutation	SNP	C	C	T	rs1003490	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr11:17632306C>T	ENST00000399391.2	+	35	5495	c.5495C>T	c.(5494-5496)gCc>gTc	p.A1832V	OTOG_ENST00000399397.1_Missense_Mutation_p.A1759V|OTOG_ENST00000342528.2_Missense_Mutation_p.A838V	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1832	Pro-rich.		A -> V (in dbSNP:rs1003490).		adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						GCCCCAGTGGCCACACCCGGC	0.627													C|||	490	0.0978435	0.0968	0.0922	5008	,	,		16412	0.0089		0.1859	False		,,,				2504	0.1043					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.5495C>T	11.37:g.17632306C>T	ENSP00000382323:p.Ala1832Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.A1832V	ENST00000399391.2	37	c.5495	CCDS59225.1	11	234	0.10714285714285714	51	0.10365853658536585	36	0.09944751381215469	7	0.012237762237762238	140	0.18469656992084432	C	19.12	3.765186	0.69878	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	T;T;T	0.16457	2.34;2.45;2.79	5.92	5.01	0.66863	.	0.489617	0.19795	N	0.105887	T	0.00073	0.0002	M	0.68317	2.08	0.38965	P	0.041371999999999964	D	0.65815	0.995	P	0.61940	0.896	T	0.02728	-1.1118	9	0.44086	T	0.13	.	10.0273	0.42079	0.0:0.9109:0.0:0.0891	rs1003490;rs1003490	838	Q6ZRI0-2	.	V	1832;1759;838	ENSP00000382323:A1832V;ENSP00000382329:A1759V;ENSP00000341666:A838V	ENSP00000341666:A838V	A	+	2	0	OTOG	17588882	0.996000	0.38824	1.000000	0.80357	0.968000	0.65278	1.371000	0.34250	2.818000	0.97014	0.655000	0.94253	GCC	OTOG	-	NULL	ENSG00000188162		0.627	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		43	0.00	0	C			17632306	17632306	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
PCDHB10	56126	genome.wustl.edu	37	5	140574062	140574062	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr5:140574062A>G	ENST00000239446.4	+	1	2121	c.1937A>G	c.(1936-1938)gAc>gGc	p.D646G		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	646	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTTGTCAAGGACAATGGCGAG	0.701																																						dbGAP											0													22.0	24.0	23.0					5																	140574062		2078	3937	6015	-	-	-	SO:0001583	missense	0			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1937A>G	5.37:g.140574062A>G	ENSP00000239446:p.Asp646Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96T99	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D646G	ENST00000239446.4	37	c.1937	CCDS4252.1	5	.	.	.	.	.	.	.	.	.	.	a	14.66	2.601235	0.46423	.	.	ENSG00000120324	ENST00000239446	T	0.68765	-0.35	3.03	3.03	0.35002	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.89550	0.6747	H	0.99919	4.95	0.44523	D	0.997474	D	0.89917	1.0	D	0.97110	1.0	D	0.92147	0.5725	9	0.87932	D	0	.	11.3477	0.49569	1.0:0.0:0.0:0.0	.	646	Q9UN67	PCDBA_HUMAN	G	646	ENSP00000239446:D646G	ENSP00000239446:D646G	D	+	2	0	PCDHB10	140554246	1.000000	0.71417	0.999000	0.59377	0.234000	0.25298	5.783000	0.68982	1.393000	0.46605	0.248000	0.18094	GAC	PCDHB10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120324		0.701	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	HGNC	protein_coding	OTTHUMT00000251821.1	124	0.00	0	A	NM_018930		140574062	140574062	+1	no_errors	ENST00000239446	ensembl	human	known	69_37n	missense	57	21.92	16	SNP	1.000	G
PDE1B	5153	genome.wustl.edu	37	12	54955324	54955324	+	Intron	SNP	T	T	C	rs10747699	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr12:54955324T>C	ENST00000243052.3	+	3	549				PDE1B_ENST00000550620.1_5'UTR|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Intron	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTGGGGCTCCTGGGGTCAGGA	0.557													C|||	3035	0.60603	0.4539	0.6326	5008	,	,		16202	0.6121		0.6928	False		,,,				2504	0.6973					dbGAP											0													22.0	21.0	21.0					12																	54955324		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.114-5434T>C	12.37:g.54955324T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q92825|Q96KP3	RNA	SNP	-	NULL	ENST00000243052.3	37	NULL	CCDS8882.1	12																																																																																			PDE1B	-	-	ENSG00000123360		0.557	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	HGNC	protein_coding	OTTHUMT00000406203.1	72	0.00	0	T			54955324	54955324	+1	no_errors	ENST00000394277	ensembl	human	known	69_37n	rna	49	10.91	6	SNP	0.000	C
PHLDB3	653583	genome.wustl.edu	37	19	44001403	44001403	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:44001403C>T	ENST00000292140.5	-	6	1052	c.692G>A	c.(691-693)cGt>cAt	p.R231H	PHLDB3_ENST00000599242.1_Missense_Mutation_p.R231H	NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	231							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				CTCATAGGCACGTTGGGCCAC	0.622																																						dbGAP											0													35.0	31.0	32.0					19																	44001403		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.692G>A	19.37:g.44001403C>T	ENSP00000292140:p.Arg231His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7Z4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R231H	ENST00000292140.5	37	c.692	CCDS12621.2	19	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676297	0.67928	.	.	ENSG00000176531	ENST00000292140	T	0.56275	0.47	4.51	3.47	0.39725	.	0.197409	0.32386	N	0.006179	T	0.45577	0.1349	M	0.62723	1.935	0.22213	N	0.999287	D;B	0.54772	0.968;0.244	B;B	0.39617	0.305;0.022	T	0.48779	-0.9005	10	0.72032	D	0.01	.	9.0264	0.36232	0.0:0.8952:0.0:0.1048	.	231;231	Q6NSJ2-2;Q6NSJ2	.;PHLB3_HUMAN	H	231	ENSP00000292140:R231H	ENSP00000292140:R231H	R	-	2	0	PHLDB3	48693243	0.233000	0.23772	0.853000	0.33588	0.658000	0.38924	0.405000	0.21015	1.034000	0.39945	0.306000	0.20318	CGT	PHLDB3	-	NULL	ENSG00000176531		0.622	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	39	0.00	0	C			44001403	44001403	-1	no_errors	ENST00000292140	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.918	T
PLG	5340	genome.wustl.edu	37	6	161132417	161132417	+	Intron	SNP	T	T	G	rs4252082	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr6:161132417T>G	ENST00000308192.9	+	4	470				PLG_ENST00000462918.1_Intron|PLG_ENST00000366924.2_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	taaatgctatttaatcgttgt	0.284													G|||	1245	0.248602	0.5076	0.2248	5008	,	,		22070	0.001		0.3012	False		,,,				2504	0.1166					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.407+194T>G	6.37:g.161132417T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15146|Q5TEH4|Q6PA00	RNA	SNP	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			PLG	-	-	ENSG00000122194		0.284	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	50	0.00	0	T	NM_000301		161132417	161132417	+1	no_errors	ENST00000494325	ensembl	human	known	69_37n	rna	68	11.69	9	SNP	0.003	G
PREX2	80243	genome.wustl.edu	37	8	69069648	69069648	+	Silent	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr8:69069648C>T	ENST00000288368.4	+	35	4600	c.4323C>T	c.(4321-4323)gtC>gtT	p.V1441V		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1441					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGGAAAAGGTCAAACAGTACA	0.348																																						dbGAP											0													101.0	101.0	101.0					8																	69069648		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4323C>T	8.37:g.69069648C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.V1441	ENST00000288368.4	37	c.4323	CCDS6201.1	8																																																																																			PREX2	-	NULL	ENSG00000046889		0.348	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	55	0.00	0	C	NM_025170		69069648	69069648	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	silent	125	26.47	45	SNP	1.000	T
SAV1	60485	genome.wustl.edu	37	14	51111508	51111508	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr14:51111508C>G	ENST00000324679.4	-	3	1123	c.760G>C	c.(760-762)Gat>Cat	p.D254H		NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	254	WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					TTTGTGTGATCTACATAATAG	0.423																																						dbGAP											0													92.0	76.0	82.0					14																	51111508		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.760G>C	14.37:g.51111508C>G	ENSP00000324729:p.Asp254His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_SARAH,pfscan_WW_Rsp5_WWP	p.D254H	ENST00000324679.4	37	c.760	CCDS9701.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.975479|3.975479	0.74360|0.74360	.|.	.|.	ENSG00000151748|ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862|ENST00000557458	T;T|.	0.59502|.	0.26;0.27|.	6.17|6.17	6.17|6.17	0.99709|0.99709	WW/Rsp5/WWP (5);|.	0.043402|.	0.85682|.	D|.	0.000000|.	T|T	0.77592|0.77592	0.4153|0.4153	M|M	0.74467|0.74467	2.265|2.265	0.80722|0.80722	D|D	1|1	B|.	0.29481|.	0.245|.	B|.	0.27500|.	0.08|.	T|T	0.74959|0.74959	-0.3486|-0.3486	10|5	0.87932|.	D|.	0|.	-12.3953|-12.3953	19.4575|19.4575	0.94900|0.94900	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	254|.	Q9H4B6|.	SAV1_HUMAN|.	H|T	186;254;221|7	ENSP00000451492:D186H;ENSP00000324729:D254H|.	ENSP00000324729:D254H|.	D|R	-|-	1|2	0|0	SAV1|SAV1	50181258|50181258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.818000|7.818000	0.86416|0.86416	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|AGA	SAV1	-	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	ENSG00000151748		0.423	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAV1	HGNC	protein_coding	OTTHUMT00000276879.1	42	0.00	0	C			51111508	51111508	-1	no_errors	ENST00000324679	ensembl	human	known	69_37n	missense	38	22.45	11	SNP	1.000	G
SETD1B	23067	genome.wustl.edu	37	12	122248500	122248500	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr12:122248500C>G	ENST00000604567.1	+	6	1717	c.1649C>G	c.(1648-1650)tCc>tGc	p.S550C	SETD1B_ENST00000267197.5_Missense_Mutation_p.S550C|SETD1B_ENST00000542440.1_Missense_Mutation_p.S550C			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	550	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GGCACCAACTCCCAGCCAGGC	0.697																																						dbGAP											0													20.0	28.0	25.0					12																	122248500		692	1591	2283	-	-	-	SO:0001583	missense	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.1649C>G	12.37:g.122248500C>G	ENSP00000474253:p.Ser550Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	F6MFW1	Missense_Mutation	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.S550C	ENST00000604567.1	37	c.1649		12	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331118	0.41297	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	D;D	0.94897	-3.55;-3.55	4.97	4.97	0.65823	.	.	.	.	.	D	0.96109	0.8732	L	0.46157	1.445	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	D	0.96150	0.9107	9	0.49607	T	0.09	.	18.2215	0.89903	0.0:1.0:0.0:0.0	.	550	Q9UPS6	SET1B_HUMAN	C	550	ENSP00000442924:S550C;ENSP00000267197:S550C	ENSP00000267197:S550C	S	+	2	0	SETD1B	120732883	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	5.638000	0.67861	2.304000	0.77564	0.462000	0.41574	TCC	SETD1B	-	NULL	ENSG00000139718		0.697	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1	23	0.00	0	C	XM_037523		122248500	122248500	+1	no_errors	ENST00000267197	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	G
SLC35G6	643664	genome.wustl.edu	37	17	7386279	7386279	+	Missense_Mutation	SNP	T	T	C	rs7219992|rs66615310	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr17:7386279T>C	ENST00000412468.2	+	2	1091	c.976T>C	c.(976-978)Tgg>Cgg	p.W326R	POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	326						integral component of membrane (GO:0016021)											CATCACAGCCTGGAACCTCAG	0.552													c|||	3742	0.747204	0.5726	0.8718	5008	,	,		19125	0.9187		0.7734	False		,,,				2504	0.6912					dbGAP											0													70.0	65.0	67.0					17																	7386279		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.976T>C	17.37:g.7386279T>C	ENSP00000396523:p.Trp326Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DMT	p.W326R	ENST00000412468.2	37	c.976	CCDS45603.1	17	1275	0.5837912087912088	196	0.3983739837398374	250	0.6906077348066298	399	0.6975524475524476	430	0.5672823218997362	C	4.169	0.029957	0.08101	.	.	ENSG00000181222	ENST00000412468	T	0.66995	-0.24	4.7	3.72	0.42706	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.49389	P	2.1300000000001873E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.43798	-0.9369	8	0.20519	T	0.43	0.2542	7.4591	0.27285	0.1643:0.748:0.0:0.0877	rs7219992;rs57379166	326	P0C7Q6	S35G6_HUMAN	R	326	ENSP00000396523:W326R	ENSP00000396523:W326R	W	+	1	0	SLC35G6	7327003	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	1.015000	0.29963	0.538000	0.28769	-0.983000	0.02560	TGG	SLC35G6	-	NULL	ENSG00000259224		0.552	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G6	HGNC	protein_coding		114	0.87	1	T	NM_001102614		7386279	7386279	+1	no_errors	ENST00000412468	ensembl	human	known	69_37n	missense	97	10.19	11	SNP	1.000	C
SLC7A13	157724	genome.wustl.edu	37	8	87242151	87242151	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr8:87242151C>T	ENST00000297524.3	-	1	459	c.356G>A	c.(355-357)aGc>aAc	p.S119N	SLC7A13_ENST00000520624.1_Intron|SLC7A13_ENST00000419776.2_Missense_Mutation_p.S119N	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	119						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						AGGCTGGATGCTGTACTCAGC	0.493																																						dbGAP											0													70.0	67.0	68.0					8																	87242151		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.356G>A	8.37:g.87242151C>T	ENSP00000297524:p.Ser119Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1	p.S119N	ENST00000297524.3	37	c.356	CCDS34917.1	8	.	.	.	.	.	.	.	.	.	.	C	8.602	0.887192	0.17540	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.89746	-2.56;-2.56	4.33	2.33	0.28932	Amino acid permease domain (1);	1.227710	0.05570	N	0.570913	D	0.87398	0.6167	L	0.42245	1.32	0.09310	N	1	P;P	0.46912	0.886;0.572	P;B	0.47075	0.536;0.207	T	0.76860	-0.2803	10	0.72032	D	0.01	.	6.6082	0.22737	0.3591:0.4664:0.1745:0.0	.	119;119	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	N	119	ENSP00000297524:S119N;ENSP00000410982:S119N	ENSP00000297524:S119N	S	-	2	0	SLC7A13	87311267	0.301000	0.24444	0.177000	0.23020	0.526000	0.34562	1.333000	0.33816	1.136000	0.42199	0.514000	0.50259	AGC	SLC7A13	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1	ENSG00000164893		0.493	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A13	HGNC	protein_coding	OTTHUMT00000374704.1	32	0.00	0	C	NM_138817		87242151	87242151	-1	no_errors	ENST00000297524	ensembl	human	known	69_37n	missense	89	13.59	14	SNP	0.045	T
TDRD12	91646	genome.wustl.edu	37	19	33309030	33309030	+	Missense_Mutation	SNP	A	A	T	rs12151363	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:33309030A>T	ENST00000444215.2	+	27	3670	c.3350A>T	c.(3349-3351)cAg>cTg	p.Q1117L				Q587J7	TDR12_HUMAN	tudor domain containing 12	1117					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					gctcaagaccaggatcatcca	0.582													A|||	386	0.0770767	0.0098	0.0807	5008	,	,		17260	0.1042		0.162	False		,,,				2504	0.0501					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.3350A>T	19.37:g.33309030A>T	ENSP00000416248:p.Gln1117Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tudor,pfam_DNA/RNA_helicase_DEAD/DEAH_N	p.Q1117L	ENST00000444215.2	37	c.3350		19	194	0.08882783882783883	5	0.01016260162601626	28	0.07734806629834254	47	0.08216783216783216	114	0.1503957783641161	A	5.507	0.278457	0.10403	.	.	ENSG00000173809	ENST00000444215	T	0.23147	1.92	0.235	0.235	0.15431	.	.	.	.	.	T	0.00073	0.0002	.	.	.	0.58432	P	1.0000000000287557E-6	B	0.30211	0.273	B	0.26416	0.069	T	0.18903	-1.0322	6	0.49607	T	0.09	.	.	.	.	rs12151363;rs17206191;rs52812301;rs12151363	1117	Q587J7	TDR12_HUMAN	L	1117	ENSP00000416248:Q1117L	ENSP00000416248:Q1117L	Q	+	2	0	TDRD12	38000870	0.021000	0.18746	0.100000	0.21137	0.050000	0.14768	0.699000	0.25586	0.263000	0.21812	0.260000	0.18958	CAG	TDRD12	-	NULL	ENSG00000173809		0.582	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1	67	0.00	0	A	NM_001015890		33309030	33309030	+1	no_errors	ENST00000444215	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.129	T
TNRC18	84629	genome.wustl.edu	37	7	5352791	5352793	+	In_Frame_Del	DEL	GCT	GCT	-	rs191028877|rs374450776	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr7:5352791_5352793delGCT	ENST00000430969.1	-	27	8077_8079	c.7729_7731delAGC	c.(7729-7731)agcdel	p.S2577del	TNRC18_ENST00000399537.4_In_Frame_Del_p.S2577del	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2577	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TCTCCGAgccgctgctgctgctg	0.69																																						dbGAP											0										14,42,1342		6,0,2,11,20,660						0.5	0.2			6	46,100,3046		15,0,16,25,50,1490	no	codingComplex	TNRC18	NM_001080495.2		21,0,18,36,70,2150	A1A1,A1A2,A1R,A2A2,A2R,RR		4.5739,4.0057,4.4009				60,142,4388				-	-	-	SO:0001651	inframe_deletion	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7729_7731delAGC	7.37:g.5352800_5352802delGCT	ENSP00000395538:p.Ser2577del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX41|Q96JH1|Q96K91	In_Frame_Del	DEL	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.S2577in_frame_del	ENST00000430969.1	37	c.7731_7729	CCDS47534.1	7																																																																																			TNRC18	-	NULL	ENSG00000182095		0.690	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		47	0.00	0	GCT			5352791	5352793	-1	no_errors	ENST00000399537	ensembl	human	known	69_37n	in_frame_del	24	11.11	3	DEL	0.989:0.990:0.991	-
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	49	0.00	0	G	NM_000546		7578263	7578263	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	17	68.52	37	SNP	1.000	A
TPP2	7174	genome.wustl.edu	37	13	103301463	103301463	+	Nonsense_Mutation	SNP	T	T	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr13:103301463T>G	ENST00000376065.4	+	22	2871	c.2835T>G	c.(2833-2835)taT>taG	p.Y945*	TPP2_ENST00000376052.3_Nonsense_Mutation_p.Y945*	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	945					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CACCCAAATATAACCAGCCAT	0.338																																						dbGAP											0													136.0	131.0	133.0					13																	103301463		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2835T>G	13.37:g.103301463T>G	ENSP00000365233:p.Tyr945*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZU8	Nonsense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.Y945*	ENST00000376065.4	37	c.2835	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	T	39	7.902729	0.98551	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.76	-7.19	0.01500	.	0.291693	0.37906	N	0.001883	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	19.3304	0.94283	0.0:0.6212:0.0:0.3788	.	.	.	.	X	945	.	ENSP00000365220:Y945X	Y	+	3	2	TPP2	102099464	0.041000	0.20044	0.711000	0.30485	0.994000	0.84299	-0.736000	0.04882	-1.482000	0.01860	0.482000	0.46254	TAT	TPP2	-	pfam_Peptidase_S8A_TPPII	ENSG00000134900		0.338	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	67	0.00	0	T			103301463	103301463	+1	no_errors	ENST00000376065	ensembl	human	known	69_37n	nonsense	29	35.56	16	SNP	0.465	G
TRIM54	57159	genome.wustl.edu	37	2	27529175	27529175	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr2:27529175G>A	ENST00000380075.2	+	7	1301	c.961G>A	c.(961-963)Gaa>Aaa	p.E321K	TRIM54_ENST00000296098.4_Missense_Mutation_p.E363K	NM_187841.2	NP_912730.2	Q9BYV2	TRI54_HUMAN	tripartite motif containing 54	321	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|negative regulation of microtubule depolymerization (GO:0007026)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACGTGGCCGAAATGCTGCG	0.667																																						dbGAP											0													62.0	63.0	63.0					2																	27529175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ291714	CCDS1745.2, CCDS1746.2	2p23.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000138100	ENSG00000138100		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16008	protein-coding gene	gene with protein product		606474	"""ring finger protein 30"", ""tripartite motif-containing 54"""	RNF30		11243782	Standard	NM_032546		Approved	MURF, MURF-3	uc002rjn.3	Q9BYV2	OTTHUMG00000097078	ENST00000380075.2:c.961G>A	2.37:g.27529175G>A	ENSP00000369415:p.Glu321Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8T7|Q53SY4|Q9BYV3	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_Chorismate_mutase_type_II,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.E363K	ENST00000380075.2	37	c.1087	CCDS1746.2	2	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530467	0.45073	.	.	ENSG00000138100	ENST00000380075;ENST00000380073;ENST00000296098	T;T	0.39997	1.27;1.05	5.33	5.33	0.75918	COS domain (1);	0.281432	0.35805	N	0.002961	T	0.25606	0.0623	N	0.16368	0.405	0.37196	D	0.904136	B;B	0.19073	0.033;0.002	B;B	0.10450	0.005;0.002	T	0.13335	-1.0513	10	0.02654	T	1	-6.7026	16.5204	0.84312	0.0:0.0:1.0:0.0	.	321;363	Q9BYV2;Q9BYV2-2	TRI54_HUMAN;.	K	321;142;363	ENSP00000369415:E321K;ENSP00000296098:E363K	ENSP00000296098:E363K	E	+	1	0	TRIM54	27382679	0.989000	0.36119	0.918000	0.36340	0.594000	0.36715	4.943000	0.63554	2.492000	0.84095	0.555000	0.69702	GAA	TRIM54	-	NULL	ENSG00000138100		0.667	TRIM54-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM54	HGNC	protein_coding	OTTHUMT00000214199.2	119	0.00	0	G	NM_187841		27529175	27529175	+1	no_errors	ENST00000296098	ensembl	human	known	69_37n	missense	78	35.00	42	SNP	0.961	A
UPF2	26019	genome.wustl.edu	37	10	12046629	12046629	+	Silent	SNP	A	A	G			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr10:12046629A>G	ENST00000356352.2	-	4	1877	c.1404T>C	c.(1402-1404)taT>taC	p.Y468Y	UPF2_ENST00000397053.2_Silent_p.Y468Y|UPF2_ENST00000357604.5_Silent_p.Y468Y			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	468					gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				TGAGGTTCTCATAAAAATTCC	0.378																																						dbGAP											0													107.0	99.0	101.0					10																	12046629		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.1404T>C	10.37:g.12046629A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Silent	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.Y468	ENST00000356352.2	37	c.1404	CCDS7086.1	10																																																																																			UPF2	-	NULL	ENSG00000151461		0.378	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	54	0.00	0	A			12046629	12046629	-1	no_errors	ENST00000356352	ensembl	human	known	69_37n	silent	87	20.91	23	SNP	1.000	G
WBP11P1	441818	genome.wustl.edu	37	18	30092097	30092097	+	RNA	SNP	C	C	T	rs718721	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr18:30092097C>T	ENST00000567636.1	+	0	472					NR_003558.1				WW domain binding protein 11 pseudogene 1																		TATTCTATGACTCTATGAAAA	0.348													C|||	2340	0.467252	0.2042	0.5072	5008	,	,		20047	0.5476		0.5408	False		,,,				2504	0.636					dbGAP											0																																										-	-	-			0			BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30092097C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			WBP11P1	-	-	ENSG00000260389		0.348	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	42	0.00	0	C			30092097	30092097	+1	no_errors	ENST00000567636	ensembl	human	known	69_37n	rna	29	14.71	5	SNP	0.997	T
YTHDF2	51441	genome.wustl.edu	37	1	29064036	29064036	+	Intron	SNP	C	C	T	rs61787567	byFrequency	TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr1:29064036C>T	ENST00000373812.3	+	2	389				YTHDF2_ENST00000542507.1_Intron|YTHDF2_ENST00000541996.1_Intron|YTHDF2_ENST00000478283.1_3'UTR	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2						humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCCTCTTCCTCACTACCAT	0.607													C|||	443	0.0884585	0.0219	0.134	5008	,	,		12515	0.0		0.2276	False		,,,				2504	0.0941					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.28-134C>T	1.37:g.29064036C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	RNA	SNP	-	NULL	ENST00000373812.3	37	NULL	CCDS41296.1	1																																																																																			YTHDF2	-	-	ENSG00000198492		0.607	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF2	HGNC	protein_coding	OTTHUMT00000010335.1	75	0.00	0	C	NM_016258		29064036	29064036	+1	no_errors	ENST00000478283	ensembl	human	known	69_37n	rna	37	11.90	5	SNP	0.801	T
ZNF114	163071	genome.wustl.edu	37	19	48789742	48789742	+	Silent	SNP	C	C	T	rs200721350		TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr19:48789742C>T	ENST00000595607.1	+	6	1355	c.861C>T	c.(859-861)aaC>aaT	p.N287N	ZNF114_ENST00000600687.1_Silent_p.N287N|ZNF114_ENST00000315849.1_Silent_p.N287N|ZNF114_ENST00000597695.1_Silent_p.N253N			Q8NC26	ZN114_HUMAN	zinc finger protein 114	287					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		CCTCTGCCAACGCTCCAAATT	0.453																																						dbGAP											0													82.0	76.0	78.0					19																	48789742		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.861C>T	19.37:g.48789742C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B0|Q08AQ6	Silent	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N287	ENST00000595607.1	37	c.861	CCDS12713.1	19																																																																																			ZNF114	-	NULL	ENSG00000178150		0.453	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF114	HGNC	protein_coding	OTTHUMT00000465601.1	25	0.00	0	C	NM_153608		48789742	48789742	+1	no_errors	ENST00000315849	ensembl	human	known	69_37n	silent	8	50.00	8	SNP	0.000	T
ZNF205	7755	genome.wustl.edu	37	16	3169359	3169359	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A402-01A-11D-A23C-09	TCGA-B6-A402-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d7db268b-d2b0-48f6-8a1f-c7fa1c12b5fd	49d02ca7-0a88-4936-8f0d-aec9b9b888a4	g.chr16:3169359C>T	ENST00000382192.3	+	7	903	c.698C>T	c.(697-699)cCg>cTg	p.P233L	RP11-473M20.14_ENST00000575139.1_RNA|ZNF205_ENST00000219091.4_Missense_Mutation_p.P233L|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	233					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						TGGGGCGTCCCGCAGTGCGCG	0.697																																						dbGAP											0													27.0	25.0	25.0					16																	3169359		2182	4271	6453	-	-	-	SO:0001583	missense	0			AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.698C>T	16.37:g.3169359C>T	ENSP00000371627:p.Pro233Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZK0|D3DUB4|Q9BU95	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P233L	ENST00000382192.3	37	c.698	CCDS10494.2	16	.	.	.	.	.	.	.	.	.	.	C	1.112	-0.658019	0.03454	.	.	ENSG00000122386	ENST00000382192;ENST00000219091;ENST00000414351	T;T;T	0.09723	3.13;3.13;2.95	5.21	-6.04	0.02178	.	1.268060	0.05867	N	0.624049	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40776	-0.9545	10	0.25106	T	0.35	-0.7856	2.7375	0.05244	0.1282:0.408:0.1299:0.334	.	233	O95201	ZN205_HUMAN	L	233	ENSP00000371627:P233L;ENSP00000219091:P233L;ENSP00000403306:P233L	ENSP00000219091:P233L	P	+	2	0	ZNF205	3109360	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.329000	0.02677	-1.017000	0.03367	-1.421000	0.01109	CCG	ZNF205	-	NULL	ENSG00000122386		0.697	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF205	HGNC	protein_coding	OTTHUMT00000309057.1	32	0.00	0	C	NM_003456		3169359	3169359	+1	no_errors	ENST00000219091	ensembl	human	known	69_37n	missense	7	81.58	31	SNP	0.000	T
