#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA10	10349	genome.wustl.edu	37	17	67151207	67151207	+	Missense_Mutation	SNP	C	C	G	rs72853603	byFrequency	TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr17:67151207C>G	ENST00000269081.4	-	31	4556	c.3647G>C	c.(3646-3648)aGa>aCa	p.R1216T	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1216	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.			R -> I (in Ref. 2; AAO72160/AAO72161 and 4; AAH51320). {ECO:0000305}.	transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TTTCTTCTTTCTTGTTGAAAA	0.308																																						dbGAP											0													78.0	76.0	77.0					17																	67151207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.3647G>C	17.37:g.67151207C>G	ENSP00000269081:p.Arg1216Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1216T	ENST00000269081.4	37	c.3647	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	C	4.028	0.002729	0.07866	.	.	ENSG00000154263	ENST00000269081	T	0.13778	2.56	3.24	1.02	0.19986	ABC transporter-like (1);	1.131400	0.07297	N	0.873502	T	0.08179	0.0204	N	0.11313	0.125	0.23969	N	0.996314	B;B	0.20261	0.043;0.04	B;B	0.25140	0.035;0.058	T	0.40961	-0.9535	10	0.54805	T	0.06	.	5.8445	0.18659	0.0:0.5162:0.2961:0.1877	.	208;1216	B4DPV2;Q8WWZ4	.;ABCAA_HUMAN	T	1216	ENSP00000269081:R1216T	ENSP00000269081:R1216T	R	-	2	0	ABCA10	64662802	0.001000	0.12720	0.008000	0.14137	0.340000	0.28889	-0.179000	0.09768	0.150000	0.19136	0.557000	0.71058	AGA	ABCA10	-	pfscan_ABC_transporter-like	ENSG00000154263		0.308	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	78	0.00	0	C	NM_080282		67151207	67151207	-1	no_errors	ENST00000269081	ensembl	human	known	69_37n	missense	64	23.81	20	SNP	0.042	G
ACOXL	55289	genome.wustl.edu	37	2	111744695	111744695	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr2:111744695G>A	ENST00000389811.4	+	14	1384	c.1160G>A	c.(1159-1161)cGg>cAg	p.R387Q	ACOXL_ENST00000439055.1_Missense_Mutation_p.R357Q			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	387					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						GTTGTGGGGCGGGAACTGCTG	0.458																																						dbGAP											0													81.0	66.0	71.0					2																	111744695		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.1160G>A	2.37:g.111744695G>A	ENSP00000374461:p.Arg387Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_Oxase/DH_1,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	p.R357Q	ENST00000389811.4	37	c.1070		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.203|4.203	0.036422|0.036422	0.08148|0.08148	.|.	.|.	ENSG00000153093|ENSG00000153093	ENST00000433706|ENST00000389811;ENST00000439055;ENST00000422487;ENST00000417074	.|T;T;T	.|0.76839	.|-1.05;-1.05;-1.05	5.35|5.35	0.466|0.466	0.16716|0.16716	.|Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	.|0.350989	.|0.25981	.|N	.|0.027065	T|T	0.73729|0.73729	0.3624|0.3624	M|M	0.76938|0.76938	2.355|2.355	0.49299|0.49299	D|D	0.999776|0.999776	.|B;B;B	.|0.26775	.|0.003;0.003;0.159	.|B;B;B	.|0.26202	.|0.007;0.004;0.067	T|T	0.67142|0.67142	-0.5745|-0.5745	5|10	.|0.72032	.|D	.|0.01	-11.4627|-11.4627	7.8426|7.8426	0.29408|0.29408	0.2159:0.0:0.6664:0.1177|0.2159:0.0:0.6664:0.1177	.|.	.|357;357;387	.|E9PB20;Q9NUZ1-2;Q9NUZ1	.|.;.;ACOXL_HUMAN	R|Q	123|387;357;208;195	.|ENSP00000374461:R387Q;ENSP00000407761:R357Q;ENSP00000387832:R195Q	.|ENSP00000374461:R387Q	G|R	+|+	1|2	0|0	ACOXL|ACOXL	111461166|111461166	0.680000|0.680000	0.27605|0.27605	0.141000|0.141000	0.22245|0.22245	0.053000|0.053000	0.15095|0.15095	0.511000|0.511000	0.22739|0.22739	-0.118000|-0.118000	0.11851|0.11851	-2.430000|-2.430000	0.00215|0.00215	GGG|CGG	ACOXL	-	pfam_Acyl-CoA_Oxase/DH_1,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	ENSG00000153093		0.458	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	ACOXL	HGNC	protein_coding	OTTHUMT00000254024.2	95	0.00	0	G	NM_018308		111744695	111744695	+1	no_errors	ENST00000439055	ensembl	human	known	69_37n	missense	64	22.89	19	SNP	0.679	A
ANK2	287	genome.wustl.edu	37	4	114209638	114209638	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr4:114209638C>A	ENST00000357077.4	+	20	2326	c.2273C>A	c.(2272-2274)aCc>aAc	p.T758N	ANK2_ENST00000506722.1_Missense_Mutation_p.T737N|ANK2_ENST00000264366.6_Missense_Mutation_p.T758N|ANK2_ENST00000394537.3_Missense_Mutation_p.T758N	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	758					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T758N(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AACGCAAAAACCAAGGTAAAG	0.373																																						dbGAP											1	Substitution - Missense(1)	lung(1)											80.0	78.0	79.0					4																	114209638		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2273C>A	4.37:g.114209638C>A	ENSP00000349588:p.Thr758Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.T758N	ENST00000357077.4	37	c.2273	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675764	0.88445	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45;2.45;2.45	5.15	5.15	0.70609	Ankyrin repeat-containing domain (3);	0.000000	0.47455	D	0.000235	T	0.15089	0.0364	N	0.00459	-1.475	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.973	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;0.99	T	0.65598	-0.6129	10	0.62326	D	0.03	.	18.6162	0.91303	0.0:1.0:0.0:0.0	.	758;758;758;737;737	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	N	737;704;737;773;758;758;758;737	ENSP00000423799:T737N;ENSP00000421011:T704N;ENSP00000421067:T737N;ENSP00000424722:T773N;ENSP00000378044:T758N;ENSP00000349588:T758N;ENSP00000264366:T758N	ENSP00000264366:T758N	T	+	2	0	ANK2	114429087	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.800000	0.85949	2.381000	0.81170	0.460000	0.39030	ACC	ANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.373	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	59	0.00	0	C	NM_001148		114209638	114209638	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	A
ASXL1	171023	genome.wustl.edu	37	20	30954253	30954253	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr20:30954253G>A	ENST00000375687.4	+	2	548	c.124G>A	c.(124-126)Gga>Aga	p.G42R	ASXL1_ENST00000375689.1_Missense_Mutation_p.G38R|ASXL1_ENST00000542461.1_Missense_Mutation_p.G42R|ASXL1_ENST00000470145.1_3'UTR|ASXL1_ENST00000306058.5_Missense_Mutation_p.G38R	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	42					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G42*(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						AGAGGCAGAAGGACTAAAGGA	0.383			"""F, N, Mis"""		"""MDS, CMML"""																																	dbGAP		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	1	Substitution - Nonsense(1)	large_intestine(1)											259.0	232.0	241.0					20																	30954253		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.124G>A	20.37:g.30954253G>A	ENSP00000364839:p.Gly42Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	NULL	p.G42R	ENST00000375687.4	37	c.124	CCDS13201.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.17|19.17	3.775372|3.775372	0.70107|0.70107	.|.	.|.	ENSG00000171456|ENSG00000171456	ENST00000358956;ENST00000542189;ENST00000375687;ENST00000542461;ENST00000421155;ENST00000412498;ENST00000375689;ENST00000306058|ENST00000497249	T;T|.	0.21361|.	2.19;2.01|.	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72244|0.72244	0.3436|0.3436	M|M	0.68593|0.68593	2.085|2.085	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.71297|0.71297	-0.4635|-0.4635	10|5	0.87932|.	D|.	0|.	-12.6033|-12.6033	15.2795|15.2795	0.73770|0.73770	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	42|.	Q8IXJ9|.	ASXL1_HUMAN|.	R|K	42;42;42;42;42;32;38;38|30	ENSP00000364839:G42R;ENSP00000305119:G38R|.	ENSP00000305119:G38R|.	G|R	+|+	1|2	0|0	ASXL1|ASXL1	30417914|30417914	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	4.000000|4.000000	0.57039|0.57039	2.680000|2.680000	0.91292|0.91292	0.643000|0.643000	0.83706|0.83706	GGA|AGG	ASXL1	-	NULL	ENSG00000171456		0.383	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	106	0.00	0	G	NM_015338		30954253	30954253	+1	no_errors	ENST00000375687	ensembl	human	known	69_37n	missense	80	32.77	39	SNP	1.000	A
BAG3	9531	genome.wustl.edu	37	10	121431832	121431832	+	Silent	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr10:121431832C>T	ENST00000369085.3	+	3	879	c.573C>T	c.(571-573)tcC>tcT	p.S191S		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	191					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)				endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		TGCCTTCCTCCGGCAGGAGCA	0.647																																						dbGAP											0													46.0	45.0	46.0					10																	121431832		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.573C>T	10.37:g.121431832C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L8|Q3B763|Q9NT20|Q9P120	Silent	SNP	pfam_BAG_domain,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_BAG_domain,pfscan_BAG_domain,pfscan_WW_Rsp5_WWP	p.S191	ENST00000369085.3	37	c.573	CCDS7615.1	10																																																																																			BAG3	-	NULL	ENSG00000151929		0.647	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG3	HGNC	protein_coding	OTTHUMT00000050662.1	68	0.00	0	C	NM_004281		121431832	121431832	+1	no_errors	ENST00000369085	ensembl	human	known	69_37n	silent	51	33.77	26	SNP	0.000	T
BAHCC1	57597	genome.wustl.edu	37	17	79414864	79414864	+	Silent	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr17:79414864G>A	ENST00000307745.7	+	15	3966	c.3966G>A	c.(3964-3966)agG>agA	p.R1322R																								GGAGTGAGAGGACTGTGCCAG	0.662																																						dbGAP											0													10.0	10.0	10.0					17																	79414864		1938	4135	6073	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000307745.7:c.3966G>A	17.37:g.79414864G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.G1234E	ENST00000307745.7	37	c.3701		17																																																																																			BAHCC1	-	NULL	ENSG00000171282		0.662	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	HGNC	protein_coding		56	0.00	0	G			79414864	79414864	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000571813	ensembl	human	putative	69_37n	missense	43	27.12	16	SNP	0.000	A
BNC1	646	genome.wustl.edu	37	15	83935703	83935703	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr15:83935703C>T	ENST00000345382.2	-	3	405	c.320G>A	c.(319-321)cGc>cAc	p.R107H	BNC1_ENST00000569704.1_Missense_Mutation_p.R100H|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	107					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GATTTTTAGGCGAACGGGGAT	0.507																																						dbGAP											0													107.0	100.0	102.0					15																	83935703		2203	4300	6503	-	-	-	SO:0001583	missense	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.320G>A	15.37:g.83935703C>T	ENSP00000307041:p.Arg107His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R107H	ENST00000345382.2	37	c.320	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.412924	0.96072	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	D	0.86694	-2.16	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.93556	0.7943	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.93593	0.6923	10	0.87932	D	0	-34.9268	19.614	0.95622	0.0:1.0:0.0:0.0	.	100;107	F5GY04;Q01954	.;BNC1_HUMAN	H	107;100	ENSP00000307041:R107H	ENSP00000307041:R107H	R	-	2	0	BNC1	81726707	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.573000	0.82421	2.873000	0.98535	0.561000	0.74099	CGC	BNC1	-	NULL	ENSG00000169594		0.507	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	92	0.00	0	C	NM_001717		83935703	83935703	-1	no_errors	ENST00000345382	ensembl	human	known	69_37n	missense	71	27.55	27	SNP	1.000	T
CCDC97	90324	genome.wustl.edu	37	19	41822480	41822480	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr19:41822480C>G	ENST00000269967.3	+	2	360	c.238C>G	c.(238-240)Cag>Gag	p.Q80E		NM_052848.1	NP_443080.1	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	80										biliary_tract(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	17						TGTTTGCAGCCAGCAGCAGGG	0.612																																						dbGAP											0													60.0	54.0	56.0					19																	41822480		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011577	CCDS12578.1	19q13.2	2008-02-05							28289	protein-coding gene	gene with protein product						12477932	Standard	NM_052848		Approved	FLJ40267, MGC20255	uc002oqg.3	Q96F63		ENST00000269967.3:c.238C>G	19.37:g.41822480C>G	ENSP00000269967:p.Gln80Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658N6|Q96IF3	Missense_Mutation	SNP	pfam_DUF2052_coiled-coil	p.Q80E	ENST00000269967.3	37	c.238	CCDS12578.1	19	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740246	0.69304	.	.	ENSG00000142039	ENST00000269967	.	.	.	4.66	4.66	0.58398	.	0.000000	0.64402	D	0.000001	T	0.77611	0.4156	M	0.70595	2.14	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.81093	-0.1089	9	0.87932	D	0	-10.1908	16.3144	0.82913	0.0:1.0:0.0:0.0	.	80	Q96F63	CCD97_HUMAN	E	80	.	ENSP00000269967:Q80E	Q	+	1	0	CCDC97	46514320	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	6.617000	0.74210	2.145000	0.66743	0.557000	0.71058	CAG	CCDC97	-	NULL	ENSG00000142039		0.612	CCDC97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC97	HGNC	protein_coding	OTTHUMT00000463293.1	40	0.00	0	C	NM_052848		41822480	41822480	+1	no_errors	ENST00000269967	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	1.000	G
CDH1	999	genome.wustl.edu	37	16	68849577	68849577	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr16:68849577G>T	ENST00000261769.5	+	10	1671	c.1480G>T	c.(1480-1482)Gaa>Taa	p.E494*	CDH1_ENST00000422392.2_Nonsense_Mutation_p.E433*|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	494	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.E494*(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AAAGAGAGTGGAAGTGTCCGA	0.512			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Substitution - Nonsense(1)|Unknown(1)	NS(1)|breast(1)											174.0	153.0	160.0					16																	68849577		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1480G>T	16.37:g.68849577G>T	ENSP00000261769:p.Glu494*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E494*	ENST00000261769.5	37	c.1480	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009421	0.54361	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.5	-1.37	0.09056	.	0.687147	0.12987	N	0.422778	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	0.8059	0.01084	0.2593:0.1076:0.3027:0.3304	.	.	.	.	X	494;512;494;433	.	ENSP00000261769:E494X	E	+	1	0	CDH1	67407078	0.000000	0.05858	0.000000	0.03702	0.219000	0.24729	-0.156000	0.10100	-0.490000	0.06707	-0.254000	0.11334	GAA	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000039068		0.512	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	98	0.00	0	G	NM_004360		68849577	68849577	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	38	40.62	26	SNP	0.000	T
COL14A1	7373	genome.wustl.edu	37	8	121259909	121259909	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr8:121259909G>T	ENST00000297848.3	+	21	2807	c.2537G>T	c.(2536-2538)cGc>cTc	p.R846L	COL14A1_ENST00000309791.4_Missense_Mutation_p.R846L|COL14A1_ENST00000247781.3_Missense_Mutation_p.R751L|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AACCGGTTGCGCATTACGTGG	0.458																																						dbGAP											0													107.0	94.0	99.0					8																	121259909		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2537G>T	8.37:g.121259909G>T	ENSP00000297848:p.Arg846Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.R846L	ENST00000297848.3	37	c.2537	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	28.8	4.948750	0.92660	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.47	5.47	0.80525	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.051779	0.64402	D	0.000001	T	0.73401	0.3582	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.985;0.999	T	0.73849	-0.3853	10	0.56958	D	0.05	.	19.7038	0.96066	0.0:0.0:1.0:0.0	.	846;846	Q05707-2;Q05707	.;COEA1_HUMAN	L	846;846;751;659	ENSP00000311809:R846L;ENSP00000297848:R846L;ENSP00000247781:R751L;ENSP00000409461:R659L	ENSP00000247781:R751L	R	+	2	0	COL14A1	121329090	1.000000	0.71417	0.974000	0.42286	0.803000	0.45373	5.238000	0.65366	2.745000	0.94114	0.462000	0.41574	CGC	COL14A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187955		0.458	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	60	0.00	0	G	NM_021110		121259909	121259909	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	1.000	T
COL24A1	255631	genome.wustl.edu	37	1	86210401	86210401	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr1:86210401G>T	ENST00000370571.2	-	57	4986	c.4620C>A	c.(4618-4620)aaC>aaA	p.N1540K	COL24A1_ENST00000436319.1_Missense_Mutation_p.N1519K	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1540	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTCGTGCTGGGTTATCTCGTG	0.368																																						dbGAP											0													189.0	175.0	180.0					1																	86210401		1875	4108	5983	-	-	-	SO:0001583	missense	0			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.4620C>A	1.37:g.86210401G>T	ENSP00000359603:p.Asn1540Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.N1540K	ENST00000370571.2	37	c.4620	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795643	0.50208	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	T;T	0.73258	-0.73;-0.73	5.29	3.43	0.39272	Fibrillar collagen, C-terminal (3);	0.000000	0.39407	N	0.001379	T	0.81088	0.4750	M	0.88377	2.95	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.987	D	0.84113	0.0402	10	0.72032	D	0.01	.	11.752	0.51853	0.1433:0.0:0.8567:0.0	.	1540;1519	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	K	1540;1519	ENSP00000359603:N1540K;ENSP00000392531:N1519K	ENSP00000359603:N1540K	N	-	3	2	COL24A1	85982989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.679000	0.37597	0.737000	0.32582	0.563000	0.77884	AAC	COL24A1	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000171502		0.368	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	HGNC	protein_coding	OTTHUMT00000029335.4	68	0.00	0	G	NM_152890		86210401	86210401	-1	no_errors	ENST00000370571	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
CORO6	84940	genome.wustl.edu	37	17	27949760	27949760	+	5'Flank	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr17:27949760C>T	ENST00000445145.2	-	0	0				CORO6_ENST00000577909.1_5'UTR|CORO6_ENST00000584969.1_5'Flank|CORO6_ENST00000388767.3_5'Flank|CORO6_ENST00000580212.1_5'Flank|RP11-68I3.2_ENST00000581474.1_RNA|CORO6_ENST00000345068.5_5'UTR|RP11-68I3.10_ENST00000582367.1_RNA			Q6QEF8	CORO6_HUMAN	coronin 6						actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)	actin filament binding (GO:0051015)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(2)	14						GCGGAAGGGGCCCGAGTGCGT	0.711																																						dbGAP											0													5.0	6.0	6.0					17																	27949760		855	1955	2810	-	-	-	SO:0001631	upstream_gene_variant	0			AF193039	CCDS11252.2	17q11.2	2013-01-10			ENSG00000167549	ENSG00000167549		"""Coronins"", ""WD repeat domain containing"""	21356	protein-coding gene	gene with protein product							Standard	NM_032854		Approved	FLJ14871	uc002hel.2	Q6QEF8	OTTHUMG00000132732		17.37:g.27949760C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU26|Q71MF3|Q8WYH7|Q96K02	RNA	SNP	-	NULL	ENST00000445145.2	37	NULL		17	.	.	.	.	.	.	.	.	.	.	C	4.762	0.141717	0.09083	.	.	ENSG00000167549	ENST00000345068	T	0.60299	0.2	5.31	1.49	0.22878	.	.	.	.	.	T	0.47469	0.1447	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.43605	-0.9381	6	0.49607	T	0.09	.	3.2764	0.06899	0.0:0.4906:0.214:0.2954	.	.	.	.	T	53	ENSP00000344562:A53T	ENSP00000344562:A53T	A	-	1	0	CORO6	24973886	0.002000	0.14202	0.018000	0.16275	0.002000	0.02628	-0.083000	0.11286	1.203000	0.43233	0.462000	0.41574	GCC	CORO6	-	-	ENSG00000167549		0.711	CORO6-202	KNOWN	basic|appris_candidate_longest	protein_coding	CORO6	HGNC	protein_coding	OTTHUMT00000447831.1	18	0.00	0	C	NM_032854		27949760	27949760	-1	no_errors	ENST00000577909	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.001	T
CPEB2	132864	genome.wustl.edu	37	4	15004655	15004655	+	5'Flank	SNP	G	G	A	rs7435318	byFrequency	TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr4:15004655G>A	ENST00000507071.1	+	0	0				CPEB2_ENST00000541112.1_Missense_Mutation_p.D120N|CPEB2_ENST00000259997.5_5'Flank|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000382395.3_5'Flank|CPEB2_ENST00000382401.3_5'Flank|CPEB2_ENST00000442003.2_Missense_Mutation_p.D120N|CPEB2_ENST00000538197.1_Missense_Mutation_p.D120N|CPEB2_ENST00000345451.3_5'Flank			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2						cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						GAAACTCCCCGACCACCACCC	0.701													a|||	4009	0.800519	0.8835	0.7695	5008	,	,		9054	0.9663		0.665	False		,,,				2504	0.6789					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669		4.37:g.15004655G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D120N	ENST00000507071.1	37	c.358		4	1748	0.8003663003663004	424	0.8617886178861789	257	0.7099447513812155	552	0.965034965034965	515	0.679419525065963	a	15.41	2.824443	0.50739	.	.	ENSG00000137449	ENST00000538197;ENST00000541112;ENST00000442003	T;T;T	0.54071	0.59;0.59;0.6	3.24	2.03	0.26663	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.54753	P	1.4999999999987246E-5	.	.	.	.	.	.	T	0.28364	-1.0046	6	0.17832	T	0.49	.	5.1208	0.14860	0.6124:0.0:0.3876:0.0	rs7435318;rs7435318	.	.	.	N	120	ENSP00000443985:D120N;ENSP00000437884:D120N;ENSP00000414270:D120N	ENSP00000414270:D120N	D	+	1	0	CPEB2	14613753	0.997000	0.39634	0.996000	0.52242	0.977000	0.68977	0.923000	0.28757	0.275000	0.22094	-0.809000	0.03173	GAC	CPEB2	-	NULL	ENSG00000137449		0.701	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	8	0.00	0	G	XM_059607		15004655	15004655	+1	no_errors	ENST00000538197	ensembl	human	known	69_37n	missense	3	62.50	5	SNP	0.997	A
CPS1	1373	genome.wustl.edu	37	2	211521327	211521327	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr2:211521327C>A	ENST00000233072.5	+	30	3833	c.3637C>A	c.(3637-3639)Caa>Aaa	p.Q1213K	CPS1_ENST00000430249.2_Missense_Mutation_p.Q1219K|CPS1_ENST00000451903.2_Missense_Mutation_p.Q762K	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1213	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GCTGCCCACACAAACCATCAG	0.408																																						dbGAP											0													70.0	70.0	70.0					2																	211521327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3637C>A	2.37:g.211521327C>A	ENSP00000233072:p.Gln1213Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE_1,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,smart_MGS-like_dom,prints_CbamoylP_synth_lsu_CPSase_dom,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.Q1219K	ENST00000233072.5	37	c.3655	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	29.4	4.998829	0.93227	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97161	-4.27;-4.27;-4.27	5.87	5.87	0.94306	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.000000	0.85682	D	0.000000	D	0.98033	0.9352	M	0.85299	2.745	0.58432	D	0.999999	P;P	0.51653	0.947;0.947	P;P	0.51615	0.675;0.675	D	0.98552	1.0637	10	0.87932	D	0	-7.3503	20.206	0.98277	0.0:1.0:0.0:0.0	.	1223;1213	Q59HF8;P31327	.;CPSM_HUMAN	K	1219;1221;1213;762	ENSP00000402608:Q1219K;ENSP00000233072:Q1213K;ENSP00000406136:Q762K	ENSP00000233072:Q1213K	Q	+	1	0	CPS1	211229572	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.340000	0.79292	2.785000	0.95823	0.655000	0.94253	CAA	CPS1	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.408	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	64	0.00	0	C			211521327	211521327	+1	no_errors	ENST00000430249	ensembl	human	known	69_37n	missense	40	25.93	14	SNP	1.000	A
EBPL	84650	genome.wustl.edu	37	13	50235136	50235136	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr13:50235136T>C	ENST00000242827.6	-	4	639	c.589A>G	c.(589-591)Aaa>Gaa	p.K197E	EBPL_ENST00000378270.5_3'UTR|EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000495963.2_5'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	197					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)			endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		CTGGTTTCTTTCTGATGCATT	0.388																																					NSCLC(39;857 1083 36109 42364 51411)	dbGAP											0													74.0	74.0	74.0					13																	50235136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.589A>G	13.37:g.50235136T>C	ENSP00000242827:p.Lys197Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	pfam_EBP	p.K197E	ENST00000242827.6	37	c.589	CCDS9420.1	13	.	.	.	.	.	.	.	.	.	.	T	13.87	2.365768	0.41902	.	.	ENSG00000123179	ENST00000242827	D	0.97888	-4.59	5.61	1.77	0.24775	.	0.812928	0.11472	N	0.560662	D	0.94420	0.8205	M	0.64997	1.995	0.09310	N	1	B	0.22080	0.064	B	0.18263	0.021	T	0.83146	-0.0106	10	0.02654	T	1	-0.1063	5.9438	0.19207	0.0:0.1494:0.2991:0.5516	.	197	Q9BY08	EBPL_HUMAN	E	197	ENSP00000242827:K197E	ENSP00000242827:K197E	K	-	1	0	EBPL	49133137	0.001000	0.12720	0.000000	0.03702	0.996000	0.88848	0.977000	0.29475	0.133000	0.18654	0.528000	0.53228	AAA	EBPL	-	pfam_EBP	ENSG00000123179		0.388	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EBPL	HGNC	protein_coding	OTTHUMT00000044932.2	54	0.00	0	T	NM_032565		50235136	50235136	-1	no_errors	ENST00000242827	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.000	C
ERBB2IP	55914	genome.wustl.edu	37	5	65342343	65342343	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr5:65342343G>A	ENST00000284037.5	+	18	2154	c.1765G>A	c.(1765-1767)Gtt>Att	p.V589I	ERBB2IP_ENST00000380935.1_Missense_Mutation_p.V589I|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.V589I|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.V589I|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.V589I|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.V589I|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.V589I|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.V589I|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.V585I	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	589					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		GAAGCATATTGTTAACCATGA	0.338																																						dbGAP											0													138.0	148.0	144.0					5																	65342343		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.1765G>A	5.37:g.65342343G>A	ENSP00000284037:p.Val589Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.V589I	ENST00000284037.5	37	c.1765	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946945	0.34377	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.06849	3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25	5.68	2.86	0.33363	.	0.330222	0.32578	N	0.005908	T	0.04318	0.0119	N	0.08118	0	0.32979	D	0.523323	B;B;B;B;B;B;B	0.11235	0.001;0.0;0.0;0.004;0.001;0.001;0.003	B;B;B;B;B;B;B	0.12837	0.005;0.001;0.001;0.005;0.002;0.006;0.008	T	0.15350	-1.0440	10	0.38643	T	0.18	.	8.6409	0.33976	0.2436:0.0:0.7564:0.0	.	589;589;589;585;589;589;589	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	I	589;589;589;589;589;589;585;589;589	ENSP00000284037:V589I;ENSP00000370330:V589I;ENSP00000370326:V589I;ENSP00000370323:V589I;ENSP00000370322:V589I;ENSP00000370325:V589I;ENSP00000422766:V585I;ENSP00000426632:V589I;ENSP00000422015:V589I	ENSP00000284037:V589I	V	+	1	0	ERBB2IP	65378099	1.000000	0.71417	0.920000	0.36463	0.845000	0.48019	4.046000	0.57376	0.713000	0.32060	-0.136000	0.14681	GTT	ERBB2IP	-	NULL	ENSG00000112851		0.338	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	42	0.00	0	G	NM_018695		65342343	65342343	+1	no_errors	ENST00000284037	ensembl	human	known	69_37n	missense	20	50.00	20	SNP	0.875	A
FAM50A	9130	genome.wustl.edu	37	X	153678580	153678580	+	Silent	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chrX:153678580G>A	ENST00000393600.3	+	12	1034	c.924G>A	c.(922-924)ctG>ctA	p.L308L		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	308					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGTGGTGCTGAGGAGCTGGT	0.607																																						dbGAP											0													96.0	78.0	84.0					X																	153678580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.924G>A	X.37:g.153678580G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAQ4|B2R997|Q5HY37|Q6PJH5	Silent	SNP	pfam_XAP5	p.L308	ENST00000393600.3	37	c.924	CCDS14751.1	X																																																																																			FAM50A	-	pfam_XAP5	ENSG00000071859		0.607	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM50A	HGNC	protein_coding	OTTHUMT00000081643.2	92	0.00	0	G	NM_004699		153678580	153678580	+1	no_errors	ENST00000393600	ensembl	human	known	69_37n	silent	67	39.09	43	SNP	0.998	A
FAM81B	153643	genome.wustl.edu	37	5	94784045	94784045	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr5:94784045C>G	ENST00000283357.5	+	9	1148	c.1102C>G	c.(1102-1104)Cag>Gag	p.Q368E		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	368						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		CATTAACACACAGAAACAGGA	0.328																																						dbGAP											0													83.0	73.0	76.0					5																	94784045		1808	4083	5891	-	-	-	SO:0001583	missense	0				CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.1102C>G	5.37:g.94784045C>G	ENSP00000283357:p.Gln368Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q368E	ENST00000283357.5	37	c.1102	CCDS43341.1	5	.	.	.	.	.	.	.	.	.	.	C	0	-2.687750	0.00100	.	.	ENSG00000153347	ENST00000283357;ENST00000512365	T	0.18810	2.19	5.63	-0.898	0.10550	.	0.728813	0.13547	N	0.379777	T	0.14227	0.0344	N	0.13098	0.295	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.28808	-1.0032	10	0.11182	T	0.66	0.192	23.0995	0.99979	0.0:0.3018:0.6982:0.0	.	368	Q96LP2	FA81B_HUMAN	E	368;43	ENSP00000283357:Q368E	ENSP00000283357:Q368E	Q	+	1	0	FAM81B	94809801	0.108000	0.22018	0.007000	0.13788	0.095000	0.18619	0.297000	0.19101	-0.164000	0.10927	-1.252000	0.01501	CAG	FAM81B	-	NULL	ENSG00000153347		0.328	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81B	HGNC	protein_coding	OTTHUMT00000370690.1	18	0.00	0	C	NM_152548		94784045	94784045	+1	no_errors	ENST00000283357	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.017	G
FLNC	2318	genome.wustl.edu	37	7	128496900	128496900	+	Missense_Mutation	SNP	G	G	A	rs200295337		TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr7:128496900G>A	ENST00000325888.8	+	45	7747	c.7486G>A	c.(7486-7488)Gtt>Att	p.V2496I	FLNC_ENST00000346177.6_Missense_Mutation_p.V2463I|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2496	Interaction with INPPL1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CAAGATCCGCGTTGGGGAGCA	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21015	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													69.0	75.0	73.0					7																	128496900		2163	4270	6433	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7486G>A	7.37:g.128496900G>A	ENSP00000327145:p.Val2496Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V2496I	ENST00000325888.8	37	c.7486	CCDS43644.1	7	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	g	35	5.588092	0.96590	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.92911	-3.13;-3.13	5.51	5.51	0.81932	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.95494	0.8536	M	0.78916	2.43	0.58432	D	0.999999	D;D	0.67145	0.983;0.996	P;P	0.58873	0.847;0.657	D	0.95659	0.8713	10	0.72032	D	0.01	.	19.4409	0.94820	0.0:0.0:1.0:0.0	.	2463;2496	Q14315-2;Q14315	.;FLNC_HUMAN	I	2496;2463	ENSP00000327145:V2496I;ENSP00000344002:V2463I	ENSP00000327145:V2496I	V	+	1	0	FLNC	128284136	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	9.806000	0.99153	2.588000	0.87417	0.552000	0.68991	GTT	FLNC	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.622	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	67	0.00	0	G			128496900	128496900	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	43	40.54	30	SNP	1.000	A
FNDC1	84624	genome.wustl.edu	37	6	159653589	159653589	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr6:159653589G>A	ENST00000297267.9	+	11	2245	c.2045G>A	c.(2044-2046)cGc>cAc	p.R682H	FNDC1_ENST00000340366.6_Missense_Mutation_p.R619H	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	682	Ser-rich.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R682H(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AGCGTTCTCCGCGACAGAAGC	0.716																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											15.0	18.0	17.0					6																	159653589		1954	4109	6063	-	-	-	SO:0001583	missense	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2045G>A	6.37:g.159653589G>A	ENSP00000297267:p.Arg682His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R682H	ENST00000297267.9	37	c.2045	CCDS47512.1	6	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251546	0.39797	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.09445	2.98;3.86	4.87	0.863	0.19062	.	0.929336	0.09006	N	0.862294	T	0.02455	0.0075	L	0.34521	1.04	0.09310	N	1	B;B	0.13594	0.008;0.004	B;B	0.13407	0.009;0.002	T	0.45308	-0.9270	10	0.46703	T	0.11	-2.4532	4.2237	0.10570	0.2908:0.1701:0.5391:0.0	.	619;682	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	H	682;619	ENSP00000297267:R682H;ENSP00000342460:R619H	ENSP00000297267:R682H	R	+	2	0	FNDC1	159573579	0.029000	0.19370	0.000000	0.03702	0.070000	0.16714	2.496000	0.45346	0.488000	0.27723	-0.122000	0.15005	CGC	FNDC1	-	NULL	ENSG00000164694		0.716	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3	38	0.00	0	G	NM_032532		159653589	159653589	+1	no_errors	ENST00000297267	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	0.000	A
FURIN	5045	genome.wustl.edu	37	15	91424679	91424679	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr15:91424679G>C	ENST00000268171.3	+	16	2235	c.1956G>C	c.(1954-1956)caG>caC	p.Q652H	FES_ENST00000414248.2_5'Flank|FES_ENST00000328850.3_5'Flank	NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	652					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CCACATGCCAGGGGCCGGCCC	0.667																																						dbGAP											0													39.0	41.0	40.0					15																	91424679		2196	4295	6491	-	-	-	SO:0001583	missense	0			X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1956G>C	15.37:g.91424679G>C	ENSP00000268171:p.Gln652His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14336|Q6LBS3|Q9UCZ5	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,superfamily_Growth_fac_rcpt,smart_Furin_repeat,prints_Peptidase_S8_subtilisin-rel	p.Q652H	ENST00000268171.3	37	c.1956	CCDS10364.1	15	.	.	.	.	.	.	.	.	.	.	G	14.06	2.424053	0.43020	.	.	ENSG00000140564	ENST00000268171	T	0.30182	1.54	5.02	5.02	0.67125	Growth factor, receptor (1);	0.267324	0.42548	D	0.000700	T	0.14098	0.0341	N	0.04508	-0.205	0.32839	D	0.505113	B	0.09022	0.002	B	0.10450	0.005	T	0.16541	-1.0399	10	0.15066	T	0.55	-15.4481	11.8447	0.52376	0.0811:0.0:0.9189:0.0	.	652	P09958	FURIN_HUMAN	H	652	ENSP00000268171:Q652H	ENSP00000268171:Q652H	Q	+	3	2	FURIN	89225683	0.990000	0.36364	1.000000	0.80357	0.960000	0.62799	1.439000	0.35013	2.337000	0.79520	0.555000	0.69702	CAG	FURIN	-	superfamily_Growth_fac_rcpt,smart_Furin_repeat	ENSG00000140564		0.667	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FURIN	HGNC	protein_coding	OTTHUMT00000313492.1	23	0.00	0	G	NM_002569		91424679	91424679	+1	no_errors	ENST00000268171	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.998	C
GPAM	57678	genome.wustl.edu	37	10	113921450	113921450	+	Missense_Mutation	SNP	C	C	A	rs199856746		TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr10:113921450C>A	ENST00000348367.4	-	15	1666	c.1469G>T	c.(1468-1470)tGc>tTc	p.C490F	GPAM_ENST00000423155.1_Missense_Mutation_p.C490F|GPAM_ENST00000369425.1_Missense_Mutation_p.C490F			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	490					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GAGGAGCAGGCAAGCCACAAT	0.448																																					Ovarian(161;1017 2606 18293 52943)	dbGAP											0													99.0	84.0	89.0					10																	113921450		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1469G>T	10.37:g.113921450C>A	ENSP00000265276:p.Cys490Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW51|Q86TA3	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.C490F	ENST00000348367.4	37	c.1469	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086244	0.55861	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.65364	-0.12;-0.12;-0.15	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.68760	0.3036	N	0.26042	0.785	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.78314	0.991;0.986	T	0.67264	-0.5714	10	0.34782	T	0.22	-14.2576	17.318	0.87229	0.0:1.0:0.0:0.0	.	490;490	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	F	490	ENSP00000265276:C490F;ENSP00000409242:C490F;ENSP00000358433:C490F	ENSP00000265276:C490F	C	-	2	0	GPAM	113911440	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.256000	0.78350	2.530000	0.85305	0.643000	0.83706	TGC	GPAM	-	NULL	ENSG00000119927		0.448	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	54	0.00	0	C	NM_020918		113921450	113921450	-1	no_errors	ENST00000348367	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	1.000	A
GUCA1A	2978	genome.wustl.edu	37	6	42146547	42146547	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr6:42146547G>A	ENST00000394237.1	+	5	1335	c.359G>A	c.(358-360)cGc>cAc	p.R120H	GUCA1A_ENST00000372958.1_Missense_Mutation_p.R120H|GUCA1A_ENST00000541991.1_Missense_Mutation_p.R120H|GUCA1A_ENST00000053469.4_Missense_Mutation_p.R120H			P43080	GUC1A_HUMAN	guanylate cyclase activator 1A (retina)	120	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;5.54e-05)|Epithelial(12;0.000167)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CAGGCCATTCGCGCCATTAAC	0.587																																						dbGAP											0													169.0	167.0	167.0					6																	42146547		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4864.1	6p21.1	2013-06-06			ENSG00000048545	ENSG00000048545		"""EF-hand domain containing"""	4678	protein-coding gene	gene with protein product	"""cone dystrophy 3"""	600364	"""chromosome 6 open reading frame 131"""	GUCA, GUCA1, C6orf131		9425234	Standard	NM_000409		Approved	GCAP, GCAP1, COD3, dJ139D8.6, CORD14	uc003orx.3	P43080	OTTHUMG00000014696	ENST00000394237.1:c.359G>A	6.37:g.42146547G>A	ENSP00000377784:p.Arg120His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWT4|Q7Z6T1|Q9NU14	Missense_Mutation	SNP	pfam_EF-hand,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.R120H	ENST00000394237.1	37	c.359	CCDS4864.1	6	.	.	.	.	.	.	.	.	.	.	G	28.4	4.912811	0.92178	.	.	ENSG00000048545	ENST00000541991;ENST00000372965;ENST00000053469;ENST00000394237;ENST00000372958	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.63	4.63	0.57726	EF-hand-like domain (1);	2.531660	0.02769	U	0.119499	T	0.70474	0.3228	L	0.28115	0.83	0.80722	D	1	D	0.63046	0.992	P	0.61397	0.888	T	0.61407	-0.7069	10	0.66056	D	0.02	.	14.9915	0.71393	0.0:0.0:1.0:0.0	.	120	P43080	GUC1A_HUMAN	H	120;124;120;120;120	ENSP00000437476:R120H;ENSP00000053469:R120H;ENSP00000377784:R120H;ENSP00000362049:R120H	ENSP00000053469:R120H	R	+	2	0	GUCA1A	42254525	1.000000	0.71417	0.991000	0.47740	0.965000	0.64279	7.588000	0.82629	2.113000	0.64589	0.561000	0.74099	CGC	GUCA1A	-	pfam_SPARC/Testican_Ca-bd-dom,pfscan_EF_HAND_2,prints_Recoverin	ENSG00000048545		0.587	GUCA1A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GUCA1A	HGNC	protein_coding	OTTHUMT00000316582.1	56	0.00	0	G			42146547	42146547	+1	no_errors	ENST00000053469	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	1.000	A
GUCY2C	2984	genome.wustl.edu	37	12	14839128	14839128	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr12:14839128C>A	ENST00000261170.3	-	3	498	c.362G>T	c.(361-363)gGg>gTg	p.G121V	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	121					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACATGAGGGCCCTATGAGGAC	0.408																																						dbGAP											0													103.0	86.0	92.0					12																	14839128		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.362G>T	12.37:g.14839128C>A	ENSP00000261170:p.Gly121Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMY6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.G121V	ENST00000261170.3	37	c.362	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196920	0.79015	.	.	ENSG00000070019	ENST00000261170	D	0.95918	-3.85	5.92	5.92	0.95590	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.97448	0.9165	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97698	1.0183	10	0.87932	D	0	.	15.8215	0.78648	0.0:1.0:0.0:0.0	.	121	P25092	GUC2C_HUMAN	V	121	ENSP00000261170:G121V	ENSP00000261170:G121V	G	-	2	0	GUCY2C	14730395	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	5.512000	0.67030	2.804000	0.96469	0.655000	0.94253	GGG	GUCY2C	-	pfam_ANF_lig-bd_rcpt	ENSG00000070019		0.408	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1	47	0.00	0	C			14839128	14839128	-1	no_errors	ENST00000261170	ensembl	human	known	69_37n	missense	47	27.69	18	SNP	1.000	A
HMGCS2	3158	genome.wustl.edu	37	1	120301760	120301760	+	Silent	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr1:120301760G>T	ENST00000369406.3	-	4	880	c.831C>A	c.(829-831)atC>atA	p.I277I	HMGCS2_ENST00000476640.1_Intron|HMGCS2_ENST00000544913.2_Silent_p.I235I	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	277					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		ACTGATTCTGGATTTTTTTAC	0.473																																						dbGAP											0													132.0	131.0	131.0					1																	120301760		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.831C>A	1.37:g.120301760G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Silent	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.I277	ENST00000369406.3	37	c.831	CCDS905.1	1																																																																																			HMGCS2	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	ENSG00000134240		0.473	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS2	HGNC	protein_coding	OTTHUMT00000033469.2	44	0.00	0	G	NM_005518		120301760	120301760	-1	no_errors	ENST00000369406	ensembl	human	known	69_37n	silent	28	46.15	24	SNP	0.999	T
HSD17B10	3028	genome.wustl.edu	37	X	53461167	53461167	+	Intron	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chrX:53461167G>T	ENST00000168216.6	-	1	55				RP3-339A18.6_ENST00000418049.1_RNA|HSD17B10_ENST00000375304.5_Intron|HSD17B10_ENST00000495986.1_5'UTR|HSD17B10_ENST00000375298.4_Intron	NM_001037811.2|NM_004493.2	NP_001032900.1|NP_004484.1	Q99714	HCD2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 10						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity (GO:0047015)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|cholate 7-alpha-dehydrogenase activity (GO:0008709)|poly(A) RNA binding (GO:0044822)|testosterone dehydrogenase [NAD(P)] activity (GO:0030283)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	8						ACATAAGCATGACCCTTTCCC	0.537																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U96132	CCDS14354.1, CCDS35300.1	Xp11.2	2014-09-17	2006-11-22	2006-11-22	ENSG00000072506	ENSG00000072506	1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	4800	protein-coding gene	gene with protein product	"""type 10 17b-HSD"", ""type 10 17beta-hydroxysteroid dehydrogenase"", ""AB-binding alcohol dehydrogenase"", ""short chain dehydrogenase/reductase family 5C, member 1"", ""mitochondrial RNase P subunit 2"""	300256	"""hydroxyacyl-Coenzyme A dehydrogenase, type II, hydroxyacyl-Coenzyme A dehydrogenase, type II"", ""mental retardation, X-linked, syndromic 10"""	HADH2, MRXS10		9338779, 16899120, 19027726, 18984158, 17236142	Standard	NM_004493		Approved	ERAB, MHBD, 17b-HSD10, ABAD, SDR5C1, MRPP2, CAMR	uc004dsl.1	Q99714	OTTHUMG00000021612	ENST00000168216.6:c.27+98C>A	X.37:g.53461167G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H927|Q6IBS9|Q8TCV9|Q96HD5	RNA	SNP	-	NULL	ENST00000168216.6	37	NULL	CCDS14354.1	X																																																																																			HSD17B10	-	-	ENSG00000072506		0.537	HSD17B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B10	HGNC	protein_coding	OTTHUMT00000056750.1	33	0.00	0	G	NM_004493		53461167	53461167	-1	no_errors	ENST00000495986	ensembl	human	known	69_37n	rna	32	36.00	18	SNP	0.000	T
HSD17B7	51478	genome.wustl.edu	37	1	162767619	162767619	+	Silent	SNP	T	T	C			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr1:162767619T>C	ENST00000254521.3	+	4	415	c.360T>C	c.(358-360)gcT>gcC	p.A120A	HSD17B7_ENST00000367917.3_Silent_p.A120A|HSD17B7_ENST00000367913.1_Splice_Site_p.*112R|HSD17B7_ENST00000485405.1_3'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	120					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					TCTCCACAGCTGAAGGCCTGC	0.408																																						dbGAP											0													45.0	43.0	44.0					1																	162767619		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.360T>C	1.37:g.162767619T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Nonstop_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.*112R	ENST00000254521.3	37	c.334	CCDS1242.1	1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.966486	0.34659	.	.	ENSG00000132196	ENST00000367913	.	.	.	4.71	3.56	0.40772	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1.0	.	.	.	.	.	.	.	.	.	.	.	.	.	-44.2301	6.361	0.21429	0.1521:0.0:0.1693:0.6786	.	.	.	.	R	112	.	.	X	+	1	0	HSD17B7	161034243	0.035000	0.19736	1.000000	0.80357	0.998000	0.95712	-1.072000	0.03434	0.799000	0.34018	0.533000	0.62120	TGA	HSD17B7	-	NULL	ENSG00000132196		0.408	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B7	HGNC	protein_coding	OTTHUMT00000083207.1	143	0.00	0	T	NM_016371		162767619	162767619	+1	no_errors	ENST00000367913	ensembl	human	known	69_37n	nonstop	118	39.59	78	SNP	0.997	C
KHDC3L	154288	genome.wustl.edu	37	6	74072976	74072976	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr6:74072976C>G	ENST00000370367.3	+	2	381	c.328C>G	c.(328-330)Cac>Gac	p.H110D		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	110							RNA binding (GO:0003723)										GGCTGACTATCACCGCCAGCT	0.567																																						dbGAP											0													85.0	81.0	83.0					6																	74072976		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.328C>G	6.37:g.74072976C>G	ENSP00000359392:p.His110Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNW7	Missense_Mutation	SNP	NULL	p.H110D	ENST00000370367.3	37	c.328	CCDS34484.1	6	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930820	0.34096	.	.	ENSG00000203908	ENST00000370367	T	0.50277	0.75	3.52	1.73	0.24493	.	0.629027	0.14241	N	0.332097	T	0.40094	0.1103	M	0.69823	2.125	0.09310	N	1	D	0.69078	0.997	P	0.62184	0.899	T	0.14980	-1.0453	10	0.21014	T	0.42	-24.1028	5.5279	0.16968	0.0:0.7476:0.0:0.2524	.	110	Q587J8	ECAT1_HUMAN	D	110	ENSP00000359392:H110D	ENSP00000359392:H110D	H	+	1	0	C6orf221	74129697	0.280000	0.24249	0.145000	0.22337	0.011000	0.07611	0.327000	0.19663	0.494000	0.27859	-0.140000	0.14226	CAC	KHDC3L	-	NULL	ENSG00000203908		0.567	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDC3L	HGNC	protein_coding	OTTHUMT00000041202.3	72	0.00	0	C	NM_001017361		74072976	74072976	+1	no_errors	ENST00000370367	ensembl	human	known	69_37n	missense	46	29.23	19	SNP	0.198	G
LTA4H	4048	genome.wustl.edu	37	12	96421311	96421311	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr12:96421311C>T	ENST00000228740.2	-	3	463	c.322G>A	c.(322-324)Gag>Aag	p.E108K	LTA4H_ENST00000413268.2_Missense_Mutation_p.E84K|LTA4H_ENST00000552789.1_Missense_Mutation_p.E84K|RP11-256L6.2_ENST00000547346.1_RNA	NM_000895.2	NP_000886.1	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	108					arachidonic acid metabolic process (GO:0019369)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|peptide catabolic process (GO:0043171)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|leukotriene-A4 hydrolase activity (GO:0004463)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(3)|lung(4)|skin(2)|stomach(1)	12					Captopril(DB01197)	GGAGAGGTCTCAAAAGAAATT	0.348																																						dbGAP											0													58.0	62.0	60.0					12																	96421311		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032528	CCDS9059.1, CCDS58266.1, CCDS58267.1	12q22	2005-10-06				ENSG00000111144	3.3.2.6		6710	protein-coding gene	gene with protein product		151570				7628486	Standard	NM_000895		Approved		uc001ten.2	P09960	OTTHUMG00000170355	ENST00000228740.2:c.322G>A	12.37:g.96421311C>T	ENSP00000228740:p.Glu108Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNQ9|F8VV40|Q6IAT6|Q9UCT7	Missense_Mutation	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold,prints_Peptidase_M1_N,tigrfam_Leukotriene_A4_hydrolase	p.E108K	ENST00000228740.2	37	c.322	CCDS9059.1	12	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023918	0.54683	.	.	ENSG00000111144	ENST00000228740;ENST00000552789;ENST00000413268	T;T;T	0.02709	4.19;4.19;4.19	5.79	5.79	0.91817	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.050891	0.85682	D	0.000000	T	0.03651	0.0104	L	0.33668	1.02	0.80722	D	1	B;B;B	0.30793	0.295;0.128;0.09	B;B;B	0.27076	0.076;0.063;0.061	T	0.58601	-0.7608	10	0.19590	T	0.45	-24.9801	20.0411	0.97590	0.0:1.0:0.0:0.0	.	84;84;108	P09960-3;F8VV40;P09960	.;.;LKHA4_HUMAN	K	108;84;84	ENSP00000228740:E108K;ENSP00000449958:E84K;ENSP00000395051:E84K	ENSP00000228740:E108K	E	-	1	0	LTA4H	94945442	1.000000	0.71417	0.997000	0.53966	0.198000	0.23893	7.418000	0.80167	2.739000	0.93911	0.655000	0.94253	GAG	LTA4H	-	pfam_Peptidase_M1_N,tigrfam_Leukotriene_A4_hydrolase	ENSG00000111144		0.348	LTA4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTA4H	HGNC	protein_coding	OTTHUMT00000408655.1	56	0.00	0	C	NM_000895		96421311	96421311	-1	no_errors	ENST00000228740	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	1.000	T
MDS2	259283	genome.wustl.edu	37	1	23966218	23966218	+	Silent	SNP	C	C	T	rs573079966	byFrequency	TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr1:23966218C>T	ENST00000374555.3	+	6	782	c.195C>T	c.(193-195)ggC>ggT	p.G65G	MDS2_ENST00000477916.1_3'UTR			Q8NDY4	MDS2_HUMAN	myelodysplastic syndrome 2 translocation associated	65						extracellular space (GO:0005615)				breast(1)|ovary(2)	3						GTGCCCGTGGCAGGCCTCAGC	0.597			T	ETV6	MDS								C|||	3	0.000599042	0.0	0.0	5008	,	,		20152	0.0		0.0	False		,,,				2504	0.0031					dbGAP		Dom	yes		1	1p36	259283	myelodysplastic syndrome 2		L	0													14.0	13.0	13.0					1																	23966218		876	1988	2864	-	-	-	SO:0001819	synonymous_variant	0			AJ310434		1p36	2008-02-05			ENSG00000197880	ENSG00000197880			29633	protein-coding gene	gene with protein product		607305				12203785	Standard	NR_027042		Approved		uc001bhi.3	Q8NDY4	OTTHUMG00000002927	ENST00000374555.3:c.195C>T	1.37:g.23966218C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.G65	ENST00000374555.3	37	c.195		1																																																																																			MDS2	-	NULL	ENSG00000197880		0.597	MDS2-001	KNOWN	basic|appris_principal	protein_coding	MDS2	HGNC	protein_coding	OTTHUMT00000008172.1	53	0.00	0	C	NM_148895		23966218	23966218	+1	no_errors	ENST00000374555	ensembl	human	known	69_37n	silent	31	49.18	30	SNP	0.004	T
MID1	4281	genome.wustl.edu	37	X	10535364	10535364	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chrX:10535364C>T	ENST00000317552.4	-	2	624	c.224G>A	c.(223-225)cGc>cAc	p.R75H	MID1_ENST00000380782.2_Missense_Mutation_p.R75H|MID1_ENST00000380787.1_Missense_Mutation_p.R75H|MID1_ENST00000380779.1_Missense_Mutation_p.R75H|MID1_ENST00000380780.1_Missense_Mutation_p.R75H|MID1_ENST00000453318.2_Missense_Mutation_p.R75H|MID1_ENST00000380785.1_Missense_Mutation_p.R75H	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	75					microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						GGTGACGTTGCGCTTGAGCCC	0.622																																						dbGAP											0													135.0	103.0	114.0					X																	10535364		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.224G>A	X.37:g.10535364C>T	ENSP00000312678:p.Arg75His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R75H	ENST00000317552.4	37	c.224	CCDS14138.1	X	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842854	0.91197	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373;ENST00000413894;ENST00000423614	T;T;T;T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25	5.64	5.64	0.86602	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.55449	0.1921	M	0.93978	3.48	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.985;0.985;0.995;0.996;0.99;0.981	T	0.68322	-0.5439	10	0.87932	D	0	.	18.7983	0.92005	0.0:1.0:0.0:0.0	.	75;75;75;75;75;75	C9JZJ7;B7Z5K6;C9J453;O15344-2;A8K5A0;O15344	.;.;.;.;.;TRI18_HUMAN	H	75	ENSP00000414521:R75H;ENSP00000312678:R75H;ENSP00000370162:R75H;ENSP00000370156:R75H;ENSP00000370164:R75H;ENSP00000370157:R75H;ENSP00000370159:R75H;ENSP00000391154:R75H;ENSP00000387771:R75H	ENSP00000312678:R75H	R	-	2	0	MID1	10495364	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.663000	0.83820	2.386000	0.81285	0.600000	0.82982	CGC	MID1	-	NULL	ENSG00000101871		0.622	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MID1	HGNC	protein_coding	OTTHUMT00000055738.1	91	0.00	0	C			10535364	10535364	-1	no_errors	ENST00000317552	ensembl	human	known	69_37n	missense	69	32.35	33	SNP	1.000	T
MIR4477B	100616194	genome.wustl.edu	37	9	68415338	68415338	+	RNA	SNP	A	A	C	rs75019967		TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr9:68415338A>C	ENST00000581659.1	+	0	31					NR_039688.1|NR_039689.1				microRNA 4477b																		aatgtccttaatagcaatcct	0.363																																						dbGAP											0																																										-	-	-			0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68415338A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581659.1	37	NULL		9																																																																																			MIR4477A	-	-	ENSG00000266017		0.363	MIR4477B-201	KNOWN	basic	miRNA	MIR4477A	HGNC	miRNA		13	0.00	0	A	NR_039689		68415338	68415338	+1	no_errors	ENST00000581659	ensembl	human	known	69_37n	rna	21	19.23	5	SNP	0.191	C
TRPM3	80036	genome.wustl.edu	37	9	73424899	73424899	+	Intron	SNP	T	T	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr9:73424899T>A	ENST00000377111.2	-	6	1217				TRPM3_ENST00000408909.2_Intron|TRPM3_ENST00000360823.2_Intron|TRPM3_ENST00000423814.3_Intron|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000396292.4_Intron|TRPM3_ENST00000396283.1_Intron|TRPM3_ENST00000358082.3_Intron|TRPM3_ENST00000377105.1_Intron|TRPM3_ENST00000357533.2_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000361823.5_Intron|TRPM3_ENST00000377110.3_Intron|MIR204_ENST00000385200.1_RNA|TRPM3_ENST00000377106.1_Intron	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3						calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						ATGCCAGTGATGACAATTGAA	0.433																																						dbGAP											0													255.0	222.0	232.0					9																	73424899		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.973+17863A>T	9.37:g.73424899T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	RNA	SNP	-	NULL	ENST00000377111.2	37	NULL		9																																																																																			MIR204	-	-	ENSG00000207935		0.433	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	MIR204	HGNC	protein_coding	OTTHUMT00000214157.5	97	0.00	0	T	NM_206945		73424899	73424899	-1	no_errors	ENST00000385200	ensembl	human	known	69_37n	rna	62	23.46	19	SNP	1.000	A
MIR514B	100422847	genome.wustl.edu	37	X	146331732	146331732	+	RNA	SNP	G	G	C			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chrX:146331732G>C	ENST00000516774.2	-	0	16					NR_036173.1				microRNA 514b																		CCTCCCTCTTGAGAAGAGTAC	0.378																																						dbGAP											0																																										-	-	-			0					Xq27.3	2011-09-12			ENSG00000252583	ENSG00000252583		"""ncRNAs / Micro RNAs"""	38292	non-coding RNA	RNA, micro							Standard	NR_036173		Approved	hsa-mir-514b	uc022cfx.1				X.37:g.146331732G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000516774.2	37	NULL		X																																																																																			MIR514B	-	-	ENSG00000252583		0.378	MIR514B-201	KNOWN	basic	miRNA	MIR514B	HGNC	miRNA		68	0.00	0	G	NR_036173		146331732	146331732	-1	no_errors	ENST00000516774	ensembl	human	known	69_37n	rna	23	28.12	9	SNP	0.001	C
MPHOSPH8	54737	genome.wustl.edu	37	13	20244477	20244477	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr13:20244477G>A	ENST00000361479.5	+	12	2499	c.2431G>A	c.(2431-2433)Gat>Aat	p.D811N	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.D811N	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	811					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		AGTTCTGAATGATAAATTTCA	0.363																																						dbGAP											0													164.0	152.0	156.0					13																	20244477		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.2431G>A	13.37:g.20244477G>A	ENSP00000355388:p.Asp811Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.D811N	ENST00000361479.5	37	c.2431	CCDS9287.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.269209|4.269209	0.80469|0.80469	.|.	.|.	ENSG00000196199|ENSG00000196199	ENST00000414242;ENST00000360754;ENST00000361479|ENST00000449056	T;T|.	0.50277|.	0.78;0.75|.	5.67|5.67	4.82|4.82	0.62117|0.62117	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.46927|0.46927	0.1418|0.1418	N|N	0.14661|0.14661	0.345|0.345	0.52501|0.52501	D|D	0.99995|0.99995	P;P|.	0.41041|.	0.618;0.736|.	B;B|.	0.38500|.	0.142;0.275|.	T|T	0.40079|0.40079	-0.9582|-0.9582	10|5	0.87932|.	D|.	0|.	.|.	14.4641|14.4641	0.67472|0.67472	0.0704:0.0:0.9296:0.0|0.0704:0.0:0.9296:0.0	.|.	811;811|.	Q99549;Q99549-2|.	MPP8_HUMAN;.|.	N|I	811;140;811|81	ENSP00000414663:D811N;ENSP00000355388:D811N|.	ENSP00000353982:D140N|.	D|M	+|+	1|3	0|0	MPHOSPH8|MPHOSPH8	19142477|19142477	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	7.106000|7.106000	0.77039|0.77039	1.378000|1.378000	0.46305|0.46305	0.655000|0.655000	0.94253|0.94253	GAT|ATG	MPHOSPH8	-	NULL	ENSG00000196199		0.363	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	154	0.00	0	G	NM_017520		20244477	20244477	+1	no_errors	ENST00000414242	ensembl	human	known	69_37n	missense	92	29.23	38	SNP	1.000	A
MRPS22	56945	genome.wustl.edu	37	3	139062975	139062975	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr3:139062975T>C	ENST00000495075.1	+	3	539	c.107T>C	c.(106-108)cTg>cCg	p.L36P	MRPS22_ENST00000310776.4_Missense_Mutation_p.L36P|MRPS22_ENST00000478464.1_5'Flank|MRPS22_ENST00000465056.1_Missense_Mutation_p.L36P			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	36						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						CACGGTGGCCTGCTCCAACCG	0.632																																						dbGAP											0													31.0	33.0	32.0					3																	139062975		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.107T>C	3.37:g.139062975T>C	ENSP00000418008:p.Leu36Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3I1	Missense_Mutation	SNP	pfam_Ribosomal_S22_mit	p.L36P	ENST00000495075.1	37	c.107	CCDS3107.1	3	.	.	.	.	.	.	.	.	.	.	T	12.64	1.999100	0.35226	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000465373	D;D;D;D	0.86627	-2.14;-2.14;-2.15;-1.7	4.01	0.216	0.15258	.	0.781386	0.10325	N	0.688235	T	0.75591	0.3870	L	0.27053	0.805	0.18873	N	0.999986	B;B	0.13594	0.008;0.005	B;B	0.11329	0.006;0.003	T	0.63825	-0.6549	10	0.72032	D	0.01	-0.602	2.3438	0.04266	0.2125:0.2382:0.0:0.5493	.	36;36	G5E9V5;P82650	.;RT22_HUMAN	P	36;36;36;32	ENSP00000418008:L36P;ENSP00000310785:L36P;ENSP00000418233:L36P;ENSP00000419920:L32P	ENSP00000310785:L36P	L	+	2	0	MRPS22	140545665	0.047000	0.20315	0.002000	0.10522	0.026000	0.11368	0.698000	0.25571	0.192000	0.20272	0.482000	0.46254	CTG	MRPS22	-	NULL	ENSG00000175110		0.632	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS22	HGNC	protein_coding	OTTHUMT00000358120.1	67	0.00	0	T	NM_020191		139062975	139062975	+1	no_errors	ENST00000310776	ensembl	human	known	69_37n	missense	49	26.87	18	SNP	0.002	C
NLGN3	54413	genome.wustl.edu	37	X	70389455	70389455	+	Silent	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chrX:70389455G>T	ENST00000358741.3	+	8	2358	c.2055G>T	c.(2053-2055)ggG>ggT	p.G685G	NLGN3_ENST00000536169.1_Silent_p.G645G|NLGN3_ENST00000374051.3_Silent_p.G665G|NLGN3_ENST00000476589.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	685					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					ATGCCCAGGGGTCCTGGAACG	0.632																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0													50.0	41.0	44.0					X																	70389455		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.2055G>T	X.37:g.70389455G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.G685	ENST00000358741.3	37	c.2055	CCDS55441.1	X																																																																																			NLGN3	-	NULL	ENSG00000196338		0.632	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	48	0.00	0	G	NM_018977		70389455	70389455	+1	no_errors	ENST00000358741	ensembl	human	known	69_37n	silent	37	33.93	19	SNP	0.911	T
NKRF	55922	genome.wustl.edu	37	X	118723826	118723826	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chrX:118723826T>A	ENST00000371527.1	-	2	2214	c.1562A>T	c.(1561-1563)aAc>aTc	p.N521I	NKRF_ENST00000304449.5_Missense_Mutation_p.N521I|NKRF_ENST00000487600.1_Intron|NKRF_ENST00000542113.1_Missense_Mutation_p.N536I	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	521					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						TTTCTTCAAGTTGTTAATGAC	0.413																																						dbGAP											0													128.0	126.0	127.0					X																	118723826		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1562A>T	X.37:g.118723826T>A	ENSP00000360582:p.Asn521Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_R3H_ss-bd,smart_Ds-RNA-bd,smart_G_patch_dom,smart_R3H_ss-bd,pfscan_G_patch_dom,pfscan_R3H_ss-bd	p.N536I	ENST00000371527.1	37	c.1607	CCDS35375.1	X	.	.	.	.	.	.	.	.	.	.	T	16.66	3.184948	0.57909	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	T;T;T	0.51071	0.72;0.72;0.72	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.58206	0.2106	L	0.59436	1.845	0.80722	D	1	D	0.64830	0.994	P	0.54706	0.759	T	0.62784	-0.6781	10	0.87932	D	0	-19.5598	13.8796	0.63674	0.0:0.0:0.0:1.0	.	521	O15226	NKRF_HUMAN	I	521;521;536	ENSP00000360582:N521I;ENSP00000304803:N521I;ENSP00000442308:N536I	ENSP00000304803:N521I	N	-	2	0	NKRF	118607854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.661000	0.83786	1.874000	0.54306	0.486000	0.48141	AAC	NKRF	-	NULL	ENSG00000186416		0.413	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	HGNC	protein_coding	OTTHUMT00000058044.1	40	0.00	0	T	NM_017544		118723826	118723826	-1	no_errors	ENST00000542113	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	1.000	A
OR1E2	8388	genome.wustl.edu	37	17	3336292	3336292	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr17:3336292C>A	ENST00000248384.1	-	1	843	c.844G>T	c.(844-846)Gtc>Ttc	p.V282F		NM_003554.1	NP_003545.1	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E, member 2	282					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			endometrium(3)|large_intestine(3)|lung(3)	9						ATAGCCATGACAGTGTCCTTT	0.493																																						dbGAP											0													92.0	78.0	83.0					17																	3336292		2203	4300	6503	-	-	-	SO:0001583	missense	0			U04686	CCDS11026.1	17p13.3	2012-08-09			ENSG00000127780	ENSG00000127780		"""GPCR / Class A : Olfactory receptors"""	8190	protein-coding gene	gene with protein product				OR1E4		8004088, 9500546	Standard	NM_003554		Approved	OR17-93, OR17-135	uc010vre.2	P47887	OTTHUMG00000090651	ENST00000248384.1:c.844G>T	17.37:g.3336292C>A	ENSP00000248384:p.Val282Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O43877|O95632|Q0VAD5|Q0VAD6|Q9UL13	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V282F	ENST00000248384.1	37	c.844	CCDS11026.1	17	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992547	0.35131	.	.	ENSG00000127780	ENST00000248384;ENST00000454364	T	0.00274	8.35	5.16	4.19	0.49359	GPCR, rhodopsin-like superfamily (1);	0.524938	0.17606	N	0.168249	T	0.00384	0.0012	L	0.46614	1.455	0.09310	N	1	D	0.53745	0.962	P	0.58266	0.836	T	0.55848	-0.8076	10	0.62326	D	0.03	.	9.4875	0.38940	0.0:0.8303:0.0:0.1697	.	282	P47887	OR1E2_HUMAN	F	282;272	ENSP00000248384:V282F	ENSP00000248384:V282F	V	-	1	0	OR1E2	3283042	0.000000	0.05858	0.043000	0.18650	0.441000	0.31987	-0.732000	0.04904	1.394000	0.46624	0.561000	0.74099	GTC	OR1E2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000127780		0.493	OR1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1E2	HGNC	protein_coding	OTTHUMT00000207311.1	80	0.00	0	C			3336292	3336292	-1	no_errors	ENST00000248384	ensembl	human	known	69_37n	missense	52	25.71	18	SNP	0.000	A
OR4K15	81127	genome.wustl.edu	37	14	20444046	20444046	+	Silent	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr14:20444046C>T	ENST00000305051.5	+	1	444	c.369C>T	c.(367-369)gcC>gcT	p.A123A		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTGCCTGGCCCAGATTTTCT	0.433																																						dbGAP											0													132.0	133.0	133.0					14																	20444046		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.369C>T	14.37:g.20444046C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIL3|Q6IEZ4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A123	ENST00000305051.5	37	c.369	CCDS32026.1	14																																																																																			OR4K15	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000169488		0.433	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K15	HGNC	protein_coding	OTTHUMT00000409883.1	143	0.00	0	C			20444046	20444046	+1	no_errors	ENST00000305051	ensembl	human	known	69_37n	silent	112	34.88	60	SNP	0.011	T
OSBPL10	114884	genome.wustl.edu	37	3	31871637	31871637	+	Silent	SNP	G	G	A	rs370281176		TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr3:31871637G>A	ENST00000396556.2	-	4	746	c.624C>T	c.(622-624)ctC>ctT	p.L208L	OSBPL10_ENST00000438237.2_Intron|OSBPL10_ENST00000467647.1_5'UTR	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	208					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CCCCCACACTGAGGTGTCTCT	0.567																																						dbGAP											0													59.0	58.0	58.0					3																	31871637		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.624C>T	3.37:g.31871637G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E212|Q9BTU5	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L208	ENST00000396556.2	37	c.624	CCDS2651.1	3																																																																																			OSBPL10	-	NULL	ENSG00000144645		0.567	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL10	HGNC	protein_coding	OTTHUMT00000253165.2	80	0.00	0	G			31871637	31871637	-1	no_errors	ENST00000396556	ensembl	human	known	69_37n	silent	52	28.77	21	SNP	0.970	A
PAQR4	124222	genome.wustl.edu	37	16	3021843	3021843	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr16:3021843C>T	ENST00000318782.8	+	3	1146	c.716C>T	c.(715-717)tCc>tTc	p.S239F	PAQR4_ENST00000572687.1_Missense_Mutation_p.S165F|PKMYT1_ENST00000571102.1_5'Flank|PKMYT1_ENST00000431515.2_Intron|PAQR4_ENST00000293978.8_Missense_Mutation_p.S200F|PAQR4_ENST00000576565.1_Missense_Mutation_p.S172F|PAQR4_ENST00000574988.1_Missense_Mutation_p.S172F	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	239						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						TGGGGCAACTCCCACCAGATC	0.677																																						dbGAP											0													40.0	44.0	43.0					16																	3021843		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.716C>T	16.37:g.3021843C>T	ENSP00000321804:p.Ser239Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Missense_Mutation	SNP	pfam_HlyIII-related	p.S239F	ENST00000318782.8	37	c.716	CCDS10485.1	16	.	.	.	.	.	.	.	.	.	.	c	18.28	3.588323	0.66105	.	.	ENSG00000162073	ENST00000318782;ENST00000293978	T	0.36699	1.24	4.94	4.94	0.65067	.	0.117229	0.53938	D	0.000056	T	0.64929	0.2643	M	0.89968	3.075	0.58432	D	0.999992	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.97110	0.998;0.998;1.0	T	0.71781	-0.4489	10	0.72032	D	0.01	-19.0799	11.5649	0.50798	0.0:0.8193:0.1807:0.0	.	164;200;239	Q8N4S7-3;Q8N4S7-2;Q8N4S7	.;.;PAQR4_HUMAN	F	239;165	ENSP00000321804:S239F	ENSP00000293978:S165F	S	+	2	0	PAQR4	2961844	1.000000	0.71417	0.913000	0.36048	0.867000	0.49689	3.954000	0.56708	2.289000	0.77006	0.556000	0.70494	TCC	PAQR4	-	pfam_HlyIII-related	ENSG00000162073		0.677	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR4	HGNC	protein_coding	OTTHUMT00000250966.1	21	0.00	0	C	NM_152341		3021843	3021843	+1	no_errors	ENST00000318782	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.998	T
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	53	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	50	44.44	40	SNP	1.000	A
POMGNT1	55624	genome.wustl.edu	37	1	46659149	46659149	+	Intron	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr1:46659149G>T	ENST00000371984.3	-	11	1184				POMGNT1_ENST00000371986.3_Intron|POMGNT1_ENST00000485714.1_5'UTR|POMGNT1_ENST00000371992.1_Intron|POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000535522.1_Intron	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)						protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					CACAGCCCTTGCCTGGGCGGT	0.597																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.1026+86C>A	1.37:g.46659149G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	RNA	SNP	-	NULL	ENST00000371984.3	37	NULL	CCDS531.1	1																																																																																			POMGNT1	-	-	ENSG00000085998		0.597	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	HGNC	protein_coding	OTTHUMT00000020146.1	65	0.00	0	G	NM_017739		46659149	46659149	-1	no_errors	ENST00000477114	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.010	T
S1PR4	8698	genome.wustl.edu	37	19	3179502	3179502	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr19:3179502C>T	ENST00000246115.3	+	1	767	c.712C>T	c.(712-714)Cca>Tca	p.P238S	S1PR4_ENST00000591346.1_3'UTR	NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	238					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						GCAGAAGGCCCCACGCCCAGC	0.687																																					GBM(82;318 1638 33279 49708)	dbGAP											0													34.0	39.0	37.0					19																	3179502		2203	4297	6500	-	-	-	SO:0001583	missense	0			AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.712C>T	19.37:g.3179502C>T	ENSP00000246115:p.Pro238Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W612	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_EDG6_rcpt,prints_S1P_rcpt,prints_7TM_GPCR_Rhodpsn	p.P238S	ENST00000246115.3	37	c.712	CCDS12105.1	19	.	.	.	.	.	.	.	.	.	.	C	0.198	-1.046906	0.01997	.	.	ENSG00000125910	ENST00000246115	T	0.36878	1.23	4.23	-0.845	0.10737	GPCR, rhodopsin-like superfamily (1);	0.615834	0.15979	N	0.235379	T	0.10852	0.0265	N	0.02181	-0.65	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26292	-1.0107	10	0.21540	T	0.41	.	4.6369	0.12528	0.0:0.4158:0.2974:0.2868	.	238	O95977	S1PR4_HUMAN	S	238	ENSP00000246115:P238S	ENSP00000246115:P238S	P	+	1	0	S1PR4	3130502	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.138000	0.10374	-0.095000	0.12351	0.462000	0.41574	CCA	S1PR4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_EDG6_rcpt	ENSG00000125910		0.687	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR4	HGNC	protein_coding	OTTHUMT00000452517.1	125	0.00	0	C	NM_003775		3179502	3179502	+1	no_errors	ENST00000246115	ensembl	human	known	69_37n	missense	88	27.27	33	SNP	0.001	T
SCN2A	6326	genome.wustl.edu	37	2	166246184	166246184	+	Silent	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr2:166246184G>A	ENST00000375437.2	+	27	6158	c.5868G>A	c.(5866-5868)gaG>gaA	p.E1956E	SCN2A_ENST00000375427.2_Silent_p.E1956E|SCN2A_ENST00000283256.6_Silent_p.E1956E|SCN2A_ENST00000357398.3_Silent_p.E1956E	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1956					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACTGAATGAGAATTCAACTC	0.363																																						dbGAP											0													64.0	62.0	63.0					2																	166246184		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5868G>A	2.37:g.166246184G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.E1956	ENST00000375437.2	37	c.5868	CCDS33314.1	2																																																																																			SCN2A	-	NULL	ENSG00000136531		0.363	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	44	0.00	0	G	NM_021007		166246184	166246184	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	silent	27	35.71	15	SNP	0.990	A
SEPT9	10801	genome.wustl.edu	37	17	75494630	75494631	+	Missense_Mutation	DNP	AT	AT	GA			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	A|T	A|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr17:75494630_75494631AT>GA	ENST00000427177.1	+	12	1777_1778	c.1651_1652AT>GA	c.(1651-1653)ATc>GAc	p.I551D	SEPT9_ENST00000541152.2_Missense_Mutation_p.I300D|SEPT9_ENST00000431235.2_Missense_Mutation_p.I387D|SEPT9_ENST00000449803.2_Missense_Mutation_p.I387D|SEPT9_ENST00000427674.2_Missense_Mutation_p.I387D|SEPT9_ENST00000423034.2_Missense_Mutation_p.I544D|SEPT9_ENST00000592951.1_Missense_Mutation_p.I300D|SEPT9_ENST00000588690.1_Missense_Mutation_p.I387D|SEPT9_ENST00000591198.1_Missense_Mutation_p.I532D|SEPT9_ENST00000590294.1_Missense_Mutation_p.I533D|SEPT9_ENST00000427180.1_Missense_Mutation_p.I439D|SEPT9_ENST00000591088.1_Missense_Mutation_p.I300D|SEPT9_ENST00000585930.1_Missense_Mutation_p.I327D|SEPT9_ENST00000329047.8_Missense_Mutation_p.I533D	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	551	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			CATCAAGGACATCACCAGCAGC	0.688																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		Exception_encountered	17.37:g.75494630_75494631delinsGA	ENSP00000391249:p.Ile551Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pfam_AIG1	p.I551V|p.I551N	ENST00000427177.1	37	c.1651|c.1652	CCDS45790.1	17																																																																																			SEPT9	-	pfam_Cell_div_GTP-bd	ENSG00000184640		0.688	SEPT9-001	KNOWN	basic|CCDS	protein_coding	SEPT9	HGNC	protein_coding	OTTHUMT00000436304.2	25|26	0.00	0	A|T	NM_006640		75494630|75494631	75494630|75494631	+1	no_errors	ENST00000427177	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	1.000	G|A
SEPT9	10801	genome.wustl.edu	37	17	75494634	75494634	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr17:75494634C>T	ENST00000427177.1	+	12	1781	c.1655C>T	c.(1654-1656)aCc>aTc	p.T552I	SEPT9_ENST00000541152.2_Missense_Mutation_p.T301I|SEPT9_ENST00000431235.2_Missense_Mutation_p.T388I|SEPT9_ENST00000449803.2_Missense_Mutation_p.T388I|SEPT9_ENST00000427674.2_Missense_Mutation_p.T388I|SEPT9_ENST00000423034.2_Missense_Mutation_p.T545I|SEPT9_ENST00000592951.1_Missense_Mutation_p.T301I|SEPT9_ENST00000588690.1_Missense_Mutation_p.T388I|SEPT9_ENST00000591198.1_Missense_Mutation_p.T533I|SEPT9_ENST00000590294.1_Missense_Mutation_p.T534I|SEPT9_ENST00000427180.1_Missense_Mutation_p.T440I|SEPT9_ENST00000591088.1_Missense_Mutation_p.T301I|SEPT9_ENST00000585930.1_Missense_Mutation_p.T328I|SEPT9_ENST00000329047.8_Missense_Mutation_p.T534I	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	552	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			AAGGACATCACCAGCAGCATC	0.687																																						dbGAP											0													38.0	43.0	41.0					17																	75494634		2145	4231	6376	-	-	-	SO:0001583	missense	0			AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.1655C>T	17.37:g.75494634C>T	ENSP00000391249:p.Thr552Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pfam_AIG1	p.T552I	ENST00000427177.1	37	c.1655	CCDS45790.1	17	.	.	.	.	.	.	.	.	.	.	c	25.6	4.653944	0.88056	.	.	ENSG00000184640	ENST00000427177;ENST00000449803;ENST00000329047;ENST00000423034;ENST00000427674;ENST00000541152;ENST00000431235;ENST00000427180	T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	3.77	3.77	0.43336	.	0.000000	0.85682	U	0.000000	D	0.85150	0.5631	H	0.96365	3.81	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.998;1.0;1.0;1.0;1.0	D	0.90705	0.4623	10	0.87932	D	0	.	15.7166	0.77672	0.0:1.0:0.0:0.0	.	328;533;440;545;534;552	Q9UHD8-9;Q9UHD8-7;Q9UHD8-8;Q9UHD8-5;Q9UHD8-2;Q9UHD8	.;.;.;.;.;SEPT9_HUMAN	I	552;388;534;545;388;328;301;440	ENSP00000391249:T552I;ENSP00000400181:T388I;ENSP00000329161:T534I;ENSP00000405877:T545I;ENSP00000403194:T388I;ENSP00000415624:T440I	ENSP00000329161:T534I	T	+	2	0	SEPT9	73006229	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.777000	0.85628	1.666000	0.50821	0.430000	0.28490	ACC	SEPT9	-	pfam_Cell_div_GTP-bd	ENSG00000184640		0.687	SEPT9-001	KNOWN	basic|CCDS	protein_coding	SEPT9	HGNC	protein_coding	OTTHUMT00000436304.2	28	0.00	0	C	NM_006640		75494634	75494634	+1	no_errors	ENST00000427177	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	1.000	T
SHROOM1	134549	genome.wustl.edu	37	5	132159145	132159145	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr5:132159145C>T	ENST00000378679.3	-	9	2827	c.2023G>A	c.(2023-2025)Gag>Aag	p.E675K	SHROOM1_ENST00000319854.3_Missense_Mutation_p.E675K|SHROOM1_ENST00000488072.1_5'UTR|SHROOM1_ENST00000378676.1_Missense_Mutation_p.E606K	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	675	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCTTGTGCCTCCCCCTGCAGC	0.687																																						dbGAP											0													19.0	23.0	22.0					5																	132159145		2200	4291	6491	-	-	-	SO:0001583	missense	0			AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.2023G>A	5.37:g.132159145C>T	ENSP00000367950:p.Glu675Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1	p.E675K	ENST00000378679.3	37	c.2023	CCDS54902.1	5	.	.	.	.	.	.	.	.	.	.	C	6.093	0.385499	0.11524	.	.	ENSG00000164403	ENST00000378679;ENST00000319854;ENST00000378676	T;T;T	0.36699	1.24;1.24;1.24	4.91	-1.62	0.08372	Apx/shroom, ASD2 (2);	1.213920	0.05811	N	0.613992	T	0.23965	0.0580	N	0.25485	0.75	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.002	T	0.25293	-1.0136	10	0.39692	T	0.17	7.6205	6.2615	0.20903	0.0:0.3773:0.1298:0.4929	.	675;675	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	K	675;675;606	ENSP00000367950:E675K;ENSP00000324245:E675K;ENSP00000367947:E606K	ENSP00000324245:E675K	E	-	1	0	SHROOM1	132187044	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.746000	0.26275	-0.451000	0.07097	0.555000	0.69702	GAG	SHROOM1	-	pfam_ASD2	ENSG00000164403		0.687	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHROOM1	HGNC	protein_coding	OTTHUMT00000133033.1	37	0.00	0	C	NM_133456		132159145	132159145	-1	no_errors	ENST00000378679	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.000	T
SLC13A3	64849	genome.wustl.edu	37	20	45192149	45192149	+	Silent	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr20:45192149C>T	ENST00000279027.4	-	12	1554	c.1536G>A	c.(1534-1536)ccG>ccA	p.P512P	SLC13A3_ENST00000495082.1_Silent_p.P465P|SLC13A3_ENST00000413164.2_Silent_p.P462P|SLC13A3_ENST00000396360.1_Silent_p.P430P|SLC13A3_ENST00000472148.1_Silent_p.P430P|SLC13A3_ENST00000435032.1_Silent_p.P97P|SLC13A3_ENST00000290317.5_Silent_p.P465P	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	512					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	CGACTGTGCCCGGAATCATCA	0.607																																						dbGAP											0													46.0	40.0	42.0					20																	45192149		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1536G>A	20.37:g.45192149C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.P512	ENST00000279027.4	37	c.1536	CCDS13400.1	20																																																																																			SLC13A3	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	ENSG00000158296		0.607	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	HGNC	protein_coding	OTTHUMT00000080329.2	23	0.00	0	C			45192149	45192149	-1	no_errors	ENST00000279027	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	0.167	T
SLC35D2	11046	genome.wustl.edu	37	9	99083270	99083270	+	3'UTR	SNP	C	C	G			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr9:99083270C>G	ENST00000253270.7	-	0	1330				SLC35D2_ENST00000375259.4_3'UTR	NM_007001.2	NP_008932.2	Q76EJ3	S35D2_HUMAN	solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2						carbohydrate derivative transport (GO:1901264)|carbohydrate metabolic process (GO:0005975)|carbohydrate transport (GO:0008643)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)			endometrium(3)|large_intestine(3)|lung(4)|skin(2)	12		Acute lymphoblastic leukemia(62;0.0167)				GCAGCTGGGGCTCCACCTACC	0.517																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB122077	CCDS6717.1, CCDS69625.1	9q22.33	2013-07-17	2013-07-17		ENSG00000130958	ENSG00000130958		"""Solute carriers"""	20799	protein-coding gene	gene with protein product		609182	"""solute carrier family 35, member D2"""			15607426	Standard	NM_007001		Approved	UGTrel8, SQV7L	uc004awc.3	Q76EJ3	OTTHUMG00000020293	ENST00000253270.7:c.*254G>C	9.37:g.99083270C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O95454|Q498C1|Q75W21|Q7Z5X5	RNA	SNP	-	NULL	ENST00000253270.7	37	NULL	CCDS6717.1	9																																																																																			SLC35D2	-	-	ENSG00000130958		0.517	SLC35D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35D2	HGNC	protein_coding	OTTHUMT00000053261.1	29	0.00	0	C			99083270	99083270	-1	no_errors	ENST00000490599	ensembl	human	known	69_37n	rna	5	78.26	18	SNP	0.003	G
SLC45A2	51151	genome.wustl.edu	37	5	33964088	33964088	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr5:33964088G>C	ENST00000296589.4	-	3	742	c.596C>G	c.(595-597)gCt>gGt	p.A199G	SLC45A2_ENST00000382102.3_Missense_Mutation_p.A199G|SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000342059.3_Missense_Mutation_p.A140G|SLC45A2_ENST00000509381.1_Intron	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	199					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CCAGTCTATAGCACCCAAAAG	0.438																																					Ovarian(31;380 859 8490 22203 49048)	dbGAP											0													67.0	65.0	65.0					5																	33964088		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.596C>G	5.37:g.33964088G>C	ENSP00000296589:p.Ala199Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.A199G	ENST00000296589.4	37	c.596	CCDS3901.1	5	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460040	0.43736	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;T;D;D	0.91894	-2.19;-1.09;-2.19;-2.93	5.93	5.93	0.95920	Major facilitator superfamily domain, general substrate transporter (1);	0.048590	0.85682	D	0.000000	D	0.89343	0.6688	L	0.35249	1.045	0.80722	D	1	B;B	0.16166	0.013;0.016	B;B	0.29663	0.086;0.105	D	0.83691	0.0177	10	0.28530	T	0.3	-34.4582	19.1077	0.93303	0.0:0.0:1.0:0.0	.	199;199	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	G	199;140;199;24	ENSP00000296589:A199G;ENSP00000341014:A140G;ENSP00000371534:A199G;ENSP00000424010:A24G	ENSP00000296589:A199G	A	-	2	0	SLC45A2	33999845	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	6.704000	0.74639	2.814000	0.96858	0.563000	0.77884	GCT	SLC45A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000164175		0.438	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A2	HGNC	protein_coding	OTTHUMT00000207443.2	32	0.00	0	G	NM_016180		33964088	33964088	-1	no_errors	ENST00000296589	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	C
SRL	6345	genome.wustl.edu	37	16	4257368	4257368	+	Intron	SNP	G	G	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr16:4257368G>T	ENST00000399609.3	-	2	74				SRL_ENST00000537996.1_Intron	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin							sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						GGCTCCCCCTGGTCCTCGGTG	0.662																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.62-2733C>A	16.37:g.4257368G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q267K	ENST00000399609.3	37	c.799	CCDS42113.1	16	.	.	.	.	.	.	.	.	.	.	g	13.35	2.210112	0.39003	.	.	ENSG00000185739	ENST00000330063	.	.	.	5.79	1.07	0.20283	.	.	.	.	.	T	0.18045	0.0433	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29119	-1.0022	5	0.13470	T	0.59	-1.6133	5.0787	0.14646	0.0793:0.4223:0.3538:0.1447	.	.	.	.	K	267	.	ENSP00000333285:Q267K	Q	-	1	0	SRL	4197369	0.000000	0.05858	0.371000	0.25978	0.086000	0.17979	0.503000	0.22610	0.272000	0.22027	0.639000	0.83563	CAG	SRL	-	NULL	ENSG00000185739		0.662	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	97	0.00	0	G	XM_064152		4257368	4257368	-1	no_errors	ENST00000572111	ensembl	human	known	69_37n	missense	180	11.76	24	SNP	0.000	T
SSC5D	284297	genome.wustl.edu	37	19	56005180	56005180	+	Missense_Mutation	SNP	C	C	T	rs8105891	byFrequency	TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr19:56005180C>T	ENST00000389623.6	+	7	1137	c.1114C>T	c.(1114-1116)Cgg>Tgg	p.R372W	SSC5D_ENST00000587166.1_Missense_Mutation_p.R372W	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	372	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						GGACGACCTTCGGTGTCGGGG	0.711																																						dbGAP											0													26.0	27.0	27.0					19																	56005180		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.1114C>T	19.37:g.56005180C>T	ENSP00000374274:p.Arg372Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.R372W	ENST00000389623.6	37	c.1114	CCDS46196.1	19	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960230	0.53400	.	.	ENSG00000179954	ENST00000389623;ENST00000541230	T	0.44881	0.91	4.46	3.38	0.38709	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	2.091870	0.03485	N	0.215734	T	0.65974	0.2743	M	0.67569	2.06	0.22620	N	0.998923	D	0.89917	1.0	D	0.78314	0.991	T	0.42430	-0.9452	10	0.87932	D	0	.	11.3576	0.49625	0.1902:0.8098:0.0:0.0	.	372	A1L4H1	SRCRL_HUMAN	W	372	ENSP00000374274:R372W	ENSP00000374274:R372W	R	+	1	2	SSC5D	60696992	0.000000	0.05858	0.465000	0.27155	0.644000	0.38419	-0.542000	0.06091	0.949000	0.37715	0.297000	0.19635	CGG	SSC5D	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000179954		0.711	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	HGNC	protein_coding	OTTHUMT00000453345.2	19	0.00	0	C	XM_001718392		56005180	56005180	+1	no_errors	ENST00000389623	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	0.448	T
TDG	6996	genome.wustl.edu	37	12	104380594	104380594	+	Intron	SNP	T	T	C	rs2723847	byFrequency	TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr12:104380594T>C	ENST00000392872.3	+	10	1324				TDG_ENST00000536395.1_3'UTR|TDG_ENST00000266775.9_Intron|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Intron|TDG_ENST00000544861.1_Intron	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		gcccaggagtttgaggctgca	0.443								Base excision repair (BER), DNA glycosylases					T|||	577	0.115216	0.1293	0.2464	5008	,	,		18405	0.003		0.1571	False		,,,				2504	0.0757					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.1091-132T>C	12.37:g.104380594T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUZ6|Q8IZM3	RNA	SNP	-	NULL	ENST00000392872.3	37	NULL	CCDS9095.1	12																																																																																			TDG	-	-	ENSG00000139372		0.443	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDG	HGNC	protein_coding	OTTHUMT00000399673.2	8	0.00	0	T			104380594	104380594	+1	no_errors	ENST00000536395	ensembl	human	putative	69_37n	rna	3	70.00	7	SNP	0.827	C
TP53I3	9540	genome.wustl.edu	37	2	24303884	24303884	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr2:24303884C>G	ENST00000238721.4	-	3	1278	c.424G>C	c.(424-426)Gac>Cac	p.D142H	FAM228B_ENST00000461972.1_Intron|TP53I3_ENST00000407482.1_Missense_Mutation_p.D142H|TP53I3_ENST00000313482.4_Missense_Mutation_p.D142H|TP53I3_ENST00000417886.1_5'UTR|TP53I3_ENST00000335934.4_Missense_Mutation_p.D142H	NM_004881.4	NP_004872.2	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	142					NADP metabolic process (GO:0006739)	extracellular vesicular exosome (GO:0070062)	NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(2)|lung(3)|urinary_tract(2)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCACATAGTCTCCAGCCTGA	0.507																																						dbGAP											0													126.0	130.0	129.0					2																	24303884		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF010309	CCDS1708.1, CCDS56112.1	2p23.3	2009-06-12			ENSG00000115129	ENSG00000115129			19373	protein-coding gene	gene with protein product		605171				11919562, 10840161, 19349281	Standard	NM_004881		Approved	PIG3	uc002rez.2	Q53FA7	OTTHUMG00000090817	ENST00000238721.4:c.424G>C	2.37:g.24303884C>G	ENSP00000238721:p.Asp142His	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W533|O14679|O14685|Q38G78|Q6JLE7|Q9BWB8	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER,tigrfam_Quinone_OxRdtase_PIG3	p.D142H	ENST00000238721.4	37	c.424	CCDS1708.1	2	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850309	0.32699	.	.	ENSG00000115129	ENST00000335934;ENST00000238721;ENST00000313482;ENST00000407482;ENST00000413037	T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36	5.29	3.48	0.39840	GroES-like (1);	0.429777	0.25598	N	0.029570	T	0.45397	0.1340	L	0.35341	1.055	0.29930	N	0.821941	D;B;B	0.64830	0.994;0.003;0.001	P;B;B	0.60068	0.868;0.01;0.006	T	0.50915	-0.8771	10	0.72032	D	0.01	-5.1561	15.3474	0.74350	0.0:0.7358:0.2642:0.0	.	53;142;142	B4DMQ7;Q53FA7;Q53FA7-2	.;QORX_HUMAN;.	H	142;142;142;142;137	ENSP00000337834:D142H;ENSP00000238721:D142H;ENSP00000322298:D142H;ENSP00000384414:D142H;ENSP00000389620:D137H	ENSP00000238721:D142H	D	-	1	0	TP53I3	24157388	1.000000	0.71417	0.015000	0.15790	0.001000	0.01503	2.907000	0.48743	0.725000	0.32318	-0.264000	0.10439	GAC	TP53I3	-	superfamily_GroES-like,smart_PKS_ER,tigrfam_Quinone_OxRdtase_PIG3	ENSG00000115129		0.507	TP53I3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53I3	HGNC	protein_coding	OTTHUMT00000207618.2	63	0.00	0	C	NM_004881		24303884	24303884	-1	no_errors	ENST00000238721	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.783	G
TUBB4B	10383	genome.wustl.edu	37	9	140137382	140137382	+	Missense_Mutation	SNP	A	A	C	rs201369773		TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr9:140137382A>C	ENST00000340384.4	+	4	860	c.712A>C	c.(712-714)Acc>Ccc	p.T238P		NM_006088.5	NP_006079.1	P68371	TBB4B_HUMAN	tubulin, beta 4B class IVb	238					'de novo' posttranslational protein folding (GO:0051084)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|unfolded protein binding (GO:0051082)									Albendazole(DB00518)|Mebendazole(DB00643)	TGGGGTCACCACCTGCCTGCG	0.587																																						dbGAP											0													32.0	33.0	33.0					9																	140137382		2200	4292	6492	-	-	-	SO:0001583	missense	0			BC019359	CCDS7039.1	9q34.3	2011-10-10	2011-10-10	2011-10-10	ENSG00000188229	ENSG00000188229		"""Tubulins"""	20771	protein-coding gene	gene with protein product	"""class IVb beta-tubulin"""	602660	"""tubulin, beta 2C"""	TUBB2C		3999141	Standard	NM_006088		Approved	Beta2	uc004cmh.1	P68371	OTTHUMG00000131783	ENST00000340384.4:c.712A>C	9.37:g.140137382A>C	ENSP00000341289:p.Thr238Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BFA2|P05217	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.T238P	ENST00000340384.4	37	c.712	CCDS7039.1	9	.	.	.	.	.	.	.	.	.	.	A	17.07	3.294015	0.60086	.	.	ENSG00000188229	ENST00000340384	T	0.69435	-0.4	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.80407	0.4617	M	0.88704	2.975	0.80722	D	1	P	0.37824	0.609	P	0.48952	0.596	D	0.83606	0.0131	10	0.87932	D	0	.	14.5794	0.68274	1.0:0.0:0.0:0.0	.	238	P68371	TBB4B_HUMAN	P	238	ENSP00000341289:T238P	ENSP00000341289:T238P	T	+	1	0	TUBB2C	139257203	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.076000	0.71267	2.122000	0.65172	0.533000	0.62120	ACC	TUBB4B	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin	ENSG00000188229		0.587	TUBB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB4B	HGNC	protein_coding	OTTHUMT00000254715.1	128	0.00	0	A	NM_006088		140137382	140137382	+1	no_errors	ENST00000340384	ensembl	human	known	69_37n	missense	95	26.72	35	SNP	1.000	C
TXNRD3NB	645840	genome.wustl.edu	37	3	126291197	126291197	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr3:126291197C>T	ENST00000404489.2	-	1	282	c.190G>A	c.(190-192)Gag>Aag	p.E64K	TXNRD3NB_ENST00000383572.2_Missense_Mutation_p.E64K			Q6F5E7	TR3N_HUMAN	thioredoxin reductase 3 neighbor	64										endometrium(1)|large_intestine(2)|skin(2)	5						CTCTTAATCTCTTCCAGGGGA	0.562																																						dbGAP											0													59.0	64.0	62.0					3																	126291197		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC130546	CCDS33846.1	3q21.3	2011-04-13	2011-04-13	2011-04-13	ENSG00000206483	ENSG00000206483			33870	protein-coding gene	gene with protein product	"""thioredoxin reductase 3 new transcript 1"""		"""thioredoxin reductase 3 intronic transcript 1"""	TXNRD3IT1		15674732	Standard	NM_001039783		Approved	TR2IT1, TXNRD3NT1	uc003ejc.3	Q6F5E7	OTTHUMG00000162732	ENST00000404489.2:c.190G>A	3.37:g.126291197C>T	ENSP00000384071:p.Glu64Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E64K	ENST00000404489.2	37	c.190	CCDS33846.1	3	.	.	.	.	.	.	.	.	.	.	C	4.381	0.070345	0.08436	.	.	ENSG00000206483	ENST00000383572;ENST00000404489	.	.	.	0.661	0.661	0.17874	.	.	.	.	.	T	0.09949	0.0244	N	0.08118	0	0.09310	N	1	P	0.50710	0.938	B	0.34931	0.192	T	0.17684	-1.0361	7	0.87932	D	0	.	.	.	.	.	64	Q6F5E7	TR3N_HUMAN	K	64	.	ENSP00000373066:E64K	E	-	1	0	TXNRD3NB	127773887	0.010000	0.17322	0.020000	0.16555	0.025000	0.11179	0.766000	0.26560	0.639000	0.30564	0.467000	0.42956	GAG	TXNRD3NB	-	NULL	ENSG00000206483		0.562	TXNRD3NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNRD3NB	HGNC	protein_coding	OTTHUMT00000370233.2	79	0.00	0	C	NM_001039783		126291197	126291197	-1	no_errors	ENST00000383572	ensembl	human	known	69_37n	missense	55	15.38	10	SNP	0.023	T
WASH6P	653440	genome.wustl.edu	37	X	155253444	155253444	+	RNA	SNP	G	G	C			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chrX:155253444G>C	ENST00000461007.1	+	0	2360				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ATCTCCCAGTGTAACCCTAGC	0.483																																						dbGAP											0																																										-	-	-			0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155253444G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.483	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	9	0.00	0	G	NG_008380		155253444	155253444	+1	no_errors	ENST00000461007	ensembl	human	known	69_37n	rna	9	43.75	7	SNP	0.004	C
WNK1	65125	genome.wustl.edu	37	12	1009694	1009694	+	Silent	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr12:1009694C>T	ENST00000315939.6	+	26	7144	c.6501C>T	c.(6499-6501)ctC>ctT	p.L2167L	WNK1_ENST00000535572.1_Silent_p.L1919L|WNK1_ENST00000340908.4_Silent_p.L1760L|WNK1_ENST00000537687.1_Silent_p.L2427L|WNK1_ENST00000530271.2_Silent_p.L2665L	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2167					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			AGCAGACCCTCCACCCTCCTG	0.542																																					Colon(19;451 567 6672 12618 28860)	dbGAP											0													162.0	154.0	157.0					12																	1009694		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.6501C>T	12.37:g.1009694C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L2665	ENST00000315939.6	37	c.7995	CCDS8506.1	12																																																																																			WNK1	-	NULL	ENSG00000060237		0.542	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	38	0.00	0	C	NM_018979		1009694	1009694	+1	no_errors	ENST00000530271	ensembl	human	known	69_37n	silent	34	22.73	10	SNP	1.000	T
ZDHHC11	79844	genome.wustl.edu	37	5	712139	712139	+	Intron	SNP	T	T	A	rs111351502	byFrequency	TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr5:712139T>A	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000522356.1_5'UTR|ZDHHC11B_ENST00000508859.2_3'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCAGCCCATCTTCCTGGAGAT	0.562													t|||	2442	0.48762	0.5522	0.4683	5008	,	,		24038	0.5248		0.4911	False		,,,				2504	0.3722					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-1140A>T	5.37:g.712139T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.562	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		22	0.00	0	T	NM_024786		712139	712139	-1	no_errors	ENST00000522356	ensembl	human	known	69_37n	rna	26	16.13	5	SNP	0.000	A
ZMYND10	51364	genome.wustl.edu	37	3	50380800	50380800	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr3:50380800C>T	ENST00000231749.3	-	5	1720	c.448G>A	c.(448-450)Gcc>Acc	p.A150T	ZMYND10_ENST00000490675.1_5'Flank|ZMYND10_ENST00000360165.3_Missense_Mutation_p.A150T|RASSF1_ENST00000488024.1_5'Flank|RASSF1_ENST00000357043.2_5'Flank|RASSF1_ENST00000359365.4_5'Flank|ZMYND10-AS1_ENST00000440013.1_RNA	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10	150					inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCACTCTGGGCCACCAGCAGG	0.577										TSP Lung(30;0.18)																												dbGAP											0													71.0	73.0	72.0					3																	50380800		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874	ENST00000231749.3:c.448G>A	3.37:g.50380800C>T	ENSP00000231749:p.Ala150Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Missense_Mutation	SNP	pfam_Znf_MYND,pirsf_UCP037948_Znf-MYND,pfscan_Znf_MYND	p.A150T	ENST00000231749.3	37	c.448	CCDS2825.1	3	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555182	0.65425	.	.	ENSG00000004838	ENST00000231749;ENST00000360165;ENST00000442887	T;T;T	0.28454	1.61;1.61;1.61	5.16	4.27	0.50696	.	0.338330	0.35124	N	0.003438	T	0.31389	0.0795	L	0.37850	1.14	0.31617	N	0.650796	P;P	0.44521	0.837;0.626	P;B	0.46885	0.53;0.33	T	0.34428	-0.9829	10	0.48119	T	0.1	-5.451	12.7276	0.57180	0.2988:0.7012:0.0:0.0	.	150;150	O75800-2;O75800	.;ZMY10_HUMAN	T	150;150;107	ENSP00000231749:A150T;ENSP00000353289:A150T;ENSP00000393687:A107T	ENSP00000231749:A150T	A	-	1	0	ZMYND10	50355804	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	3.452000	0.52971	1.136000	0.42199	0.561000	0.74099	GCC	ZMYND10	-	pirsf_UCP037948_Znf-MYND	ENSG00000004838		0.577	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZMYND10	HGNC	protein_coding	OTTHUMT00000346376.1	61	0.00	0	C	NM_015896		50380800	50380800	-1	no_errors	ENST00000231749	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	0.998	T
ZNF608	57507	genome.wustl.edu	37	5	123983690	123983690	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr5:123983690C>A	ENST00000306315.5	-	4	2822	c.2387G>T	c.(2386-2388)gGa>gTa	p.G796V	ZNF608_ENST00000504926.1_Missense_Mutation_p.G369V	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	796							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GATGGGCTCTCCCATAATTGT	0.493																																						dbGAP											0													128.0	132.0	131.0					5																	123983690		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.2387G>T	5.37:g.123983690C>A	ENSP00000307746:p.Gly796Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.G796V	ENST00000306315.5	37	c.2387	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864007	0.51482	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.50548	0.75;0.74	6.01	6.01	0.97437	.	0.104274	0.64402	D	0.000003	T	0.69314	0.3097	M	0.68593	2.085	0.80722	D	1	D	0.69078	0.997	D	0.76575	0.988	T	0.66208	-0.5981	10	0.48119	T	0.1	-17.4611	20.5161	0.99213	0.0:1.0:0.0:0.0	.	796	Q9ULD9	ZN608_HUMAN	V	369;796	ENSP00000427657:G369V;ENSP00000307746:G796V	ENSP00000307746:G796V	G	-	2	0	ZNF608	124011589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.352000	0.52239	2.852000	0.98041	0.643000	0.83706	GGA	ZNF608	-	NULL	ENSG00000168916		0.493	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	156	0.00	0	C	XM_114432		123983690	123983690	-1	no_errors	ENST00000306315	ensembl	human	known	69_37n	missense	133	23.56	41	SNP	1.000	A
ZSCAN5C	649137	genome.wustl.edu	37	19	56720539	56720539	+	Silent	SNP	G	G	A			TCGA-B6-A40B-01A-11D-A23C-09	TCGA-B6-A40B-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4879bc18-31b9-4cd6-967c-2891a1fd416e	dc05c74e-86e4-4b00-9824-a7c8c69acf7c	g.chr19:56720539G>A	ENST00000534327.1	+	5	1610	c.1461G>A	c.(1459-1461)caG>caA	p.Q487Q	ZSCAN5C_ENST00000376267.1_Silent_p.Q487Q			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	487					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						GACGCCACCAGAAAACACATC	0.507																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.1461G>A	19.37:g.56720539G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q487	ENST00000534327.1	37	c.1461		19																																																																																			ZSCAN5C	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204532		0.507	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	38	0.00	0	G	XM_001131980		56720539	56720539	+1	no_errors	ENST00000376267	ensembl	human	known	69_37n	silent	29	25.64	10	SNP	0.024	A
