#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB4	5244	genome.wustl.edu	37	7	87051523	87051523	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr7:87051523C>T	ENST00000265723.4	-	18	2341	c.2230G>A	c.(2230-2232)Gat>Aat	p.D744N	ABCB4_ENST00000359206.3_Missense_Mutation_p.D744N|ABCB4_ENST00000545634.1_Missense_Mutation_p.D744N|ABCB4_ENST00000453593.1_Missense_Mutation_p.D744N|ABCB4_ENST00000358400.3_Missense_Mutation_p.D744N	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	744	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TTCACTGCATCATCGCCTGGT	0.363																																						dbGAP											0													56.0	55.0	55.0					7																	87051523		2203	4300	6503	-	-	-	SO:0001583	missense	0			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2230G>A	7.37:g.87051523C>T	ENSP00000265723:p.Asp744Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.D744N	ENST00000265723.4	37	c.2230	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640338	0.29157	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53	6.17	5.3	0.74995	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.536026	0.19684	N	0.108458	T	0.71298	0.3323	L	0.38175	1.15	0.25629	N	0.986328	B;B;B	0.24882	0.113;0.016;0.02	B;B;B	0.28638	0.092;0.028;0.048	T	0.60188	-0.7312	10	0.30854	T	0.27	-14.9551	8.6047	0.33767	0.0:0.7994:0.0:0.2006	.	744;744;744	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	N	744	ENSP00000352135:D744N;ENSP00000351172:D744N;ENSP00000265723:D744N;ENSP00000392983:D744N;ENSP00000437465:D744N	ENSP00000265723:D744N	D	-	1	0	ABCB4	86889459	0.001000	0.12720	0.874000	0.34290	0.899000	0.52679	0.469000	0.22067	1.632000	0.50472	-0.140000	0.14226	GAT	ABCB4	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000005471		0.363	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	92	0.00	0	C	NM_000443		87051523	87051523	-1	no_errors	ENST00000265723	ensembl	human	known	69_37n	missense	158	14.59	27	SNP	0.398	T
ABCC4	10257	genome.wustl.edu	37	13	95715010	95715010	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr13:95715010G>T	ENST00000376887.4	-	26	3428	c.3314C>A	c.(3313-3315)aCa>aAa	p.T1105K	ABCC4_ENST00000412704.1_Missense_Mutation_p.T1058K	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	1105	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	AATTTCAGTTGTCAAGATCTT	0.418																																						dbGAP											0													135.0	126.0	129.0					13																	95715010		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.3314C>A	13.37:g.95715010G>T	ENSP00000366084:p.Thr1105Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM	p.T1105K	ENST00000376887.4	37	c.3314	CCDS9474.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.207577	0.95033	.	.	ENSG00000125257	ENST00000412704;ENST00000376887	D;D	0.93953	-3.32;-3.32	6.16	6.16	0.99307	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.94775	0.8313	L	0.33189	0.99	0.80722	D	1	P;D	0.53151	0.896;0.958	P;P	0.62740	0.859;0.906	D	0.94641	0.7830	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1058;1105	O15439-2;O15439	.;MRP4_HUMAN	K	1058;1105	ENSP00000388657:T1058K;ENSP00000366084:T1105K	ENSP00000366084:T1105K	T	-	2	0	ABCC4	94513011	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	ACA	ABCC4	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000125257		0.418	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2	200	0.00	0	G	NM_005845		95715010	95715010	-1	no_errors	ENST00000376887	ensembl	human	known	69_37n	missense	199	11.50	26	SNP	1.000	T
ANAPC1	64682	genome.wustl.edu	37	2	112619981	112619981	+	Missense_Mutation	SNP	G	G	A	rs201128090	byFrequency	TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:112619981G>A	ENST00000341068.3	-	10	2019	c.1247C>T	c.(1246-1248)aCg>aTg	p.T416M		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	416					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.T416M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						ATTAGTAATCGTTTCTGTCCA	0.313																																						dbGAP											1	Substitution - Missense(1)	skin(1)											6.0	7.0	7.0					2																	112619981		2139	4197	6336	-	-	-	SO:0001583	missense	0			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1247C>T	2.37:g.112619981G>A	ENSP00000339109:p.Thr416Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NULL	p.T416M	ENST00000341068.3	37	c.1247	CCDS2093.1	2	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172314	0.38315	.	.	ENSG00000153107	ENST00000341068	.	.	.	5.64	4.75	0.60458	.	0.837001	0.09499	N	0.793841	T	0.39886	0.1095	L	0.50333	1.59	0.09310	N	1	B	0.33904	0.431	B	0.29785	0.107	T	0.32824	-0.9892	9	0.59425	D	0.04	-0.0065	13.163	0.59554	0.0752:0.0:0.9248:0.0	.	416	Q9H1A4	APC1_HUMAN	M	416	.	ENSP00000339109:T416M	T	-	2	0	ANAPC1	112336452	0.983000	0.35010	0.049000	0.19019	0.939000	0.58152	6.428000	0.73383	2.645000	0.89757	0.655000	0.94253	ACG	ANAPC1	-	NULL	ENSG00000153107		0.313	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	HGNC	protein_coding	OTTHUMT00000254045.2	37	0.00	0	G	NM_022662		112619981	112619981	-1	no_errors	ENST00000341068	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.027	A
ANKAR	150709	genome.wustl.edu	37	2	190569785	190569785	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:190569785C>G	ENST00000520309.1	+	8	1833	c.1745C>G	c.(1744-1746)tCa>tGa	p.S582*	ANKAR_ENST00000313581.4_Nonsense_Mutation_p.S582*|ANKAR_ENST00000431575.2_Nonsense_Mutation_p.S511*|ANKAR_ENST00000281412.6_Nonsense_Mutation_p.S346*|ANKAR_ENST00000438402.2_Nonsense_Mutation_p.S582*	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	582						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			CAGGCTTGCTCATTAGAAACA	0.423																																						dbGAP											0													155.0	128.0	137.0					2																	190569785		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1745C>G	2.37:g.190569785C>G	ENSP00000427882:p.Ser582*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCS6|Q4G0M2|Q6ZU02	Nonsense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Armadillo,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Armadillo	p.S582*	ENST00000520309.1	37	c.1745	CCDS33351.2	2	.	.	.	.	.	.	.	.	.	.	C	45	11.381356	0.99554	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	.	.	.	5.63	5.63	0.86233	.	0.147187	0.32028	N	0.006683	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-9.8544	18.4628	0.90745	0.0:1.0:0.0:0.0	.	.	.	.	X	582;582;582;511;346	.	ENSP00000281412:S346X	S	+	2	0	ANKAR	190278030	0.999000	0.42202	0.943000	0.38184	0.913000	0.54294	5.325000	0.65869	2.654000	0.90174	0.561000	0.74099	TCA	ANKAR	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151687		0.423	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKAR	HGNC	protein_coding	OTTHUMT00000335045.3	237	0.00	0	C	NM_144708		190569785	190569785	+1	no_errors	ENST00000313581	ensembl	human	known	69_37n	nonsense	222	14.29	37	SNP	0.997	G
CORT	1325	genome.wustl.edu	37	1	10511574	10511575	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:10511574_10511575insC	ENST00000377049.3	+	2	745_746	c.240_241insC	c.(241-243)cccfs	p.P81fs	APITD1_ENST00000602296.1_3'UTR|APITD1_ENST00000602787.1_Frame_Shift_Ins_p.P140fs|APITD1-CORT_ENST00000400900.2_Frame_Shift_Ins_p.P140fs|APITD1-CORT_ENST00000470413.2_3'UTR|CORT_ENST00000320498.4_Frame_Shift_Ins_p.P131fs|APITD1-CORT_ENST00000465026.1_3'UTR	NM_001302.4	NP_001293.3	O00230	CORT_HUMAN	cortistatin	81					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)	G-protein coupled receptor binding (GO:0001664)|neuropeptide hormone activity (GO:0005184)			breast(1)|endometrium(1)|stomach(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0487)		AGGAAGGCGCACCCCCCCAGCA	0.614																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF013252	CCDS117.1, CCDS117.2	1p36.22	2013-02-25			ENSG00000241563	ENSG00000241563		"""Endogenous ligands"""	2257	protein-coding gene	gene with protein product	"""prepro-cortistatin"""	602784				9205124	Standard	NM_001302		Approved	MGC32686		O00230	OTTHUMG00000001906	ENST00000377049.3:c.247dupC	1.37:g.10511581_10511581dupC	ENSP00000366248:p.Pro81fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6G0|Q6UX11	Frame_Shift_Ins	INS	pfam_Somatostatin/Cortistatin_C,superfamily_Histone-fold	p.Q141fs	ENST00000377049.3	37	c.417_418	CCDS117.2	1																																																																																			APITD1-CORT	-	NULL	ENSG00000251503		0.614	CORT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	APITD1-CORT	HGNC	protein_coding	OTTHUMT00000005410.3	16	0.00	0	-	NM_001302		10511574	10511575	+1	no_errors	ENST00000400900	ensembl	human	known	69_37n	frame_shift_ins	23	17.86	5	INS	0.000:0.032	C
APP	351	genome.wustl.edu	37	21	27354686	27354686	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr21:27354686C>G	ENST00000346798.3	-	9	1228	c.1195G>C	c.(1195-1197)Gag>Cag	p.E399Q	APP_ENST00000354192.3_Missense_Mutation_p.E268Q|APP_ENST00000357903.3_Missense_Mutation_p.E380Q|APP_ENST00000440126.3_Missense_Mutation_p.E375Q|APP_ENST00000439274.2_Missense_Mutation_p.E343Q|APP_ENST00000348990.5_Missense_Mutation_p.E324Q|APP_ENST00000359726.3_Missense_Mutation_p.E343Q|APP_ENST00000358918.3_Missense_Mutation_p.E399Q|APP_ENST00000448388.2_Missense_Mutation_p.E289Q	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	399	Heparin-binding.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				TGCTTGGCCTCAAGCCTCTCT	0.522																																						dbGAP											0													132.0	110.0	118.0					21																	27354686		2203	4300	6503	-	-	-	SO:0001583	missense	0			M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1195G>C	21.37:g.27354686C>G	ENSP00000284981:p.Glu399Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Amyloid_glyco_Abeta,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Amyloid_glyco_Abeta,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.E399Q	ENST00000346798.3	37	c.1195	CCDS13576.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.0|29.0	4.971434|4.971434	0.92919|0.92919	.|.	.|.	ENSG00000142192|ENSG00000142192	ENST00000346798;ENST00000354192;ENST00000348990;ENST00000357903;ENST00000358918;ENST00000359726;ENST00000448388;ENST00000440126;ENST00000439274|ENST00000448850;ENST00000415997	T;T;T;T;T;T;T;T;T|.	0.55588|.	0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51|.	5.45|5.45	5.45|5.45	0.79879|0.79879	Amyloidogenic glycoprotein, E2 domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.78941|.	0.4363|.	M|M	0.79693|0.79693	2.465|2.465	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.992;1.0;0.99;0.99;1.0|.	D;D;D;D;D;D;D|.	0.91635|.	0.999;0.999;0.977;0.997;0.961;0.961;0.998|.	T|.	0.78595|.	-0.2143|.	10|.	0.54805|.	T|.	0.06|.	-28.8251|-28.8251	19.0662|19.0662	0.93113|0.93113	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	289;343;375;268;324;380;399|.	E9PEV0;E9PG40;B4DII8;P05067-10;P05067-4;P05067-8;P05067|.	.;.;.;.;.;.;A4_HUMAN|.	Q|S	399;268;324;380;399;343;289;375;343|301;133	ENSP00000284981:E399Q;ENSP00000346129:E268Q;ENSP00000345463:E324Q;ENSP00000350578:E380Q;ENSP00000351796:E399Q;ENSP00000352760:E343Q;ENSP00000388538:E289Q;ENSP00000387483:E375Q;ENSP00000398879:E343Q|.	ENSP00000284981:E399Q|.	E|X	-|-	1|2	0|2	APP|APP	26276557|26276557	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.320000|7.320000	0.79064|0.79064	2.836000|2.836000	0.97738|0.97738	0.655000|0.655000	0.94253|0.94253	GAG|TGA	APP	-	superfamily_Amyloid_glyco_E2_domain,prints_Amyloid_glyco	ENSG00000142192		0.522	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APP	HGNC	protein_coding	OTTHUMT00000171340.1	191	0.00	0	C	NM_000484		27354686	27354686	-1	no_errors	ENST00000346798	ensembl	human	known	69_37n	missense	173	11.28	22	SNP	1.000	G
ASAP2	8853	genome.wustl.edu	37	2	9531255	9531255	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:9531255C>T	ENST00000281419.3	+	23	2788	c.2448C>T	c.(2446-2448)agC>agT	p.S816S	ASAP2_ENST00000491413.1_Intron|ASAP2_ENST00000315273.4_Intron	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	816	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						ACGGTGGAAGCCGGCAGCGAT	0.552																																						dbGAP											0													194.0	169.0	177.0					2																	9531255		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2448C>T	2.37:g.9531255C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W4Y8	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.S816	ENST00000281419.3	37	c.2448	CCDS1661.1	2																																																																																			ASAP2	-	NULL	ENSG00000151693		0.552	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	139	0.00	0	C	NM_003887		9531255	9531255	+1	no_errors	ENST00000281419	ensembl	human	known	69_37n	silent	128	32.28	61	SNP	1.000	T
ATF7IP2	80063	genome.wustl.edu	37	16	10524750	10524750	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr16:10524750C>T	ENST00000396560.2	+	3	500	c.273C>T	c.(271-273)ttC>ttT	p.F91F	ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000396559.1_Silent_p.F91F|ATF7IP2_ENST00000324570.5_Silent_p.F91F|ATF7IP2_ENST00000356427.2_Silent_p.F91F	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.F91L(1)		large_intestine(3)	3						GTAAAGTATTCTCTCAGAATT	0.333																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											39.0	43.0	42.0					16																	10524750		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.273C>T	16.37:g.10524750C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Silent	SNP	superfamily_Fibronectin_type3	p.F91	ENST00000396560.2	37	c.273	CCDS10540.1	16																																																																																			ATF7IP2	-	NULL	ENSG00000166669		0.333	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF7IP2	HGNC	protein_coding	OTTHUMT00000251961.1	163	0.00	0	C	NM_024997		10524750	10524750	+1	no_errors	ENST00000356427	ensembl	human	known	69_37n	silent	153	12.07	21	SNP	0.000	T
B3GALNT1	8706	genome.wustl.edu	37	3	160804170	160804170	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:160804170C>G	ENST00000392781.2	-	8	1120	c.373G>C	c.(373-375)Gaa>Caa	p.E125Q	B3GALNT1_ENST00000488170.1_Missense_Mutation_p.E125Q|B3GALNT1_ENST00000392780.1_Missense_Mutation_p.E125Q|B3GALNT1_ENST00000417187.1_Intron|B3GALNT1_ENST00000392779.2_Missense_Mutation_p.E125Q|B3GALNT1_ENST00000473285.1_Missense_Mutation_p.E125Q|B3GALNT1_ENST00000320474.4_Missense_Mutation_p.E125Q	NM_001038628.1	NP_001033717.1	O75752	B3GL1_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)	125					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity (GO:0047273)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			ATTTTGTCTTCCTTTTCAGCC	0.393																																						dbGAP											0													107.0	103.0	104.0					3																	160804170		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y15062	CCDS3193.1	3q25	2014-07-18	2006-06-14	2006-05-09	ENSG00000169255	ENSG00000169255	2.4.1.79	"""Blood group antigens"", ""Beta 3-glycosyltransferases"""	918	protein-coding gene	gene with protein product	"""globoside synthase"", ""P antigen synthase"""	603094	"""UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (Globoside blood group)"", ""UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 (Globoside blood group)"""	B3GALT3		9582303, 10993897	Standard	XM_005247861		Approved	beta3Gal-T3, galT3, P1, GLOB	uc003fdv.3	O75752	OTTHUMG00000159064	ENST00000392781.2:c.373G>C	3.37:g.160804170C>G	ENSP00000376532:p.Glu125Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNM4|Q3Y531|Q6IAI5|Q8NFM8|Q8NFM9|Q9HA06	Missense_Mutation	SNP	pfam_Glyco_trans_31,pfam_Fringe-like	p.E125Q	ENST00000392781.2	37	c.373	CCDS3193.1	3	.	.	.	.	.	.	.	.	.	.	C	2.647	-0.282885	0.05642	.	.	ENSG00000169255	ENST00000320474;ENST00000392779;ENST00000392780;ENST00000392781;ENST00000473285;ENST00000488170	T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81	5.73	3.93	0.45458	.	0.490290	0.16856	N	0.196756	T	0.37785	0.1016	L	0.42744	1.35	0.27839	N	0.941166	B	0.10296	0.003	B	0.12156	0.007	T	0.29427	-1.0012	10	0.49607	T	0.09	.	7.3794	0.26847	0.0:0.7151:0.1365:0.1484	.	125	O75752	B3GL1_HUMAN	Q	125	ENSP00000323479:E125Q;ENSP00000376530:E125Q;ENSP00000376531:E125Q;ENSP00000376532:E125Q;ENSP00000418226:E125Q;ENSP00000420163:E125Q	ENSP00000323479:E125Q	E	-	1	0	B3GALNT1	162286864	0.958000	0.32768	0.988000	0.46212	0.092000	0.18411	2.378000	0.44309	1.425000	0.47237	0.561000	0.74099	GAA	B3GALNT1	-	pfam_Glyco_trans_31	ENSG00000169255		0.393	B3GALNT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	B3GALNT1	HGNC	protein_coding	OTTHUMT00000353125.1	271	0.37	1	C	NM_033167		160804170	160804170	-1	no_errors	ENST00000320474	ensembl	human	known	69_37n	missense	215	12.24	30	SNP	0.717	G
C10orf12	26148	genome.wustl.edu	37	10	98743922	98743922	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr10:98743922G>C	ENST00000286067.2	+	1	2882	c.2775G>C	c.(2773-2775)ttG>ttC	p.L925F		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	925										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CTGAGCGCTTGAAAAAGCACT	0.473																																						dbGAP											0													59.0	65.0	63.0					10																	98743922		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.2775G>C	10.37:g.98743922G>C	ENSP00000286067:p.Leu925Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.L925F	ENST00000286067.2	37	c.2775	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429025	0.43122	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.16073	2.37	5.71	5.71	0.89125	.	0.406183	0.20748	N	0.086408	T	0.33440	0.0863	L	0.43152	1.355	0.42859	D	0.994105	D	0.89917	1.0	D	0.97110	1.0	T	0.00660	-1.1622	10	0.36615	T	0.2	-3.5181	14.0709	0.64858	0.0717:0.0:0.9283:0.0	.	925	Q8N655	CJ012_HUMAN	F	925;759	ENSP00000286067:L925F	ENSP00000286067:L925F	L	+	3	2	C10orf12	98733912	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	2.974000	0.49272	2.718000	0.92993	0.655000	0.94253	TTG	C10orf12	-	NULL	ENSG00000155640		0.473	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	232	0.00	0	G	NM_015652		98743922	98743922	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	171	16.99	35	SNP	1.000	C
CACNA1E	777	genome.wustl.edu	37	1	181726188	181726188	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:181726188G>T	ENST00000367573.2	+	30	4255	c.4255G>T	c.(4255-4257)Gtg>Ttg	p.V1419L	CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1419L|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V1026L|CACNA1E_ENST00000357570.5_Missense_Mutation_p.V1370L|CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1400L|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1400L|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V1351L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1419					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.V1419L(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CAATATCTTTGTGGCTCTCAT	0.478																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											157.0	155.0	155.0					1																	181726188		1942	4160	6102	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4255G>T	1.37:g.181726188G>T	ENSP00000356545:p.Val1419Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.V1419L	ENST00000367573.2	37	c.4255	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.490606	0.96339	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98329	-4.87;-4.87;-4.87;-4.87;-4.87;-4.87;-4.87	5.75	5.75	0.90469	Ion transport (1);	0.061993	0.64402	D	0.000003	D	0.98520	0.9506	L	0.49699	1.58	0.80722	D	1	P;D;D	0.67145	0.653;0.987;0.996	D;D;D	0.78314	0.917;0.991;0.987	D	0.99461	1.0943	10	0.52906	T	0.07	.	19.5549	0.95342	0.0:0.0:1.0:0.0	.	1400;1419;1419	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	L	1419;1400;1370;1351;1026;1400;1419	ENSP00000356542:V1419L;ENSP00000434814:V1400L;ENSP00000350183:V1370L;ENSP00000351101:V1351L;ENSP00000356539:V1026L;ENSP00000353222:V1400L;ENSP00000356545:V1419L	ENSP00000350183:V1370L	V	+	1	0	CACNA1E	179992811	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.731000	0.98807	2.716000	0.92895	0.655000	0.94253	GTG	CACNA1E	-	pfam_Ion_trans_dom	ENSG00000198216		0.478	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	132	0.75	1	G	NM_000721		181726188	181726188	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	197	10.86	24	SNP	1.000	T
GANC	2595	genome.wustl.edu	37	15	42646653	42646653	+	IGR	SNP	T	T	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr15:42646653T>A	ENST00000318010.8	+	0	4512				RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_Splice_Site	NM_198141.2	NP_937784.2	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C						carbohydrate metabolic process (GO:0005975)		alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)	Miglitol(DB00491)	CAGAAAAATGTAAGTATAATC	0.323																																						dbGAP											0													63.0	54.0	57.0					15																	42646653		1801	4060	5861	-	-	-	SO:0001628	intergenic_variant	0			AF545045	CCDS10084.1	15q15.2	2012-10-02			ENSG00000214013	ENSG00000214013	3.2.1.20		4139	protein-coding gene	gene with protein product		104180				6995030, 12370436	Standard	NM_198141		Approved		uc001zpi.3	Q8TET4	OTTHUMG00000130487		15.37:g.42646653T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LQ4|Q8IWZ0|Q8IZM4|Q8IZM5	Splice_Site	SNP	-	e1+2	ENST00000318010.8	37	c.48+2	CCDS10084.1	15	.	.	.	.	.	.	.	.	.	.	T	10.27	1.303898	0.23736	.	.	ENSG00000092529	ENST00000356316	.	.	.	1.43	-1.31	0.09230	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4589	0.11656	0.0:0.5524:0.0:0.4476	.	.	.	.	.	-1	.	.	.	+	.	.	CAPN3	40433945	0.040000	0.19996	0.000000	0.03702	0.606000	0.37113	-0.114000	0.10757	-0.376000	0.07943	0.240000	0.17902	.	CAPN3	-	-	ENSG00000092529		0.323	GANC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN3	HGNC	protein_coding	OTTHUMT00000252887.2	50	0.00	0	T	NM_198141		42646653	42646653	+1	no_errors	ENST00000356316	ensembl	human	known	69_37n	splice_site	45	13.46	7	SNP	0.000	A
CARD11	84433	genome.wustl.edu	37	7	2979469	2979469	+	Silent	SNP	G	G	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr7:2979469G>T	ENST00000396946.4	-	6	1181	c.778C>A	c.(778-780)Cgg>Agg	p.R260R		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	260					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.N252_K255del(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TTCTTGGGCCGATTTTCAATG	0.478			Mis		DLBCL																																	dbGAP		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)											168.0	158.0	161.0					7																	2979469		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.778C>A	7.37:g.2979469G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.R260	ENST00000396946.4	37	c.778	CCDS5336.2	7																																																																																			CARD11	-	NULL	ENSG00000198286		0.478	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	134	0.74	1	G	NM_032415		2979469	2979469	-1	no_errors	ENST00000396946	ensembl	human	known	69_37n	silent	118	19.73	29	SNP	1.000	T
CCDC28B	79140	genome.wustl.edu	37	1	32669526	32669526	+	Missense_Mutation	SNP	G	G	T	rs145792550		TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:32669526G>T	ENST00000373602.5	+	3	558	c.211G>T	c.(211-213)Ggc>Tgc	p.G71C	RP4-622L5.7_ENST00000421616.1_RNA|CCDC28B_ENST00000483009.1_3'UTR|RP4-622L5.7_ENST00000373604.4_RNA|CCDC28B_ENST00000421922.2_Missense_Mutation_p.G71C|IQCC_ENST00000291358.6_5'Flank|IQCC_ENST00000537469.1_5'Flank	NM_024296.3	NP_077272.2	Q9BUN5	CC28B_HUMAN	coiled-coil domain containing 28B	71					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.G71S(1)		large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AGGTGGAAGCGGCTCTGCAGG	0.602																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											46.0	43.0	44.0					1																	32669526		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022848	CCDS354.2, CCDS72749.1	1p36.11-p34.2	2008-02-05			ENSG00000160050	ENSG00000160050			28163	protein-coding gene	gene with protein product		610162				16327777	Standard	XM_006710892		Approved	MGC1203, RP4-622L5.5	uc001bul.1	Q9BUN5	OTTHUMG00000005738	ENST00000373602.5:c.211G>T	1.37:g.32669526G>T	ENSP00000362704:p.Gly71Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K789|Q8TBV8	Missense_Mutation	SNP	NULL	p.G71C	ENST00000373602.5	37	c.211	CCDS354.2	1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297397	0.40694	.	.	ENSG00000160050	ENST00000373602;ENST00000421922	T;T	0.51071	0.78;0.72	5.33	5.33	0.75918	.	0.171896	0.50627	D	0.000113	T	0.59810	0.2221	L	0.57536	1.79	0.34342	D	0.688916	P;D	0.89917	0.638;1.0	B;D	0.64042	0.282;0.921	T	0.71300	-0.4634	10	0.72032	D	0.01	-4.2985	9.8234	0.40896	0.0775:0.1428:0.7797:0.0	.	71;71	Q9BUN5;E9PM81	CC28B_HUMAN;.	C	71	ENSP00000362704:G71C;ENSP00000413017:G71C	ENSP00000362704:G71C	G	+	1	0	CCDC28B	32442113	0.992000	0.36948	0.956000	0.39512	0.545000	0.35147	2.075000	0.41538	2.662000	0.90505	0.561000	0.74099	GGC	CCDC28B	-	NULL	ENSG00000160050		0.602	CCDC28B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC28B	HGNC	protein_coding	OTTHUMT00000015723.4	45	0.00	0	G	NM_024296		32669526	32669526	+1	no_errors	ENST00000373602	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.989	T
CCDC53	51019	genome.wustl.edu	37	12	102437882	102437882	+	Splice_Site	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr12:102437882C>A	ENST00000240079.6	-	4	486		c.e4+1		CCDC53_ENST00000539515.1_Splice_Site|CCDC53_ENST00000545679.1_Splice_Site	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53							actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						AACTCACTTACCTGTGGTTGC	0.403																																						dbGAP											0													72.0	66.0	68.0					12																	102437882		1898	4146	6044	-	-	-	SO:0001630	splice_region_variant	0			AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.324+1G>T	12.37:g.102437882C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC74|Q53FF0|Q6IAI4|Q96QK0	Splice_Site	SNP	-	e4+1	ENST00000240079.6	37	c.324+1	CCDS44959.1	12	.	.	.	.	.	.	.	.	.	.	C	17.44	3.391182	0.62066	.	.	ENSG00000120860	ENST00000240079;ENST00000545679;ENST00000542923	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9463	0.71035	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC53	100962012	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	4.208000	0.58486	2.325000	0.78763	0.563000	0.77884	.	CCDC53	-	-	ENSG00000120860		0.403	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC53	HGNC	protein_coding	OTTHUMT00000398685.1	29	0.00	0	C	NM_016053	Intron	102437882	102437882	-1	no_errors	ENST00000240079	ensembl	human	known	69_37n	splice_site	22	21.43	6	SNP	1.000	A
CCT5	22948	genome.wustl.edu	37	5	10261724	10261724	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:10261724C>T	ENST00000280326.4	+	8	1466	c.1046C>T	c.(1045-1047)aCa>aTa	p.T349I	CCT5_ENST00000503026.1_Missense_Mutation_p.T328I|CCT5_ENST00000515390.1_Missense_Mutation_p.T294I|CTD-2256P15.4_ENST00000606194.1_RNA|CCT5_ENST00000515676.1_Missense_Mutation_p.T311I|CCT5_ENST00000506600.1_Missense_Mutation_p.T256I	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	349					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						TCAGAGCTCACAGCCGAGAAG	0.512																																						dbGAP											0													175.0	184.0	181.0					5																	10261724		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.1046C>T	5.37:g.10261724C>T	ENSP00000280326:p.Thr349Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_epsi	p.T349I	ENST00000280326.4	37	c.1046	CCDS3877.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.277252	0.95459	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.89918	0.6854	M	0.90198	3.095	0.80722	D	1	P;P;P;P;P;P	0.49253	0.518;0.667;0.921;0.603;0.603;0.603	P;P;P;P;P;P	0.54815	0.676;0.755;0.754;0.761;0.761;0.761	D	0.91900	0.5531	10	0.87932	D	0	-16.4875	18.2184	0.89894	0.0:1.0:0.0:0.0	.	256;294;198;347;349;349	B4DYD8;E7ENZ3;B4DZY9;Q9BU08;A8K2X8;P48643	.;.;.;.;.;TCPE_HUMAN	I	349;328;294;322;311;256	ENSP00000280326:T349I;ENSP00000423318:T328I;ENSP00000426923:T294I;ENSP00000427297:T311I;ENSP00000423052:T256I	ENSP00000280326:T349I	T	+	2	0	CCT5	10314724	1.000000	0.71417	0.866000	0.34008	0.964000	0.63967	7.299000	0.78831	2.528000	0.85240	0.558000	0.71614	ACA	CCT5	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_epsi	ENSG00000150753		0.512	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT5	HGNC	protein_coding	OTTHUMT00000253688.2	419	0.00	0	C			10261724	10261724	+1	no_errors	ENST00000280326	ensembl	human	known	69_37n	missense	452	13.08	68	SNP	1.000	T
CECR5	27440	genome.wustl.edu	37	22	17619469	17619469	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr22:17619469G>A	ENST00000336737.4	-	7	931	c.906C>T	c.(904-906)gcC>gcT	p.A302A	CECR5_ENST00000399852.3_Intron|CECR5_ENST00000155674.5_Silent_p.A272A	NM_033070.2	NP_149061.1	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	302						mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				GGATGGGGGCGGCCCAGCCCC	0.607																																						dbGAP											0													103.0	110.0	108.0					22																	17619469		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000336737.4:c.906C>T	22.37:g.17619469G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	Silent	SNP	superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_CECR5,tigrfam_HAD-SF_hydro_IIA	p.A302	ENST00000336737.4	37	c.906	CCDS33595.1	22																																																																																			CECR5	-	superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_CECR5,tigrfam_HAD-SF_hydro_IIA	ENSG00000069998		0.607	CECR5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CECR5	HGNC	protein_coding	OTTHUMT00000316100.1	228	0.00	0	G	NM_017829		17619469	17619469	-1	no_errors	ENST00000336737	ensembl	human	known	69_37n	silent	195	11.71	26	SNP	0.000	A
CELF2	10659	genome.wustl.edu	37	10	11299809	11299809	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr10:11299809T>C	ENST00000379261.4	+	5	583	c.491T>C	c.(490-492)cTc>cCc	p.L164P	CELF2_ENST00000427450.1_Missense_Mutation_p.L140P|CELF2_ENST00000416382.2_Missense_Mutation_p.L164P|CELF2_ENST00000354897.3_Missense_Mutation_p.L140P|CELF2_ENST00000450189.1_Missense_Mutation_p.L171P|CELF2_ENST00000354440.2_Missense_Mutation_p.L140P|CELF2_ENST00000417956.2_Missense_Mutation_p.L140P|CELF2_ENST00000315874.4_Missense_Mutation_p.L140P|CELF2_ENST00000537122.1_Missense_Mutation_p.L53P|CELF2_ENST00000542579.1_Missense_Mutation_p.L171P|CELF2_ENST00000608830.1_Missense_Mutation_p.L140P|CELF2_ENST00000399850.3_Missense_Mutation_p.L140P|CELF2_ENST00000609692.1_Missense_Mutation_p.L140P	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	164	Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						TGCCGGATCCTCCGGGGACCT	0.488																																						dbGAP											0													90.0	94.0	93.0					10																	11299809		2042	4218	6260	-	-	-	SO:0001583	missense	0			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.491T>C	10.37:g.11299809T>C	ENSP00000368563:p.Leu164Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.L171P	ENST00000379261.4	37	c.512	CCDS44354.1	10	.	.	.	.	.	.	.	.	.	.	T	24.8	4.574449	0.86542	.	.	ENSG00000048740	ENST00000379261;ENST00000416382;ENST00000450189;ENST00000542579;ENST00000399850;ENST00000417956;ENST00000315874;ENST00000354440;ENST00000354897;ENST00000427450;ENST00000537122	T;T;T;T;T;T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43	5.49	5.49	0.81192	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.068601	0.64402	D	0.000006	T	0.34337	0.0894	L	0.39147	1.195	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.999;1.0	T	0.06391	-1.0829	10	0.87932	D	0	-8.8824	15.5861	0.76485	0.0:0.0:0.0:1.0	.	148;164;159;171;159;164	B4DDE7;B4DS31;B2RA86;E9PC62;O95319-3;O95319	.;.;.;.;.;CELF2_HUMAN	P	164;164;171;171;140;140;140;140;140;140;53	ENSP00000368563:L164P;ENSP00000406451:L164P;ENSP00000389951:L171P;ENSP00000443926:L171P;ENSP00000382743:L140P;ENSP00000404834:L140P;ENSP00000315328:L140P;ENSP00000346426:L140P;ENSP00000388530:L140P;ENSP00000438884:L53P	ENSP00000315328:L140P	L	+	2	0	CELF2	11339815	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.943000	0.87716	2.067000	0.61834	0.533000	0.62120	CTC	CELF2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	ENSG00000048740		0.488	CELF2-201	KNOWN	basic|CCDS	protein_coding	CELF2	HGNC	protein_coding		67	0.00	0	T			11299809	11299809	+1	no_errors	ENST00000450189	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	1.000	C
CEP350	9857	genome.wustl.edu	37	1	179989393	179989393	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:179989393G>C	ENST00000367607.3	+	12	2902	c.2484G>C	c.(2482-2484)ttG>ttC	p.L828F		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	828					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTGAAGCCTTGAAAGCAACAG	0.443																																						dbGAP											0													135.0	141.0	139.0					1																	179989393		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2484G>C	1.37:g.179989393G>C	ENSP00000356579:p.Leu828Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.L828F	ENST00000367607.3	37	c.2484	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038558	0.55003	.	.	ENSG00000135837	ENST00000367607	T	0.15487	2.42	6.02	4.93	0.64822	.	0.000000	0.38897	N	0.001531	T	0.28234	0.0697	L	0.36672	1.1	0.46749	D	0.999181	D;D	0.89917	1.0;1.0	D;D	0.79784	0.989;0.993	T	0.00240	-1.1887	9	.	.	.	.	10.5015	0.44808	0.1819:0.0:0.8181:0.0	.	828;828	E7EU22;Q5VT06	.;CE350_HUMAN	F	828	ENSP00000356579:L828F	.	L	+	3	2	CEP350	178256016	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.384000	0.44362	2.865000	0.98341	0.655000	0.94253	TTG	CEP350	-	NULL	ENSG00000135837		0.443	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	396	0.00	0	G	NM_014810		179989393	179989393	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	339	11.86	46	SNP	1.000	C
CIT	11113	genome.wustl.edu	37	12	120295450	120295450	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr12:120295450G>A	ENST00000261833.7	-	4	343	c.291C>T	c.(289-291)ttC>ttT	p.F97F	CIT_ENST00000392521.2_Silent_p.F97F	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	97	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TTCTGACTTCGAAGTCCTTTG	0.458																																						dbGAP											0													171.0	172.0	172.0					12																	120295450		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.291C>T	12.37:g.120295450G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.F97	ENST00000261833.7	37	c.291	CCDS9192.1	12																																																																																			CIT	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Citron_Rho-interacting_kinase,pfscan_Prot_kinase_cat_dom	ENSG00000122966		0.458	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	HGNC	protein_coding	OTTHUMT00000259410.4	387	0.00	0	G	NM_007174		120295450	120295450	-1	no_errors	ENST00000261833	ensembl	human	known	69_37n	silent	289	19.05	68	SNP	1.000	A
COL12A1	1303	genome.wustl.edu	37	6	75833788	75833788	+	Silent	SNP	T	T	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr6:75833788T>C	ENST00000322507.8	-	42	7056	c.6747A>G	c.(6745-6747)acA>acG	p.T2249T	COL12A1_ENST00000483888.2_Silent_p.T2249T|COL12A1_ENST00000416123.2_Silent_p.T2249T|COL12A1_ENST00000345356.6_Silent_p.T1085T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2249	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ATCCACGCACTGTAATTTCTT	0.403																																						dbGAP											0													114.0	109.0	111.0					6																	75833788		1912	4121	6033	-	-	-	SO:0001819	synonymous_variant	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6747A>G	6.37:g.75833788T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.T2249	ENST00000322507.8	37	c.6747	CCDS43482.1	6																																																																																			COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.403	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	213	0.00	0	T	NM_004370		75833788	75833788	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	silent	163	14.21	27	SNP	0.944	C
COL12A1	1303	genome.wustl.edu	37	6	75893166	75893166	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr6:75893166G>A	ENST00000322507.8	-	10	1800	c.1491C>T	c.(1489-1491)ttC>ttT	p.F497F	COL12A1_ENST00000483888.2_Silent_p.F497F|COL12A1_ENST00000416123.2_Silent_p.F497F|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	497	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAACTTTGGTGAATTTTTTCA	0.353																																						dbGAP											0													88.0	86.0	87.0					6																	75893166		1831	4072	5903	-	-	-	SO:0001819	synonymous_variant	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1491C>T	6.37:g.75893166G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.F497	ENST00000322507.8	37	c.1491	CCDS43482.1	6																																																																																			COL12A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000111799		0.353	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	321	0.00	0	G	NM_004370		75893166	75893166	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	silent	192	19.33	46	SNP	0.992	A
COL23A1	91522	genome.wustl.edu	37	5	177695751	177695751	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:177695751G>A	ENST00000390654.3	-	7	832	c.475C>T	c.(475-477)Cca>Tca	p.P159S	COL23A1_ENST00000407622.1_Missense_Mutation_p.P123S	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	159	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TTCGGGCCTGGAAGTCCCTGG	0.572																																						dbGAP											0													66.0	68.0	67.0					5																	177695751		1945	4144	6089	-	-	-	SO:0001583	missense	0			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.475C>T	5.37:g.177695751G>A	ENSP00000375069:p.Pro159Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVR4|Q9NT93	Missense_Mutation	SNP	pfam_Collagen	p.P159S	ENST00000390654.3	37	c.475	CCDS4436.1	5	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008399	0.54361	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	D;D	0.94376	-3.26;-3.41	4.9	4.9	0.64082	.	0.383880	0.23660	N	0.045831	D	0.94149	0.8123	M	0.82433	2.59	0.44880	D	0.997899	P	0.39809	0.689	B	0.43916	0.436	D	0.93567	0.6900	10	0.38643	T	0.18	1.8811	13.9866	0.64339	0.0:0.0:1.0:0.0	.	159	Q86Y22	CONA1_HUMAN	S	159;123	ENSP00000375069:P159S;ENSP00000385092:P123S	ENSP00000375069:P159S	P	-	1	0	COL23A1	177628357	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.661000	0.68025	2.442000	0.82660	0.555000	0.69702	CCA	COL23A1	-	pfam_Collagen	ENSG00000050767		0.572	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	HGNC	protein_coding	OTTHUMT00000253475.1	34	0.00	0	G	NM_173465		177695751	177695751	-1	no_errors	ENST00000390654	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	1.000	A
COL5A2	1290	genome.wustl.edu	37	2	189950468	189950468	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:189950468C>T	ENST00000374866.3	-	10	995	c.721G>A	c.(721-723)Gaa>Aaa	p.E241K		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	241					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCACCAGGTTCACCAGGAGGT	0.383																																						dbGAP											0													89.0	84.0	86.0					2																	189950468		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.721G>A	2.37:g.189950468C>T	ENSP00000364000:p.Glu241Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.E241K	ENST00000374866.3	37	c.721	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.390774	0.95988	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.93488	-3.23	5.99	5.99	0.97316	.	0.000000	0.56097	D	0.000040	D	0.93327	0.7873	L	0.41236	1.265	0.53005	D	0.999963	P	0.42010	0.768	P	0.51582	0.674	D	0.91625	0.5314	9	.	.	.	.	17.3945	0.87441	0.0:1.0:0.0:0.0	.	241	P05997	CO5A2_HUMAN	K	241;58	ENSP00000364000:E241K	.	E	-	1	0	COL5A2	189658713	0.998000	0.40836	0.999000	0.59377	0.995000	0.86356	2.985000	0.49362	2.840000	0.97914	0.655000	0.94253	GAA	COL5A2	-	pfam_Collagen	ENSG00000204262		0.383	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	89	0.00	0	C	NM_000393		189950468	189950468	-1	no_errors	ENST00000374866	ensembl	human	known	69_37n	missense	86	24.56	28	SNP	1.000	T
CPA1	1357	genome.wustl.edu	37	7	130023271	130023271	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr7:130023271G>A	ENST00000011292.3	+	5	673	c.523G>A	c.(523-525)Gac>Aac	p.D175N	CPA1_ENST00000484324.1_Missense_Mutation_p.D87N	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	175					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					CATCTGGATCGACACGGGCAT	0.617																																						dbGAP											0													52.0	57.0	55.0					7																	130023271		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.523G>A	7.37:g.130023271G>A	ENSP00000011292:p.Asp175Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.D175N	ENST00000011292.3	37	c.523	CCDS5820.1	7	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931191	0.73327	.	.	ENSG00000091704	ENST00000481342;ENST00000011292;ENST00000476062;ENST00000484324	T;T;T;T	0.12147	2.71;2.71;2.71;2.71	5.58	5.58	0.84498	Peptidase M14, carboxypeptidase A (4);	0.134639	0.64402	D	0.000002	T	0.40145	0.1105	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	0.993;1.0	P;D	0.91635	0.713;0.999	T	0.06770	-1.0808	10	0.46703	T	0.11	.	18.572	0.91138	0.0:0.0:1.0:0.0	.	87;175	B4DDW9;P15085	.;CBPA1_HUMAN	N	87;175;87;87	ENSP00000420218:D87N;ENSP00000011292:D175N;ENSP00000419408:D87N;ENSP00000419497:D87N	ENSP00000011292:D175N	D	+	1	0	CPA1	129810507	1.000000	0.71417	0.709000	0.30452	0.117000	0.20001	9.476000	0.97823	2.641000	0.89580	0.650000	0.86243	GAC	CPA1	-	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	ENSG00000091704		0.617	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA1	HGNC	protein_coding	OTTHUMT00000349736.2	30	0.00	0	G	NM_001868		130023271	130023271	+1	no_errors	ENST00000011292	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	A
CPQ	10404	genome.wustl.edu	37	8	97797310	97797310	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:97797310G>C	ENST00000220763.5	+	2	395	c.185G>C	c.(184-186)aGa>aCa	p.R62T		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	62					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										GCCCAGAACAGATCCTATGAG	0.418																																						dbGAP											0													122.0	116.0	118.0					8																	97797310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.185G>C	8.37:g.97797310G>C	ENSP00000220763:p.Arg62Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.R62T	ENST00000220763.5	37	c.185	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188350	0.57909	.	.	ENSG00000104324	ENST00000220763;ENST00000519900;ENST00000517742;ENST00000519484;ENST00000521142	T;T	0.45276	0.9;0.94	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.36608	0.0973	L	0.39692	1.235	0.49582	D	0.9998	B;B	0.25955	0.138;0.126	B;B	0.21546	0.024;0.035	T	0.11616	-1.0580	10	0.20046	T	0.44	-7.4447	18.9127	0.92491	0.0:0.0:1.0:0.0	.	62;62	B5MDX4;Q9Y646	.;PGCP_HUMAN	T	62	ENSP00000220763:R62T;ENSP00000429146:R62T	ENSP00000220763:R62T	R	+	2	0	AC010859.1	97866486	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.141000	0.94612	2.482000	0.83794	0.563000	0.77884	AGA	CPQ	-	NULL	ENSG00000104324		0.418	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	430	0.00	0	G	NM_016134		97797310	97797310	+1	no_errors	ENST00000220763	ensembl	human	known	69_37n	missense	432	13.25	66	SNP	1.000	C
CPT2	1376	genome.wustl.edu	37	1	53676541	53676541	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:53676541C>T	ENST00000371486.3	+	4	1710	c.1195C>T	c.(1195-1197)Cca>Tca	p.P399S	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	399					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	TGCCGTCACTCCACAGAGCCA	0.502																																						dbGAP											0													44.0	45.0	45.0					1																	53676541		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.1195C>T	1.37:g.53676541C>T	ENSP00000360541:p.Pro399Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.P399S	ENST00000371486.3	37	c.1195	CCDS575.1	1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038164	0.54896	.	.	ENSG00000157184	ENST00000371486	D	0.88201	-2.35	5.99	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.92319	0.7563	L	0.57130	1.785	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.90235	0.4282	10	0.19590	T	0.45	-23.6542	15.0869	0.72162	0.0:0.9326:0.0:0.0674	.	399	P23786	CPT2_HUMAN	S	399	ENSP00000360541:P399S	ENSP00000360541:P399S	P	+	1	0	CPT2	53449129	1.000000	0.71417	0.231000	0.23993	0.558000	0.35554	4.706000	0.61845	1.540000	0.49301	0.655000	0.94253	CCA	CPT2	-	pfam_Carn_acyl_trans	ENSG00000157184		0.502	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT2	HGNC	protein_coding	OTTHUMT00000024757.1	104	0.00	0	C	NM_000098		53676541	53676541	+1	no_errors	ENST00000371486	ensembl	human	known	69_37n	missense	56	29.11	23	SNP	0.995	T
CSE1L	1434	genome.wustl.edu	37	20	47691354	47691356	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr20:47691354_47691356delGAG	ENST00000262982.2	+	11	1222_1224	c.1099_1101delGAG	c.(1099-1101)gagdel	p.E368del	CSE1L_ENST00000396192.3_In_Frame_Del_p.E312del|CSE1L_ENST00000542325.1_In_Frame_Del_p.E151del	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	368					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)	p.E367Q(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AGATAATTCTGAGGAGTACATAA	0.384																																						dbGAP											1	Substitution - Missense(1)	cervix(1)																																								-	-	-	SO:0001651	inframe_deletion	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1099_1101delGAG	20.37:g.47691357_47691359delGAG	ENSP00000262982:p.Glu368del	Somatic		WXS	Illumina GAIIx	Phase_IV	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	In_Frame_Del	DEL	pfam_CAS_CSE1_C,pfam_Exportin/Importin_Cse1-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.E368in_frame_del	ENST00000262982.2	37	c.1099_1101	CCDS13412.1	20																																																																																			CSE1L	-	pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold	ENSG00000124207		0.384	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	72	0.00	0	GAG	NM_001316		47691354	47691356	+1	no_errors	ENST00000262982	ensembl	human	known	69_37n	in_frame_del	52	20.00	13	DEL	1.000:1.000:1.000	-
CTLA4	1493	genome.wustl.edu	37	2	204737449	204737449	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:204737449C>G	ENST00000302823.3	+	4	743	c.586C>G	c.(586-588)Ctt>Gtt	p.L196V	CTLA4_ENST00000427473.2_Missense_Mutation_p.S122C|CTLA4_ENST00000487393.1_3'UTR|CTLA4_ENST00000295854.6_Missense_Mutation_p.S159C|CTLA4_ENST00000472206.1_Missense_Mutation_p.S64C	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	196					B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	AAGAAGCCCTCTTACAACAGG	0.368																																						dbGAP											0													89.0	89.0	89.0					2																	204737449		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.586C>G	2.37:g.204737449C>G	ENSP00000303939:p.Leu196Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,prints_CTLA4	p.L196V	ENST00000302823.3	37	c.586	CCDS2362.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.04|16.04	3.010225|3.010225	0.54361|0.54361	.|.	.|.	ENSG00000163599|ENSG00000163599	ENST00000302823|ENST00000295854;ENST00000472206;ENST00000427473	T|T;T	0.33216|0.47869	1.42|0.83;1.29	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.178665|.	0.38492|.	N|.	0.001666|.	T|T	0.57373|0.57373	0.2049|0.2049	N|N	0.24115|0.24115	0.695|0.695	0.32892|0.32892	D|D	0.511974|0.511974	D|D	0.89917|0.89917	1.0|1.0	D|D	0.83275|0.91635	0.996|0.999	T|T	0.66118|0.66118	-0.6003|-0.6003	10|9	0.23302|0.72032	T|D	0.38|0.01	-11.4686|-11.4686	17.0211|17.0211	0.86434|0.86434	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	196|64	P16410|P16410-4	CTLA4_HUMAN|.	V|C	196|159;64;122	ENSP00000303939:L196V|ENSP00000295854:S159C;ENSP00000417779:S64C	ENSP00000303939:L196V|ENSP00000295854:S159C	L|S	+|+	1|2	0|0	CTLA4|CTLA4	204445694|204445694	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.351000|0.351000	0.29236|0.29236	4.521000|4.521000	0.60532|0.60532	2.700000|2.700000	0.92200|0.92200	0.561000|0.561000	0.74099|0.74099	CTT|TCT	CTLA4	-	NULL	ENSG00000163599		0.368	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTLA4	HGNC	protein_coding	OTTHUMT00000256365.1	234	0.00	0	C	NM_005214		204737449	204737449	+1	no_errors	ENST00000302823	ensembl	human	known	69_37n	missense	275	11.82	37	SNP	1.000	G
CYP2S1	29785	genome.wustl.edu	37	19	41703830	41703830	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:41703830G>A	ENST00000310054.4	+	3	706	c.490G>A	c.(490-492)Gaa>Aaa	p.E164K	CYP2S1_ENST00000542619.1_Intron	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	164					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						CCAGGGGACAGAAGGTCAGCA	0.637																																						dbGAP											0													41.0	41.0	41.0					19																	41703830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.490G>A	19.37:g.41703830G>A	ENSP00000308032:p.Glu164Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZ66	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450_B	p.E164K	ENST00000310054.4	37	c.490	CCDS12573.1	19	.	.	.	.	.	.	.	.	.	.	G	4.763	0.141820	0.09083	.	.	ENSG00000167600	ENST00000301173;ENST00000310054	T	0.01252	5.1	4.87	-8.7	0.00851	.	0.617707	0.16010	N	0.233851	T	0.00608	0.0020	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45991	-0.9223	10	0.02654	T	1	.	8.9399	0.35722	0.2528:0.4862:0.261:0.0	.	164	Q96SQ9	CP2S1_HUMAN	K	164	ENSP00000308032:E164K	ENSP00000301173:E164K	E	+	1	0	CYP2S1	46395670	0.000000	0.05858	0.001000	0.08648	0.144000	0.21451	-0.935000	0.03950	-0.905000	0.03871	-0.350000	0.07774	GAA	CYP2S1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000167600		0.637	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2S1	HGNC	protein_coding	OTTHUMT00000463287.1	157	0.00	0	G			41703830	41703830	+1	no_errors	ENST00000310054	ensembl	human	known	69_37n	missense	113	12.40	16	SNP	0.000	A
DAB2IP	153090	genome.wustl.edu	37	9	124522313	124522313	+	Missense_Mutation	SNP	C	C	G	rs34727342	byFrequency	TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr9:124522313C>G	ENST00000408936.3	+	6	947	c.765C>G	c.(763-765)ttC>ttG	p.F255L	DAB2IP_ENST00000309989.1_Missense_Mutation_p.F131L|DAB2IP_ENST00000259371.2_Missense_Mutation_p.F227L			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	255	C2.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						ACAATGTTTTCTGGGGCGAGC	0.582																																						dbGAP											0													120.0	113.0	115.0					9																	124522313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.765C>G	9.37:g.124522313C>G	ENSP00000386183:p.Phe255Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.F255L	ENST00000408936.3	37	c.765		9	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430242	0.83776	.	.	ENSG00000136848	ENST00000394340;ENST00000436835;ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	4.82	2.92	0.33932	.	0.000000	0.85682	D	0.000000	T	0.81706	0.4879	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83021	-0.0167	10	0.87932	D	0	.	9.0008	0.36081	0.0:0.7553:0.0:0.2447	.	227	G3XA90	.	L	227;131;227;255;164;131	ENSP00000377872:F227L;ENSP00000409327:F131L;ENSP00000259371:F227L;ENSP00000386183:F255L;ENSP00000362887:F164L;ENSP00000310827:F131L	ENSP00000259371:F227L	F	+	3	2	DAB2IP	123562134	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.916000	0.28651	1.140000	0.42260	0.561000	0.74099	TTC	DAB2IP	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000136848		0.582	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1	75	0.00	0	C	NM_032552		124522313	124522313	+1	no_errors	ENST00000408936	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	G
DCBLD2	131566	genome.wustl.edu	37	3	98518306	98518306	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:98518306G>A	ENST00000326840.6	-	16	2600	c.2238C>T	c.(2236-2238)gaC>gaT	p.D746D	DCBLD2_ENST00000326857.9_Silent_p.D760D	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	746					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.D746D(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						ACACCAATTCGTCTGGGGCAG	0.502																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											203.0	203.0	203.0					3																	98518306		1957	4150	6107	-	-	-	SO:0001819	synonymous_variant	0				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.2238C>T	3.37:g.98518306G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_CUB,pfam_LCCL,superfamily_Galactose-bd-like,superfamily_CUB,superfamily_LCCL,smart_CUB,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.D760	ENST00000326840.6	37	c.2280	CCDS46878.1	3																																																																																			DCBLD2	-	NULL	ENSG00000057019		0.502	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCBLD2	HGNC	protein_coding	OTTHUMT00000324675.2	487	0.00	0	G	NM_080927		98518306	98518306	-1	no_errors	ENST00000326857	ensembl	human	known	69_37n	silent	445	17.90	97	SNP	0.035	A
DDR2	4921	genome.wustl.edu	37	1	162724596	162724596	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:162724596G>T	ENST00000367922.3	+	6	806	c.368G>T	c.(367-369)aGt>aTt	p.S123I	DDR2_ENST00000367921.3_Missense_Mutation_p.S123I	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	123	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ATCAATTACAGTCGGGATGGC	0.527																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													106.0	86.0	93.0					1																	162724596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.368G>T	1.37:g.162724596G>T	ENSP00000356899:p.Ser123Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S123I	ENST00000367922.3	37	c.368	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862363	0.91511	.	.	ENSG00000162733	ENST00000446985;ENST00000415555;ENST00000542391;ENST00000367922;ENST00000367921	D;D;D;D	0.99523	-6.08;-6.08;-6.08;-6.08	5.68	5.68	0.88126	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99764	0.9904	H	0.98426	4.23	0.44798	D	0.997807	D	0.89917	1.0	D	0.97110	1.0	D	0.99955	1.1612	9	0.25751	T	0.34	.	18.3487	0.90330	0.0:0.0:1.0:0.0	.	123	Q16832	DDR2_HUMAN	I	123	ENSP00000400309:S123I;ENSP00000391310:S123I;ENSP00000356899:S123I;ENSP00000356898:S123I	ENSP00000356898:S123I	S	+	2	0	DDR2	160991220	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.715000	0.84713	2.671000	0.90904	0.650000	0.86243	AGT	DDR2	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000162733		0.527	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	101	0.00	0	G	NM_006182		162724596	162724596	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	missense	135	21.97	38	SNP	1.000	T
DECR1	1666	genome.wustl.edu	37	8	91029554	91029554	+	Splice_Site	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:91029554G>C	ENST00000220764.2	+	2	360	c.272G>C	c.(271-273)cGg>cCg	p.R91P	DECR1_ENST00000522161.1_Splice_Site_p.R82P|DECR1_ENST00000519007.1_3'UTR	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	91					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			ATAGCCAGCCGGTAAGTCCCT	0.473																																						dbGAP											0													59.0	63.0	62.0					8																	91029554		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.272+1G>C	8.37:g.91029554G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6B8|Q2M304|Q93085	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	p.R91P	ENST00000220764.2	37	c.272	CCDS6250.1	8	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600517	0.87055	.	.	ENSG00000104325	ENST00000220764;ENST00000519410;ENST00000522161;ENST00000517761;ENST00000520227	T;D;T;D;D	0.92149	1.57;-2.98;1.57;-2.98;-2.98	5.39	4.5	0.54988	NAD(P)-binding domain (1);	0.047804	0.85682	N	0.000000	D	0.97483	0.9176	H	0.96996	3.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.98988	1.0807	10	0.87932	D	0	.	16.2898	0.82742	0.0:0.1328:0.8672:0.0	.	82;91	B7Z6B8;Q16698	.;DECR_HUMAN	P	91;69;82;82;41	ENSP00000220764:R91P;ENSP00000430561:R69P;ENSP00000429779:R82P;ENSP00000427936:R82P;ENSP00000429096:R41P	ENSP00000220764:R91P	R	+	2	0	DECR1	91098730	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	9.435000	0.97529	1.356000	0.45884	0.655000	0.94253	CGG	DECR1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000104325		0.473	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DECR1	HGNC	protein_coding	OTTHUMT00000375822.1	162	0.00	0	G		Missense_Mutation	91029554	91029554	+1	no_errors	ENST00000220764	ensembl	human	known	69_37n	missense	151	11.70	20	SNP	1.000	C
DNAH9	1770	genome.wustl.edu	37	17	11672535	11672535	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr17:11672535G>A	ENST00000262442.4	+	38	7509	c.7441G>A	c.(7441-7443)Ggc>Agc	p.G2481S	DNAH9_ENST00000454412.2_Missense_Mutation_p.G2481S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2481	AAA 3. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGGCACGGCTGGCACTGGCAA	0.607																																						dbGAP											0													74.0	69.0	71.0					17																	11672535		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.7441G>A	17.37:g.11672535G>A	ENSP00000262442:p.Gly2481Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.G2481S	ENST00000262442.4	37	c.7441	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701150	0.88924	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	D;D	0.90504	-2.68;-2.68	5.71	5.71	0.89125	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97688	0.9242	H	0.98866	4.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98858	1.0761	10	0.87932	D	0	.	19.8383	0.96670	0.0:0.0:1.0:0.0	.	2481	Q9NYC9	DYH9_HUMAN	S	2481;2481;1063	ENSP00000262442:G2481S;ENSP00000414874:G2481S	ENSP00000262442:G2481S	G	+	1	0	DNAH9	11613260	1.000000	0.71417	0.909000	0.35828	0.236000	0.25371	9.813000	0.99286	2.696000	0.92011	0.655000	0.94253	GGC	DNAH9	-	smart_AAA+_ATPase	ENSG00000007174		0.607	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	38	0.00	0	G	NM_001372		11672535	11672535	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	23	36.11	13	SNP	1.000	A
DNAJC27	51277	genome.wustl.edu	37	2	25180735	25180735	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:25180735C>A	ENST00000264711.2	-	4	538	c.349G>T	c.(349-351)Gag>Tag	p.E117*	DNAJC27_ENST00000534855.1_Nonsense_Mutation_p.E46*|DNAJC27_ENST00000468467.1_5'UTR	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	117					small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						GGTCCAAGCTCTTGCTTCATT	0.443																																						dbGAP											0													120.0	113.0	115.0					2																	25180735		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.349G>T	2.37:g.25180735C>A	ENSP00000264711:p.Glu117*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JV88|Q86Y24	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_DnaJ_N,pfam_ProtSyn_GTP-bd,superfamily_DnaJ_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_DnaJ_N,pfscan_DnaJ_N,prints_Small_GTPase,prints_Hsp_DnaJ,tigrfam_Small_GTP-bd_dom	p.E117*	ENST00000264711.2	37	c.349	CCDS1716.1	2	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545810	0.86022	.	.	ENSG00000115137	ENST00000264711;ENST00000534855	.	.	.	5.27	5.27	0.74061	.	0.042074	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-17.9359	17.6166	0.88069	0.0:1.0:0.0:0.0	.	.	.	.	X	117;46	.	ENSP00000264711:E117X	E	-	1	0	DNAJC27	25034239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.550000	0.82173	2.750000	0.94351	0.563000	0.77884	GAG	DNAJC27	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000115137		0.443	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC27	HGNC	protein_coding	OTTHUMT00000246855.3	175	0.00	0	C	NM_016544		25180735	25180735	-1	no_errors	ENST00000264711	ensembl	human	known	69_37n	nonsense	198	17.08	41	SNP	1.000	A
DOCK8	81704	genome.wustl.edu	37	9	434905	434905	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr9:434905C>G	ENST00000453981.1	+	39	5121	c.5009C>G	c.(5008-5010)gCg>gGg	p.A1670G	DOCK8_ENST00000382329.1_Missense_Mutation_p.A1137G|DOCK8_ENST00000469391.1_Missense_Mutation_p.A1570G|DOCK8_ENST00000432829.2_Missense_Mutation_p.A1602G			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1670	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CACGCCGCTGCGTTAGTGGCT	0.582																																						dbGAP											0													102.0	89.0	94.0					9																	434905		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.5009C>G	9.37:g.434905C>G	ENSP00000408464:p.Ala1670Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.A1670G	ENST00000453981.1	37	c.5009	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315018	0.60524	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.67345	2.1;-0.26;-0.26;-0.26	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.83709	0.5313	M	0.88181	2.935	0.80722	D	1	P;D;P	0.60160	0.956;0.987;0.956	P;D;P	0.64877	0.888;0.93;0.888	D	0.84770	0.0767	10	0.41790	T	0.15	.	18.5837	0.91181	0.0:1.0:0.0:0.0	.	1570;1137;1670	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	G	1670;1638;1602;1570;1137	ENSP00000408464:A1670G;ENSP00000394888:A1602G;ENSP00000419438:A1570G;ENSP00000371766:A1137G	ENSP00000287364:A1638G	A	+	2	0	DOCK8	424905	1.000000	0.71417	0.185000	0.23176	0.057000	0.15508	7.551000	0.82182	2.615000	0.88500	0.609000	0.83330	GCG	DOCK8	-	NULL	ENSG00000107099		0.582	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	61	0.00	0	C	XM_036307		434905	434905	+1	no_errors	ENST00000453981	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	1.000	G
DSCAM	1826	genome.wustl.edu	37	21	41710062	41710062	+	Silent	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr21:41710062G>C	ENST00000400454.1	-	8	2226	c.1749C>G	c.(1747-1749)ctC>ctG	p.L583L		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	583	Ig-like C2-type 6.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGCTGGTGGAGAGTTGTGGTT	0.502																																					Melanoma(134;970 1778 1785 21664 32388)	dbGAP											0													154.0	154.0	154.0					21																	41710062		2090	4220	6310	-	-	-	SO:0001819	synonymous_variant	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1749C>G	21.37:g.41710062G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O60468	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L583	ENST00000400454.1	37	c.1749	CCDS42929.1	21																																																																																			DSCAM	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000171587		0.502	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	145	0.00	0	G	NM_001389		41710062	41710062	-1	no_errors	ENST00000400454	ensembl	human	known	69_37n	silent	81	12.90	12	SNP	0.998	C
EBF2	64641	genome.wustl.edu	37	8	25715895	25715895	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:25715895A>C	ENST00000520164.1	-	14	2005	c.1468T>G	c.(1468-1470)Ttg>Gtg	p.L490V	EBF2_ENST00000535548.1_Missense_Mutation_p.L221V|EBF2_ENST00000408929.3_Missense_Mutation_p.L342V	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	490	Pro/Ser/Thr-rich.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GGAACACCCAAGTTGGCCATG	0.507																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	dbGAP											0													145.0	146.0	146.0					8																	25715895		1998	4164	6162	-	-	-	SO:0001583	missense	0			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1468T>G	8.37:g.25715895A>C	ENSP00000430241:p.Leu490Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	p.L490V	ENST00000520164.1	37	c.1468	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	A	13.75	2.329936	0.41297	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	T;T;T	0.51325	0.71;0.71;0.71	5.43	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.59649	0.2209	M	0.70595	2.14	0.51233	D	0.999916	D	0.59357	0.985	P	0.57244	0.816	T	0.58509	-0.7624	10	0.41790	T	0.15	-7.2081	11.3962	0.49843	0.1476:0.0:0.8524:0.0	.	490	Q9HAK2	COE2_HUMAN	V	490;342;221	ENSP00000430241:L490V;ENSP00000386178:L342V;ENSP00000437909:L221V	ENSP00000386178:L342V	L	-	1	2	EBF2	25771812	1.000000	0.71417	1.000000	0.80357	0.058000	0.15608	4.945000	0.63568	0.664000	0.31047	-0.797000	0.03246	TTG	EBF2	-	NULL	ENSG00000221818		0.507	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	HGNC	protein_coding	OTTHUMT00000375886.2	120	0.00	0	A	NM_022659		25715895	25715895	-1	no_errors	ENST00000520164	ensembl	human	known	69_37n	missense	88	14.56	15	SNP	1.000	C
ECT2	1894	genome.wustl.edu	37	3	172534566	172534566	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:172534566G>A	ENST00000392692.3	+	24	2770	c.2594G>A	c.(2593-2595)aGa>aAa	p.R865K	ECT2_ENST00000441497.2_Missense_Mutation_p.R834K|ECT2_ENST00000417960.1_Missense_Mutation_p.R833K|ECT2_ENST00000232458.5_Missense_Mutation_p.R834K|ECT2_ENST00000427830.1_Missense_Mutation_p.R834K|ECT2_ENST00000540509.1_Missense_Mutation_p.R865K	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	865					activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			GTGGAGGGAAGAAGTCCTTCC	0.388																																						dbGAP											0													120.0	117.0	118.0					3																	172534566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.2594G>A	3.37:g.172534566G>A	ENSP00000376457:p.Arg865Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	pfam_DH-domain,pfam_BRCT_dom,superfamily_DH-domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_DH-domain,pfscan_BRCT_dom,pfscan_DH-domain	p.R834K	ENST00000392692.3	37	c.2501	CCDS58860.1	3	.	.	.	.	.	.	.	.	.	.	G	0.469	-0.885142	0.02511	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	T;T;T;T;T;T	0.63913	-0.05;-0.07;-0.04;-0.05;-0.05;-0.07	5.58	4.71	0.59529	.	0.215797	0.53938	N	0.000050	T	0.54822	0.1882	M	0.61703	1.905	0.38125	D	0.937975	B;B;B;B;B	0.17465	0.0;0.001;0.002;0.022;0.001	B;B;B;B;B	0.16289	0.003;0.003;0.003;0.015;0.01	T	0.52465	-0.8572	10	0.13853	T	0.58	-15.8825	10.4033	0.44241	0.1583:0.0:0.8417:0.0	.	865;310;865;834;833	Q9H8V3;Q96SJ9;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.;.	K	834;865;834;833;834;865	ENSP00000232458:R834K;ENSP00000376457:R865K;ENSP00000401910:R834K;ENSP00000415876:R833K;ENSP00000412259:R834K;ENSP00000443160:R865K	ENSP00000232458:R834K	R	+	2	0	ECT2	174017260	1.000000	0.71417	1.000000	0.80357	0.157000	0.22087	3.606000	0.54095	1.366000	0.46076	-0.258000	0.10820	AGA	ECT2	-	NULL	ENSG00000114346		0.388	ECT2-003	NOVEL	basic|CCDS	protein_coding	ECT2	HGNC	protein_coding	OTTHUMT00000345994.2	91	0.00	0	G	NM_018098		172534566	172534566	+1	no_errors	ENST00000427830	ensembl	human	known	69_37n	missense	94	13.76	15	SNP	0.997	A
ERCC6	2074	genome.wustl.edu	37	10	50667204	50667204	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr10:50667204G>A	ENST00000355832.5	-	21	4217	c.4139C>T	c.(4138-4140)tCa>tTa	p.S1380L	RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000542458.1_Missense_Mutation_p.S750L|ERCC6_ENST00000465653.1_5'Flank	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	1380					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GGGCCCGGATGAAGAGTCTGC	0.468								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													104.0	115.0	112.0					10																	50667204		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.4139C>T	10.37:g.50667204G>A	ENSP00000348089:p.Ser1380Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S1380L	ENST00000355832.5	37	c.4139	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330154	0.41297	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	D;D	0.83914	-1.78;-1.51	5.87	1.51	0.23008	.	.	.	.	.	T	0.80999	0.4732	M	0.77616	2.38	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.08055	0.003;0.003	T	0.70332	-0.4901	9	0.52906	T	0.07	0.5034	8.3825	0.32479	0.1991:0.1104:0.6905:0.0	.	1380;757	Q03468;Q59FF6	ERCC6_HUMAN;.	L	1380;757;750	ENSP00000348089:S1380L;ENSP00000445134:S750L	ENSP00000348089:S1380L	S	-	2	0	ERCC6	50337210	0.083000	0.21467	0.000000	0.03702	0.186000	0.23388	1.523000	0.35932	0.081000	0.16988	0.655000	0.94253	TCA	ERCC6	-	NULL	ENSG00000225830		0.468	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	265	0.00	0	G	NM_000124		50667204	50667204	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	missense	209	12.18	29	SNP	0.000	A
EIF3A	8661	genome.wustl.edu	37	10	120797885	120797885	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr10:120797885G>A	ENST00000369144.3	-	20	3720	c.3593C>T	c.(3592-3594)tCa>tTa	p.S1198L	EIF3A_ENST00000541549.1_Missense_Mutation_p.S1164L	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ACGTTCTTCTGATGGCCTTGA	0.438																																						dbGAP											0													268.0	244.0	252.0					10																	120797885		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3593C>T	10.37:g.120797885G>A	ENSP00000358140:p.Ser1198Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.S1198L	ENST00000369144.3	37	c.3593	CCDS7608.1	10	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554680	0.27739	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.24908	1.83;1.83	5.73	4.82	0.62117	.	0.498297	0.14695	N	0.303900	T	0.17704	0.0425	N	0.22421	0.69	0.09310	N	1	P;B	0.38504	0.634;0.008	B;B	0.31101	0.124;0.011	T	0.07028	-1.0794	10	0.26408	T	0.33	2.1343	17.043	0.86494	0.0:0.1272:0.8727:0.0	.	1164;1198	F5H335;Q14152	.;EIF3A_HUMAN	L	1198;1164	ENSP00000358140:S1198L;ENSP00000438178:S1164L	ENSP00000358140:S1198L	S	-	2	0	EIF3A	120787875	0.487000	0.25988	0.143000	0.22291	0.950000	0.60333	3.661000	0.54503	1.541000	0.49316	0.555000	0.69702	TCA	EIF3A	-	NULL	ENSG00000107581		0.438	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000050634.1	189	0.00	0	G	NM_003750		120797885	120797885	-1	no_errors	ENST00000369144	ensembl	human	known	69_37n	missense	215	16.02	41	SNP	0.015	A
ERMAP	114625	genome.wustl.edu	37	1	43296636	43296636	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:43296636A>G	ENST00000372517.2	+	4	527	c.283A>G	c.(283-285)Aag>Gag	p.K95E	ERMAP_ENST00000328249.3_Missense_Mutation_p.K5E|ERMAP_ENST00000372514.3_Missense_Mutation_p.K95E|ERMAP_ENST00000487556.1_Intron	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	95	Ig-like V-type.					cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCCGGAATATAAGGGGAGGAC	0.572																																						dbGAP											0													125.0	108.0	113.0					1																	43296636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.283A>G	1.37:g.43296636A>G	ENSP00000361595:p.Lys95Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.K95E	ENST00000372517.2	37	c.283	CCDS475.1	1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.163839	0.38217	.	.	ENSG00000164010	ENST00000372517;ENST00000372514;ENST00000328249	T;T;T	0.68181	-0.31;-0.31;-0.31	4.83	2.45	0.29901	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.210963	0.32444	N	0.006087	T	0.63082	0.2481	L	0.60455	1.87	0.09310	N	1	P;B	0.48589	0.912;0.002	P;B	0.48982	0.597;0.007	T	0.53599	-0.8416	10	0.36615	T	0.2	.	4.6466	0.12575	0.7051:0.1947:0.1002:0.0	.	156;95	B7Z3C6;Q96PL5	.;ERMAP_HUMAN	E	95;95;5	ENSP00000361595:K95E;ENSP00000361592:K95E;ENSP00000332439:K5E	ENSP00000332439:K5E	K	+	1	0	ERMAP	43069223	0.587000	0.26791	0.108000	0.21378	0.726000	0.41606	0.762000	0.26503	0.331000	0.23511	0.377000	0.23210	AAG	ERMAP	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000164010		0.572	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMAP	HGNC	protein_coding	OTTHUMT00000020180.1	48	0.00	0	A	NM_018538		43296636	43296636	+1	no_errors	ENST00000372514	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.280	G
ETFB	2109	genome.wustl.edu	37	19	51848506	51848506	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:51848506C>T	ENST00000309244.4	-	6	818	c.727G>A	c.(727-729)Gag>Aag	p.E243K	CTD-2616J11.16_ENST00000601148.1_RNA|CTD-2616J11.9_ENST00000600974.1_RNA|CTD-2616J11.16_ENST00000594311.1_RNA|ETFB_ENST00000354232.4_Missense_Mutation_p.E334K	NM_001985.2	NP_001976.1	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide	243					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)			kidney(2)|large_intestine(1)|lung(3)	6		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)		ACCAGGTCCTCAGTGGTCTCC	0.567																																						dbGAP											0													114.0	110.0	111.0					19																	51848506		2203	4300	6503	-	-	-	SO:0001583	missense	0			X71129	CCDS12828.1, CCDS33085.1	19q13.3-q13.4	2008-02-05				ENSG00000105379			3482	protein-coding gene	gene with protein product		130410					Standard	NM_001014763		Approved		uc002pwg.3	P38117		ENST00000309244.4:c.727G>A	19.37:g.51848506C>T	ENSP00000311930:p.Glu243Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K766|B3KNY2|Q6IBH7|Q71RF6|Q9Y3S7	Missense_Mutation	SNP	pfam_ETF_a/b_N,smart_ETF_a/b_N	p.E334K	ENST00000309244.4	37	c.1000	CCDS12828.1	19	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295443	0.60086	.	.	ENSG00000105379	ENST00000309244;ENST00000354232	D;D	0.82619	-1.63;-1.63	4.2	4.2	0.49525	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.211314	0.38778	N	0.001570	T	0.67373	0.2886	N	0.22421	0.69	0.46096	D	0.998861	B;B	0.31611	0.051;0.331	B;B	0.28553	0.037;0.091	T	0.62595	-0.6821	10	0.11182	T	0.66	.	10.3777	0.44092	0.0:0.8013:0.1987:0.0	.	243;334	P38117;P38117-2	ETFB_HUMAN;.	K	243;334	ENSP00000311930:E243K;ENSP00000346173:E334K	ENSP00000311930:E243K	E	-	1	0	ETFB	56540318	1.000000	0.71417	0.963000	0.40424	0.809000	0.45718	5.011000	0.64011	2.626000	0.88956	0.655000	0.94253	GAG	ETFB	-	NULL	ENSG00000105379		0.567	ETFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFB	HGNC	protein_coding	OTTHUMT00000464273.1	107	0.00	0	C			51848506	51848506	-1	no_errors	ENST00000354232	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.988	T
EXO1	9156	genome.wustl.edu	37	1	242016718	242016718	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:242016718G>A	ENST00000366548.3	+	6	933	c.340G>A	c.(340-342)Gaa>Aaa	p.E114K	EXO1_ENST00000493702.1_3'UTR|EXO1_ENST00000518483.1_Missense_Mutation_p.E114K|EXO1_ENST00000348581.5_Missense_Mutation_p.E114K	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	114					DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			GAAAGTCTCGGAAGCTCGAGA	0.418								Editing and processing nucleases																														dbGAP											0													92.0	97.0	95.0					1																	242016718		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.340G>A	1.37:g.242016718G>A	ENSP00000355506:p.Glu114Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	pfam_XPG/RAD2_endonuclease,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.E114K	ENST00000366548.3	37	c.340	CCDS1620.1	1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.728987	0.69074	.	.	ENSG00000174371	ENST00000366548;ENST00000423131;ENST00000523590;ENST00000348581;ENST00000366547;ENST00000518483;ENST00000437497;ENST00000450748	T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.61048	0.2316	L	0.52364	1.645	0.80722	D	1	P;P;D	0.69078	0.948;0.932;0.997	P;P;P	0.58130	0.547;0.554;0.833	T	0.61992	-0.6948	10	0.66056	D	0.02	-0.5276	19.3525	0.94395	0.0:0.0:1.0:0.0	.	114;114;114	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	K	114;74;74;114;74;114;74;114	ENSP00000355506:E114K;ENSP00000415531:E74K;ENSP00000430082:E74K;ENSP00000311873:E114K;ENSP00000430251:E114K;ENSP00000412041:E74K;ENSP00000406652:E114K	ENSP00000311873:E114K	E	+	1	0	EXO1	240083341	1.000000	0.71417	0.996000	0.52242	0.120000	0.20174	9.360000	0.97119	2.744000	0.94065	0.655000	0.94253	GAA	EXO1	-	NULL	ENSG00000174371		0.418	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	120	0.00	0	G	NM_006027		242016718	242016718	+1	no_errors	ENST00000348581	ensembl	human	known	69_37n	missense	91	12.50	13	SNP	1.000	A
FAM222B	55731	genome.wustl.edu	37	17	27086257	27086258	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr17:27086257_27086258insG	ENST00000341217.5	-	3	934_935	c.719_720insC	c.(718-720)ccgfs	p.P240fs	FAM222B_ENST00000452648.3_Frame_Shift_Ins_p.P240fs|FAM222B_ENST00000582266.1_3'UTR|FAM222B_ENST00000581407.1_Frame_Shift_Ins_p.P240fs	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	240																	CGGTCACATTCGGGGGGGCATC	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.720dupC	17.37:g.27086264_27086264dupG	ENSP00000343115:p.Pro240fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H6F3|Q9NVJ4|Q9NXN6	Frame_Shift_Ins	INS	NULL	p.N241fs	ENST00000341217.5	37	c.720_719	CCDS45637.1	17																																																																																			FAM222B	-	NULL	ENSG00000173065		0.619	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM222B	HGNC	protein_coding	OTTHUMT00000446703.1	19	0.00	0	-	NM_018182		27086257	27086258	-1	no_errors	ENST00000341217	ensembl	human	known	69_37n	frame_shift_ins	23	14.81	4	INS	0.994:1.000	G
FANK1	92565	genome.wustl.edu	37	10	127697019	127697019	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr10:127697019G>C	ENST00000368693.1	+	8	853	c.749G>C	c.(748-750)aGa>aCa	p.R250T	FANK1_ENST00000368695.1_Missense_Mutation_p.R244T|FANK1_ENST00000477963.1_3'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	250						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				CCACTCATGAGAGTCTCTGCG	0.493																																						dbGAP											0													120.0	118.0	119.0					10																	127697019		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.749G>C	10.37:g.127697019G>C	ENSP00000357682:p.Arg250Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3,prints_Ankyrin_rpt	p.R250T	ENST00000368693.1	37	c.749	CCDS31309.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.86|15.86	2.956638|2.956638	0.53293|0.53293	.|.	.|.	ENSG00000203780|ENSG00000203780	ENST00000456942|ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692	.|T;T;T	.|0.64260	.|0.67;0.67;-0.09	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Ankyrin repeat-containing domain (4);	.|0.081014	.|0.48767	.|D	.|0.000165	T|T	0.71178|0.71178	0.3309|0.3309	L|L	0.28556|0.28556	0.865|0.865	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.996;0.996;1.0	.|D;D;D	.|0.87578	.|0.99;0.99;0.998	T|T	0.71994|0.71994	-0.4424|-0.4424	5|10	.|0.51188	.|T	.|0.08	-28.9213|-28.9213	18.4482|18.4482	0.90693|0.90693	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|276;250;250	.|Q8TC84-3;Q8TC84-2;Q8TC84	.|.;.;FANK1_HUMAN	Q|T	145|244;250;228;276	.|ENSP00000357684:R244T;ENSP00000357682:R250T;ENSP00000357680:R228T	.|ENSP00000357680:R228T	E|R	+|+	1|2	0|0	FANK1|FANK1	127687009|127687009	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.420000|0.420000	0.31355|0.31355	4.604000|4.604000	0.61112|0.61112	2.634000|2.634000	0.89283|0.89283	0.655000|0.655000	0.94253|0.94253	GAG|AGA	FANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000203780		0.493	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	HGNC	protein_coding		109	0.00	0	G	NM_145235		127697019	127697019	+1	no_errors	ENST00000368693	ensembl	human	known	69_37n	missense	94	19.66	23	SNP	0.999	C
FRG1B	284802	genome.wustl.edu	37	20	29612292	29612292	+	Intron	SNP	G	G	A	rs79612047		TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr20:29612292G>A	ENST00000278882.3	+	1	257				FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GAGAGGGGCAGCCTCCCGTGC	0.682																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+179G>A	20.37:g.29612292G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.682	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	12	0.00	0	G	NR_003579		29612292	29612292	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	2	66.67	4	SNP	0.001	A
GBE1	2632	genome.wustl.edu	37	3	81584455	81584455	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:81584455C>T	ENST00000429644.2	-	14	2468	c.1825G>A	c.(1825-1827)Gaa>Aaa	p.E609K	GBE1_ENST00000489715.1_Missense_Mutation_p.E568K	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	609					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		TTATTGCCTTCATGTTTTTCA	0.363									Glycogen Storage Disease, type IV																													dbGAP											0													111.0	107.0	108.0					3																	81584455		1938	4166	6104	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Andersen Disease, Brancher deficiency		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.1825G>A	3.37:g.81584455C>T	ENSP00000410833:p.Glu609Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWV3|Q96EN0	Missense_Mutation	SNP	pfam_A-amylase_b_C,pfam_Glyco_hydro_13_cat_dom,pfam_Glyco_hydro_13_N,superfamily_Glycoside_hydrolase_SF,superfamily_Ig_E-set,smart_Glyco_hydro_13_sub_cat_dom	p.E609K	ENST00000429644.2	37	c.1825	CCDS54612.1	3	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709390	0.68615	.	.	ENSG00000114480	ENST00000429644;ENST00000264326;ENST00000489715;ENST00000536832	T;T	0.77877	-1.13;-1.13	5.55	5.55	0.83447	Alpha-amylase, C-terminal all beta (1);Glycosyl hydrolase, family 13, all-beta (1);	0.113668	0.56097	D	0.000022	D	0.90796	0.7110	M	0.92691	3.335	0.46954	D	0.999269	D;P	0.56746	0.977;0.714	D;P	0.64410	0.925;0.755	D	0.92571	0.6066	10	0.87932	D	0	-28.9293	19.5081	0.95127	0.0:1.0:0.0:0.0	.	568;609	E9PGM4;Q04446	.;GLGB_HUMAN	K	609;660;568;372	ENSP00000410833:E609K;ENSP00000419638:E568K	ENSP00000264326:E660K	E	-	1	0	GBE1	81667145	1.000000	0.71417	0.998000	0.56505	0.272000	0.26649	5.603000	0.67619	2.616000	0.88540	0.591000	0.81541	GAA	GBE1	-	pfam_A-amylase_b_C	ENSG00000114480		0.363	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBE1	HGNC	protein_coding	OTTHUMT00000352760.2	70	0.00	0	C			81584455	81584455	-1	no_errors	ENST00000429644	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	1.000	T
GOLGA3	2802	genome.wustl.edu	37	12	133367817	133367817	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr12:133367817C>A	ENST00000450791.2	-	11	2715	c.2532G>T	c.(2530-2532)caG>caT	p.Q844H	GOLGA3_ENST00000204726.3_Missense_Mutation_p.Q844H|GOLGA3_ENST00000537452.1_Missense_Mutation_p.Q844H|GOLGA3_ENST00000545875.1_Missense_Mutation_p.Q844H|GOLGA3_ENST00000456883.2_Missense_Mutation_p.Q844H			Q08378	GOGA3_HUMAN	golgin A3	844					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GTTGGAGAAACTGTTCCTTTA	0.398																																						dbGAP											0													168.0	169.0	169.0					12																	133367817		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2532G>T	12.37:g.133367817C>A	ENSP00000410378:p.Gln844His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.Q844H	ENST00000450791.2	37	c.2532	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	16.23	3.063433	0.55432	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.41065	1.49;1.49;1.51;1.01;1.01	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.62889	0.2465	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.65957	-0.6042	10	0.72032	D	0.01	.	11.6942	0.51534	0.0:0.9186:0.0:0.0814	.	844;844;844	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	H	844	ENSP00000204726:Q844H;ENSP00000410378:Q844H;ENSP00000409303:Q844H;ENSP00000442143:Q844H;ENSP00000442603:Q844H	ENSP00000204726:Q844H	Q	-	3	2	GOLGA3	131877890	1.000000	0.71417	1.000000	0.80357	0.263000	0.26337	4.584000	0.60971	2.527000	0.85204	0.655000	0.94253	CAG	GOLGA3	-	superfamily_Prefoldin	ENSG00000090615		0.398	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	66	0.00	0	C	NM_005895		133367817	133367817	-1	no_errors	ENST00000204726	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	A
GOLGA4	2803	genome.wustl.edu	37	3	37357021	37357021	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:37357021G>A	ENST00000361924.2	+	11	1719	c.1345G>A	c.(1345-1347)Gag>Aag	p.E449K	GOLGA4_ENST00000356847.4_Missense_Mutation_p.E471K|GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000435830.2_3'UTR	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	449	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AAAAACAAGTGAGGAGGAACG	0.378																																						dbGAP											0													126.0	123.0	124.0					3																	37357021		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1345G>A	3.37:g.37357021G>A	ENSP00000354486:p.Glu449Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.E449K	ENST00000361924.2	37	c.1345	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.517985	0.96416	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.27256	1.69;1.68;1.69	5.82	4.94	0.65067	.	0.000000	0.35677	N	0.003058	T	0.53077	0.1774	M	0.79475	2.455	0.51767	D	0.999938	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.959;0.959;0.996	T	0.55854	-0.8075	10	0.41790	T	0.15	.	16.9292	0.86186	0.0:0.1279:0.8721:0.0	.	449;471;449	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	K	449;471;320	ENSP00000354486:E449K;ENSP00000349305:E471K;ENSP00000405842:E320K	ENSP00000349305:E471K	E	+	1	0	GOLGA4	37332025	1.000000	0.71417	0.963000	0.40424	0.998000	0.95712	7.371000	0.79600	1.452000	0.47756	0.650000	0.86243	GAG	GOLGA4	-	NULL	ENSG00000144674		0.378	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	183	0.00	0	G	NM_002078		37357021	37357021	+1	no_errors	ENST00000361924	ensembl	human	known	69_37n	missense	161	15.71	30	SNP	1.000	A
GTPBP1	9567	genome.wustl.edu	37	22	39111931	39111931	+	Silent	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr22:39111931G>C	ENST00000216044.5	+	3	557	c.324G>C	c.(322-324)ctG>ctC	p.L108L		NM_004286.4	NP_004277.2	O00178	GTPB1_HUMAN	GTP binding protein 1	108					GTP catabolic process (GO:0006184)|immune response (GO:0006955)|positive regulation of mRNA catabolic process (GO:0061014)|signal transduction (GO:0007165)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	18	Melanoma(58;0.04)					AGTATGGGCTGAGTGAAGCTG	0.597																																						dbGAP											0													130.0	115.0	120.0					22																	39111931		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U87964	CCDS13977.2	22q13.1	2008-07-01			ENSG00000100226	ENSG00000100226			4669	protein-coding gene	gene with protein product		602245				9070279	Standard	XM_005261857		Approved	GP-1, HSPC018	uc003awg.3	O00178	OTTHUMG00000151002	ENST00000216044.5:c.324G>C	22.37:g.39111931G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IC67	Nonstop_Mutation	SNP	NULL	p.*71S	ENST00000216044.5	37	c.212	CCDS13977.2	22																																																																																			GTPBP1	-	NULL	ENSG00000100226		0.597	GTPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP1	HGNC	protein_coding	OTTHUMT00000075532.1	152	0.00	0	G	NM_004286		39111931	39111931	+1	no_errors	ENST00000418601	ensembl	human	known	69_37n	nonstop	86	16.50	17	SNP	1.000	C
HGSNAT	138050	genome.wustl.edu	37	8	43047544	43047544	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:43047544G>A	ENST00000458501.2	+	13	1432	c.1432G>A	c.(1432-1434)Gat>Aat	p.D478N	HGSNAT_ENST00000379644.4_Missense_Mutation_p.D450N|HGSNAT_ENST00000297798.7_Missense_Mutation_p.D182N|HGSNAT_ENST00000521576.1_Missense_Mutation_p.D167N			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	478					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			GCTGGGAGACGATCACCTTTA	0.507																																						dbGAP											0													67.0	65.0	66.0					8																	43047544		1989	4163	6152	-	-	-	SO:0001583	missense	0				CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.1432G>A	8.37:g.43047544G>A	ENSP00000389524:p.Asp478Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2V0	Missense_Mutation	SNP	pfam_DUF1624	p.D478N	ENST00000458501.2	37	c.1432		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.736|0.736	-0.778301|-0.778301	0.02929|0.02929	.|.	.|.	ENSG00000165102|ENSG00000165102	ENST00000458501;ENST00000379644;ENST00000521576;ENST00000297798|ENST00000524016	D;D;D;D|.	0.87179|.	-2.22;-2.22;-2.22;-2.22|.	5.23|5.23	0.252|0.252	0.15545|0.15545	.|.	1.355260|.	0.04215|.	N|.	0.332446|.	T|T	0.08802|0.08802	0.0218|0.0218	N|N	0.01668|0.01668	-0.77|-0.77	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.04013|.	0.001|.	T|T	0.34527|0.34527	-0.9825|-0.9825	10|5	0.06757|.	T|.	0.87|.	-0.7127|-0.7127	5.2504|5.2504	0.15519|0.15519	0.3451:0.1496:0.5052:0.0|0.3451:0.1496:0.5052:0.0	.|.	478|.	Q68CP4|.	HGNAT_HUMAN|.	N|Q	478;450;167;182|151	ENSP00000389524:D478N;ENSP00000368965:D450N;ENSP00000429029:D167N;ENSP00000297798:D182N|.	ENSP00000297798:D182N|.	D|R	+|+	1|2	0|0	HGSNAT|HGSNAT	43166701|43166701	0.004000|0.004000	0.15560|0.15560	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	0.880000|0.880000	0.28159|0.28159	-0.025000|-0.025000	0.13918|0.13918	-0.151000|-0.151000	0.13558|0.13558	GAT|CGA	HGSNAT	-	NULL	ENSG00000165102		0.507	HGSNAT-202	KNOWN	basic	protein_coding	HGSNAT	HGNC	protein_coding		37	0.00	0	G	XM_372038		43047544	43047544	+1	no_errors	ENST00000458501	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.000	A
HIVEP1	3096	genome.wustl.edu	37	6	12121958	12121958	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr6:12121958G>A	ENST00000379388.2	+	4	2262	c.1930G>A	c.(1930-1932)Gcc>Acc	p.A644T		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	644					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AACGGTACACGCCCAGCTACA	0.507																																						dbGAP											0													61.0	59.0	59.0					6																	12121958		1984	4177	6161	-	-	-	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.1930G>A	6.37:g.12121958G>A	ENSP00000368698:p.Ala644Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A644T	ENST00000379388.2	37	c.1930	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865053	0.91511	.	.	ENSG00000095951	ENST00000379388	T	0.29397	1.57	5.92	5.92	0.95590	.	0.000000	0.36134	N	0.002771	T	0.54647	0.1871	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52487	-0.8569	9	.	.	.	-25.9666	20.3248	0.98698	0.0:0.0:1.0:0.0	.	644	P15822	ZEP1_HUMAN	T	644	ENSP00000368698:A644T	.	A	+	1	0	HIVEP1	12229944	1.000000	0.71417	0.986000	0.45419	0.357000	0.29423	9.869000	0.99810	2.818000	0.97014	0.655000	0.94253	GCC	HIVEP1	-	NULL	ENSG00000095951		0.507	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	151	0.66	1	G	NM_002114		12121958	12121958	+1	no_errors	ENST00000379388	ensembl	human	known	69_37n	missense	146	13.10	22	SNP	1.000	A
HPS3	84343	genome.wustl.edu	37	3	148871407	148871407	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:148871407G>C	ENST00000296051.2	+	7	1512	c.1372G>C	c.(1372-1374)Gag>Cag	p.E458Q	HPS3_ENST00000460120.1_Missense_Mutation_p.E293Q	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	458					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AGCCATTCCAGAGAGAAGACA	0.423									Hermansky-Pudlak syndrome																													dbGAP											0													93.0	97.0	96.0					3																	148871407		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1372G>C	3.37:g.148871407G>C	ENSP00000296051:p.Glu458Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps3_subunit	p.E458Q	ENST00000296051.2	37	c.1372	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	G	29.3	4.997280	0.93167	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.65364	-0.15;-0.15	5.97	5.97	0.96955	.	0.224070	0.44483	D	0.000444	T	0.75729	0.3889	M	0.61703	1.905	0.47183	D	0.999343	D;P	0.63046	0.992;0.934	P;P	0.58660	0.843;0.766	T	0.75698	-0.3227	10	0.62326	D	0.03	-11.9439	20.4136	0.99023	0.0:0.0:1.0:0.0	.	293;458	G5E9V4;Q969F9	.;HPS3_HUMAN	Q	458;293	ENSP00000296051:E458Q;ENSP00000418230:E293Q	ENSP00000296051:E458Q	E	+	1	0	HPS3	150354097	1.000000	0.71417	0.982000	0.44146	0.957000	0.61999	7.368000	0.79567	2.819000	0.97034	0.655000	0.94253	GAG	HPS3	-	pirsf_BLOC-2_complex_Hps3_subunit	ENSG00000163755		0.423	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	221	0.00	0	G	NM_032383		148871407	148871407	+1	no_errors	ENST00000296051	ensembl	human	known	69_37n	missense	160	14.44	27	SNP	1.000	C
HSD17B4	3295	genome.wustl.edu	37	5	118835111	118835111	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:118835111C>G	ENST00000256216.6	+	13	1205	c.1072C>G	c.(1072-1074)Cca>Gca	p.P358A	HSD17B4_ENST00000414835.2_Missense_Mutation_p.P218A|HSD17B4_ENST00000509514.1_Missense_Mutation_p.P96A|HSD17B4_ENST00000513628.1_Missense_Mutation_p.P221A|HSD17B4_ENST00000510025.1_Missense_Mutation_p.P334A|HSD17B4_ENST00000504811.1_Missense_Mutation_p.P383A|HSD17B4_ENST00000515320.1_Missense_Mutation_p.P340A	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	358	Enoyl-CoA hydratase 2.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		AATCAAGGATCCAAAAGATTT	0.423																																					Colon(35;490 801 34689 41394 43344)	dbGAP											0													103.0	108.0	106.0					5																	118835111		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1072C>G	5.37:g.118835111C>G	ENSP00000256216:p.Pro358Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.P358A	ENST00000256216.6	37	c.1072	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	C	19.37	3.814931	0.70912	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	T;T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.78855	0.4349	L	0.53249	1.67	0.80722	D	1	B;B;B;B;B	0.29162	0.235;0.031;0.031;0.084;0.014	B;B;B;B;B	0.28465	0.09;0.045;0.045;0.076;0.02	T	0.76024	-0.3110	10	0.42905	T	0.14	-10.9788	18.9677	0.92702	0.0:1.0:0.0:0.0	.	383;340;334;96;358	F5HE57;E9PB82;E7EWE5;E7EPL9;P51659	.;.;.;.;DHB4_HUMAN	A	358;340;334;383;218;221;96	ENSP00000256216:P358A;ENSP00000424613:P340A;ENSP00000424940:P334A;ENSP00000420914:P383A;ENSP00000411960:P218A;ENSP00000425993:P221A;ENSP00000426272:P96A	ENSP00000256216:P358A	P	+	1	0	HSD17B4	118863010	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	2.587000	0.46128	2.561000	0.86390	0.557000	0.71058	CCA	HSD17B4	-	NULL	ENSG00000133835		0.423	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	167	0.00	0	C	NM_000414		118835111	118835111	+1	no_errors	ENST00000256216	ensembl	human	known	69_37n	missense	149	14.37	25	SNP	1.000	G
IFI16	3428	genome.wustl.edu	37	1	159021525	159021525	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:159021525G>A	ENST00000295809.7	+	10	1977	c.1722G>A	c.(1720-1722)caG>caA	p.Q574Q	IFI16_ENST00000359709.3_Silent_p.Q518Q|IFI16_ENST00000368132.3_Silent_p.Q518Q|IFI16_ENST00000368131.4_Silent_p.Q518Q|IFI16_ENST00000340979.6_Silent_p.Q462Q|IFI16_ENST00000430894.2_Silent_p.Q522Q|IFI16_ENST00000448393.2_Silent_p.Q462Q			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	574	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.Q518Q(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					ACAGTGCCCAGAGTGACCTCA	0.418																																						dbGAP											1	Substitution - coding silent(1)	urinary_tract(1)											83.0	87.0	85.0					1																	159021525		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1722G>A	1.37:g.159021525G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.Q574	ENST00000295809.7	37	c.1722		1	.	.	.	.	.	.	.	.	.	.	G	1.627	-0.520016	0.04171	.	.	ENSG00000163565	ENST00000448393	.	.	.	4.85	-1.51	0.08664	.	.	.	.	.	T	0.08846	0.0219	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36311	-0.9753	4	.	.	.	.	4.6331	0.12511	0.3099:0.2883:0.4018:0.0	.	.	.	.	K	283	.	.	R	+	2	0	IFI16	157288149	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.656000	0.05342	-0.484000	0.06763	-1.301000	0.01330	AGA	IFI16	-	pfscan_HIN200/IF120x	ENSG00000163565		0.418	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	62	0.00	0	G	NM_005531		159021525	159021525	+1	no_errors	ENST00000295809	ensembl	human	known	69_37n	silent	108	13.60	17	SNP	0.000	A
ITSN2	50618	genome.wustl.edu	37	2	24469072	24469072	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:24469072delT	ENST00000355123.4	-	29	3946	c.3503delA	c.(3502-3504)gagfs	p.E1168fs	ITSN2_ENST00000361999.3_Frame_Shift_Del_p.E1141fs|ITSN2_ENST00000406921.3_Frame_Shift_Del_p.E1168fs	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1168	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCGTTGATCTCTCCTTGCCA	0.388																																						dbGAP											0													179.0	158.0	165.0					2																	24469072		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.3503delA	2.37:g.24469072delT	ENSP00000347244:p.Glu1168fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Frame_Shift_Del	DEL	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.E1168fs	ENST00000355123.4	37	c.3503	CCDS1710.2	2																																																																																			ITSN2	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	ENSG00000198399		0.388	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	181	0.00	0	T	NM_006277		24469072	24469072	-1	no_errors	ENST00000355123	ensembl	human	known	69_37n	frame_shift_del	153	12.36	22	DEL	1.000	-
JAK2	3717	genome.wustl.edu	37	9	5029900	5029900	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr9:5029900G>T	ENST00000381652.3	+	4	838	c.344G>T	c.(343-345)aGa>aTa	p.R115I	JAK2_ENST00000539801.1_Missense_Mutation_p.R115I	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	115	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GTACTCTACAGAATAAGGTAC	0.333		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																													dbGAP		Dom	yes		9	9p24	3717	Janus kinase 2		L	0													148.0	148.0	148.0					9																	5029900		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database			CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.344G>T	9.37:g.5029900G>T	ENSP00000371067:p.Arg115Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O14636|O75297	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak2,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R115I	ENST00000381652.3	37	c.344	CCDS6457.1	9	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000292	0.93227	.	.	ENSG00000096968	ENST00000539801;ENST00000381652	T;T	0.77877	-1.13;-1.13	6.01	6.01	0.97437	Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.88994	0.6589	M	0.85197	2.74	0.80722	D	1	D	0.64830	0.994	P	0.61070	0.883	D	0.89535	0.3788	10	0.87932	D	0	-21.807	20.5211	0.99222	0.0:0.0:1.0:0.0	.	115	O60674	JAK2_HUMAN	I	115	ENSP00000440387:R115I;ENSP00000371067:R115I	ENSP00000371067:R115I	R	+	2	0	JAK2	5019900	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.480000	0.81109	2.861000	0.98227	0.650000	0.86243	AGA	JAK2	-	smart_Band_41_domain,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain	ENSG00000096968		0.333	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK2	HGNC	protein_coding	OTTHUMT00000051609.1	272	0.00	0	G			5029900	5029900	+1	no_errors	ENST00000381652	ensembl	human	known	69_37n	missense	157	14.21	26	SNP	1.000	T
KLRC3	3823	genome.wustl.edu	37	12	10570980	10570980	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr12:10570980G>C	ENST00000396439.2	-	4	493	c.449C>G	c.(448-450)tCt>tGt	p.S150C	KLRC3_ENST00000381904.2_Missense_Mutation_p.S150C|KLRC3_ENST00000381903.2_Missense_Mutation_p.S150C|NKG2-E_ENST00000539033.1_Missense_Mutation_p.S150C	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	150	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						CAGACTAGAAGAGTTCTTTGA	0.343																																						dbGAP											0													146.0	154.0	151.0					12																	10570980		2203	4300	6503	-	-	-	SO:0001583	missense	0			L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.449C>G	12.37:g.10570980G>C	ENSP00000379716:p.Ser150Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WXA4|Q96RL0|Q9UP04	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S150C	ENST00000396439.2	37	c.449	CCDS41755.1	12	.	.	.	.	.	.	.	.	.	.	g	10.41	1.342681	0.24339	.	.	ENSG00000255641;ENSG00000205810;ENSG00000205810;ENSG00000205810	ENST00000539033;ENST00000396439;ENST00000381904;ENST00000381903	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	2.34	1.37	0.22104	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.293378	0.24996	N	0.033943	T	0.26048	0.0635	M	0.81179	2.53	0.09310	N	1	P;P;P	0.49696	0.91;0.702;0.927	P;B;P	0.48840	0.534;0.326;0.592	T	0.09707	-1.0662	10	0.87932	D	0	.	6.5909	0.22646	0.0:0.3258:0.6742:0.0	.	150;150;150	Q07444-2;F5H6K3;Q07444	.;.;NKG2E_HUMAN	C	150	ENSP00000437563:S150C;ENSP00000379716:S150C;ENSP00000371329:S150C;ENSP00000371328:S150C	ENSP00000371328:S150C	S	-	2	0	KLRC3;RP11-277P12.6	10462247	0.418000	0.25440	0.005000	0.12908	0.025000	0.11179	1.622000	0.36997	0.508000	0.28173	0.454000	0.30748	TCT	KLRC3	-	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000205810		0.343	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLRC3	HGNC	protein_coding	OTTHUMT00000393471.1	265	0.00	0	G	NM_002261		10570980	10570980	-1	no_errors	ENST00000381903	ensembl	human	known	69_37n	missense	205	25.63	71	SNP	0.006	C
KRTAP5-10	387273	genome.wustl.edu	37	11	71276947	71276947	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:71276947G>A	ENST00000398531.1	+	1	339	c.314G>A	c.(313-315)gGt>gAt	p.G105D	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	105	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GGGGGCTGTGGTTCTTGTGGG	0.682																																						dbGAP											0													39.0	59.0	52.0					11																	71276947		2163	4271	6434	-	-	-	SO:0001583	missense	0			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.314G>A	11.37:g.71276947G>A	ENSP00000381542:p.Gly105Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EHA4	Missense_Mutation	SNP	NULL	p.G105D	ENST00000398531.1	37	c.314	CCDS41684.1	11	.	.	.	.	.	.	.	.	.	.	.	0.018	-1.475007	0.01035	.	.	ENSG00000204572	ENST00000398531	T	0.01106	5.33	1.85	1.85	0.25348	.	.	.	.	.	T	0.04318	0.0119	M	0.65677	2.01	0.27174	N	0.960834	D	0.69078	0.997	D	0.63957	0.92	T	0.28522	-1.0041	9	0.49607	T	0.09	.	9.7284	0.40346	0.0:0.0:1.0:0.0	.	105	Q6L8G5	KR510_HUMAN	D	105	ENSP00000381542:G105D	ENSP00000381542:G105D	G	+	2	0	KRTAP5-10	70954595	0.003000	0.15002	0.112000	0.21494	0.007000	0.05969	0.216000	0.17585	1.383000	0.46405	0.184000	0.17185	GGT	KRTAP5-10	-	NULL	ENSG00000204572		0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP5-10	HGNC	protein_coding	OTTHUMT00000127968.2	93	0.00	0	G			71276947	71276947	+1	no_errors	ENST00000398531	ensembl	human	known	69_37n	missense	106	17.56	23	SNP	0.904	A
LAYN	143903	genome.wustl.edu	37	11	111414805	111414805	+	Silent	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:111414805G>C	ENST00000375615.3	+	3	452	c.267G>C	c.(265-267)ctG>ctC	p.L89L	LAYN_ENST00000436913.2_5'UTR|LAYN_ENST00000525126.1_Silent_p.L89L|LAYN_ENST00000375614.2_Silent_p.L81L|LAYN_ENST00000533265.1_Silent_p.L81L|LAYN_ENST00000528924.1_3'UTR	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	89	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	AACAGAAACTGATAGAAAAGT	0.483																																					Ovarian(17;551 586 12136 22082 22900)	dbGAP											0													110.0	98.0	102.0					11																	111414805		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.267G>C	11.37:g.111414805G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L89	ENST00000375615.3	37	c.267	CCDS58178.1	11																																																																																			LAYN	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000204381		0.483	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	HGNC	protein_coding	OTTHUMT00000391187.1	95	0.00	0	G	NM_178834		111414805	111414805	+1	no_errors	ENST00000375615	ensembl	human	known	69_37n	silent	46	25.81	16	SNP	0.992	C
LPO	4025	genome.wustl.edu	37	17	56329630	56329630	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr17:56329630A>T	ENST00000262290.4	+	8	1184	c.868A>T	c.(868-870)Aag>Tag	p.K290*	LPO_ENST00000582328.1_Nonsense_Mutation_p.K207*|LPO_ENST00000421678.2_Nonsense_Mutation_p.K207*|LPO_ENST00000543544.1_Nonsense_Mutation_p.K231*	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	290					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TCCACCCTACAAGTCCCTGGC	0.607																																						dbGAP											0													93.0	83.0	86.0					17																	56329630		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.868A>T	17.37:g.56329630A>T	ENSP00000262290:p.Lys290*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Nonsense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.K290*	ENST00000262290.4	37	c.868	CCDS32689.1	17	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650519	0.67472	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	.	.	.	5.3	-4.63	0.03359	.	1.034680	0.07596	N	0.922881	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-1.3616	12.5983	0.56483	0.2631:0.3176:0.4193:0.0	.	.	.	.	X	290;207;231;35	.	ENSP00000262290:K290X	K	+	1	0	LPO	53684629	0.000000	0.05858	0.007000	0.13788	0.039000	0.13416	-1.243000	0.02905	-0.302000	0.08869	-0.879000	0.02964	AAG	LPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000167419		0.607	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	88	0.00	0	A			56329630	56329630	+1	no_errors	ENST00000262290	ensembl	human	known	69_37n	nonsense	105	10.17	12	SNP	0.000	T
LRCH1	23143	genome.wustl.edu	37	13	47262104	47262104	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr13:47262104G>A	ENST00000389798.3	+	6	1137	c.940G>A	c.(940-942)Gtg>Atg	p.V314M	LRCH1_ENST00000389797.3_Missense_Mutation_p.V314M|LRCH1_ENST00000311191.6_Missense_Mutation_p.V314M	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	314								p.V314L(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		ACACCAGCACGTGGAAGATGG	0.448																																						dbGAP											2	Substitution - Missense(2)	lung(2)											78.0	76.0	77.0					13																	47262104		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.940G>A	13.37:g.47262104G>A	ENSP00000374448:p.Val314Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.V314M	ENST00000389798.3	37	c.940	CCDS31972.1	13	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607788	0.46527	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797;ENST00000463929;ENST00000478412	T;T;T	0.55760	0.5;0.55;0.51	5.53	2.86	0.33363	.	0.132235	0.50627	N	0.000110	T	0.42404	0.1201	L	0.57536	1.79	0.30961	N	0.723685	P;P;P;P	0.43885	0.725;0.532;0.82;0.725	B;B;B;B	0.32583	0.07;0.072;0.148;0.047	T	0.51403	-0.8710	10	0.59425	D	0.04	-3.5632	10.6985	0.45913	0.2025:0.0:0.7975:0.0	.	314;314;314;314	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	M	314;314;314;60;60	ENSP00000308493:V314M;ENSP00000374448:V314M;ENSP00000374447:V314M	ENSP00000308493:V314M	V	+	1	0	LRCH1	46160105	0.999000	0.42202	0.612000	0.29024	0.883000	0.51084	3.048000	0.49862	0.390000	0.25115	0.585000	0.79938	GTG	LRCH1	-	NULL	ENSG00000136141		0.448	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	HGNC	protein_coding	OTTHUMT00000044824.2	140	0.00	0	G	NM_015116		47262104	47262104	+1	no_errors	ENST00000389798	ensembl	human	known	69_37n	missense	95	13.64	15	SNP	0.630	A
LRRIQ4	344657	genome.wustl.edu	37	3	169539922	169539922	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:169539922G>C	ENST00000340806.6	+	1	213	c.213G>C	c.(211-213)aaG>aaC	p.K71N		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	71										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						AGCGTTTAAAGAACATCAGGG	0.502																																						dbGAP											0													89.0	92.0	91.0					3																	169539922		1905	4124	6029	-	-	-	SO:0001583	missense	0				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.213G>C	3.37:g.169539922G>C	ENSP00000342188:p.Lys71Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.K71N	ENST00000340806.6	37	c.213	CCDS46951.1	3	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635179	0.47049	.	.	ENSG00000188306	ENST00000340806	T	0.57752	0.38	5.58	2.59	0.31030	.	1.107440	0.06629	N	0.758909	T	0.49626	0.1568	L	0.42529	1.33	0.09310	N	1	P	0.39920	0.695	B	0.42593	0.392	T	0.38650	-0.9651	10	0.25751	T	0.34	.	10.9628	0.47395	0.0751:0.3597:0.5652:0.0	.	71	A6NIV6	LRIQ4_HUMAN	N	71	ENSP00000342188:K71N	ENSP00000342188:K71N	K	+	3	2	LRRIQ4	171022616	0.353000	0.24904	0.004000	0.12327	0.006000	0.05464	0.927000	0.28818	1.312000	0.45043	0.561000	0.74099	AAG	LRRIQ4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000188306		0.502	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	HGNC	protein_coding	OTTHUMT00000378698.1	159	0.00	0	G	NM_001080460		169539922	169539922	+1	no_errors	ENST00000340806	ensembl	human	known	69_37n	missense	191	15.86	36	SNP	0.005	C
MAK	4117	genome.wustl.edu	37	6	10802211	10802211	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr6:10802211G>C	ENST00000313243.2	-	8	1127	c.745C>G	c.(745-747)Ctt>Gtt	p.L249V	MAK_ENST00000474039.1_Missense_Mutation_p.L249V|RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000354489.2_Missense_Mutation_p.L249V|SYCP2L_ENST00000543878.1_Intron|MAK_ENST00000538030.1_Missense_Mutation_p.L249V|MAK_ENST00000536370.1_Missense_Mutation_p.L249V			P20794	MAK_HUMAN	male germ cell-associated kinase	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				TTGGGAATAAGAGTTTTTAAG	0.428																																						dbGAP											0													98.0	98.0	98.0					6																	10802211		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.745C>G	6.37:g.10802211G>C	ENSP00000313021:p.Leu249Val	Somatic		WXS	Illumina GAIIx	Phase_IV	F1T0K6|G1FL29|Q547D0|Q9NUH7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L249V	ENST00000313243.2	37	c.745	CCDS4516.1	6	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965868	0.74131	.	.	ENSG00000111837	ENST00000313243;ENST00000354489;ENST00000538030;ENST00000536370	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.72	4.84	0.62591	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.25865	0.0630	N	0.26092	0.79	0.80722	D	1	P	0.44816	0.844	P	0.47786	0.557	T	0.03193	-1.1062	10	0.29301	T	0.29	.	16.0614	0.80839	0.0:0.0:0.8649:0.1351	.	249	P20794	MAK_HUMAN	V	249	ENSP00000313021:L249V;ENSP00000346484:L249V;ENSP00000442250:L249V;ENSP00000442221:L249V	ENSP00000313021:L249V	L	-	1	0	MAK	10910197	1.000000	0.71417	0.856000	0.33681	0.973000	0.67179	7.507000	0.81676	1.389000	0.46526	0.655000	0.94253	CTT	MAK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000111837		0.428	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK	HGNC	protein_coding	OTTHUMT00000039841.1	129	0.00	0	G	NM_005906		10802211	10802211	-1	no_errors	ENST00000313243	ensembl	human	known	69_37n	missense	126	14.86	22	SNP	1.000	C
MAP3K15	389840	genome.wustl.edu	37	X	19410533	19410534	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chrX:19410533_19410534insT	ENST00000338883.4	-	17	2251_2252	c.2252_2253insA	c.(2251-2253)aagfs	p.K751fs	MAP3K15_ENST00000359173.3_Frame_Shift_Ins_p.K186fs|MAP3K15_ENST00000469203.2_Frame_Shift_Ins_p.K583fs|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	751	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					TGGTGTAAAACTTGATTGTCGG	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2253dupA	X.37:g.19410535_19410535dupT	ENSP00000345629:p.Lys751fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F752fs	ENST00000338883.4	37	c.2253_2252		X																																																																																			MAP3K15	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000180815		0.436	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	HGNC	protein_coding		401	0.00	0	-	NM_001001671		19410533	19410534	-1	no_errors	ENST00000338883	ensembl	human	known	69_37n	frame_shift_ins	217	13.20	33	INS	1.000:1.000	T
MAP7D2	256714	genome.wustl.edu	37	X	20030640	20030640	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chrX:20030640C>T	ENST00000379651.3	-	14	1794	c.1776G>A	c.(1774-1776)ttG>ttA	p.L592L	MAP7D2_ENST00000543767.1_Silent_p.L477L|MAP7D2_ENST00000379643.5_Silent_p.L633L|MAP7D2_ENST00000443379.3_Silent_p.L547L|MAP7D2_ENST00000452324.3_Silent_p.L540L	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	592					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						GGCAGGTGTTCAATCCATTGA	0.393																																						dbGAP											0													117.0	104.0	109.0					X																	20030640		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.1776G>A	X.37:g.20030640C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Silent	SNP	pfam_E-MAP-115	p.L633	ENST00000379651.3	37	c.1899	CCDS14195.1	X																																																																																			MAP7D2	-	NULL	ENSG00000184368		0.393	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP7D2	HGNC	protein_coding	OTTHUMT00000056001.1	434	0.00	0	C	NM_152780		20030640	20030640	-1	no_errors	ENST00000379643	ensembl	human	known	69_37n	silent	331	17.62	71	SNP	1.000	T
MIR548I2	100302277	genome.wustl.edu	37	4	9557896	9557896	+	RNA	SNP	T	T	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr4:9557896T>G	ENST00000408348.1	-	0	41					NR_031688.1				microRNA 548i-2																		ccgcaattacttttgcaccaa	0.408																																						dbGAP											0													68.0	68.0	68.0					4																	9557896		1568	3581	5149	-	-	-			0					4p16.1	2011-09-12		2008-12-18	ENSG00000221275	ENSG00000221275		"""ncRNAs / Micro RNAs"""	35353	non-coding RNA	RNA, micro				MIRN548I2			Standard	NR_031688		Approved	hsa-mir-548i-2	uc021xlt.1				4.37:g.9557896T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000408348.1	37	NULL		4																																																																																			MIR548I2	-	-	ENSG00000221275		0.408	MIR548I2-201	KNOWN	basic	miRNA	MIR548I2	HGNC	miRNA		280	0.00	0	T	NR_031688		9557896	9557896	-1	no_errors	ENST00000408348	ensembl	human	known	69_37n	rna	162	20.98	43	SNP	0.164	G
MPHOSPH8	54737	genome.wustl.edu	37	13	20233249	20233249	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr13:20233249C>A	ENST00000361479.5	+	6	1759	c.1691C>A	c.(1690-1692)gCa>gAa	p.A564E	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.A564E	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	564					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		GCAACAGATGCAATTCCAAGT	0.338																																						dbGAP											0													114.0	113.0	113.0					13																	20233249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.1691C>A	13.37:g.20233249C>A	ENSP00000355388:p.Ala564Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.A564E	ENST00000361479.5	37	c.1691	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	C	0.827	-0.746533	0.03065	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.70282	-0.47;-0.47	5.61	-0.489	0.12052	Ankyrin repeat-containing domain (2);	0.880184	0.10296	N	0.691737	T	0.55800	0.1943	L	0.47716	1.5	0.09310	N	1	B;B	0.24043	0.058;0.096	B;B	0.26202	0.016;0.067	T	0.42816	-0.9429	10	0.02654	T	1	.	7.6964	0.28598	0.0:0.4778:0.3342:0.1879	.	564;564	Q99549;Q99549-2	MPP8_HUMAN;.	E	564	ENSP00000414663:A564E;ENSP00000355388:A564E	ENSP00000355388:A564E	A	+	2	0	MPHOSPH8	19131249	0.654000	0.27367	0.000000	0.03702	0.954000	0.61252	2.088000	0.41663	-0.481000	0.06792	-0.264000	0.10439	GCA	MPHOSPH8	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000196199		0.338	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	211	0.00	0	C	NM_017520		20233249	20233249	+1	no_errors	ENST00000414242	ensembl	human	known	69_37n	missense	126	22.70	37	SNP	0.008	A
MST1L	11223	genome.wustl.edu	37	1	17085995	17085996	+	RNA	INS	-	-	C	rs528252461	byFrequency	TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:17085995_17085996insC	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCCAACGCCCGCCCCCCCGCCC	0.658													|||unknown(NO_COVERAGE)	266	0.053115	0.0492	0.0821	5008	,	,		18719	0.002		0.0408	False		,,,				2504	0.1033					dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086002_17086002dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Frame_Shift_Ins	INS	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.A301fs	ENST00000455405.2	37	c.902_901		1																																																																																			MST1P9	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.658	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	11	0.00	0	-	NM_001271733		17085995	17085996	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.980:0.979	C
MTTP	4547	genome.wustl.edu	37	4	100521863	100521863	+	Silent	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr4:100521863C>G	ENST00000265517.5	+	9	1412	c.1209C>G	c.(1207-1209)ccC>ccG	p.P403P	RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Silent_p.P403P|MTTP_ENST00000511045.1_Silent_p.P430P			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	403	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	CTTCTCATCCCAATGAAGAAC	0.363																																						dbGAP											0													60.0	62.0	62.0					4																	100521863		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1209C>G	4.37:g.100521863C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K428|Q08AM4|Q6P5T3	Silent	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.P403	ENST00000265517.5	37	c.1209	CCDS3651.1	4																																																																																			MTTP	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000138823		0.363	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	192	0.00	0	C			100521863	100521863	+1	no_errors	ENST00000265517	ensembl	human	known	69_37n	silent	95	26.36	34	SNP	0.465	G
MUC16	94025	genome.wustl.edu	37	19	9067623	9067623	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:9067623G>A	ENST00000397910.4	-	3	20026	c.19823C>T	c.(19822-19824)tCg>tTg	p.S6608L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6610	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGGACAGACGAATAAGATTC	0.443																																						dbGAP											0													214.0	193.0	200.0					19																	9067623		1929	4135	6064	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19823C>T	19.37:g.9067623G>A	ENSP00000381008:p.Ser6608Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S6608L	ENST00000397910.4	37	c.19823	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	6.161	0.397895	0.11696	.	.	ENSG00000181143	ENST00000397910	T	0.38560	1.13	2.36	2.36	0.29203	.	.	.	.	.	T	0.53061	0.1773	L	0.50333	1.59	.	.	.	D	0.89917	1.0	D	0.69824	0.966	T	0.63484	-0.6627	8	0.87932	D	0	.	8.4222	0.32707	0.0:0.0:1.0:0.0	.	6608	B5ME49	.	L	6608	ENSP00000381008:S6608L	ENSP00000381008:S6608L	S	-	2	0	MUC16	8928623	0.001000	0.12720	0.004000	0.12327	0.396000	0.30629	0.918000	0.28678	1.656000	0.50722	0.154000	0.16183	TCG	MUC16	-	NULL	ENSG00000181143		0.443	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	463	0.22	1	G	NM_024690		9067623	9067623	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	441	17.88	96	SNP	0.004	A
NCAM1	4684	genome.wustl.edu	37	11	113140962	113140962	+	Silent	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:113140962C>A	ENST00000316851.7	+	16	2154	c.2154C>A	c.(2152-2154)ctC>ctA	p.L718L	NCAM1-AS1_ENST00000533638.1_RNA|NCAM1-AS1_ENST00000526229.1_RNA|NCAM1_ENST00000397957.4_3'UTR	NM_001242607.1|NM_181351.4	NP_001229536.1|NP_851996.2	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	728					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TGGGCATCCTCATCGTCATCT	0.572																																						dbGAP											0													165.0	182.0	176.0					11																	113140962		2157	4267	6424	-	-	-	SO:0001819	synonymous_variant	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000316851.7:c.2154C>A	11.37:g.113140962C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,prints_Neural_cell_adh,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L718	ENST00000316851.7	37	c.2154		11																																																																																			NCAM1	-	NULL	ENSG00000149294		0.572	NCAM1-201	KNOWN	basic	protein_coding	NCAM1	HGNC	protein_coding		85	0.00	0	C	NM_000615		113140962	113140962	+1	no_errors	ENST00000316851	ensembl	human	known	69_37n	silent	60	25.00	20	SNP	1.000	A
NDUFA2	4695	genome.wustl.edu	37	5	140025248	140025248	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:140025248G>C	ENST00000252102.4	-	3	425	c.224C>G	c.(223-225)aCg>aGg	p.T75R	NDUFA2_ENST00000510680.1_Intron|MIR3655_ENST00000581765.1_RNA|IK_ENST00000417647.2_5'Flank|NDUFA2_ENST00000512088.1_3'UTR	NM_001185012.1|NM_002488.4	NP_001171941.1|NP_002479.1	O43678	NDUA2_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa	75					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGACATTCGTCTCTTGGCC	0.443																																						dbGAP											0													107.0	104.0	105.0					5																	140025248		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047185	CCDS4234.1, CCDS54911.1	5q31.2	2011-07-04	2002-08-29		ENSG00000131495	ENSG00000131495		"""Mitochondrial respiratory chain complex / Complex I"""	7685	protein-coding gene	gene with protein product	"""complex I B8 subunit"""	602137	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (8kD, B8)"""			9425316, 9763676	Standard	NM_002488		Approved	B8	uc003lgp.3	O43678	OTTHUMG00000129505	ENST00000252102.4:c.224C>G	5.37:g.140025248G>C	ENSP00000252102:p.Thr75Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RJD6|Q6IAY8	Missense_Mutation	SNP	pfam_Ribosome/NADH_DH,superfamily_Thioredoxin-like_fold,smart_Ribosome/NADH_DH,pirsf_NADH_Ub_cplx-1_asu_su-2	p.T75R	ENST00000252102.4	37	c.224	CCDS4234.1	5	.	.	.	.	.	.	.	.	.	.	G	6.862	0.528470	0.13127	.	.	ENSG00000131495	ENST00000252102	.	.	.	5.95	4.79	0.61399	Ribosomal protein/NADH dehydrogenase domain (2);Thioredoxin-like fold (1);	0.349419	0.36066	N	0.002815	T	0.37732	0.1014	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14172	-1.0482	8	0.15066	T	0.55	-6.3477	7.3375	0.26617	0.0:0.0698:0.2776:0.6527	.	75	O43678	NDUA2_HUMAN	R	75	.	ENSP00000252102:T75R	T	-	2	0	NDUFA2	140005432	0.996000	0.38824	1.000000	0.80357	0.571000	0.35966	0.654000	0.24918	1.076000	0.40961	-0.264000	0.10439	ACG	NDUFA2	-	pfam_Ribosome/NADH_DH,superfamily_Thioredoxin-like_fold,smart_Ribosome/NADH_DH,pirsf_NADH_Ub_cplx-1_asu_su-2	ENSG00000131495		0.443	NDUFA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA2	HGNC	protein_coding	OTTHUMT00000251679.2	135	0.00	0	G	NM_002488		140025248	140025248	-1	no_errors	ENST00000252102	ensembl	human	known	69_37n	missense	94	18.97	22	SNP	1.000	C
OR10V1	390201	genome.wustl.edu	37	11	59480614	59480614	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:59480614G>A	ENST00000307552.2	-	1	723	c.705C>T	c.(703-705)cgC>cgT	p.R235R	STX3_ENST00000300150.7_5'Flank	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						AGGCTTGCTGGCGCCCTTCTG	0.512																																						dbGAP											0													85.0	78.0	80.0					11																	59480614		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.705C>T	11.37:g.59480614G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFD9|Q96R50	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R235	ENST00000307552.2	37	c.705	CCDS31565.1	11																																																																																			OR10V1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172289		0.512	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10V1	HGNC	protein_coding	OTTHUMT00000394517.1	157	0.00	0	G	NM_001005324		59480614	59480614	-1	no_errors	ENST00000307552	ensembl	human	known	69_37n	silent	122	20.26	31	SNP	0.063	A
OR12D3	81797	genome.wustl.edu	37	6	29342398	29342398	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr6:29342398G>C	ENST00000396806.3	-	1	670	c.667C>G	c.(667-669)Ctt>Gtt	p.L223V	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						TTAAACAGAAGGAAGCCAATT	0.448																																						dbGAP											0													76.0	80.0	79.0					6																	29342398		1510	2709	4219	-	-	-	SO:0001583	missense	0				CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.667C>G	6.37:g.29342398G>C	ENSP00000380023:p.Leu223Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDZ1|Q5SQI8|Q6IF23	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L223V	ENST00000396806.3	37	c.667	CCDS4658.1	6	.	.	.	.	.	.	.	.	.	.	G	9.163	1.019175	0.19355	.	.	ENSG00000112462	ENST00000377143;ENST00000396806	T	0.45276	0.9	4.04	2.1	0.27182	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.17492	0.0420	N	0.11201	0.11	0.09310	N	1	P	0.46457	0.878	P	0.56612	0.802	T	0.17806	-1.0357	9	0.23302	T	0.38	-5.9809	8.1967	0.31400	0.0:0.1393:0.4342:0.4265	.	223	Q9UGF7	O12D3_HUMAN	V	223	ENSP00000380023:L223V	ENSP00000366348:L223V	L	-	1	0	OR12D3	29450377	0.000000	0.05858	0.033000	0.17914	0.356000	0.29392	-0.021000	0.12504	0.269000	0.21961	0.205000	0.17691	CTT	OR12D3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000112462		0.448	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D3	HGNC	protein_coding	OTTHUMT00000076056.3	315	0.00	0	G			29342398	29342398	-1	no_errors	ENST00000377143	ensembl	human	known	69_37n	missense	251	10.68	30	SNP	0.000	C
OR5M3	219482	genome.wustl.edu	37	11	56237193	56237193	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:56237193G>C	ENST00000312240.2	-	1	821	c.781C>G	c.(781-783)Ccc>Gcc	p.P261A		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TCCTCTGTGGGACGTCTGAGA	0.488																																						dbGAP											0													26.0	26.0	26.0					11																	56237193		2200	4292	6492	-	-	-	SO:0001583	missense	0			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.781C>G	11.37:g.56237193G>C	ENSP00000312208:p.Pro261Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P261A	ENST00000312240.2	37	c.781	CCDS31532.1	11	.	.	.	.	.	.	.	.	.	.	G	9.287	1.049732	0.19827	.	.	ENSG00000174937	ENST00000312240	T	0.00091	8.74	4.55	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42420	D	0.000718	T	0.00271	0.0008	N	0.20881	0.62	0.18873	N	0.999986	D	0.71674	0.998	D	0.71414	0.973	T	0.71361	-0.4616	10	0.51188	T	0.08	-14.5157	14.856	0.70338	0.0:0.0:1.0:0.0	.	261	Q8NGP4	OR5M3_HUMAN	A	261	ENSP00000312208:P261A	ENSP00000312208:P261A	P	-	1	0	OR5M3	55993769	0.043000	0.20138	0.401000	0.26359	0.039000	0.13416	2.090000	0.41682	2.341000	0.79615	0.549000	0.68633	CCC	OR5M3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174937		0.488	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	HGNC	protein_coding	OTTHUMT00000391639.1	152	0.00	0	G	NM_001004742		56237193	56237193	-1	no_errors	ENST00000312240	ensembl	human	known	69_37n	missense	113	15.04	20	SNP	0.422	C
OR6K2	81448	genome.wustl.edu	37	1	158670357	158670357	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:158670357A>G	ENST00000359610.2	-	1	129	c.86T>C	c.(85-87)gTt>gCt	p.V29A		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					GAGCAGTGGAACAAAGCAGAC	0.443																																						dbGAP											0													116.0	115.0	116.0					1																	158670357		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.86T>C	1.37:g.158670357A>G	ENSP00000352626:p.Val29Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH33|Q6IFR6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V29A	ENST00000359610.2	37	c.86	CCDS30902.1	1	.	.	.	.	.	.	.	.	.	.	A	5.690	0.311797	0.10789	.	.	ENSG00000196171	ENST00000359610	T	0.00460	7.27	4.47	4.47	0.54385	.	0.463445	0.15809	N	0.243565	T	0.00144	0.0004	N	0.22421	0.69	0.20975	N	0.999816	B	0.26120	0.142	B	0.26094	0.066	T	0.29518	-1.0009	10	0.24483	T	0.36	-6.7465	12.8974	0.58108	1.0:0.0:0.0:0.0	.	29	Q8NGY2	OR6K2_HUMAN	A	29	ENSP00000352626:V29A	ENSP00000352626:V29A	V	-	2	0	OR6K2	156936981	0.001000	0.12720	0.075000	0.20258	0.015000	0.08874	1.339000	0.33885	1.854000	0.53819	0.533000	0.62120	GTT	OR6K2	-	prints_7TM_GPCR_Rhodpsn	ENSG00000196171		0.443	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K2	HGNC	protein_coding	OTTHUMT00000059061.1	445	0.00	0	A	NM_001005279		158670357	158670357	-1	no_errors	ENST00000359610	ensembl	human	known	69_37n	missense	491	10.56	58	SNP	0.767	G
PAG1	55824	genome.wustl.edu	37	8	81897162	81897162	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:81897162A>G	ENST00000220597.4	-	7	1435	c.725T>C	c.(724-726)gTa>gCa	p.V242A		NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	242					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			GATACTCTCTACATTAACACT	0.483																																						dbGAP											0													142.0	140.0	140.0					8																	81897162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.725T>C	8.37:g.81897162A>G	ENSP00000220597:p.Val242Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	NULL	p.V242A	ENST00000220597.4	37	c.725	CCDS6227.1	8	.	.	.	.	.	.	.	.	.	.	A	6.997	0.554194	0.13374	.	.	ENSG00000076641	ENST00000220597	.	.	.	5.33	1.37	0.22104	.	0.540986	0.21978	N	0.066350	T	0.05456	0.0144	N	0.00138	-2.015	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42616	-0.9441	9	0.02654	T	1	-3.9036	9.9274	0.41501	0.2793:0.0:0.7207:0.0	.	242	Q9NWQ8	PAG1_HUMAN	A	242	.	ENSP00000220597:V242A	V	-	2	0	PAG1	82059717	0.027000	0.19231	0.001000	0.08648	0.580000	0.36256	1.204000	0.32296	0.053000	0.16036	-0.182000	0.12963	GTA	PAG1	-	NULL	ENSG00000076641		0.483	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	191	0.52	1	A	NM_018440		81897162	81897162	-1	no_errors	ENST00000220597	ensembl	human	known	69_37n	missense	132	51.82	142	SNP	0.015	G
PAM	5066	genome.wustl.edu	37	5	102237088	102237088	+	Missense_Mutation	SNP	G	G	C	rs34626583		TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:102237088G>C	ENST00000438793.3	+	3	709	c.239G>C	c.(238-240)cGa>cCa	p.R80P	PAM_ENST00000304400.7_Missense_Mutation_p.R80P|PAM_ENST00000348126.2_Missense_Mutation_p.R80P|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000455264.2_Missense_Mutation_p.R80P|PAM_ENST00000274392.9_Intron|PAM_ENST00000346918.2_Missense_Mutation_p.R80P	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	80	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	ATGTCTATGCGAATACCAGTG	0.348																																						dbGAP											0													133.0	133.0	133.0					5																	102237088		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.239G>C	5.37:g.102237088G>C	ENSP00000396493:p.Arg80Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Cu2_ascorb_mOase_N,superfamily_PHM/PNGase_F_dom,pfscan_NHL_repeat_subgr,prints_Pep_amidat_mOase	p.R80P	ENST00000438793.3	37	c.239	CCDS54885.1	5	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303728	0.23736	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000455264	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.39	4.52	0.55395	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.161669	0.53938	D	0.000053	T	0.16085	0.0387	N	0.05534	-0.03	0.80722	D	1	B;B;B;B;B	0.15141	0.001;0.002;0.002;0.003;0.012	B;B;B;B;B	0.12837	0.005;0.004;0.004;0.004;0.008	T	0.06285	-1.0835	10	0.26408	T	0.33	.	11.6645	0.51366	0.0686:0.1235:0.8079:0.0	.	80;80;80;80;80	P19021;P19021-4;P19021-3;P19021-5;P19021-2	AMD_HUMAN;.;.;.;.	P	80	ENSP00000396493:R80P;ENSP00000282992:R80P;ENSP00000314638:R80P;ENSP00000306100:R80P;ENSP00000403461:R80P	ENSP00000306100:R80P	R	+	2	0	PAM	102264987	0.973000	0.33851	0.986000	0.45419	0.794000	0.44872	1.574000	0.36482	1.397000	0.46682	0.650000	0.86243	CGA	PAM	-	pfam_Cu2_ascorb_mOase_N,superfamily_PHM/PNGase_F_dom	ENSG00000145730		0.348	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PAM	HGNC	protein_coding	OTTHUMT00000250640.2	35	0.00	0	G	NM_000919		102237088	102237088	+1	no_errors	ENST00000304400	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.987	C
PAPPA2	60676	genome.wustl.edu	37	1	176811528	176811528	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:176811528G>A	ENST00000367662.3	+	23	6478	c.5314G>A	c.(5314-5316)Gct>Act	p.A1772T		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1772					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CATTCCATTTGCTGCTGACTG	0.502																																						dbGAP											0													112.0	110.0	110.0					1																	176811528		1930	4148	6078	-	-	-	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5314G>A	1.37:g.176811528G>A	ENSP00000356634:p.Ala1772Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.A1772T	ENST00000367662.3	37	c.5314	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697141	0.88830	.	.	ENSG00000116183	ENST00000367662	T	0.01613	4.73	5.63	5.63	0.86233	.	0.067581	0.64402	D	0.000017	T	0.03305	0.0096	L	0.44542	1.39	0.80722	D	1	P	0.43938	0.822	P	0.44732	0.459	T	0.53165	-0.8477	10	0.59425	D	0.04	-14.1194	14.0381	0.64658	0.0:0.0:0.8485:0.1515	.	1772	Q9BXP8	PAPP2_HUMAN	T	1772	ENSP00000356634:A1772T	ENSP00000356634:A1772T	A	+	1	0	PAPPA2	175078151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.598000	0.74122	2.652000	0.90054	0.655000	0.94253	GCT	PAPPA2	-	NULL	ENSG00000116183		0.502	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	78	0.00	0	G			176811528	176811528	+1	no_errors	ENST00000367662	ensembl	human	known	69_37n	missense	62	24.71	21	SNP	1.000	A
PASD1	139135	genome.wustl.edu	37	X	150780207	150780207	+	Silent	SNP	T	T	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chrX:150780207T>A	ENST00000370357.4	+	4	434	c.189T>A	c.(187-189)tcT>tcA	p.S63S		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	63	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					ACATCTCTTCTCTTCTTGGAC	0.318																																						dbGAP											0													255.0	211.0	226.0					X																	150780207		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.189T>A	X.37:g.150780207T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	smart_PAS,pfscan_PAS	p.S63	ENST00000370357.4	37	c.189	CCDS35431.1	X																																																																																			PASD1	-	smart_PAS,pfscan_PAS	ENSG00000166049		0.318	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	252	0.00	0	T	NM_173493		150780207	150780207	+1	no_errors	ENST00000370357	ensembl	human	known	69_37n	silent	324	16.71	65	SNP	0.001	A
PDP1	54704	genome.wustl.edu	37	8	94934414	94934414	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:94934414C>T	ENST00000297598.4	+	2	396	c.127C>T	c.(127-129)Cga>Tga	p.R43*	PDP1_ENST00000517764.1_Nonsense_Mutation_p.R43*|PDP1_ENST00000520728.1_Nonsense_Mutation_p.R43*|PDP1_ENST00000396200.3_Nonsense_Mutation_p.R68*	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	43					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						TCCTCAGAGTCGACTGAGATA	0.488																																						dbGAP											0													173.0	150.0	158.0					8																	94934414		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.127C>T	8.37:g.94934414C>T	ENSP00000297598:p.Arg43*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX71|J3KPU0|Q5U5K1	Nonsense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.R68*	ENST00000297598.4	37	c.202	CCDS6259.1	8	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573657	0.65765	.	.	ENSG00000164951	ENST00000297598;ENST00000520614;ENST00000520728;ENST00000518107;ENST00000396200;ENST00000518573;ENST00000517764;ENST00000518827;ENST00000521144	.	.	.	6.16	6.16	0.99307	.	0.624246	0.16251	N	0.222687	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-6.0263	13.9788	0.64291	0.0:0.9314:0.0:0.0686	.	.	.	.	X	43;43;43;43;68;43;43;43;43	.	ENSP00000297598:R43X	R	+	1	2	PDP1	95003590	0.970000	0.33590	1.000000	0.80357	0.453000	0.32348	3.524000	0.53495	2.937000	0.99478	0.650000	0.86243	CGA	PDP1	-	NULL	ENSG00000164951		0.488	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDP1	HGNC	protein_coding	OTTHUMT00000378415.2	124	0.00	0	C	NM_018444		94934414	94934414	+1	no_errors	ENST00000396200	ensembl	human	known	69_37n	nonsense	111	17.16	23	SNP	0.678	T
JADE2	23338	genome.wustl.edu	37	5	133901983	133901983	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:133901983G>A	ENST00000402835.1	+	9	1402	c.1147G>A	c.(1147-1149)Gct>Act	p.A383T	PHF15_ENST00000361895.2_Missense_Mutation_p.A383T|PHF15_ENST00000282605.4_Missense_Mutation_p.A383T|PHF15_ENST00000395003.1_Missense_Mutation_p.A383T																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACCCAGCCAGGCTGGCGAGGA	0.617																																						dbGAP											0													61.0	61.0	61.0					5																	133901983		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000402835.1:c.1147G>A	5.37:g.133901983G>A	ENSP00000384671:p.Ala383Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.A399T	ENST00000402835.1	37	c.1195		5	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928913	0.34002	.	.	ENSG00000043143	ENST00000413974;ENST00000448712;ENST00000282605;ENST00000361895;ENST00000432594;ENST00000402835;ENST00000395003	T;T;T;T	0.45668	0.89;0.92;0.91;0.92	5.78	3.95	0.45737	.	1.213190	0.05235	N	0.511034	T	0.30262	0.0759	L	0.29908	0.895	0.27975	N	0.936245	B;B;B;B;B;B	0.20780	0.048;0.014;0.01;0.014;0.03;0.014	B;B;B;B;B;B	0.15052	0.009;0.009;0.005;0.009;0.012;0.009	T	0.29579	-1.0007	10	0.14252	T	0.57	.	5.9504	0.19242	0.1354:0.0:0.5855:0.2791	.	383;383;383;383;383;399	B4DFY8;Q9NQC1;B5MBX1;D3DQA3;Q9NQC1-3;B3KPL2	.;JADE2_HUMAN;.;.;.;.	T	383;399;383;383;383;383;383	ENSP00000282605:A383T;ENSP00000354425:A383T;ENSP00000384671:A383T;ENSP00000378451:A383T	ENSP00000282605:A383T	A	+	1	0	PHF15	133929882	0.947000	0.32204	0.947000	0.38551	0.970000	0.65996	2.560000	0.45896	0.738000	0.32606	0.591000	0.81541	GCT	PHF15	-	NULL	ENSG00000043143		0.617	PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	PHF15	HGNC	protein_coding	OTTHUMT00000318543.1	55	0.00	0	G			133901983	133901983	+1	no_errors	ENST00000448712	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	0.934	A
PHF8	23133	genome.wustl.edu	37	X	54069105	54069105	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chrX:54069105G>A	ENST00000357988.5	-	2	523	c.165C>T	c.(163-165)ttC>ttT	p.F55F	PHF8_ENST00000338946.6_Silent_p.F19F|PHF8_ENST00000338154.6_Silent_p.F19F|PHF8_ENST00000462182.1_5'UTR|PHF8_ENST00000322659.8_Silent_p.F19F	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	55					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						ACTCGATCATGAAGCGGGTCA	0.627											OREG0019805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													111.0	66.0	81.0					X																	54069105		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.165C>T	X.37:g.54069105G>A		Somatic	997	WXS	Illumina GAIIx	Phase_IV	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Silent	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.F55	ENST00000357988.5	37	c.165	CCDS55420.1	X																																																																																			PHF8	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000172943		0.627	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	HGNC	protein_coding	OTTHUMT00000056784.2	24	0.00	0	G	NM_015107		54069105	54069105	-1	no_errors	ENST00000357988	ensembl	human	known	69_37n	silent	16	30.43	7	SNP	1.000	A
PHLDB1	23187	genome.wustl.edu	37	11	118520793	118520793	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:118520793G>A	ENST00000361417.2	+	20	4077	c.3666G>A	c.(3664-3666)ctG>ctA	p.L1222L	PHLDB1_ENST00000524713.1_Silent_p.L365L|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000527898.1_Silent_p.L273L|PHLDB1_ENST00000356063.5_Silent_p.L1175L	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1222										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CACGACCCCTGACCCGCTACC	0.567																																						dbGAP											0													91.0	82.0	85.0					11																	118520793		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3666G>A	11.37:g.118520793G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Silent	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1222	ENST00000361417.2	37	c.3666	CCDS8401.1	11																																																																																			PHLDB1	-	NULL	ENSG00000019144		0.567	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	102	0.00	0	G	NM_015157		118520793	118520793	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	silent	85	13.27	13	SNP	1.000	A
PKD1L1	168507	genome.wustl.edu	37	7	47897385	47897385	+	Missense_Mutation	SNP	G	G	A	rs199549399	byFrequency	TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr7:47897385G>A	ENST00000289672.2	-	28	4458	c.4408C>T	c.(4408-4410)Cgg>Tgg	p.R1470W		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1470	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGAAGGGTCCGGAACTCCATC	0.507													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19683	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													62.0	62.0	62.0					7																	47897385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4408C>T	7.37:g.47897385G>A	ENSP00000289672:p.Arg1470Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.R1470W	ENST00000289672.2	37	c.4408	CCDS34633.1	7	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	7.725	0.697910	0.15106	.	.	ENSG00000158683	ENST00000289672	T	0.20200	2.09	5.12	1.22	0.21188	Egg jelly receptor, REJ-like (1);	2.072920	0.02028	N	0.048337	T	0.14830	0.0358	L	0.36672	1.1	0.20703	N	0.999861	P	0.36282	0.546	B	0.17433	0.018	T	0.20371	-1.0277	10	0.51188	T	0.08	-0.441	5.1224	0.14867	0.2467:0.0:0.6085:0.1448	.	1470	Q8TDX9	PK1L1_HUMAN	W	1470	ENSP00000289672:R1470W	ENSP00000289672:R1470W	R	-	1	2	PKD1L1	47863910	0.964000	0.33143	0.071000	0.20095	0.319000	0.28217	1.599000	0.36751	-0.051000	0.13334	0.563000	0.77884	CGG	PKD1L1	-	pfscan_REJ-like	ENSG00000158683		0.507	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	90	0.00	0	G	NM_138295		47897385	47897385	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	121	15.38	22	SNP	0.330	A
PLCB1	23236	genome.wustl.edu	37	20	8769095	8769095	+	Splice_Site	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr20:8769095G>C	ENST00000338037.6	+	28	3138		c.e28-1		PLCB1_ENST00000494924.1_Splice_Site|PLCB1_ENST00000378641.3_Splice_Site|PLCB1_ENST00000378637.2_Splice_Site	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)						activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TCTTTTTCCAGCTTATTCAAA	0.378																																						dbGAP											0													70.0	68.0	69.0					20																	8769095		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.3112-1G>C	20.37:g.8769095G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Splice_Site	SNP	-	e28-1	ENST00000338037.6	37	c.3112-1	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312603	0.81358	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2861	0.94072	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLCB1	8717095	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.420000	0.97426	2.640000	0.89533	0.563000	0.77884	.	PLCB1	-	-	ENSG00000182621		0.378	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	HGNC	protein_coding	OTTHUMT00000077938.3	77	0.00	0	G		Intron	8769095	8769095	+1	no_errors	ENST00000338037	ensembl	human	known	69_37n	splice_site	64	20.00	16	SNP	1.000	C
PLEKHA4	57664	genome.wustl.edu	37	19	49364911	49364911	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:49364911G>A	ENST00000263265.6	-	4	786	c.231C>T	c.(229-231)ttC>ttT	p.F77F	PLEKHA4_ENST00000355496.5_Silent_p.F77F|PLEKHA4_ENST00000596713.1_5'Flank	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	77	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		CGGAGAGGACGAACCAGCGGC	0.617																																						dbGAP											0													29.0	31.0	30.0					19																	49364911		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.231C>T	19.37:g.49364911G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4M8|Q8N658	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.F77	ENST00000263265.6	37	c.231	CCDS12737.1	19																																																																																			PLEKHA4	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105559		0.617	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA4	HGNC	protein_coding	OTTHUMT00000466216.1	59	0.00	0	G			49364911	49364911	-1	no_errors	ENST00000263265	ensembl	human	known	69_37n	silent	77	10.47	9	SNP	0.995	A
PRAME	23532	genome.wustl.edu	37	22	22892667	22892667	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr22:22892667G>C	ENST00000398741.1	-	5	740	c.434C>G	c.(433-435)tCa>tGa	p.S145*	PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000543184.1_Nonsense_Mutation_p.S145*|PRAME_ENST00000424204.2_Nonsense_Mutation_p.S129*|PRAME_ENST00000405655.3_Nonsense_Mutation_p.S145*|PRAME_ENST00000398743.2_Nonsense_Mutation_p.S145*|PRAME_ENST00000539862.1_Nonsense_Mutation_p.S129*|PRAME_ENST00000402697.1_Nonsense_Mutation_p.S145*	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	145					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		CTCTGGAAATGAGTACAGACT	0.502																																					Melanoma(73;1707 1838 15168 27201)	dbGAP											0													79.0	72.0	75.0					22																	22892667		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.434C>G	22.37:g.22892667G>C	ENSP00000381726:p.Ser145*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Y7|O43481|Q8IXN8	Nonsense_Mutation	SNP	NULL	p.S145*	ENST00000398741.1	37	c.434	CCDS13801.1	22	.	.	.	.	.	.	.	.	.	.	.	16.55	3.155721	0.57259	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204;ENST00000439106;ENST00000420709	.	.	.	2.92	1.87	0.25490	.	1.092320	0.07269	N	0.868738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	7.8368	0.29374	0.0:0.2579:0.7421:0.0	.	.	.	.	X	145;145;145;145;129;145;129;145;145	.	ENSP00000381726:S145X	S	-	2	0	PRAME	21222667	0.028000	0.19301	0.002000	0.10522	0.000000	0.00434	2.899000	0.48679	0.777000	0.33496	-0.175000	0.13238	TCA	PRAME	-	NULL	ENSG00000185686		0.502	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAME	HGNC	protein_coding	OTTHUMT00000321644.1	110	0.00	0	G	NM_206953		22892667	22892667	-1	no_errors	ENST00000398741	ensembl	human	known	69_37n	nonsense	109	10.66	13	SNP	0.002	C
PRKACA	5566	genome.wustl.edu	37	19	14213652	14213652	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:14213652G>A	ENST00000308677.4	-	4	508	c.312C>T	c.(310-312)ctC>ctT	p.L104L	PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000589994.1_Silent_p.L96L	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	104	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						CGAGTTTGACGAGGAACGGAA	0.597																																						dbGAP											0													205.0	166.0	179.0					19																	14213652		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.312C>T	19.37:g.14213652G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S59L	ENST00000308677.4	37	c.176	CCDS12304.1	19																																																																																			PRKACA	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000072062		0.597	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	HGNC	protein_coding	OTTHUMT00000459004.1	67	0.00	0	G	NM_002730		14213652	14213652	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000587372	ensembl	human	novel	69_37n	missense	46	38.67	29	SNP	0.985	A
PROSER1	80209	genome.wustl.edu	37	13	39587225	39587225	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr13:39587225G>T	ENST00000352251.3	-	11	2997	c.2164C>A	c.(2164-2166)Cca>Aca	p.P722T	PROSER1_ENST00000484434.3_Intron|PROSER1_ENST00000350125.3_Missense_Mutation_p.P700T	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	722	Ser-rich.																AATGACCCTGGGAGAGATACT	0.483																																						dbGAP											0													194.0	204.0	200.0					13																	39587225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.2164C>A	13.37:g.39587225G>T	ENSP00000332034:p.Pro722Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	NULL	p.P700T	ENST00000352251.3	37	c.2098	CCDS9368.2	13	.	.	.	.	.	.	.	.	.	.	G	7.476	0.647722	0.14516	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.33216	1.43;1.42	4.97	1.86	0.25419	.	.	.	.	.	T	0.18593	0.0446	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.14438	0.002;0.01	B;B	0.12156	0.007;0.007	T	0.28713	-1.0035	8	.	.	.	-4.1402	9.8769	0.41209	0.0:0.3785:0.4792:0.1423	.	700;722	A6NJ97;Q86XN7	.;PRSR1_HUMAN	T	722;700	ENSP00000332034:P722T;ENSP00000339123:P700T	.	P	-	1	0	PROSER1	38485225	0.618000	0.27051	0.003000	0.11579	0.429000	0.31625	0.967000	0.29344	0.075000	0.16796	0.561000	0.74099	CCA	PROSER1	-	NULL	ENSG00000120685		0.483	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	347	0.00	0	G	NM_025138		39587225	39587225	-1	no_errors	ENST00000350125	ensembl	human	known	69_37n	missense	198	18.52	45	SNP	0.069	T
QSER1	79832	genome.wustl.edu	37	11	32976846	32976846	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:32976846C>A	ENST00000399302.2	+	6	4453	c.4118C>A	c.(4117-4119)gCt>gAt	p.A1373D	QSER1_ENST00000527788.1_Missense_Mutation_p.A1134D	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1373										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TTACAGGAGGCTTTAAAAACA	0.328																																						dbGAP											0													40.0	36.0	37.0					11																	32976846		1800	4061	5861	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4118C>A	11.37:g.32976846C>A	ENSP00000382241:p.Ala1373Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.A1373D	ENST00000399302.2	37	c.4118	CCDS41631.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.556000|4.556000	0.86231|0.86231	.|.	.|.	ENSG00000060749|ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788|ENST00000524678	T;T|.	0.36699|.	1.57;1.24|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.000000|.	0.64402|.	D|.	0.000016|.	T|T	0.77870|0.77870	0.4195|0.4195	M|M	0.78801|0.78801	2.425|2.425	0.53688|0.53688	D|D	0.999978|0.999978	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.995;0.963|.	T|T	0.78550|0.78550	-0.2161|-0.2161	10|5	0.87932|.	D|.	0|.	.|.	18.653|18.653	0.91437|0.91437	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1134;1134;1373|.	C9JJ88;Q2KHR3-2;Q2KHR3|.	.;.;QSER1_HUMAN|.	D|I	1373;1134;1134|394	ENSP00000382241:A1373D;ENSP00000432766:A1134D|.	ENSP00000078652:A1134D|.	A|L	+|+	2|1	0|0	QSER1|QSER1	32933422|32933422	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	7.189000|7.189000	0.77747|0.77747	2.400000|2.400000	0.81607|0.81607	0.313000|0.313000	0.20887|0.20887	GCT|CTT	QSER1	-	NULL	ENSG00000060749		0.328	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	53	0.00	0	C	NM_024774		32976846	32976846	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	1.000	A
RAB11FIP4	84440	genome.wustl.edu	37	17	29858682	29858682	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr17:29858682C>T	ENST00000325874.8	+	15	2075	c.1846C>T	c.(1846-1848)Cag>Tag	p.Q616*	RAB11FIP4_ENST00000394744.2_Nonsense_Mutation_p.Q514*	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	616	FIP-RBD. {ECO:0000255|PROSITE- ProRule:PRU00844}.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				CCGGCTGAGGCAGTACATGGA	0.562																																						dbGAP											0													154.0	137.0	142.0					17																	29858682		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.1846C>T	17.37:g.29858682C>T	ENSP00000312837:p.Gln616*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LI1|Q8N829|Q8NDT7|Q969D8	Nonsense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfscan_EF_HAND_2	p.Q616*	ENST00000325874.8	37	c.1846	CCDS11267.1	17	.	.	.	.	.	.	.	.	.	.	C	40	8.461369	0.98822	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-43.2567	17.5764	0.87950	0.0:1.0:0.0:0.0	.	.	.	.	X	616	.	.	Q	+	1	0	RAB11FIP4	26882802	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.717000	0.84732	2.746000	0.94184	0.655000	0.94253	CAG	RAB11FIP4	-	pfam_Rab-bd_FIP-RBD	ENSG00000131242		0.562	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP4	HGNC	protein_coding	OTTHUMT00000256195.2	48	0.00	0	C	NM_032932		29858682	29858682	+1	no_errors	ENST00000325874	ensembl	human	known	69_37n	nonsense	18	21.74	5	SNP	1.000	T
RAI2	10742	genome.wustl.edu	37	X	17818739	17818739	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chrX:17818739T>G	ENST00000545871.1	-	3	1852	c.1392A>C	c.(1390-1392)aaA>aaC	p.K464N	RAI2_ENST00000331511.1_Missense_Mutation_p.K464N|RAI2_ENST00000451717.1_Missense_Mutation_p.K464N|RAI2_ENST00000415486.3_Missense_Mutation_p.K414N|RAI2_ENST00000360011.1_Missense_Mutation_p.K464N	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	464					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					AGGAGAAGTTTTTGGTGGACA	0.527																																						dbGAP											0													197.0	203.0	201.0					X																	17818739		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.1392A>C	X.37:g.17818739T>G	ENSP00000444210:p.Lys464Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	NULL	p.K464N	ENST00000545871.1	37	c.1392	CCDS14183.1	X	.	.	.	.	.	.	.	.	.	.	t	14.37	2.514222	0.44763	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.50277	0.77;0.77;0.77;0.77;0.75	5.12	1.44	0.22558	.	0.000000	0.85682	D	0.000000	T	0.53481	0.1799	L	0.36672	1.1	0.45172	D	0.998184	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.50276	-0.8847	10	0.87932	D	0	-15.8108	8.5618	0.33516	0.0:0.2256:0.0:0.7744	.	414;464	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	N	464;464;464;464;414	ENSP00000333456:K464N;ENSP00000353106:K464N;ENSP00000444210:K464N;ENSP00000401323:K464N;ENSP00000392578:K414N	ENSP00000333456:K464N	K	-	3	2	RAI2	17728660	0.936000	0.31750	0.999000	0.59377	0.992000	0.81027	-0.023000	0.12456	0.001000	0.14605	-0.313000	0.08912	AAA	RAI2	-	NULL	ENSG00000131831		0.527	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI2	HGNC	protein_coding	OTTHUMT00000055937.1	558	0.18	1	T	NM_021785		17818739	17818739	-1	no_errors	ENST00000331511	ensembl	human	known	69_37n	missense	315	16.67	63	SNP	1.000	G
RALBP1	10928	genome.wustl.edu	37	18	9533749	9533749	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr18:9533749C>T	ENST00000019317.4	+	9	1849	c.1626C>T	c.(1624-1626)agC>agT	p.S542S	RALBP1_ENST00000383432.3_Silent_p.S542S			Q15311	RBP1_HUMAN	ralA binding protein 1	542					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	CCTCCGAGAGCGAGAGCGAGA	0.532																																						dbGAP											0													86.0	84.0	85.0					18																	9533749		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1626C>T	18.37:g.9533749C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUI0	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S542	ENST00000019317.4	37	c.1626	CCDS11845.1	18																																																																																			RALBP1	-	NULL	ENSG00000017797		0.532	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALBP1	HGNC	protein_coding	OTTHUMT00000254479.1	186	0.00	0	C	NM_006788		9533749	9533749	+1	no_errors	ENST00000019317	ensembl	human	known	69_37n	silent	186	12.68	27	SNP	0.378	T
RCBTB1	55213	genome.wustl.edu	37	13	50141327	50141327	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr13:50141327G>A	ENST00000378302.2	-	3	349	c.89C>T	c.(88-90)tCa>tTa	p.S30L	RCBTB1_ENST00000258646.3_Missense_Mutation_p.S30L|RCBTB1_ENST00000546015.1_Missense_Mutation_p.S30L	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	30					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		TTCACTGGCTGAGGTGCCGAA	0.478																																						dbGAP											0													123.0	109.0	113.0					13																	50141327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.89C>T	13.37:g.50141327G>A	ENSP00000367552:p.Ser30Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IY29|Q969U9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_Reg_chr_condens,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.S30L	ENST00000378302.2	37	c.89	CCDS9418.1	13	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835278	0.71373	.	.	ENSG00000136144	ENST00000258646;ENST00000378302;ENST00000546015	D;D;D	0.81499	-1.5;-1.5;-1.5	5.84	5.84	0.93424	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.059063	0.64402	D	0.000001	T	0.75895	0.3912	L	0.35593	1.075	0.80722	D	1	B	0.29552	0.248	B	0.31614	0.133	T	0.71431	-0.4595	10	0.39692	T	0.17	-10.6126	20.1466	0.98079	0.0:0.0:1.0:0.0	.	30	Q8NDN9	RCBT1_HUMAN	L	30	ENSP00000258646:S30L;ENSP00000367552:S30L;ENSP00000443293:S30L	ENSP00000258646:S30L	S	-	2	0	RCBTB1	49039328	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	9.358000	0.97109	2.779000	0.95612	0.591000	0.81541	TCA	RCBTB1	-	superfamily_Reg_csome_cond/b-lactamase_inh	ENSG00000136144		0.478	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCBTB1	HGNC	protein_coding	OTTHUMT00000044912.2	98	0.00	0	G	NM_018191		50141327	50141327	-1	no_errors	ENST00000258646	ensembl	human	known	69_37n	missense	66	22.35	19	SNP	1.000	A
RGPD4	285190	genome.wustl.edu	37	2	108487659	108487659	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:108487659C>T	ENST00000408999.3	+	20	3276	c.3199C>T	c.(3199-3201)Cta>Tta	p.L1067L	RGPD4_ENST00000354986.4_Silent_p.L1067L	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1067	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GGGGGTAAAACTATTTAGATT	0.388																																						dbGAP											0													3.0	3.0	3.0					2																	108487659		614	1402	2016	-	-	-	SO:0001819	synonymous_variant	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3199C>T	2.37:g.108487659C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9A029	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.L1067	ENST00000408999.3	37	c.3199	CCDS46381.1	2																																																																																			RGPD4	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000196862		0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	615	0.00	0	C	XM_496581		108487659	108487659	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	silent	405	31.24	184	SNP	1.000	T
RNF138	51444	genome.wustl.edu	37	18	29691779	29691779	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr18:29691779G>A	ENST00000261593.3	+	3	631	c.173G>A	c.(172-174)cGt>cAt	p.R58H	RNF138_ENST00000585103.1_Intron|RNF138_ENST00000257190.5_Intron|RP11-53I6.2_ENST00000583184.1_RNA	NM_001191324.1|NM_016271.4	NP_001178253.2|NP_057355.2	Q8WVD3	RN138_HUMAN	ring finger protein 138, E3 ubiquitin protein ligase	58					protein ubiquitination (GO:0016567)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	ligase activity (GO:0016874)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						CCCCTATGTCGTGGAAATGTG	0.403																																						dbGAP											0													92.0	82.0	85.0					18																	29691779		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF162680	CCDS11903.1, CCDS11904.1	18q12.1	2013-01-28	2012-02-23		ENSG00000134758	ENSG00000134758		"""RING-type (C3HC4) zinc fingers"""	17765	protein-coding gene	gene with protein product	"""nemo-like kinase associated ring finger protein"""		"""ring finger protein 138"""			22155992, 16714285	Standard	NM_016271		Approved	STRIN, NARF	uc021uip.2	Q8WVD3	OTTHUMG00000132265	ENST00000261593.3:c.173G>A	18.37:g.29691779G>A	ENSP00000261593:p.Arg58His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE17|Q9H8K2|Q9UF87|Q9UKI6	Missense_Mutation	SNP	pfam_Znf_MIZ,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R58H	ENST00000261593.3	37	c.173	CCDS11903.1	18	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073243	0.55646	.	.	ENSG00000134758	ENST00000261593	T	0.78707	-1.2	5.71	5.71	0.89125	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.216399	0.41605	D	0.000841	D	0.90027	0.6886	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.63033	0.91	D	0.91490	0.5211	10	0.87932	D	0	-0.5527	19.8398	0.96678	0.0:0.0:1.0:0.0	.	58	Q8WVD3	RN138_HUMAN	H	58	ENSP00000261593:R58H	ENSP00000261593:R58H	R	+	2	0	RNF138	27945777	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.764000	0.62264	2.694000	0.91930	0.591000	0.81541	CGT	RNF138	-	pfam_Znf_MIZ,pfscan_Znf_RING	ENSG00000134758		0.403	RNF138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF138	HGNC	protein_coding	OTTHUMT00000255352.2	74	0.00	0	G	NM_016271		29691779	29691779	+1	no_errors	ENST00000261593	ensembl	human	known	69_37n	missense	46	23.33	14	SNP	1.000	A
S100A6	6277	genome.wustl.edu	37	1	153507273	153507273	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:153507273C>T	ENST00000368720.2	-	4	474	c.172G>A	c.(172-174)Gaa>Aaa	p.E58K	BX470102.3_ENST00000420695.1_RNA|S100A6_ENST00000496817.1_Missense_Mutation_p.E58K|S100A6_ENST00000368719.4_Missense_Mutation_p.E58K			P06703	S10A6_HUMAN	S100 calcium binding protein A6	58	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axonogenesis (GO:0007409)|positive regulation of fibroblast proliferation (GO:0048146)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|ion transmembrane transporter activity (GO:0015075)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)|tropomyosin binding (GO:0005523)|zinc ion binding (GO:0008270)			ovary(1)	1	all_lung(78;1.66e-32)|Lung NSC(65;5.71e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCAAGTCTTCCATCAGCCTT	0.507																																						dbGAP											0													114.0	107.0	109.0					1																	153507273		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001431	CCDS1040.1	1q21	2013-01-10	2006-09-11		ENSG00000197956	ENSG00000197956		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10496	protein-coding gene	gene with protein product		114110	"""S100 calcium-binding protein A6 (calcyclin)"", ""S100 calcium binding protein A6 (calcyclin)"""	CACY			Standard	NM_014624		Approved	2A9, PRA, CABP	uc001fbw.1	P06703	OTTHUMG00000013549	ENST00000368720.2:c.172G>A	1.37:g.153507273C>T	ENSP00000357709:p.Glu58Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV39|Q5RHS4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E58K	ENST00000368720.2	37	c.172	CCDS1040.1	1	.	.	.	.	.	.	.	.	.	.	C	7.618	0.676183	0.14841	.	.	ENSG00000197956	ENST00000368719;ENST00000368720	T;T	0.05925	3.37;3.37	5.43	4.51	0.55191	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	0.536026	0.19812	N	0.105518	T	0.00845	0.0028	.	.	.	0.30121	N	0.805683	B	0.11235	0.004	B	0.12156	0.007	T	0.45498	-0.9257	9	0.02654	T	1	.	10.4838	0.44708	0.0:0.9084:0.0:0.0916	.	58	P06703	S10A6_HUMAN	K	58	ENSP00000357708:E58K;ENSP00000357709:E58K	ENSP00000357708:E58K	E	-	1	0	S100A6	151773897	0.001000	0.12720	0.822000	0.32727	0.956000	0.61745	-0.091000	0.11146	2.547000	0.85894	0.655000	0.94253	GAA	S100A6	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000197956		0.507	S100A6-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	S100A6	HGNC	protein_coding	OTTHUMT00000037723.2	175	0.00	0	C	NM_014624		153507273	153507273	-1	no_errors	ENST00000368719	ensembl	human	known	69_37n	missense	86	19.63	21	SNP	0.971	T
RXFP4	339403	genome.wustl.edu	37	1	155912498	155912498	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:155912498C>A	ENST00000368318.3	+	1	1019	c.998C>A	c.(997-999)cCc>cAc	p.P333H		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	333						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)			endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGGCTGTGGCCCCAGGGCGGA	0.667																																						dbGAP											0													39.0	43.0	41.0					1																	155912498		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.998C>A	1.37:g.155912498C>A	ENSP00000357301:p.Pro333His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M0L4|Q3MJB1|Q8NGZ8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_ATII_rcpt	p.P333H	ENST00000368318.3	37	c.998	CCDS1124.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987505	0.74589	.	.	ENSG00000173080	ENST00000368318	T	0.61859	0.07	4.9	3.95	0.45737	.	0.326854	0.22119	N	0.064370	T	0.47078	0.1426	N	0.24115	0.695	0.09310	N	1	D	0.76494	0.999	D	0.64042	0.921	T	0.33317	-0.9873	10	0.39692	T	0.17	-18.0025	13.0383	0.58885	0.0:0.8248:0.1752:0.0	.	333	Q8TDU9	RL3R2_HUMAN	H	333	ENSP00000357301:P333H	ENSP00000357301:P333H	P	+	2	0	RXFP4	154179122	0.203000	0.23435	0.979000	0.43373	0.905000	0.53344	2.078000	0.41567	2.547000	0.85894	0.655000	0.94253	CCC	RXFP4	-	NULL	ENSG00000173080		0.667	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP4	HGNC	protein_coding	OTTHUMT00000046203.1	26	0.00	0	C	NM_181885		155912498	155912498	+1	no_errors	ENST00000368318	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.007	A
SBDS	51119	genome.wustl.edu	37	7	66453378	66453380	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr7:66453378_66453380delCTT	ENST00000246868.2	-	5	914_916	c.731_733delAAG	c.(730-735)gaagga>gga	p.E244del		NM_016038.2	NP_057122.2	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome	244					bone marrow development (GO:0048539)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|inner cell mass cell proliferation (GO:0001833)|leukocyte chemotaxis (GO:0030595)|mature ribosome assembly (GO:0042256)|mitotic spindle stabilization (GO:0043148)|ribosomal large subunit biogenesis (GO:0042273)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			cervix(1)|endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7						TTCTCATCTCCTTCTTCTACATC	0.414			Gene Conversion			"""AML, MDS"""			Shwachman-Diamond syndrome																													dbGAP	yes	Rec		Schwachman-Diamond syndrome	7	7q11	51119	Shwachman-Bodian-Diamond syndrome protein		L	0																																										-	-	-	SO:0001651	inframe_deletion	0	Familial Cancer Database	Shwachman syndrome, Shwachman-Bodian syndrome, Congenital Lipomatosis of the Pancreas	AF151855	CCDS5537.1	7q11.22	2014-09-17			ENSG00000126524	ENSG00000126524			19440	protein-coding gene	gene with protein product		607444				12496757	Standard	NM_016038		Approved	CGI-97, FLJ10917, SDS, SWDS	uc003tvm.1	Q9Y3A5	OTTHUMG00000023165	ENST00000246868.2:c.731_733delAAG	7.37:g.66453381_66453383delCTT	ENSP00000246868:p.Glu244del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0P4|Q96FX0|Q9NV53	In_Frame_Del	DEL	pfam_Ribosome_mat_SBDS_C,pfam_Ribosome_mat_SBDS_N,superfamily_Ribosome_mat_SBDS_N,tigrfam_Ribosome_maturation_pr_SBDS	p.E244in_frame_del	ENST00000246868.2	37	c.733_731	CCDS5537.1	7																																																																																			SBDS	-	NULL	ENSG00000126524		0.414	SBDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBDS	HGNC	protein_coding	OTTHUMT00000251746.2	108	0.00	0	CTT	NM_016038		66453378	66453380	-1	no_errors	ENST00000246868	ensembl	human	known	69_37n	in_frame_del	119	12.50	17	DEL	1.000:1.000:1.000	-
SBF2	81846	genome.wustl.edu	37	11	10024173	10024173	+	Missense_Mutation	SNP	G	G	A	rs527564842		TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:10024173G>A	ENST00000256190.8	-	7	820	c.683C>T	c.(682-684)tCt>tTt	p.S228F	SBF2_ENST00000527019.1_5'UTR	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	228	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GAAACTTGCAGAATGGAAGAG	0.348																																						dbGAP											0													96.0	97.0	97.0					11																	10024173		2201	4294	6495	-	-	-	SO:0001583	missense	0			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.683C>T	11.37:g.10024173G>A	ENSP00000256190:p.Ser228Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotub-related,pfam_dDENN_dom,pfam_Pleckstrin_homology,pfam_GRAM,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.S228F	ENST00000256190.8	37	c.683	CCDS31427.1	11	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204575	0.79127	.	.	ENSG00000133812	ENST00000256190	T	0.30182	1.54	5.52	3.65	0.41850	DENN (3);	0.000000	0.85682	D	0.000000	T	0.65428	0.2690	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72564	-0.4255	9	.	.	.	.	10.5254	0.44945	0.0692:0.0:0.7969:0.1339	.	228	Q86WG5	MTMRD_HUMAN	F	228	ENSP00000256190:S228F	.	S	-	2	0	SBF2	9980749	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.869000	0.99810	0.688000	0.31529	0.591000	0.81541	TCT	SBF2	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000133812		0.348	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBF2	HGNC	protein_coding	OTTHUMT00000386911.2	222	0.00	0	G	NM_030962		10024173	10024173	-1	no_errors	ENST00000256190	ensembl	human	known	69_37n	missense	154	17.20	32	SNP	1.000	A
SCAF4	57466	genome.wustl.edu	37	21	33073365	33073365	+	Silent	SNP	T	T	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr21:33073365T>C	ENST00000286835.7	-	7	1102	c.720A>G	c.(718-720)caA>caG	p.Q240Q	SCAF4_ENST00000399804.1_Silent_p.Q240Q|SCAF4_ENST00000434667.3_Silent_p.Q225Q	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	240						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GTTCAGATGGTTGTGTAGGAG	0.453																																						dbGAP											0													148.0	147.0	147.0					21																	33073365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.720A>G	21.37:g.33073365T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Silent	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD,smart_RRM_dom,pfscan_RRM_dom	p.Q240	ENST00000286835.7	37	c.720	CCDS33537.1	21																																																																																			SCAF4	-	NULL	ENSG00000156304		0.453	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCAF4	HGNC	protein_coding	OTTHUMT00000192659.1	147	0.00	0	T	XM_047889		33073365	33073365	-1	no_errors	ENST00000286835	ensembl	human	known	69_37n	silent	117	19.86	29	SNP	0.867	C
SDC1	6382	genome.wustl.edu	37	2	20403830	20403831	+	Frame_Shift_Ins	INS	-	-	G	rs375790781		TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:20403830_20403831insG	ENST00000254351.4	-	3	614_615	c.370_371insC	c.(370-372)cgafs	p.R124fs	SDC1_ENST00000482879.1_5'UTR|SDC1_ENST00000381150.1_Frame_Shift_Ins_p.R124fs|SDC1_ENST00000403076.1_Frame_Shift_Ins_p.R124fs	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	124					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)	p.R124*(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		CTCCCTGGGTCGGGGGGTGGCC	0.703																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.371dupC	2.37:g.20403836_20403836dupG	ENSP00000254351:p.Arg124fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W523|Q53QV0|Q546D3|Q96HB7	Frame_Shift_Ins	INS	pfam_Syndecan,smart_Neurexin-like	p.R124fs	ENST00000254351.4	37	c.371_370	CCDS1697.1	2																																																																																			SDC1	-	pfam_Syndecan	ENSG00000115884		0.703	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC1	HGNC	protein_coding	OTTHUMT00000207495.1	33	0.00	0	-	NM_001006946		20403830	20403831	-1	no_errors	ENST00000254351	ensembl	human	known	69_37n	frame_shift_ins	23	14.81	4	INS	0.001:0.001	G
SERPINA7	6906	genome.wustl.edu	37	X	105278294	105278294	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chrX:105278294G>A	ENST00000327674.4	-	3	1311	c.976C>T	c.(976-978)Cag>Tag	p.Q326*	SERPINA7_ENST00000487487.1_5'UTR|SERPINA7_ENST00000372563.1_Nonsense_Mutation_p.Q326*			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	326					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TAGGCATGCTGAATGCCCATC	0.398																																						dbGAP											0													114.0	95.0	101.0					X																	105278294		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.976C>T	X.37:g.105278294G>A	ENSP00000329374:p.Gln326*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUX1	Nonsense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Prot_inh_Lserp2	p.Q326*	ENST00000327674.4	37	c.976	CCDS14518.1	X	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979671	0.74360	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	.	.	.	4.84	1.71	0.24356	.	1.002830	0.08036	N	0.994397	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	7.2996	0.26413	0.0:0.129:0.3899:0.4811	.	.	.	.	X	326	.	ENSP00000329374:Q326X	Q	-	1	0	SERPINA7	105164950	0.000000	0.05858	0.048000	0.18961	0.049000	0.14656	0.380000	0.20602	0.344000	0.23847	0.600000	0.82982	CAG	SERPINA7	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000123561		0.398	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA7	HGNC	protein_coding	OTTHUMT00000057790.1	187	0.00	0	G	NM_000354		105278294	105278294	-1	no_errors	ENST00000327674	ensembl	human	known	69_37n	nonsense	140	15.15	25	SNP	0.000	A
SH3BP4	23677	genome.wustl.edu	37	2	235951351	235951351	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:235951351G>A	ENST00000409212.1	+	4	2445	c.1938G>A	c.(1936-1938)ccG>ccA	p.P646P	SH3BP4_ENST00000392011.2_Silent_p.P646P|SH3BP4_ENST00000344528.4_Silent_p.P646P			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	646					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CAAAGTACCCGACTTTCCAGG	0.522																																						dbGAP											0													70.0	74.0	73.0					2																	235951351		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1938G>A	2.37:g.235951351G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_ZU5,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.P646	ENST00000409212.1	37	c.1938	CCDS2513.1	2																																																																																			SH3BP4	-	NULL	ENSG00000130147		0.522	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SH3BP4	HGNC	protein_coding	OTTHUMT00000329763.1	126	0.00	0	G			235951351	235951351	+1	no_errors	ENST00000344528	ensembl	human	known	69_37n	silent	31	41.51	22	SNP	0.003	A
SLC12A8	84561	genome.wustl.edu	37	3	124826851	124826851	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:124826851C>T	ENST00000393469.4	-	9	1228	c.1179G>A	c.(1177-1179)ctG>ctA	p.L393L	SLC12A8_ENST00000469902.1_Silent_p.L393L|SLC12A8_ENST00000430155.2_Silent_p.L194L|SLC12A8_ENST00000314584.7_Silent_p.L146L|SLC12A8_ENST00000465475.1_5'UTR|SLC12A8_ENST00000423114.2_Silent_p.L422L	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	393					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						CAACGTATGTCAGCATGAAGT	0.582																																						dbGAP											0													38.0	40.0	39.0					3																	124826851		2109	4219	6328	-	-	-	SO:0001819	synonymous_variant	0				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.1179G>A	3.37:g.124826851C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Silent	SNP	pfam_AA-permease_dom,superfamily_ABC_transptrTM_dom_typ1	p.L422	ENST00000393469.4	37	c.1266	CCDS43143.1	3																																																																																			SLC12A8	-	pfam_AA-permease_dom	ENSG00000221955		0.582	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A8	HGNC	protein_coding	OTTHUMT00000355711.4	174	0.00	0	C	NM_024628		124826851	124826851	-1	no_errors	ENST00000423114	ensembl	human	known	69_37n	silent	117	15.22	21	SNP	1.000	T
SLC17A6	57084	genome.wustl.edu	37	11	22397543	22397543	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr11:22397543C>T	ENST00000263160.3	+	10	1627	c.1190C>T	c.(1189-1191)gCc>gTc	p.A397V		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	397					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GGCATGGAAGCCACACTGCTC	0.393																																						dbGAP											0													154.0	158.0	156.0					11																	22397543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1190C>T	11.37:g.22397543C>T	ENSP00000263160:p.Ala397Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A397V	ENST00000263160.3	37	c.1190	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.654799	0.96724	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.61980	0.06	6.17	6.17	0.99709	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.82384	0.5025	M	0.82193	2.58	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.82709	-0.0323	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	397	Q9P2U8	VGLU2_HUMAN	V	397;285	ENSP00000263160:A397V	ENSP00000263160:A397V	A	+	2	0	SLC17A6	22354119	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	7.817000	0.86213	2.941000	0.99782	0.655000	0.94253	GCC	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.393	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	112	0.88	1	C	NM_020346		22397543	22397543	+1	no_errors	ENST00000263160	ensembl	human	known	69_37n	missense	85	17.48	18	SNP	1.000	T
SLC45A4	57210	genome.wustl.edu	37	8	142221699	142221700	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:142221699_142221700insT	ENST00000024061.3	-	8	2545_2546	c.2238_2239insA	c.(2236-2241)aaatttfs	p.F747fs	SLC45A4_ENST00000517878.1_Frame_Shift_Ins_p.I800fs|SLC45A4_ENST00000519067.1_3'UTR|SLC45A4_ENST00000433583.2_Frame_Shift_Ins_p.I742fs	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GGAAAAGAAAATTTTTTTTCTA	0.45																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.2239dupA	8.37:g.142221707_142221707dupT	ENSP00000024061:p.Phe747fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRI2|Q9ULU3	Frame_Shift_Ins	INS	superfamily_MFS_dom_general_subst_transpt	p.I800fs	ENST00000024061.3	37	c.2399_2398	CCDS34948.1	8																																																																																			SLC45A4	-	NULL	ENSG00000022567		0.450	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A4	HGNC	protein_coding	OTTHUMT00000378571.3	48	0.00	0	-	XM_050325		142221699	142221700	-1	no_errors	ENST00000517878	ensembl	human	known	69_37n	frame_shift_ins	18	14.29	3	INS	0.000:0.000	T
SMYD4	114826	genome.wustl.edu	37	17	1703215	1703215	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr17:1703215C>T	ENST00000305513.7	-	5	1640	c.1473G>A	c.(1471-1473)gcG>gcA	p.A491A		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	491	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						GTCTCAGCATCGCCACTCCCC	0.478																																						dbGAP											0													102.0	80.0	87.0					17																	1703215		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1473G>A	17.37:g.1703215C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.A491	ENST00000305513.7	37	c.1473	CCDS11013.1	17																																																																																			SMYD4	-	pfam_SET_dom	ENSG00000186532		0.478	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	119	0.00	0	C	XM_056082		1703215	1703215	-1	no_errors	ENST00000305513	ensembl	human	known	69_37n	silent	54	18.18	12	SNP	0.983	T
SPATA2	9825	genome.wustl.edu	37	20	48523073	48523073	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr20:48523073C>G	ENST00000422556.1	-	3	995	c.646G>C	c.(646-648)Gag>Cag	p.E216Q	SPATA2_ENST00000289431.5_Missense_Mutation_p.E216Q|SPATA2_ENST00000543716.1_Missense_Mutation_p.E79Q	NM_001135773.1	NP_001129245.1	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	216					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	20	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			TCCCGGCCCTCTGCCCGCCGC	0.667																																						dbGAP											0													24.0	24.0	24.0					20																	48523073		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB018300	CCDS13422.1	20q13.13	2014-06-13			ENSG00000158480	ENSG00000158480			14681	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 145"""	607662					Standard	NM_001135773		Approved	KIAA0757, PD1, tamo, PPP1R145	uc002xuw.3	Q9UM82	OTTHUMG00000032704	ENST00000422556.1:c.646G>C	20.37:g.48523073C>G	ENSP00000416799:p.Glu216Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P626|O94857	Missense_Mutation	SNP	NULL	p.E216Q	ENST00000422556.1	37	c.646	CCDS13422.1	20	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760349	0.69763	.	.	ENSG00000158480	ENST00000289431;ENST00000422556;ENST00000543716	T;T;T	0.57595	0.79;0.79;0.39	5.17	5.17	0.71159	.	0.000000	0.50627	D	0.000102	T	0.69735	0.3144	L	0.55481	1.735	0.44352	D	0.99724	D	0.89917	1.0	D	0.87578	0.998	T	0.70626	-0.4820	10	0.59425	D	0.04	-35.7546	18.8582	0.92262	0.0:1.0:0.0:0.0	.	216	Q9UM82	SPAT2_HUMAN	Q	216;216;79	ENSP00000289431:E216Q;ENSP00000416799:E216Q;ENSP00000438855:E79Q	ENSP00000289431:E216Q	E	-	1	0	SPATA2	47956480	.	.	0.816000	0.32577	0.615000	0.37417	.	.	2.674000	0.91012	0.650000	0.86243	GAG	SPATA2	-	NULL	ENSG00000158480		0.667	SPATA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA2	HGNC	protein_coding	OTTHUMT00000079658.1	48	0.00	0	C	NM_006038		48523073	48523073	-1	no_errors	ENST00000289431	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	0.995	G
STX17	55014	genome.wustl.edu	37	9	102713416	102713416	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr9:102713416G>A	ENST00000259400.6	+	4	400	c.264G>A	c.(262-264)aaG>aaA	p.K88K	STX17_ENST00000525847.1_3'UTR|STX17_ENST00000534052.1_Silent_p.K88K|STX17_ENST00000525640.1_Silent_p.K88K	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	88					autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				TACTTCTGAAGAGAATGATAG	0.353																																						dbGAP											0													89.0	89.0	89.0					9																	102713416		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.264G>A	9.37:g.102713416G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXC2	Silent	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.K88	ENST00000259400.6	37	c.264	CCDS6745.1	9																																																																																			STX17	-	superfamily_t-SNARE	ENSG00000136874		0.353	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	STX17	HGNC	protein_coding	OTTHUMT00000053398.3	116	0.00	0	G	NM_017919		102713416	102713416	+1	no_errors	ENST00000259400	ensembl	human	known	69_37n	silent	131	13.25	20	SNP	1.000	A
STXBP1	6812	genome.wustl.edu	37	9	130423461	130423461	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr9:130423461G>A	ENST00000373299.1	+	6	521	c.406G>A	c.(406-408)Gca>Aca	p.A136T	STXBP1_ENST00000373302.3_Missense_Mutation_p.A136T	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	136					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						AATCAATATTGCATTTCTCCC	0.463																																						dbGAP											0													106.0	100.0	102.0					9																	130423461		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.406G>A	9.37:g.130423461G>A	ENSP00000362396:p.Ala136Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.A136T	ENST00000373299.1	37	c.406	CCDS35146.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.657345	0.96724	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000373299	T;T	0.76578	-1.03;-1.03	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.90971	0.7161	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.92575	0.6069	10	0.72032	D	0.01	-6.0026	17.3563	0.87336	0.0:0.0:1.0:0.0	.	136;136	P61764;P61764-2	STXB1_HUMAN;.	T	90;136;136	ENSP00000362399:A136T;ENSP00000362396:A136T	ENSP00000362396:A136T	A	+	1	0	STXBP1	129463282	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	9.529000	0.98049	2.689000	0.91719	0.655000	0.94253	GCA	STXBP1	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000136854		0.463	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	HGNC	protein_coding	OTTHUMT00000054229.1	154	0.00	0	G	NM_003165		130423461	130423461	+1	no_errors	ENST00000373299	ensembl	human	known	69_37n	missense	101	17.21	21	SNP	1.000	A
SWSAP1	126074	genome.wustl.edu	37	19	11486225	11486225	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:11486225C>T	ENST00000312423.2	+	2	282	c.223C>T	c.(223-225)Ctt>Ttt	p.L75F	CTD-2342J14.6_ENST00000590399.1_RNA	NM_175871.3	NP_787067.2	Q6NVH7	SWAP1_HUMAN	SWIM-type zinc finger 7 associated protein 1	75					ATP catabolic process (GO:0006200)|double-strand break repair via homologous recombination (GO:0000724)|protein stabilization (GO:0050821)	nucleus (GO:0005634)|Shu complex (GO:0097196)	ATPase activity (GO:0016887)|single-stranded DNA binding (GO:0003697)										AACCCGAGAGCTTTTCCGGCT	0.587																																						dbGAP											0													108.0	127.0	120.0					19																	11486225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092438	CCDS12259.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000173928	ENSG00000173928			26638	protein-coding gene	gene with protein product	"""zinc finger, SWIM-type containing 7 associated protein 1"", ""SWS1-associated protein 1"""	614536	"""chromosome 19 open reading frame 39"""	C19orf39		21965664	Standard	NM_175871		Approved	FLJ35119, ZSWIM7AP1, SWS1AP1	uc002mrg.1	Q6NVH7		ENST00000312423.2:c.223C>T	19.37:g.11486225C>T	ENSP00000310008:p.Leu75Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAM1	Missense_Mutation	SNP	NULL	p.L75F	ENST00000312423.2	37	c.223	CCDS12259.1	19	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464255	0.84425	.	.	ENSG00000173928	ENST00000312423	T	0.25912	1.77	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000012	T	0.52773	0.1755	M	0.78801	2.425	0.48762	D	0.999708	D	0.89917	1.0	D	0.91635	0.999	T	0.58002	-0.7713	10	0.87932	D	0	-13.497	15.3805	0.74651	0.0:1.0:0.0:0.0	.	75	Q6NVH7	CS039_HUMAN	F	75	ENSP00000310008:L75F	ENSP00000310008:L75F	L	+	1	0	C19orf39	11347225	1.000000	0.71417	0.394000	0.26270	0.909000	0.53808	4.453000	0.60061	2.362000	0.80069	0.655000	0.94253	CTT	SWSAP1	-	NULL	ENSG00000173928		0.587	SWSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWSAP1	HGNC	protein_coding	OTTHUMT00000458789.1	261	0.00	0	C	NM_175871		11486225	11486225	+1	no_errors	ENST00000312423	ensembl	human	known	69_37n	missense	237	11.90	32	SNP	0.962	T
SYNE1	23345	genome.wustl.edu	37	6	152655294	152655294	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr6:152655294T>A	ENST00000367255.5	-	77	13244	c.12643A>T	c.(12643-12645)Aat>Tat	p.N4215Y	SYNE1_ENST00000423061.1_Missense_Mutation_p.N4144Y|SYNE1_ENST00000341594.5_Missense_Mutation_p.N4080Y|SYNE1_ENST00000265368.4_Missense_Mutation_p.N4215Y|SYNE1_ENST00000448038.1_Missense_Mutation_p.N4144Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4215					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CACTGATCATTTAAATGATTT	0.403										HNSCC(10;0.0054)																												dbGAP											0													224.0	193.0	203.0					6																	152655294		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12643A>T	6.37:g.152655294T>A	ENSP00000356224:p.Asn4215Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.N4215Y	ENST00000367255.5	37	c.12643	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	10.64	1.405607	0.25378	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.55588	1.2;1.2;1.2;1.2;0.51	5.71	4.55	0.56014	.	0.170661	0.40908	D	0.000988	T	0.29976	0.0750	L	0.36672	1.1	0.80722	D	1	B;B;B	0.32338	0.25;0.25;0.365	B;B;B	0.34301	0.087;0.087;0.179	T	0.20840	-1.0263	10	0.56958	D	0.05	.	13.1703	0.59593	0.0:0.0:0.1335:0.8665	.	4215;4215;4144	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Y	4215;4144;4215;4144;4080	ENSP00000356224:N4215Y;ENSP00000396024:N4144Y;ENSP00000265368:N4215Y;ENSP00000390975:N4144Y;ENSP00000341887:N4080Y	ENSP00000265368:N4215Y	N	-	1	0	SYNE1	152696987	0.998000	0.40836	0.662000	0.29724	0.900000	0.52787	2.121000	0.41977	1.006000	0.39211	-0.257000	0.10917	AAT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.403	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	305	0.00	0	T	NM_182961		152655294	152655294	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	217	51.24	228	SNP	0.892	A
TCHH	7062	genome.wustl.edu	37	1	152082392	152082392	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:152082392T>C	ENST00000368804.1	-	2	3300	c.3301A>G	c.(3301-3303)Aga>Gga	p.R1101G		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1101	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGCGCCTTCTCTTCTCCGGT	0.612																																						dbGAP											0													90.0	93.0	92.0					1																	152082392		1966	4144	6110	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3301A>G	1.37:g.152082392T>C	ENSP00000357794:p.Arg1101Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.R1101G	ENST00000368804.1	37	c.3301	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	T	4.584	0.108455	0.08780	.	.	ENSG00000159450	ENST00000368804	T	0.07327	3.2	2.41	1.14	0.20703	.	.	.	.	.	T	0.01800	0.0057	N	0.24115	0.695	0.09310	N	1	D	0.55385	0.971	P	0.44772	0.46	T	0.39251	-0.9623	9	0.34782	T	0.22	.	2.9529	0.05867	0.0:0.1603:0.2557:0.5841	.	1101	Q07283	TRHY_HUMAN	G	1101	ENSP00000357794:R1101G	ENSP00000357794:R1101G	R	-	1	2	TCHH	150349016	0.010000	0.17322	0.000000	0.03702	0.020000	0.10135	0.723000	0.25939	0.028000	0.15324	0.379000	0.24179	AGA	TCHH	-	NULL	ENSG00000159450		0.612	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	333	0.00	0	T	NM_007113		152082392	152082392	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	437	20.11	110	SNP	0.000	C
TEX15	56154	genome.wustl.edu	37	8	30700081	30700081	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:30700081G>A	ENST00000256246.2	-	1	6527	c.6453C>T	c.(6451-6453)tgC>tgT	p.C2151C		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2151					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TAGCATATGAGCAATTAACAG	0.328																																						dbGAP											0													54.0	55.0	55.0					8																	30700081		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.6453C>T	8.37:g.30700081G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.C2151	ENST00000256246.2	37	c.6453	CCDS6080.1	8																																																																																			TEX15	-	NULL	ENSG00000133863		0.328	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	142	0.00	0	G			30700081	30700081	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	silent	103	12.71	15	SNP	0.007	A
TG	7038	genome.wustl.edu	37	8	133899016	133899016	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:133899016C>G	ENST00000220616.4	+	9	1439	c.1399C>G	c.(1399-1401)Ctc>Gtc	p.L467V	TG_ENST00000377869.1_Missense_Mutation_p.L467V	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	467					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCAAAGAGACTCCAGCAAAA	0.458																																						dbGAP											0													60.0	65.0	64.0					8																	133899016		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1399C>G	8.37:g.133899016C>G	ENSP00000220616:p.Leu467Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.L467V	ENST00000220616.4	37	c.1399	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038410	0.75617	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.71461	-0.57;-0.56	5.8	5.8	0.92144	.	0.107851	0.41605	D	0.000850	T	0.77585	0.4152	M	0.74881	2.28	0.36410	D	0.863689	D	0.62365	0.991	P	0.55923	0.787	T	0.82386	-0.0483	10	0.51188	T	0.08	.	8.5149	0.33239	0.0:0.8367:0.0:0.1633	.	467	P01266	THYG_HUMAN	V	467	ENSP00000367100:L467V;ENSP00000220616:L467V	ENSP00000220616:L467V	L	+	1	0	TG	133968198	0.997000	0.39634	0.997000	0.53966	0.997000	0.91878	3.271000	0.51608	2.740000	0.93945	0.650000	0.86243	CTC	TG	-	pirsf_Thyroglobulin	ENSG00000042832		0.458	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	309	0.00	0	C	NM_003235		133899016	133899016	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	258	14.00	42	SNP	1.000	G
TIAM1	7074	genome.wustl.edu	37	21	32492859	32492859	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr21:32492859G>A	ENST00000286827.3	-	29	5074	c.4603C>T	c.(4603-4605)Cag>Tag	p.Q1535*	TIAM1_ENST00000541036.1_Nonsense_Mutation_p.Q1475*	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1535					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTTTCCCGCTGACTGATGGAG	0.592																																						dbGAP											0													89.0	77.0	81.0					21																	32492859		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4603C>T	21.37:g.32492859G>A	ENSP00000286827:p.Gln1535*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLR6|F5GZ53|Q17RT7	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.Q1535*	ENST00000286827.3	37	c.4603	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	G	46	12.957222	0.99709	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	.	.	.	4.81	4.81	0.61882	.	0.562606	0.16955	N	0.192719	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	11.0952	0.48141	0.0:0.1368:0.722:0.1412	.	.	.	.	X	1535;1475	.	ENSP00000286827:Q1535X	Q	-	1	0	TIAM1	31414730	0.170000	0.23016	0.982000	0.44146	0.920000	0.55202	2.836000	0.48183	2.213000	0.71641	0.655000	0.94253	CAG	TIAM1	-	NULL	ENSG00000156299		0.592	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	86	0.00	0	G	NM_003253		32492859	32492859	-1	no_errors	ENST00000286827	ensembl	human	known	69_37n	nonsense	64	20.99	17	SNP	0.992	A
TMCC1	23023	genome.wustl.edu	37	3	129389511	129389511	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:129389511G>C	ENST00000393238.3	-	4	1513	c.1173C>G	c.(1171-1173)gaC>gaG	p.D391E	TMCC1_ENST00000432054.2_Missense_Mutation_p.D67E|TMCC1_ENST00000329333.5_Missense_Mutation_p.D212E|TMCC1_ENST00000426664.2_Missense_Mutation_p.D277E	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	391						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CCTCTAAAGAGTCCTTCAGGT	0.478																																						dbGAP											0													76.0	74.0	75.0					3																	129389511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1173C>G	3.37:g.129389511G>C	ENSP00000376930:p.Asp391Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.D391E	ENST00000393238.3	37	c.1173	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545665	0.65198	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.58395	0.2119	M	0.65498	2.005	0.58432	D	0.999999	D;D	0.89917	1.0;0.992	D;D	0.91635	0.999;0.992	T	0.52328	-0.8590	10	0.16896	T	0.51	-3.1042	12.4783	0.55827	0.0773:0.0:0.9227:0.0	.	212;391	B4DE04;O94876	.;TMCC1_HUMAN	E	67;391;277;212	ENSP00000404711:D67E;ENSP00000376930:D391E;ENSP00000389892:D277E;ENSP00000327349:D212E	ENSP00000327349:D212E	D	-	3	2	TMCC1	130872201	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.522000	0.81844	2.581000	0.87130	0.591000	0.81541	GAC	TMCC1	-	pfam_Predicted_TM_coiled-coil_2	ENSG00000172765		0.478	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	HGNC	protein_coding	OTTHUMT00000356418.2	157	0.00	0	G	NM_015008		129389511	129389511	-1	no_errors	ENST00000393238	ensembl	human	known	69_37n	missense	106	14.52	18	SNP	1.000	C
TMEM50A	23585	genome.wustl.edu	37	1	25667009	25667009	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr1:25667009C>T	ENST00000374358.4	+	2	585	c.32C>T	c.(31-33)tCa>tTa	p.S11L	TMEM50A_ENST00000480937.1_3'UTR|RNU6-1171P_ENST00000516706.1_RNA	NM_014313.3	NP_055128.1	O95807	TM50A_HUMAN	transmembrane protein 50A	11						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)		TTGAGATGCTCAGAATGCATT	0.378																																						dbGAP											0													108.0	99.0	102.0					1																	25667009		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY071927	CCDS264.1	1p36.11	2008-02-05			ENSG00000183726	ENSG00000183726			30590	protein-coding gene	gene with protein product	"""small membrane protein 1"""	605348				10938938, 10845894	Standard	NM_014313		Approved	SMP1	uc001bke.3	O95807	OTTHUMG00000007651	ENST00000374358.4:c.32C>T	1.37:g.25667009C>T	ENSP00000363478:p.Ser11Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_UPF0220	p.S11L	ENST00000374358.4	37	c.32	CCDS264.1	1	.	.	.	.	.	.	.	.	.	.	c	18.40	3.616737	0.66672	.	.	ENSG00000183726	ENST00000374358	T	0.31769	1.48	5.4	5.4	0.78164	.	0.122041	0.56097	D	0.000027	T	0.35393	0.0930	L	0.38175	1.15	0.44409	D	0.997321	B;B	0.28470	0.213;0.188	B;B	0.39971	0.197;0.315	T	0.13202	-1.0518	10	0.41790	T	0.15	.	17.721	0.88351	0.0:1.0:0.0:0.0	.	11;11	B7Z5M7;O95807	.;TM50A_HUMAN	L	11	ENSP00000363478:S11L	ENSP00000363478:S11L	S	+	2	0	TMEM50A	25539596	0.998000	0.40836	0.999000	0.59377	0.995000	0.86356	3.753000	0.55180	2.538000	0.85594	0.585000	0.79938	TCA	TMEM50A	-	pfam_UPF0220	ENSG00000183726		0.378	TMEM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM50A	HGNC	protein_coding	OTTHUMT00000020313.1	72	0.00	0	C			25667009	25667009	+1	no_errors	ENST00000374358	ensembl	human	known	69_37n	missense	80	18.37	18	SNP	1.000	T
TNPO3	23534	genome.wustl.edu	37	7	128658066	128658066	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr7:128658066G>A	ENST00000265388.5	-	2	409	c.266C>T	c.(265-267)tCa>tTa	p.S89L	TNPO3_ENST00000393245.1_Missense_Mutation_p.S89L|TNPO3_ENST00000471166.1_Missense_Mutation_p.S89L|TNPO3_ENST00000471234.1_Missense_Mutation_p.S89L|TNPO3_ENST00000482320.1_Missense_Mutation_p.S23L			Q9Y5L0	TNPO3_HUMAN	transportin 3	89					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						GGTTAGCAATGAGTCCCGTAA	0.423																																					Pancreas(147;583 2585 39696 52331)	dbGAP											0													150.0	140.0	143.0					7																	128658066		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.266C>T	7.37:g.128658066G>A	ENSP00000265388:p.Ser89Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.S89L	ENST00000265388.5	37	c.266	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966533	0.92855	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	5.83	4.95	0.65309	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83344	0.5234	M	0.92026	3.265	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.962;0.988	D	0.83894	0.0286	10	0.26408	T	0.33	.	12.5663	0.56312	0.0803:0.0:0.9197:0.0	.	89;89;89	C9IZM0;C9J7E5;Q9Y5L0	.;.;TNPO3_HUMAN	L	89;89;23;89;89	ENSP00000376936:S89L;ENSP00000265388:S89L;ENSP00000420089:S23L;ENSP00000418646:S89L;ENSP00000418267:S89L	ENSP00000265388:S89L	S	-	2	0	TNPO3	128445302	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.776000	0.99001	1.479000	0.48272	0.655000	0.94253	TCA	TNPO3	-	superfamily_ARM-type_fold	ENSG00000064419		0.423	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	145	0.00	0	G	NM_012470		128658066	128658066	-1	no_errors	ENST00000393245	ensembl	human	known	69_37n	missense	175	18.60	40	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577129	7577129	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr17:7577129A>G	ENST00000269305.4	-	8	998	c.809T>C	c.(808-810)tTt>tCt	p.F270S	TP53_ENST00000445888.2_Missense_Mutation_p.F270S|TP53_ENST00000420246.2_Missense_Mutation_p.F270S|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.F270S|TP53_ENST00000359597.4_Missense_Mutation_p.F270S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	270	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F270C(15)|p.0?(8)|p.F270S(8)|p.F270Y(5)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACGCACCTCAAAGCTGTTCCG	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	48	Substitution - Missense(28)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(4)|Unknown(2)	oesophagus(10)|breast(8)|upper_aerodigestive_tract(5)|large_intestine(4)|bone(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(2)|ovary(2)|salivary_gland(1)|lung(1)|eye(1)|pancreas(1)											57.0	50.0	53.0					17																	7577129		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.809T>C	17.37:g.7577129A>G	ENSP00000269305:p.Phe270Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F270S	ENST00000269305.4	37	c.809	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.2	4.262404	0.80358	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99815	-6.9;-6.9;-6.9;-6.9;-6.9;-6.9	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	M	0.86740	2.835	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;0.994;1.0;0.999	D;D;D;D	0.83275	0.996;0.931;0.996;0.996	D	0.96817	0.9601	10	0.87932	D	0	-25.5181	12.9367	0.58319	1.0:0.0:0.0:0.0	.	270;270;270;270	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	S	270;270;270;270;270;259;138	ENSP00000352610:F270S;ENSP00000269305:F270S;ENSP00000398846:F270S;ENSP00000391127:F270S;ENSP00000391478:F270S;ENSP00000425104:F138S	ENSP00000269305:F270S	F	-	2	0	TP53	7517854	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.040000	0.76551	2.154000	0.67381	0.379000	0.24179	TTT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	110	0.00	0	A	NM_000546		7577129	7577129	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	41	48.78	40	SNP	1.000	G
TPGS2	25941	genome.wustl.edu	37	18	34380248	34380248	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr18:34380248G>C	ENST00000334295.4	-	5	836	c.409C>G	c.(409-411)Cac>Gac	p.H137D	TPGS2_ENST00000590652.1_5'Flank|TPGS2_ENST00000593035.1_Missense_Mutation_p.H102D|TPGS2_ENST00000590842.1_Missense_Mutation_p.H137D|TPGS2_ENST00000587129.1_Missense_Mutation_p.H137D|TPGS2_ENST00000383056.3_Missense_Mutation_p.H94D|TPGS2_ENST00000589049.1_Missense_Mutation_p.H137D	NM_015476.2	NP_056291.2	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	137						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GAGTCAAAGTGAGGCTTCTCT	0.413																																						dbGAP											0													174.0	175.0	175.0					18																	34380248		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015178	CCDS32817.1, CCDS62421.1, CCDS62422.1, CCDS62423.1, CCDS62424.1, CCDS74214.1, CCDS74215.1	18q12.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134779	ENSG00000134779			24561	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 10"""	C18orf10		12477932	Standard	NM_015476		Approved	DKFZP586M1523, HsT3006	uc031rhw.1	Q68CL5		ENST00000334295.4:c.409C>G	18.37:g.34380248G>C	ENSP00000335144:p.His137Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIX2|K7EIJ9|Q4KN59|Q8WTU3|Q96BT9|Q9Y435	Nonsense_Mutation	SNP	smart_Cell_wall_assmbl_KNR4-like	p.S93*	ENST00000334295.4	37	c.278	CCDS32817.1	18	.	.	.	.	.	.	.	.	.	.	G	26.4	4.734908	0.89482	.	.	ENSG00000134779	ENST00000334295;ENST00000383056	T;T	0.43294	0.95;0.95	5.9	5.9	0.94986	Cell wall assembly/cell proliferation coordinating protein, KNR4-like (1);	0.000000	0.85682	D	0.000000	T	0.67850	0.2937	M	0.78637	2.42	0.80722	D	1	P;D;D;P	0.76494	0.724;0.999;0.999;0.669	B;D;D;B	0.71414	0.263;0.973;0.96;0.171	T	0.68934	-0.5278	10	0.66056	D	0.02	-21.6198	20.2789	0.98501	0.0:0.0:1.0:0.0	.	102;137;94;137	B4DIX2;Q68CL5-3;Q68CL5-1;Q68CL5	.;.;.;TPGS2_HUMAN	D	137;94	ENSP00000335144:H137D;ENSP00000372530:H94D	ENSP00000335144:H137D	H	-	1	0	C18orf10	32634246	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.229000	0.95273	2.788000	0.95919	0.650000	0.86243	CAC	TPGS2	-	smart_Cell_wall_assmbl_KNR4-like	ENSG00000134779		0.413	TPGS2-001	KNOWN	basic|CCDS	protein_coding	TPGS2	HGNC	protein_coding	OTTHUMT00000440410.2	346	0.00	0	G	NM_015476		34380248	34380248	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000591906	ensembl	human	putative	69_37n	nonsense	297	14.41	50	SNP	1.000	C
TRIM10	10107	genome.wustl.edu	37	6	30124770	30124770	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr6:30124770G>A	ENST00000449742.2	-	5	916	c.841C>T	c.(841-843)Cgg>Tgg	p.R281W	TRIM10_ENST00000376704.3_Missense_Mutation_p.R281W	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	281					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			ovary(1)	1						GGAAAGTCCCGAATCCTCTGG	0.587																																						dbGAP											0													69.0	76.0	73.0					6																	30124770		1509	2708	4217	-	-	-	SO:0001583	missense	0			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.841C>T	6.37:g.30124770G>A	ENSP00000397073:p.Arg281Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R281W	ENST00000449742.2	37	c.841	CCDS34375.1	6	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008551	0.75046	.	.	ENSG00000204613	ENST00000449742;ENST00000376704;ENST00000376706	T;T	0.64438	-0.1;0.06	5.61	4.68	0.58851	.	0.122386	0.37809	N	0.001940	T	0.66809	0.2827	M	0.69823	2.125	0.36222	D	0.852042	D;D	0.89917	1.0;1.0	P;D	0.63703	0.642;0.917	T	0.65990	-0.6034	10	0.35671	T	0.21	.	11.2894	0.49241	0.0:0.0:0.8183:0.1816	.	281;281	Q9UDY6;Q9UDY6-2	TRI10_HUMAN;.	W	281	ENSP00000397073:R281W;ENSP00000365894:R281W	ENSP00000365894:R281W	R	-	1	2	TRIM10	30232749	0.001000	0.12720	1.000000	0.80357	0.793000	0.44817	0.302000	0.19192	2.809000	0.96659	0.643000	0.83706	CGG	TRIM10	-	NULL	ENSG00000204613		0.587	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	HGNC	protein_coding	OTTHUMT00000076634.1	139	0.00	0	G			30124770	30124770	-1	no_errors	ENST00000449742	ensembl	human	known	69_37n	missense	96	21.95	27	SNP	0.999	A
TRIM13	10206	genome.wustl.edu	37	13	50587274	50587275	+	Frame_Shift_Del	DEL	TT	TT	-	rs373574909		TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr13:50587274_50587275delTT	ENST00000378182.3	+	2	1936_1937	c.1198_1199delTT	c.(1198-1200)tttfs	p.F400fs	TRIM13_ENST00000298772.5_Frame_Shift_Del_p.F403fs|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000457662.2_Frame_Shift_Del_p.F400fs|TRIM13_ENST00000420995.2_Frame_Shift_Del_p.F400fs|KCNRG_ENST00000312942.1_5'Flank|TRIM13_ENST00000356017.4_Frame_Shift_Del_p.F403fs|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	400					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		TGTGGCAGAATTTGTGTGCAAA	0.312																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.1198_1199delTT	13.37:g.50587274_50587275delTT	ENSP00000367424:p.Phe400fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Frame_Shift_Del	DEL	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.F403fs	ENST00000378182.3	37	c.1207_1208	CCDS9423.1	13																																																																																			TRIM13	-	NULL	ENSG00000204977		0.312	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TRIM13	HGNC	protein_coding	OTTHUMT00000354875.1	169	0.00	0	TT	NM_001007278		50587274	50587275	+1	no_errors	ENST00000298772	ensembl	human	known	69_37n	frame_shift_del	83	20.00	21	DEL	1.000:1.000	-
TRIP13	9319	genome.wustl.edu	37	5	914588	914588	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:914588C>G	ENST00000166345.3	+	11	1385	c.1029C>G	c.(1027-1029)atC>atG	p.I343M		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	343					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			AGTGTCAGATCATATACCCTC	0.507																																						dbGAP											0													155.0	159.0	158.0					5																	914588		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.1029C>G	5.37:g.914588C>G	ENSP00000166345:p.Ile343Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase,prints_Chaprnin_ClpA/B	p.I343M	ENST00000166345.3	37	c.1029	CCDS3858.1	5	.	.	.	.	.	.	.	.	.	.	.	19.57	3.852369	0.71719	.	.	ENSG00000071539	ENST00000166345	D	0.95756	-3.8	5.8	4.86	0.63082	.	0.196102	0.50627	D	0.000102	D	0.97052	0.9037	M	0.86651	2.83	0.58432	D	0.999999	D	0.57899	0.981	P	0.55577	0.779	D	0.97229	0.9883	10	0.87932	D	0	-27.7761	13.4774	0.61316	0.2584:0.7416:0.0:0.0	.	343	Q15645	PCH2_HUMAN	M	343	ENSP00000166345:I343M	ENSP00000166345:I343M	I	+	3	3	TRIP13	967588	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.420000	0.34804	2.755000	0.94549	0.655000	0.94253	ATC	TRIP13	-	NULL	ENSG00000071539		0.507	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP13	HGNC	protein_coding	OTTHUMT00000206721.2	309	0.00	0	C	NM_004237		914588	914588	+1	no_errors	ENST00000166345	ensembl	human	known	69_37n	missense	194	13.39	30	SNP	1.000	G
TRIO	7204	genome.wustl.edu	37	5	14399176	14399176	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr5:14399176G>A	ENST00000344204.4	+	30	4635	c.4611G>A	c.(4609-4611)ttG>ttA	p.L1537L	TRIO_ENST00000537187.1_Silent_p.L1537L|TRIO_ENST00000509967.2_Silent_p.L1488L	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1537	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					AAAGCAAATTGTTTGTAAGTA	0.353																																						dbGAP											0													82.0	89.0	86.0					5																	14399176		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4611G>A	5.37:g.14399176G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.L1537	ENST00000344204.4	37	c.4611	CCDS3883.1	5																																																																																			TRIO	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000038382		0.353	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	150	0.00	0	G	NM_007118		14399176	14399176	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	silent	180	16.28	35	SNP	1.000	A
TRPV6	55503	genome.wustl.edu	37	7	142573242	142573242	+	Silent	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr7:142573242G>C	ENST00000359396.3	-	8	1346	c.1101C>G	c.(1099-1101)ctC>ctG	p.L367L	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	367					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TCTGCTGTAAGAGGGTGTTGT	0.562																																						dbGAP											0													88.0	82.0	84.0					7																	142573242		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1101C>G	7.37:g.142573242G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Silent	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6_channel,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.L367	ENST00000359396.3	37	c.1101	CCDS5874.1	7																																																																																			TRPV6	-	tigrfam_TRP_channel	ENSG00000165125		0.562	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1	90	0.00	0	G	NM_014274		142573242	142573242	-1	no_errors	ENST00000359396	ensembl	human	known	69_37n	silent	69	12.66	10	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179612700	179612700	+	Intron	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr2:179612700C>T	ENST00000591111.1	-	45	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Silent_p.L4809L			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGGTCTTCCAAAGTGGCAT	0.478																																						dbGAP											0													69.0	55.0	60.0					2																	179612700		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+5150G>A	2.37:g.179612700C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L4809	ENST00000591111.1	37	c.14427		2																																																																																			TTN	-	NULL	ENSG00000155657		0.478	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	122	0.00	0	C	NM_133378		179612700	179612700	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	silent	88	31.25	40	SNP	0.000	T
UBTD1	80019	genome.wustl.edu	37	10	99330208	99330208	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr10:99330208C>T	ENST00000370664.3	+	3	948	c.612C>T	c.(610-612)ctC>ctT	p.L204L	ANKRD2_ENST00000370655.1_5'Flank|ANKRD2_ENST00000455090.1_5'Flank|ANKRD2_ENST00000307518.5_5'Flank|ANKRD2_ENST00000298808.5_5'Flank	NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	204	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.									central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		GCACACGGCTCCAGGAGACCA	0.627																																					Pancreas(100;169 2668 32720)	dbGAP											0													47.0	45.0	46.0					10																	99330208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.612C>T	10.37:g.99330208C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR57|Q53HI3	Silent	SNP	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.L204	ENST00000370664.3	37	c.612	CCDS7465.1	10																																																																																			UBTD1	-	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	ENSG00000165886		0.627	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTD1	HGNC	protein_coding	OTTHUMT00000049701.1	48	0.00	0	C	NM_024954		99330208	99330208	+1	no_errors	ENST00000370664	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	1.000	T
UHRF1BP1L	23074	genome.wustl.edu	37	12	100452800	100452800	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr12:100452800G>A	ENST00000279907.7	-	14	2467	c.2255C>T	c.(2254-2256)tCa>tTa	p.S752L	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.S402L	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	752										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						TTCACTTTGTGATGTATTTAG	0.423																																						dbGAP											0													97.0	104.0	102.0					12																	100452800		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.2255C>T	12.37:g.100452800G>A	ENSP00000279907:p.Ser752Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.S752L	ENST00000279907.7	37	c.2255	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536701	0.65085	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.11604	2.8;2.76	6.02	5.13	0.70059	.	0.254195	0.41396	N	0.000898	T	0.15912	0.0383	M	0.70275	2.135	0.80722	D	1	P	0.36753	0.568	B	0.34093	0.175	T	0.01520	-1.1334	10	0.72032	D	0.01	-5.5362	15.3978	0.74812	0.0665:0.0:0.9335:0.0	.	752	A0JNW5	UH1BL_HUMAN	L	752;402	ENSP00000279907:S752L;ENSP00000444824:S402L	ENSP00000279907:S752L	S	-	2	0	UHRF1BP1L	98976931	1.000000	0.71417	0.914000	0.36105	0.813000	0.45954	4.424000	0.59868	1.557000	0.49525	0.650000	0.86243	TCA	UHRF1BP1L	-	NULL	ENSG00000111647		0.423	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	344	0.00	0	G	NM_001006947		100452800	100452800	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	missense	160	23.81	50	SNP	0.997	A
WDR49	151790	genome.wustl.edu	37	3	167277905	167277905	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr3:167277905delG	ENST00000308378.3	-	5	903	c.598delC	c.(598-600)cttfs	p.L200fs	WDR49_ENST00000476376.1_Frame_Shift_Del_p.L25fs|WDR49_ENST00000453925.2_Frame_Shift_Del_p.L253fs|WDR49_ENST00000479765.1_Intron	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	200										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TTTGCATCAAGGGCCATAGTG	0.453																																						dbGAP											0													186.0	169.0	175.0					3																	167277905		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.598delC	3.37:g.167277905delG	ENSP00000311343:p.Leu200fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N297	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D201fs	ENST00000308378.3	37	c.598	CCDS3201.1	3																																																																																			WDR49	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000174776		0.453	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3	151	0.00	0	G	NM_178824		167277905	167277905	-1	no_errors	ENST00000308378	ensembl	human	known	69_37n	frame_shift_del	86	14.71	15	DEL	0.992	-
ZCCHC13	389874	genome.wustl.edu	37	X	73524431	73524431	+	Silent	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chrX:73524431G>A	ENST00000339534.2	+	1	407	c.330G>A	c.(328-330)caG>caA	p.Q110Q		NM_203303.2	NP_976048.1	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	110							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	8						AGAAAGAGCAGAAATGCTACT	0.517																																						dbGAP											0													96.0	76.0	83.0					X																	73524431		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021176	CCDS14425.1	Xq13.2	2008-02-05			ENSG00000187969	ENSG00000187969		"""Zinc fingers, CCHC domain containing"""	31749	protein-coding gene	gene with protein product							Standard	NM_203303		Approved	4930513O09RIK, Cnbp2, ZNF9L	uc004ebs.4	Q8WW36	OTTHUMG00000021851	ENST00000339534.2:c.330G>A	X.37:g.73524431G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.Q110	ENST00000339534.2	37	c.330	CCDS14425.1	X																																																																																			ZCCHC13	-	pfam_Znf_CCHC,superfamily_Znf_CCHC	ENSG00000187969		0.517	ZCCHC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC13	HGNC	protein_coding	OTTHUMT00000057260.1	106	0.00	0	G	NM_203303		73524431	73524431	+1	no_errors	ENST00000339534	ensembl	human	known	69_37n	silent	107	22.46	31	SNP	1.000	A
ZFHX4	79776	genome.wustl.edu	37	8	77764171	77764174	+	Frame_Shift_Del	DEL	AAAA	AAAA	-			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	AAAA	AAAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr8:77764171_77764174delAAAA	ENST00000521891.2	+	10	5462_5465	c.5014_5017delAAAA	c.(5014-5019)aaaaagfs	p.KK1672fs	ZFHX4_ENST00000518282.1_Frame_Shift_Del_p.KK1646fs|ZFHX4_ENST00000050961.6_Frame_Shift_Del_p.KK1627fs|ZFHX4_ENST00000455469.2_Frame_Shift_Del_p.KK1627fs	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1627	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGAATTAAATAAAAAGCAAACTCC	0.431										HNSCC(33;0.089)																												dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5014_5017delAAAA	8.37:g.77764171_77764174delAAAA	ENSP00000430497:p.Lys1672fs	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Frame_Shift_Del	DEL	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.K1672fs	ENST00000521891.2	37	c.5014_5017	CCDS47878.2	8																																																																																			ZFHX4	-	NULL	ENSG00000091656		0.431	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	424	0.00	0	AAAA	NM_024721		77764171	77764174	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	frame_shift_del	354	29.34	147	DEL	1.000:1.000:1.000:1.000	-
ZNF236	7776	genome.wustl.edu	37	18	74625817	74625817	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr18:74625817C>T	ENST00000253159.8	+	18	3216	c.3018C>T	c.(3016-3018)tcC>tcT	p.S1006S	ZNF236_ENST00000320610.9_Silent_p.S1008S	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1006					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCTTTGTTTCCTCTGGGGTCC	0.483																																						dbGAP											0													88.0	97.0	94.0					18																	74625817		1962	4142	6104	-	-	-	SO:0001819	synonymous_variant	0			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.3018C>T	18.37:g.74625817C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX9|Q9UL37	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1006	ENST00000253159.8	37	c.3018	CCDS42447.1	18																																																																																			ZNF236	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130856		0.483	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	188	0.00	0	C			74625817	74625817	+1	no_errors	ENST00000253159	ensembl	human	known	69_37n	silent	246	14.29	41	SNP	1.000	T
ZNF253	56242	genome.wustl.edu	37	19	20002371	20002371	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:20002371C>T	ENST00000589717.1	+	4	407	c.315C>T	c.(313-315)tgC>tgT	p.C105C	ZNF253_ENST00000355650.4_Silent_p.C29C|AC011477.1_ENST00000578823.1_RNA|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	105					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATGAAGAATGCAGACATGACA	0.368																																						dbGAP											0													50.0	51.0	51.0					19																	20002371		2118	4258	6376	-	-	-	SO:0001819	synonymous_variant	0			AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.315C>T	19.37:g.20002371C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C105	ENST00000589717.1	37	c.315	CCDS42532.1	19																																																																																			ZNF253	-	NULL	ENSG00000256771		0.368	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF253	HGNC	protein_coding	OTTHUMT00000460802.1	170	0.00	0	C	NM_021047		20002371	20002371	+1	no_errors	ENST00000589717	ensembl	human	known	69_37n	silent	172	11.79	23	SNP	0.033	T
ZNF440	126070	genome.wustl.edu	37	19	11943231	11943231	+	Missense_Mutation	SNP	C	C	G	rs369613510		TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:11943231C>G	ENST00000304060.5	+	4	1404	c.1240C>G	c.(1240-1242)Cat>Gat	p.H414D		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CCTTCGAGTGCATGGTAGGAC	0.448																																						dbGAP											0													95.0	92.0	93.0					19																	11943231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.1240C>G	19.37:g.11943231C>G	ENSP00000305373:p.His414Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1R9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H414D	ENST00000304060.5	37	c.1240	CCDS42503.1	19	.	.	.	.	.	.	.	.	.	.	c	14.63	2.591769	0.46214	.	.	ENSG00000171295	ENST00000304060	D	0.86769	-2.17	1.19	1.19	0.21007	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95127	0.8421	H	0.97829	4.085	0.35707	D	0.816082	D	0.76494	0.999	D	0.79784	0.993	D	0.95646	0.8702	9	0.87932	D	0	.	9.9281	0.41505	0.0:1.0:0.0:0.0	.	414	Q8IYI8	ZN440_HUMAN	D	414	ENSP00000305373:H414D	ENSP00000305373:H414D	H	+	1	0	ZNF440	11804231	0.996000	0.38824	0.003000	0.11579	0.005000	0.04900	5.974000	0.70465	0.972000	0.38314	0.205000	0.17691	CAT	ZNF440	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171295		0.448	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF440	HGNC	protein_coding	OTTHUMT00000344508.1	247	0.00	0	C	NM_152357		11943231	11943231	+1	no_errors	ENST00000304060	ensembl	human	known	69_37n	missense	258	13.71	41	SNP	0.776	G
ZNF429	353088	genome.wustl.edu	37	19	21719844	21719844	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:21719844G>A	ENST00000358491.4	+	4	1197	c.989G>A	c.(988-990)aGc>aAc	p.S330N	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						ACCCTTACTAGCCATAAGAGA	0.368																																						dbGAP											0													33.0	37.0	36.0					19																	21719844		2144	4275	6419	-	-	-	SO:0001583	missense	0			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.989G>A	19.37:g.21719844G>A	ENSP00000351280:p.Ser330Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLV7|Q9BZE6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S330N	ENST00000358491.4	37	c.989	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	1.426	-0.571509	0.03882	.	.	ENSG00000197013	ENST00000358491	T	0.18174	2.23	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06142	0.0159	N	0.05306	-0.075	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.41342	-0.9514	9	0.17369	T	0.5	.	1.8208	0.03110	0.2457:0.0:0.4311:0.3232	.	330	Q86V71	ZN429_HUMAN	N	330	ENSP00000351280:S330N	ENSP00000351280:S330N	S	+	2	0	ZNF429	21511684	0.000000	0.05858	0.803000	0.32268	0.804000	0.45430	-9.099000	0.00014	0.293000	0.22520	0.298000	0.19748	AGC	ZNF429	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197013		0.368	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	HGNC	protein_coding	OTTHUMT00000463981.1	207	0.00	0	G	NM_001001415		21719844	21719844	+1	no_errors	ENST00000358491	ensembl	human	known	69_37n	missense	226	21.25	61	SNP	0.003	A
ZNF510	22869	genome.wustl.edu	37	9	99521783	99521783	+	Silent	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr9:99521783C>T	ENST00000375231.1	-	6	1979	c.1329G>A	c.(1327-1329)caG>caA	p.Q443Q	ZNF510_ENST00000223428.4_Silent_p.Q443Q			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	443					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				GGTGTGACTTCTGGGAGAAAG	0.398																																						dbGAP											0													91.0	92.0	92.0					9																	99521783		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.1329G>A	9.37:g.99521783C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZP5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q443	ENST00000375231.1	37	c.1329	CCDS35074.1	9																																																																																			ZNF510	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000081386		0.398	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF510	HGNC	protein_coding	OTTHUMT00000053287.1	421	0.00	0	C	NM_014930		99521783	99521783	-1	no_errors	ENST00000223428	ensembl	human	known	69_37n	silent	269	15.09	48	SNP	0.017	T
ZNF562	54811	genome.wustl.edu	37	19	9764242	9764242	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:9764242G>C	ENST00000448622.1	-	6	826	c.664C>G	c.(664-666)Cac>Gac	p.H222D	ZNF562_ENST00000453792.2_Missense_Mutation_p.H153D|ZNF562_ENST00000537617.1_Missense_Mutation_p.H106D|ZNF562_ENST00000590155.1_Missense_Mutation_p.H221D|ZNF562_ENST00000453372.2_Missense_Mutation_p.H222D|ZNF562_ENST00000293648.4_Missense_Mutation_p.H150D|ZNF562_ENST00000541032.1_Missense_Mutation_p.H185D	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						ATTCCCATGTGATTATCAAGG	0.413																																						dbGAP											0													68.0	60.0	63.0					19																	9764242		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.664C>G	19.37:g.9764242G>C	ENSP00000411784:p.His222Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MN2|Q9NXS5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H222D	ENST00000448622.1	37	c.664	CCDS45956.1	19	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721481	0.68959	.	.	ENSG00000171466	ENST00000453372;ENST00000448622;ENST00000293648;ENST00000541032;ENST00000453792;ENST00000537617	D;D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2;-10.2	1.67	1.67	0.24075	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.99981	0.9994	H	0.98133	4.155	0.09310	N	1	D;D;P;D;P	0.62365	0.96;0.968;0.951;0.991;0.879	D;D;P;D;B	0.78314	0.923;0.954;0.692;0.991;0.391	D	0.97987	1.0352	9	0.87932	D	0	.	9.2869	0.37762	0.0:0.0:1.0:0.0	.	106;221;185;222;150	F5H1B4;B4DMG0;B4DZP9;Q6V9R5;Q6V9R5-2	.;.;.;ZN562_HUMAN;.	D	222;222;150;185;153;106	ENSP00000410734:H222D;ENSP00000411784:H222D;ENSP00000293648:H150D;ENSP00000442614:H185D;ENSP00000440451:H153D;ENSP00000445816:H106D	ENSP00000293648:H150D	H	-	1	0	ZNF562	9625242	1.000000	0.71417	0.001000	0.08648	0.849000	0.48306	5.959000	0.70339	1.229000	0.43630	0.313000	0.20887	CAC	ZNF562	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171466		0.413	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF562	HGNC	protein_coding	OTTHUMT00000450239.1	299	0.00	0	G	NM_017656		9764242	9764242	-1	no_errors	ENST00000448622	ensembl	human	known	69_37n	missense	172	16.91	35	SNP	0.064	C
ZNF578	147660	genome.wustl.edu	37	19	53014007	53014007	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:53014007C>A	ENST00000421239.2	+	6	617	c.373C>A	c.(373-375)Cat>Aat	p.H125N	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AAGAAATGGCCATGAAGCATC	0.378																																						dbGAP											0													116.0	119.0	118.0					19																	53014007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.373C>A	19.37:g.53014007C>A	ENSP00000459216:p.His125Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H125N	ENST00000421239.2	37	c.373	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	-	3.722	-0.057395	0.07317	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.72	-1.66	0.08265	.	.	.	.	.	T	0.25306	0.0615	M	0.65975	2.015	0.09310	N	1	P	0.35982	0.531	B	0.26770	0.073	T	0.16012	-1.0417	7	.	.	.	.	1.9747	0.03413	0.3045:0.2827:0.0:0.4128	.	125	G3V4F6	.	N	125	.	.	H	+	1	0	ZNF578	57705819	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.812000	0.04496	-0.282000	0.09128	0.134000	0.15878	CAT	ZNF578	-	NULL	ENSG00000258405		0.378	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	498	0.00	0	C	NM_152472		53014007	53014007	+1	no_errors	ENST00000421239	ensembl	human	known	69_37n	missense	440	15.71	82	SNP	0.000	A
ZNF658	26149	genome.wustl.edu	37	9	40774338	40774338	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr9:40774338T>A	ENST00000602553.1	-	5	1231	c.937A>T	c.(937-939)Act>Tct	p.T313S	ZNF658_ENST00000377626.3_Missense_Mutation_p.T313S|ZNF658_ENST00000441795.1_Missense_Mutation_p.T311S			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGAGATTGAGTGAGGGGTGAC	0.388																																						dbGAP											0													40.0	42.0	41.0					9																	40774338		2133	4243	6376	-	-	-	SO:0001583	missense	0			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.937A>T	9.37:g.40774338T>A	ENSP00000473484:p.Thr313Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T313S	ENST00000602553.1	37	c.937	CCDS35023.1	9	.	.	.	.	.	.	.	.	.	.	t	11.13	1.547378	0.27652	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.28666	1.6;1.6	2.05	-2.76	0.05896	.	.	.	.	.	T	0.13884	0.0336	L	0.28274	0.84	0.09310	N	1	B;B	0.14012	0.009;0.002	B;B	0.11329	0.006;0.003	T	0.36261	-0.9755	9	0.06494	T	0.89	.	3.8805	0.09076	0.0:0.2878:0.4212:0.291	.	313;313	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	S	311;313	ENSP00000408462:T311S;ENSP00000366853:T313S	ENSP00000366853:T313S	T	-	1	0	ZNF658	40764338	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	0.655000	0.24933	-0.605000	0.05753	0.321000	0.21382	ACT	ZNF658	-	NULL	ENSG00000196409		0.388	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1	345	0.00	0	T	NM_033160		40774338	40774338	-1	no_errors	ENST00000377626	ensembl	human	known	69_37n	missense	197	18.60	45	SNP	0.000	A
ZNF718	255403	genome.wustl.edu	37	4	155296	155296	+	lincRNA	SNP	A	A	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr4:155296A>T	ENST00000510175.1	+	0	731							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		AATTTACATAAGAGAATTCAT	0.343																																						dbGAP											0													41.0	45.0	44.0					4																	155296		2059	4227	6286	-	-	-			0			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155296A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXZ4|Q3SXZ5	RNA	SNP	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			ZNF718	-	-	ENSG00000250312		0.343	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	HGNC	lincRNA	OTTHUMT00000357865.3	147	0.00	0	A	NM_001039127		155296	155296	+1	no_errors	ENST00000400172	ensembl	human	known	69_37n	rna	94	25.98	33	SNP	0.829	T
ZNF776	284309	genome.wustl.edu	37	19	58265573	58265573	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0AW-01A-11W-A071-09	TCGA-BH-A0AW-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	82057159-dd32-49fd-9ee7-82b4668f39c3	959f61e0-33ba-4464-a04a-efd0372eedb5	g.chr19:58265573C>T	ENST00000317178.5	+	3	1338	c.1075C>T	c.(1075-1077)Cac>Tac	p.H359Y	ZNF776_ENST00000489376.1_3'UTR	NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		ATCGTTTAATCACAAGTGCAA	0.458																																						dbGAP											0													139.0	113.0	122.0					19																	58265573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.1075C>T	19.37:g.58265573C>T	ENSP00000321812:p.His359Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZS36|Q8N968	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H359Y	ENST00000317178.5	37	c.1075	CCDS12962.2	19	.	.	.	.	.	.	.	.	.	.	C	6.763	0.509663	0.12883	.	.	ENSG00000152443	ENST00000317178	T	0.17854	2.25	1.86	0.675	0.17952	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06234	0.0161	N	0.04387	-0.21	0.09310	N	1	B;B	0.19073	0.033;0.006	B;B	0.14578	0.011;0.002	T	0.42103	-0.9471	9	0.19147	T	0.46	.	4.3673	0.11230	0.0:0.372:0.4697:0.1583	.	359;359	Q68DI1;B4DSC6	ZN776_HUMAN;.	Y	359	ENSP00000321812:H359Y	ENSP00000321812:H359Y	H	+	1	0	ZNF776	62957385	0.000000	0.05858	0.002000	0.10522	0.707000	0.40811	-4.247000	0.00266	0.082000	0.17018	0.313000	0.20887	CAC	ZNF776	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152443		0.458	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF776	HGNC	protein_coding	OTTHUMT00000346722.2	380	0.00	0	C	NM_173632		58265573	58265573	+1	no_errors	ENST00000317178	ensembl	human	known	69_37n	missense	318	11.88	43	SNP	0.000	T
