#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABL1	25	genome.wustl.edu	37	9	133755477	133755477	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr9:133755477C>A	ENST00000318560.5	+	9	1827	c.1446C>A	c.(1444-1446)gaC>gaA	p.D482E		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	482	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	ATCCCTCTGACCGGCCCTCCT	0.512			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																	dbGAP		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	0													114.0	106.0	108.0					9																	133755477		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1446C>A	9.37:g.133755477C>A	ENSP00000323315:p.Asp482Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	pfam_F-actin_binding,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.D501E	ENST00000318560.5	37	c.1503	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092917	0.36952	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	D;D	0.82167	-1.58;-1.58	5.87	2.94	0.34122	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.142100	0.64402	N	0.000006	T	0.61123	0.2322	N	0.04768	-0.165	0.58432	D	0.999998	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.45041	-0.9288	10	0.29301	T	0.29	.	5.2766	0.15653	0.1201:0.6317:0.1162:0.1319	.	482;519	P00519;Q59FK4	ABL1_HUMAN;.	E	297;501;482	ENSP00000361423:D501E;ENSP00000323315:D482E	ENSP00000323315:D482E	D	+	3	2	ABL1	132745298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.893000	0.28336	0.344000	0.23847	0.655000	0.94253	GAC	ABL1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000097007		0.512	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	HGNC	protein_coding	OTTHUMT00000054684.1	102	0.97	1	C	NM_007313		133755477	133755477	+1	no_errors	ENST00000372348	ensembl	human	known	69_37n	missense	45	43.04	34	SNP	1.000	A
ABL1	25	genome.wustl.edu	37	9	133755477	133755477	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr9:133755477C>A	ENST00000318560.5	+	9	1827	c.1446C>A	c.(1444-1446)gaC>gaA	p.D482E		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	482	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	ATCCCTCTGACCGGCCCTCCT	0.512			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																	dbGAP		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	0													114.0	106.0	108.0					9																	133755477		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1446C>A	9.37:g.133755477C>A	ENSP00000323315:p.Asp482Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	pfam_F-actin_binding,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.D501E	ENST00000318560.5	37	c.1503	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092917	0.36952	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	D;D	0.82167	-1.58;-1.58	5.87	2.94	0.34122	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.142100	0.64402	N	0.000006	T	0.61123	0.2322	N	0.04768	-0.165	0.58432	D	0.999998	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.45041	-0.9288	10	0.29301	T	0.29	.	5.2766	0.15653	0.1201:0.6317:0.1162:0.1319	.	482;519	P00519;Q59FK4	ABL1_HUMAN;.	E	297;501;482	ENSP00000361423:D501E;ENSP00000323315:D482E	ENSP00000323315:D482E	D	+	3	2	ABL1	132745298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.893000	0.28336	0.344000	0.23847	0.655000	0.94253	GAC	ABL1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000097007		0.512	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	HGNC	protein_coding	OTTHUMT00000054684.1	69	0.00	0	C	NM_007313		133755477	133755477	+1	no_errors	ENST00000372348	ensembl	human	known	69_37n	missense	45	43.04	34	SNP	1.000	A
AFF2	2334	genome.wustl.edu	37	X	147743942	147743942	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chrX:147743942G>T	ENST00000370460.2	+	3	1173	c.694G>T	c.(694-696)Gaa>Taa	p.E232*	AFF2_ENST00000342251.3_Nonsense_Mutation_p.E228*|AFF2_ENST00000370457.5_Nonsense_Mutation_p.E228*|AFF2_ENST00000370458.1_Nonsense_Mutation_p.E228*	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	232					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGCTTTCAAAGAAATCTTTCA	0.478													G|||	1	0.000264901	0.0008	0.0	3775	,	,		14244	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													140.0	145.0	143.0					X																	147743942		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.694G>T	X.37:g.147743942G>T	ENSP00000359489:p.Glu232*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Nonsense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E232*	ENST00000370460.2	37	c.694	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	41	8.843057	0.98974	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	.	.	.	5.82	5.82	0.92795	.	1.098430	0.06868	N	0.800274	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.0492	0.93036	0.0:0.0:1.0:0.0	.	.	.	.	X	232;228;228;228	.	ENSP00000345459:E228X	E	+	1	0	AFF2	147551634	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.105000	0.89553	2.448000	0.82819	0.600000	0.82982	GAA	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.478	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	1255	0.00	0	G	NM_002025		147743942	147743942	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	nonsense	539	14.17	89	SNP	1.000	T
AFF2	2334	genome.wustl.edu	37	X	147743942	147743942	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chrX:147743942G>T	ENST00000370460.2	+	3	1173	c.694G>T	c.(694-696)Gaa>Taa	p.E232*	AFF2_ENST00000342251.3_Nonsense_Mutation_p.E228*|AFF2_ENST00000370457.5_Nonsense_Mutation_p.E228*|AFF2_ENST00000370458.1_Nonsense_Mutation_p.E228*	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	232					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGCTTTCAAAGAAATCTTTCA	0.478													G|||	1	0.000264901	0.0008	0.0	3775	,	,		14244	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													140.0	145.0	143.0					X																	147743942		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.694G>T	X.37:g.147743942G>T	ENSP00000359489:p.Glu232*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Nonsense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E232*	ENST00000370460.2	37	c.694	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	41	8.843057	0.98974	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	.	.	.	5.82	5.82	0.92795	.	1.098430	0.06868	N	0.800274	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.0492	0.93036	0.0:0.0:1.0:0.0	.	.	.	.	X	232;228;228;228	.	ENSP00000345459:E228X	E	+	1	0	AFF2	147551634	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.105000	0.89553	2.448000	0.82819	0.600000	0.82982	GAA	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.478	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	878	0.00	0	G	NM_002025		147743942	147743942	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	nonsense	539	14.17	89	SNP	1.000	T
ATXN1	6310	genome.wustl.edu	37	6	16328222	16328222	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr6:16328222G>A	ENST00000244769.4	-	8	1256	c.320C>T	c.(319-321)gCc>gTc	p.A107V	ATXN1_ENST00000436367.1_Missense_Mutation_p.A107V	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	107					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CTGCGGGGTGGCGTACGCGGC	0.642																																						dbGAP											0													57.0	60.0	59.0					6																	16328222		2203	4299	6502	-	-	-	SO:0001583	missense	0			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.320C>T	6.37:g.16328222G>A	ENSP00000244769:p.Ala107Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_Capicua_tscrpt_rep_mod,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.A107V	ENST00000244769.4	37	c.320	CCDS34342.1	6	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506636	0.44558	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.77750	-1.12;-1.12	5.11	5.11	0.69529	.	0.218619	0.47852	D	0.000204	T	0.50103	0.1596	N	0.08118	0	0.36459	D	0.866591	B	0.19817	0.039	B	0.18871	0.023	T	0.52275	-0.8597	10	0.48119	T	0.1	-6.3041	18.5424	0.91033	0.0:0.0:1.0:0.0	.	107	P54253	ATX1_HUMAN	V	107	ENSP00000244769:A107V;ENSP00000416360:A107V	ENSP00000244769:A107V	A	-	2	0	ATXN1	16436201	1.000000	0.71417	0.943000	0.38184	0.011000	0.07611	6.101000	0.71479	2.376000	0.81061	0.467000	0.42956	GCC	ATXN1	-	NULL	ENSG00000124788		0.642	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	HGNC	protein_coding	OTTHUMT00000039943.3	47	0.00	0	G	NM_000332		16328222	16328222	-1	no_errors	ENST00000244769	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	0.998	A
ATXN1	6310	genome.wustl.edu	37	6	16328222	16328222	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr6:16328222G>A	ENST00000244769.4	-	8	1256	c.320C>T	c.(319-321)gCc>gTc	p.A107V	ATXN1_ENST00000436367.1_Missense_Mutation_p.A107V	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	107					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CTGCGGGGTGGCGTACGCGGC	0.642																																						dbGAP											0													57.0	60.0	59.0					6																	16328222		2203	4299	6502	-	-	-	SO:0001583	missense	0			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.320C>T	6.37:g.16328222G>A	ENSP00000244769:p.Ala107Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_Capicua_tscrpt_rep_mod,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.A107V	ENST00000244769.4	37	c.320	CCDS34342.1	6	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506636	0.44558	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.77750	-1.12;-1.12	5.11	5.11	0.69529	.	0.218619	0.47852	D	0.000204	T	0.50103	0.1596	N	0.08118	0	0.36459	D	0.866591	B	0.19817	0.039	B	0.18871	0.023	T	0.52275	-0.8597	10	0.48119	T	0.1	-6.3041	18.5424	0.91033	0.0:0.0:1.0:0.0	.	107	P54253	ATX1_HUMAN	V	107	ENSP00000244769:A107V;ENSP00000416360:A107V	ENSP00000244769:A107V	A	-	2	0	ATXN1	16436201	1.000000	0.71417	0.943000	0.38184	0.011000	0.07611	6.101000	0.71479	2.376000	0.81061	0.467000	0.42956	GCC	ATXN1	-	NULL	ENSG00000124788		0.642	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	HGNC	protein_coding	OTTHUMT00000039943.3	34	0.00	0	G	NM_000332		16328222	16328222	-1	no_errors	ENST00000244769	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	0.998	A
CSMD2	114784	genome.wustl.edu	37	1	34042946	34042946	+	Missense_Mutation	SNP	C	C	T	rs202029488	byFrequency	TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr1:34042946C>T	ENST00000373381.4	-	49	7702	c.7526G>A	c.(7525-7527)cGg>cAg	p.R2509Q		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2511	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTGGGGGTGCCGGGTACAGAT	0.622													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		17620	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													73.0	73.0	73.0					1																	34042946		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.7526G>A	1.37:g.34042946C>T	ENSP00000362479:p.Arg2509Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.R2509Q	ENST00000373381.4	37	c.7526		1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	C	17.22	3.334847	0.60853	.	.	ENSG00000121904	ENST00000373381	T	0.23950	1.88	5.45	5.45	0.79879	Complement control module (2);Sushi/SCR/CCP (3);	0.144408	0.46145	D	0.000312	T	0.17746	0.0426	L	0.28504	0.86	0.80722	D	1	B;B	0.24768	0.111;0.066	B;B	0.21917	0.037;0.037	T	0.07693	-1.0759	10	0.15952	T	0.53	.	11.6492	0.51279	0.0:0.9098:0.0:0.0902	.	2511;2509	Q7Z408;E7EUA6	CSMD2_HUMAN;.	Q	2509	ENSP00000362479:R2509Q	ENSP00000241312:R2511Q	R	-	2	0	CSMD2	33815533	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.278000	0.51662	2.569000	0.86673	0.563000	0.77884	CGG	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.622	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		107	0.00	0	C	NM_052896		34042946	34042946	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	45	44.44	36	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	32662397	32662397	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chrX:32662397G>A	ENST00000357033.4	-	11	1389	c.1183C>T	c.(1183-1185)Cgg>Tgg	p.R395W	DMD_ENST00000378677.2_Missense_Mutation_p.R391W|DMD_ENST00000288447.4_Missense_Mutation_p.R387W|MIR548F5_ENST00000408421.1_RNA	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	395					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTACCAACCCGGCCCTGATGG	0.383																																						dbGAP											0													105.0	93.0	97.0					X																	32662397		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1183C>T	X.37:g.32662397G>A	ENSP00000354923:p.Arg395Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.R395W	ENST00000357033.4	37	c.1183	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404558	0.42613	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.55588	0.51;0.51;0.51	5.77	2.99	0.34606	.	0.524812	0.13578	U	0.377565	T	0.58466	0.2124	L	0.60455	1.87	0.80722	D	1	D;B;P;B	0.67145	0.996;0.003;0.928;0.004	P;B;P;B	0.54210	0.745;0.002;0.717;0.003	T	0.54344	-0.8308	10	0.72032	D	0.01	.	8.2059	0.31454	0.0708:0.0:0.5281:0.4012	.	387;387;395;391	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	W	387;391;395;395;272;387	ENSP00000367948:R391W;ENSP00000354923:R395W;ENSP00000288447:R387W	ENSP00000288447:R387W	R	-	1	2	DMD	32572318	1.000000	0.71417	0.899000	0.35326	0.185000	0.23345	4.275000	0.58927	0.193000	0.20303	-0.199000	0.12753	CGG	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.383	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	227	0.00	0	G	NM_004006		32662397	32662397	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	88	36.69	51	SNP	0.989	A
DMD	1756	genome.wustl.edu	37	X	32662397	32662397	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chrX:32662397G>A	ENST00000357033.4	-	11	1389	c.1183C>T	c.(1183-1185)Cgg>Tgg	p.R395W	DMD_ENST00000378677.2_Missense_Mutation_p.R391W|DMD_ENST00000288447.4_Missense_Mutation_p.R387W|MIR548F5_ENST00000408421.1_RNA	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	395					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTACCAACCCGGCCCTGATGG	0.383																																						dbGAP											0													105.0	93.0	97.0					X																	32662397		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1183C>T	X.37:g.32662397G>A	ENSP00000354923:p.Arg395Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.R395W	ENST00000357033.4	37	c.1183	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404558	0.42613	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.55588	0.51;0.51;0.51	5.77	2.99	0.34606	.	0.524812	0.13578	U	0.377565	T	0.58466	0.2124	L	0.60455	1.87	0.80722	D	1	D;B;P;B	0.67145	0.996;0.003;0.928;0.004	P;B;P;B	0.54210	0.745;0.002;0.717;0.003	T	0.54344	-0.8308	10	0.72032	D	0.01	.	8.2059	0.31454	0.0708:0.0:0.5281:0.4012	.	387;387;395;391	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	W	387;391;395;395;272;387	ENSP00000367948:R391W;ENSP00000354923:R395W;ENSP00000288447:R387W	ENSP00000288447:R387W	R	-	1	2	DMD	32572318	1.000000	0.71417	0.899000	0.35326	0.185000	0.23345	4.275000	0.58927	0.193000	0.20303	-0.199000	0.12753	CGG	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.383	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	360	0.28	1	G	NM_004006		32662397	32662397	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	88	36.69	51	SNP	0.989	A
FAM86EP	348926	genome.wustl.edu	37	4	3951270	3951270	+	RNA	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr4:3951270C>A	ENST00000313946.8	-	0	155				AC226119.5_ENST00000281228.8_RNA					family with sequence similarity 86, member E, pseudogene																		GTGTGGACAGCCTCGTGCTGG	0.542																																						dbGAP											0																																										-	-	-			0					4p16.3	2011-07-01			ENSG00000251669	ENSG00000251669			28017	pseudogene	pseudogene						12477932	Standard	NR_024253		Approved		uc011bvu.2		OTTHUMG00000159867		4.37:g.3951270C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000313946.8	37	NULL		4																																																																																			FAM86EP	-	-	ENSG00000251669		0.542	FAM86EP-002	KNOWN	basic	processed_transcript	FAM86EP	HGNC	pseudogene	OTTHUMT00000357822.1	18	0.00	0	C			3951270	3951270	-1	no_errors	ENST00000504375	ensembl	human	known	69_37n	rna	16	27.27	6	SNP	1.000	A
FAM86EP	348926	genome.wustl.edu	37	4	3951270	3951270	+	RNA	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr4:3951270C>A	ENST00000313946.8	-	0	155				AC226119.5_ENST00000281228.8_RNA					family with sequence similarity 86, member E, pseudogene																		GTGTGGACAGCCTCGTGCTGG	0.542																																						dbGAP											0																																										-	-	-			0					4p16.3	2011-07-01			ENSG00000251669	ENSG00000251669			28017	pseudogene	pseudogene						12477932	Standard	NR_024253		Approved		uc011bvu.2		OTTHUMG00000159867		4.37:g.3951270C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000313946.8	37	NULL		4																																																																																			FAM86EP	-	-	ENSG00000251669		0.542	FAM86EP-002	KNOWN	basic	processed_transcript	FAM86EP	HGNC	pseudogene	OTTHUMT00000357822.1	19	0.00	0	C			3951270	3951270	-1	no_errors	ENST00000504375	ensembl	human	known	69_37n	rna	16	27.27	6	SNP	1.000	A
FAT3	120114	genome.wustl.edu	37	11	92531859	92531859	+	Silent	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr11:92531859C>T	ENST00000298047.6	+	9	5697	c.5680C>T	c.(5680-5682)Cta>Tta	p.L1894L	FAT3_ENST00000409404.2_Silent_p.L1894L|FAT3_ENST00000525166.1_Silent_p.L1744L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1894	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TATCTTACTTCTACCTACCTA	0.458										TCGA Ovarian(4;0.039)																												dbGAP											0													112.0	100.0	104.0					11																	92531859		1944	4167	6111	-	-	-	SO:0001819	synonymous_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5680C>T	11.37:g.92531859C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L1894	ENST00000298047.6	37	c.5680		11																																																																																			FAT3	-	superfamily_Cadherin-like	ENSG00000165323		0.458	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		128	0.00	0	C	NM_001008781		92531859	92531859	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	silent	77	15.38	14	SNP	0.833	T
FAT3	120114	genome.wustl.edu	37	11	92531859	92531859	+	Silent	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr11:92531859C>T	ENST00000298047.6	+	9	5697	c.5680C>T	c.(5680-5682)Cta>Tta	p.L1894L	FAT3_ENST00000409404.2_Silent_p.L1894L|FAT3_ENST00000525166.1_Silent_p.L1744L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1894	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TATCTTACTTCTACCTACCTA	0.458										TCGA Ovarian(4;0.039)																												dbGAP											0													112.0	100.0	104.0					11																	92531859		1944	4167	6111	-	-	-	SO:0001819	synonymous_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5680C>T	11.37:g.92531859C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L1894	ENST00000298047.6	37	c.5680		11																																																																																			FAT3	-	superfamily_Cadherin-like	ENSG00000165323		0.458	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		98	0.00	0	C	NM_001008781		92531859	92531859	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	silent	77	15.38	14	SNP	0.833	T
GIMAP8	155038	genome.wustl.edu	37	7	150164402	150164402	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr7:150164402A>G	ENST00000307271.3	+	2	1190	c.616A>G	c.(616-618)Act>Gct	p.T206A		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	206	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GAACTTCAAAACTGAAGGCAG	0.398																																						dbGAP											0													72.0	67.0	68.0					7																	150164402		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.616A>G	7.37:g.150164402A>G	ENSP00000305107:p.Thr206Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AIG1	p.T206A	ENST00000307271.3	37	c.616	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	A	1.842	-0.467251	0.04476	.	.	ENSG00000171115	ENST00000307271	T	0.05447	3.44	4.3	1.93	0.25924	.	0.500084	0.16421	N	0.215165	T	0.04679	0.0127	N	0.25647	0.755	0.09310	N	1	P	0.39576	0.679	B	0.41946	0.371	T	0.38478	-0.9659	10	0.13470	T	0.59	.	5.7025	0.17891	0.778:0.0:0.222:0.0	.	206	Q8ND71	GIMA8_HUMAN	A	206	ENSP00000305107:T206A	ENSP00000305107:T206A	T	+	1	0	GIMAP8	149795335	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	0.138000	0.16016	0.237000	0.21200	-0.334000	0.08254	ACT	GIMAP8	-	NULL	ENSG00000171115		0.398	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	370	0.00	0	A	NM_175571		150164402	150164402	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	missense	189	26.46	68	SNP	0.000	G
GIMAP8	155038	genome.wustl.edu	37	7	150164402	150164402	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr7:150164402A>G	ENST00000307271.3	+	2	1190	c.616A>G	c.(616-618)Act>Gct	p.T206A		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	206	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GAACTTCAAAACTGAAGGCAG	0.398																																						dbGAP											0													72.0	67.0	68.0					7																	150164402		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.616A>G	7.37:g.150164402A>G	ENSP00000305107:p.Thr206Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AIG1	p.T206A	ENST00000307271.3	37	c.616	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	A	1.842	-0.467251	0.04476	.	.	ENSG00000171115	ENST00000307271	T	0.05447	3.44	4.3	1.93	0.25924	.	0.500084	0.16421	N	0.215165	T	0.04679	0.0127	N	0.25647	0.755	0.09310	N	1	P	0.39576	0.679	B	0.41946	0.371	T	0.38478	-0.9659	10	0.13470	T	0.59	.	5.7025	0.17891	0.778:0.0:0.222:0.0	.	206	Q8ND71	GIMA8_HUMAN	A	206	ENSP00000305107:T206A	ENSP00000305107:T206A	T	+	1	0	GIMAP8	149795335	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	0.138000	0.16016	0.237000	0.21200	-0.334000	0.08254	ACT	GIMAP8	-	NULL	ENSG00000171115		0.398	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	240	0.41	1	A	NM_175571		150164402	150164402	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	missense	189	26.46	68	SNP	0.000	G
GPI	2821	genome.wustl.edu	37	19	34870465	34870465	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr19:34870465A>G	ENST00000356487.5	+	8	989	c.748A>G	c.(748-750)Aca>Gca	p.T250A	GPI_ENST00000415930.3_Missense_Mutation_p.T261A|GPI_ENST00000586425.1_Missense_Mutation_p.T250A	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	250					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					GTCTACTAACACAGTAAGTGC	0.572																																						dbGAP											0													271.0	217.0	236.0					19																	34870465		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.748A>G	19.37:g.34870465A>G	ENSP00000348877:p.Thr250Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	pfam_G6P_Isomerase,prints_G6P_Isomerase	p.T261A	ENST00000356487.5	37	c.781	CCDS12437.1	19	.	.	.	.	.	.	.	.	.	.	A	4.647	0.120363	0.08881	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	D;D	0.93189	-3.18;-3.18	5.74	4.66	0.58398	.	0.152852	0.56097	D	0.000021	T	0.73916	0.3648	N	0.01410	-0.885	0.43863	D	0.996461	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.13407	0.002;0.009;0.002;0.0	T	0.70648	-0.4814	10	0.02654	T	1	-9.9627	3.313	0.07024	0.6672:0.0:0.3328:0.0	.	222;261;233;250	B4DE36;B4DG39;B4DVJ0;P06744	.;.;.;G6PI_HUMAN	A	261;250	ENSP00000405573:T261A;ENSP00000348877:T250A	ENSP00000348877:T250A	T	+	1	0	GPI	39562305	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.543000	0.82106	2.187000	0.69744	0.528000	0.53228	ACA	GPI	-	pfam_G6P_Isomerase	ENSG00000105220		0.572	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPI	HGNC	protein_coding	OTTHUMT00000451693.3	63	0.00	0	A			34870465	34870465	+1	no_errors	ENST00000415930	ensembl	human	known	69_37n	missense	99	13.16	15	SNP	1.000	G
GPI	2821	genome.wustl.edu	37	19	34870465	34870465	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr19:34870465A>G	ENST00000356487.5	+	8	989	c.748A>G	c.(748-750)Aca>Gca	p.T250A	GPI_ENST00000415930.3_Missense_Mutation_p.T261A|GPI_ENST00000586425.1_Missense_Mutation_p.T250A	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	250					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					GTCTACTAACACAGTAAGTGC	0.572																																						dbGAP											0													271.0	217.0	236.0					19																	34870465		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.748A>G	19.37:g.34870465A>G	ENSP00000348877:p.Thr250Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	pfam_G6P_Isomerase,prints_G6P_Isomerase	p.T261A	ENST00000356487.5	37	c.781	CCDS12437.1	19	.	.	.	.	.	.	.	.	.	.	A	4.647	0.120363	0.08881	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	D;D	0.93189	-3.18;-3.18	5.74	4.66	0.58398	.	0.152852	0.56097	D	0.000021	T	0.73916	0.3648	N	0.01410	-0.885	0.43863	D	0.996461	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.13407	0.002;0.009;0.002;0.0	T	0.70648	-0.4814	10	0.02654	T	1	-9.9627	3.313	0.07024	0.6672:0.0:0.3328:0.0	.	222;261;233;250	B4DE36;B4DG39;B4DVJ0;P06744	.;.;.;G6PI_HUMAN	A	261;250	ENSP00000405573:T261A;ENSP00000348877:T250A	ENSP00000348877:T250A	T	+	1	0	GPI	39562305	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.543000	0.82106	2.187000	0.69744	0.528000	0.53228	ACA	GPI	-	pfam_G6P_Isomerase	ENSG00000105220		0.572	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPI	HGNC	protein_coding	OTTHUMT00000451693.3	107	0.93	1	A			34870465	34870465	+1	no_errors	ENST00000415930	ensembl	human	known	69_37n	missense	99	13.16	15	SNP	1.000	G
HIST1H2AD	3013	genome.wustl.edu	37	6	26199318	26199318	+	Silent	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr6:26199318G>A	ENST00000341023.1	-	1	153	c.154C>T	c.(154-156)Ctg>Ttg	p.L52L	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	52						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				ACCGCCGCCAGATACACTGGC	0.682																																						dbGAP											0													32.0	38.0	36.0					6																	26199318		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.154C>T	6.37:g.26199318G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK91|P57754|Q6FGY6	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.L52	ENST00000341023.1	37	c.154	CCDS4591.1	6																																																																																			HIST1H2AD	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000196866		0.682	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AD	HGNC	protein_coding	OTTHUMT00000040100.1	63	0.00	0	G	NM_021065		26199318	26199318	-1	no_errors	ENST00000341023	ensembl	human	known	69_37n	silent	70	10.26	8	SNP	1.000	A
HIST1H2AD	3013	genome.wustl.edu	37	6	26199318	26199318	+	Silent	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr6:26199318G>A	ENST00000341023.1	-	1	153	c.154C>T	c.(154-156)Ctg>Ttg	p.L52L	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	52						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				ACCGCCGCCAGATACACTGGC	0.682																																						dbGAP											0													32.0	38.0	36.0					6																	26199318		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.154C>T	6.37:g.26199318G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK91|P57754|Q6FGY6	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.L52	ENST00000341023.1	37	c.154	CCDS4591.1	6																																																																																			HIST1H2AD	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000196866		0.682	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AD	HGNC	protein_coding	OTTHUMT00000040100.1	58	0.00	0	G	NM_021065		26199318	26199318	-1	no_errors	ENST00000341023	ensembl	human	known	69_37n	silent	70	10.26	8	SNP	1.000	A
HSPA1A	3303	genome.wustl.edu	37	6	31783755	31783755	+	Silent	SNP	T	T	C	rs1043620	byFrequency	TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr6:31783755T>C	ENST00000375651.5	+	1	465	c.222T>C	c.(220-222)atT>atC	p.I74I	HSPA1A_ENST00000458062.2_Intron|HSPA1L_ENST00000375654.4_5'Flank|HSPA1A_ENST00000608703.1_Intron|HSPA1L_ENST00000417199.3_5'Flank	NM_005345.5	NP_005336.3	P08107	HSP71_HUMAN	heat shock 70kDa protein 1A	74					ATP catabolic process (GO:0006200)|cellular heat acclimation (GO:0070370)|cellular response to heat (GO:0034605)|gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of erythrocyte differentiation (GO:0045648)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)	aggresome (GO:0016235)|blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|protein N-terminus binding (GO:0047485)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|virus receptor activity (GO:0001618)			endometrium(1)|ovary(1)|stomach(1)	3						AGCGGCTGATTGGCCGCAAGT	0.622													c|||	4824	0.963259	0.9932	0.964	5008	,	,		18506	0.9881		0.8917	False		,,,				2504	0.9703					dbGAP											0													2.0	3.0	2.0					6																	31783755		1369	2952	4321	-	-	-	SO:0001819	synonymous_variant	0			BC002453	CCDS34414.1	6p21.3	2012-10-02	2002-08-29		ENSG00000204389	ENSG00000204389		"""Heat shock proteins / HSP70"""	5232	protein-coding gene	gene with protein product		140550	"""heat shock 70kD protein 1A"""	HSPA1			Standard	NM_005345		Approved	HSP70-1	uc003nxj.3	P08107	OTTHUMG00000031201	ENST00000375651.5:c.222T>C	6.37:g.31783755T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B6|P19790|Q5JQI4|Q5SP17|Q9UQL9|Q9UQM0	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.I74	ENST00000375651.5	37	c.222	CCDS34414.1	6																																																																																			HSPA1A	-	pfam_Hsp_70_fam	ENSG00000204389		0.622	HSPA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA1A	HGNC	protein_coding	OTTHUMT00000076401.2	9	0.00	0	T			31783755	31783755	+1	no_errors	ENST00000375651	ensembl	human	known	69_37n	silent	11	45.00	9	SNP	0.999	C
KIF4A	24137	genome.wustl.edu	37	X	69623828	69623828	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chrX:69623828A>T	ENST00000374403.3	+	24	2816	c.2734A>T	c.(2734-2736)Ata>Tta	p.I912L	KIF4A_ENST00000374388.3_Missense_Mutation_p.I912L	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	912	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TTTTGCCGAGATAGAGACAGA	0.438																																						dbGAP											0													103.0	84.0	91.0					X																	69623828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2734A>T	X.37:g.69623828A>T	ENSP00000363524:p.Ile912Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I912L	ENST00000374403.3	37	c.2734	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	A	13.11	2.140747	0.37825	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.66995	-0.24;-0.18	4.73	3.56	0.40772	.	0.201161	0.34580	N	0.003854	T	0.47600	0.1454	N	0.22421	0.69	0.32037	N	0.598697	B	0.02656	0.0	B	0.04013	0.001	T	0.46596	-0.9180	9	.	.	.	.	8.7279	0.34480	0.9094:0.0:0.0906:0.0	.	912	O95239	KIF4A_HUMAN	L	912;912;214	ENSP00000363509:I912L;ENSP00000363524:I912L	.	I	+	1	0	KIF4A	69540553	1.000000	0.71417	0.961000	0.40146	0.997000	0.91878	2.889000	0.48601	0.644000	0.30656	0.481000	0.45027	ATA	KIF4A	-	NULL	ENSG00000090889		0.438	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	100	0.00	0	A	NM_012310		69623828	69623828	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	34	43.33	26	SNP	1.000	T
KIF4A	24137	genome.wustl.edu	37	X	69623828	69623828	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chrX:69623828A>T	ENST00000374403.3	+	24	2816	c.2734A>T	c.(2734-2736)Ata>Tta	p.I912L	KIF4A_ENST00000374388.3_Missense_Mutation_p.I912L	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	912	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TTTTGCCGAGATAGAGACAGA	0.438																																						dbGAP											0													103.0	84.0	91.0					X																	69623828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2734A>T	X.37:g.69623828A>T	ENSP00000363524:p.Ile912Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I912L	ENST00000374403.3	37	c.2734	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	A	13.11	2.140747	0.37825	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.66995	-0.24;-0.18	4.73	3.56	0.40772	.	0.201161	0.34580	N	0.003854	T	0.47600	0.1454	N	0.22421	0.69	0.32037	N	0.598697	B	0.02656	0.0	B	0.04013	0.001	T	0.46596	-0.9180	9	.	.	.	.	8.7279	0.34480	0.9094:0.0:0.0906:0.0	.	912	O95239	KIF4A_HUMAN	L	912;912;214	ENSP00000363509:I912L;ENSP00000363524:I912L	.	I	+	1	0	KIF4A	69540553	1.000000	0.71417	0.961000	0.40146	0.997000	0.91878	2.889000	0.48601	0.644000	0.30656	0.481000	0.45027	ATA	KIF4A	-	NULL	ENSG00000090889		0.438	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	54	0.00	0	A	NM_012310		69623828	69623828	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	34	43.33	26	SNP	1.000	T
LTBP4	8425	genome.wustl.edu	37	19	41133200	41133201	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr19:41133200_41133201insG	ENST00000308370.7	+	32	4504_4505	c.4504_4505insG	c.(4504-4506)cggfs	p.R1502fs	LTBP4_ENST00000243562.9_3'UTR|LTBP4_ENST00000204005.9_Frame_Shift_Ins_p.R1465fs|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000396819.3_Frame_Shift_Ins_p.R1435fs|LTBP4_ENST00000545697.1_Frame_Shift_Ins_p.R870fs	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1503					extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTATCGGTCCCGGGACACCCGC	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.4507dupG	19.37:g.41133203_41133203dupG	ENSP00000311905:p.Arg1502fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Frame_Shift_Ins	INS	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.D1503fs	ENST00000308370.7	37	c.4504_4505		19																																																																																			LTBP4	-	NULL	ENSG00000090006		0.653	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		11	0.00	0	-	NM_003573		41133200	41133201	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.993:0.784	G
MYO5C	55930	genome.wustl.edu	37	15	52569338	52569338	+	Intron	DEL	C	C	-			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr15:52569338delC	ENST00000261839.7	-	5	611				MYO5C_ENST00000443683.2_Intron|MIR1266_ENST00000408125.1_RNA|MYO5C_ENST00000541028.1_Intron	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC							extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		tccctcagggcatagaacagg	0.493																																						dbGAP											0													25.0	24.0	24.0					15																	52569338		1559	3568	5127	-	-	-	SO:0001627	intron_variant	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.450-1423G>-	15.37:g.52569338delC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1W8	RNA	DEL	-	NULL	ENST00000261839.7	37	NULL	CCDS42036.1	15																																																																																			MIR1266	-	-	ENSG00000221052		0.493	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1266	HGNC	protein_coding	OTTHUMT00000419562.1	42	0.00	0	C	NM_018728		52569338	52569338	-1	no_errors	ENST00000408125	ensembl	human	known	69_37n	rna	15	11.76	2	DEL	0.000	-
MKRN3	7681	genome.wustl.edu	37	15	23811294	23811294	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr15:23811294C>T	ENST00000314520.3	+	1	841	c.365C>T	c.(364-366)tCt>tTt	p.S122F	MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	122					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CACGACCTTTCTGGTCGGAAG	0.597																																						dbGAP											0													55.0	57.0	56.0					15																	23811294		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.365C>T	15.37:g.23811294C>T	ENSP00000313881:p.Ser122Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.S122F	ENST00000314520.3	37	c.365	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395427	0.62066	.	.	ENSG00000179455	ENST00000314520	T	0.36340	1.26	3.94	0.935	0.19483	Zinc finger, CCCH-type (1);	0.428519	0.22993	N	0.053176	T	0.25606	0.0623	L	0.49571	1.57	0.09310	N	0.999999	P	0.40476	0.718	B	0.36808	0.233	T	0.18524	-1.0334	10	0.87932	D	0	.	3.8413	0.08915	0.0:0.5722:0.2037:0.2241	.	122	Q13064	MKRN3_HUMAN	F	122	ENSP00000313881:S122F	ENSP00000313881:S122F	S	+	2	0	MKRN3	21362387	0.002000	0.14202	0.000000	0.03702	0.184000	0.23303	1.678000	0.37586	0.222000	0.20900	0.563000	0.77884	TCT	MKRN3	-	NULL	ENSG00000179455		0.597	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	54	0.00	0	C	NM_005664		23811294	23811294	+1	no_errors	ENST00000314520	ensembl	human	known	69_37n	missense	36	41.94	26	SNP	0.000	T
MKRN3	7681	genome.wustl.edu	37	15	23811294	23811294	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr15:23811294C>T	ENST00000314520.3	+	1	841	c.365C>T	c.(364-366)tCt>tTt	p.S122F	MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	122					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CACGACCTTTCTGGTCGGAAG	0.597																																						dbGAP											0													55.0	57.0	56.0					15																	23811294		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.365C>T	15.37:g.23811294C>T	ENSP00000313881:p.Ser122Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.S122F	ENST00000314520.3	37	c.365	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395427	0.62066	.	.	ENSG00000179455	ENST00000314520	T	0.36340	1.26	3.94	0.935	0.19483	Zinc finger, CCCH-type (1);	0.428519	0.22993	N	0.053176	T	0.25606	0.0623	L	0.49571	1.57	0.09310	N	0.999999	P	0.40476	0.718	B	0.36808	0.233	T	0.18524	-1.0334	10	0.87932	D	0	.	3.8413	0.08915	0.0:0.5722:0.2037:0.2241	.	122	Q13064	MKRN3_HUMAN	F	122	ENSP00000313881:S122F	ENSP00000313881:S122F	S	+	2	0	MKRN3	21362387	0.002000	0.14202	0.000000	0.03702	0.184000	0.23303	1.678000	0.37586	0.222000	0.20900	0.563000	0.77884	TCT	MKRN3	-	NULL	ENSG00000179455		0.597	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	40	0.00	0	C	NM_005664		23811294	23811294	+1	no_errors	ENST00000314520	ensembl	human	known	69_37n	missense	36	41.94	26	SNP	0.000	T
MMP27	64066	genome.wustl.edu	37	11	102575447	102575447	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr11:102575447C>G	ENST00000260229.4	-	2	253	c.162G>C	c.(160-162)aaG>aaC	p.K54N		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	54					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	GACTCCTATTCTTGCTTTGAA	0.373																																						dbGAP											0													71.0	69.0	69.0					11																	102575447		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.162G>C	11.37:g.102575447C>G	ENSP00000260229:p.Lys54Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK6	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.K54N	ENST00000260229.4	37	c.162	CCDS8319.1	11	.	.	.	.	.	.	.	.	.	.	c	3.111	-0.182628	0.06340	.	.	ENSG00000137675	ENST00000260229	T	0.36340	1.26	5.55	3.72	0.42706	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.654949	0.14649	N	0.306719	T	0.31857	0.0810	L	0.50919	1.6	0.09310	N	1	B	0.14438	0.01	B	0.24848	0.056	T	0.24404	-1.0161	10	0.38643	T	0.18	.	6.9658	0.24623	0.1247:0.6727:0.0:0.2026	.	54	Q9H306	MMP27_HUMAN	N	54	ENSP00000260229:K54N	ENSP00000260229:K54N	K	-	3	2	MMP27	102080657	0.000000	0.05858	0.780000	0.31762	0.025000	0.11179	-0.279000	0.08479	0.929000	0.37192	-0.185000	0.12909	AAG	MMP27	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_matrix_strom	ENSG00000137675		0.373	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	HGNC	protein_coding	OTTHUMT00000398128.1	220	0.00	0	C	NM_022122		102575447	102575447	-1	no_errors	ENST00000260229	ensembl	human	known	69_37n	missense	101	38.04	62	SNP	0.006	G
MMP27	64066	genome.wustl.edu	37	11	102575447	102575447	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr11:102575447C>G	ENST00000260229.4	-	2	253	c.162G>C	c.(160-162)aaG>aaC	p.K54N		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	54					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	GACTCCTATTCTTGCTTTGAA	0.373																																						dbGAP											0													71.0	69.0	69.0					11																	102575447		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.162G>C	11.37:g.102575447C>G	ENSP00000260229:p.Lys54Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK6	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.K54N	ENST00000260229.4	37	c.162	CCDS8319.1	11	.	.	.	.	.	.	.	.	.	.	c	3.111	-0.182628	0.06340	.	.	ENSG00000137675	ENST00000260229	T	0.36340	1.26	5.55	3.72	0.42706	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.654949	0.14649	N	0.306719	T	0.31857	0.0810	L	0.50919	1.6	0.09310	N	1	B	0.14438	0.01	B	0.24848	0.056	T	0.24404	-1.0161	10	0.38643	T	0.18	.	6.9658	0.24623	0.1247:0.6727:0.0:0.2026	.	54	Q9H306	MMP27_HUMAN	N	54	ENSP00000260229:K54N	ENSP00000260229:K54N	K	-	3	2	MMP27	102080657	0.000000	0.05858	0.780000	0.31762	0.025000	0.11179	-0.279000	0.08479	0.929000	0.37192	-0.185000	0.12909	AAG	MMP27	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_matrix_strom	ENSG00000137675		0.373	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	HGNC	protein_coding	OTTHUMT00000398128.1	169	0.00	0	C	NM_022122		102575447	102575447	-1	no_errors	ENST00000260229	ensembl	human	known	69_37n	missense	101	38.04	62	SNP	0.006	G
NBPF12	149013	genome.wustl.edu	37	1	146459553	146459556	+	Frame_Shift_Del	DEL	GATA	GATA	-			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	GATA	GATA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr1:146459553_146459556delGATA	ENST00000442909.2	+	74	9630_9633	c.8794_8797delGATA	c.(8794-8799)gatagafs	p.DR2932fs	NBPF12_ENST00000446760.2_Intron|NBPF12_ENST00000309471.8_Intron|NBPF12_ENST00000446080.2_Intron|NBPF12_ENST00000537773.1_3'UTR			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	114						cytoplasm (GO:0005737)				ovary(2)	2						GGACTCACTGGATAGATGTTATTC	0.466																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.8794_8797delGATA	1.37:g.146459553_146459556delGATA	ENSP00000391116:p.Asp2932fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O95877	Frame_Shift_Del	DEL	pfam_NBPF_dom	p.R2933fs	ENST00000442909.2	37	c.8794_8797		1																																																																																			NBPF12	-	pfam_NBPF_dom	ENSG00000186275		0.466	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	NBPF12	HGNC	protein_coding	OTTHUMT00000102086.3	16	0.00	0	GATA	XM_003119146		146459553	146459556	+1	no_errors	ENST00000442909	ensembl	human	novel	69_37n	frame_shift_del	33	15.38	6	DEL	0.160:0.145:0.119:0.077	-
NLRP7	199713	genome.wustl.edu	37	19	55450913	55450913	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr19:55450913G>A	ENST00000590030.1	-	3	1314	c.1274C>T	c.(1273-1275)gCg>gTg	p.A425V	NLRP7_ENST00000592784.1_Missense_Mutation_p.A425V|NLRP7_ENST00000588756.1_Missense_Mutation_p.A425V|NLRP7_ENST00000448121.2_Missense_Mutation_p.A425V|NLRP7_ENST00000340844.2_Missense_Mutation_p.A425V|NLRP7_ENST00000328092.5_Missense_Mutation_p.A425V|NLRP7_ENST00000446217.1_Missense_Mutation_p.A453V			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	425	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GGACATCTGCGCCCACAGGCC	0.692																																						dbGAP											0													31.0	27.0	28.0					19																	55450913		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1274C>T	19.37:g.55450913G>A	ENSP00000465520:p.Ala425Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A453V	ENST00000590030.1	37	c.1358	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374044	0.42105	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.73681	-0.71;-0.71;-0.77;-0.74	2.06	1.01	0.19927	.	1.490780	0.04758	N	0.425805	T	0.75686	0.3883	L	0.58101	1.795	0.09310	N	1	D;D;D;D	0.65815	0.995;0.99;0.99;0.988	P;P;P;P	0.52646	0.591;0.591;0.591;0.705	T	0.59252	-0.7489	10	0.51188	T	0.08	.	2.732	0.05230	0.1662:0.0:0.5564:0.2775	.	453;425;425;425	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	V	425;425;425;453;192	ENSP00000329568:A425V;ENSP00000409137:A425V;ENSP00000339491:A425V;ENSP00000414273:A453V	ENSP00000329568:A425V	A	-	2	0	NLRP7	60142725	0.010000	0.17322	0.001000	0.08648	0.004000	0.04260	0.953000	0.29162	0.436000	0.26393	0.462000	0.41574	GCG	NLRP7	-	NULL	ENSG00000167634		0.692	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	46	0.00	0	G	NM_139176		55450913	55450913	-1	no_errors	ENST00000446217	ensembl	human	known	69_37n	missense	61	22.50	18	SNP	0.000	A
NLRP7	199713	genome.wustl.edu	37	19	55450913	55450913	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr19:55450913G>A	ENST00000590030.1	-	3	1314	c.1274C>T	c.(1273-1275)gCg>gTg	p.A425V	NLRP7_ENST00000592784.1_Missense_Mutation_p.A425V|NLRP7_ENST00000588756.1_Missense_Mutation_p.A425V|NLRP7_ENST00000448121.2_Missense_Mutation_p.A425V|NLRP7_ENST00000340844.2_Missense_Mutation_p.A425V|NLRP7_ENST00000328092.5_Missense_Mutation_p.A425V|NLRP7_ENST00000446217.1_Missense_Mutation_p.A453V			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	425	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GGACATCTGCGCCCACAGGCC	0.692																																						dbGAP											0													31.0	27.0	28.0					19																	55450913		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1274C>T	19.37:g.55450913G>A	ENSP00000465520:p.Ala425Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A453V	ENST00000590030.1	37	c.1358	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374044	0.42105	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.73681	-0.71;-0.71;-0.77;-0.74	2.06	1.01	0.19927	.	1.490780	0.04758	N	0.425805	T	0.75686	0.3883	L	0.58101	1.795	0.09310	N	1	D;D;D;D	0.65815	0.995;0.99;0.99;0.988	P;P;P;P	0.52646	0.591;0.591;0.591;0.705	T	0.59252	-0.7489	10	0.51188	T	0.08	.	2.732	0.05230	0.1662:0.0:0.5564:0.2775	.	453;425;425;425	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	V	425;425;425;453;192	ENSP00000329568:A425V;ENSP00000409137:A425V;ENSP00000339491:A425V;ENSP00000414273:A453V	ENSP00000329568:A425V	A	-	2	0	NLRP7	60142725	0.010000	0.17322	0.001000	0.08648	0.004000	0.04260	0.953000	0.29162	0.436000	0.26393	0.462000	0.41574	GCG	NLRP7	-	NULL	ENSG00000167634		0.692	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	38	0.00	0	G	NM_139176		55450913	55450913	-1	no_errors	ENST00000446217	ensembl	human	known	69_37n	missense	61	22.50	18	SNP	0.000	A
NOP14	8602	genome.wustl.edu	37	4	2952750	2952750	+	Intron	SNP	C	C	G	rs200049113		TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr4:2952750C>G	ENST00000314262.6	-	7	1051				NOP14_ENST00000502735.1_Intron|NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000398071.4_Intron|NOP14_ENST00000416614.2_Intron|NOP14-AS1_ENST00000503709.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TTAAAATTCCCAACTGTAATA	0.264																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1002+90G>C	4.37:g.2952750C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	RNA	SNP	-	NULL	ENST00000314262.6	37	NULL	CCDS33945.1	4																																																																																			NOP14-AS1	-	-	ENSG00000249673		0.264	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14-AS1	HGNC	protein_coding	OTTHUMT00000358135.2	96	0.00	0	C	NM_003703		2952750	2952750	+1	no_errors	ENST00000515194	ensembl	human	known	69_37n	rna	39	36.07	22	SNP	0.004	G
NOP14	8602	genome.wustl.edu	37	4	2952750	2952750	+	Intron	SNP	C	C	G	rs200049113		TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr4:2952750C>G	ENST00000314262.6	-	7	1051				NOP14_ENST00000502735.1_Intron|NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000398071.4_Intron|NOP14_ENST00000416614.2_Intron|NOP14-AS1_ENST00000503709.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TTAAAATTCCCAACTGTAATA	0.264																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1002+90G>C	4.37:g.2952750C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	RNA	SNP	-	NULL	ENST00000314262.6	37	NULL	CCDS33945.1	4																																																																																			NOP14-AS1	-	-	ENSG00000249673		0.264	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14-AS1	HGNC	protein_coding	OTTHUMT00000358135.2	56	0.00	0	C	NM_003703		2952750	2952750	+1	no_errors	ENST00000515194	ensembl	human	known	69_37n	rna	39	36.07	22	SNP	0.004	G
NOS1	4842	genome.wustl.edu	37	12	117723956	117723956	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr12:117723956G>A	ENST00000338101.4	-	5	1247	c.1243C>T	c.(1243-1245)Cgg>Tgg	p.R415W	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.R415W			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GAGGCATTCCGCCAGGCGTGC	0.552																																					Esophageal Squamous(162;1748 2599 51982 52956)	dbGAP											0													145.0	145.0	145.0					12																	117723956		2166	4296	6462	-	-	-	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1243C>T	12.37:g.117723956G>A	ENSP00000337459:p.Arg415Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_met,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.R415W	ENST00000338101.4	37	c.1243	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819133	0.71028	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.62498	0.02;0.02	4.93	0.378	0.16204	Nitric oxide synthase, oxygenase domain (3);	0.000000	0.85682	D	0.000000	D	0.84451	0.5475	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89742	0.3934	10	0.87932	D	0	-24.7757	16.6112	0.84883	0.0:0.0:0.403:0.597	.	415	P29475	NOS1_HUMAN	W	415	ENSP00000320758:R415W;ENSP00000337459:R415W	ENSP00000320758:R415W	R	-	1	2	NOS1	116208339	0.998000	0.40836	0.999000	0.59377	0.952000	0.60782	0.399000	0.20916	0.203000	0.20529	0.591000	0.81541	CGG	NOS1	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_met	ENSG00000089250		0.552	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	80	0.00	0	G			117723956	117723956	-1	no_errors	ENST00000317775	ensembl	human	known	69_37n	missense	47	50.00	47	SNP	0.997	A
PCDHGB3	56102	genome.wustl.edu	37	5	140750987	140750987	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr5:140750987C>A	ENST00000576222.1	+	1	1157	c.1026C>A	c.(1024-1026)gaC>gaA	p.D342E	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	342	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAAAATGACAATGCCCCGG	0.433																																						dbGAP											0													58.0	59.0	59.0					5																	140750987		1925	4140	6065	-	-	-	SO:0001583	missense	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1026C>A	5.37:g.140750987C>A	ENSP00000461862:p.Asp342Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D342E	ENST00000576222.1	37	c.1026	CCDS58980.1	5																																																																																			PCDHGB3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000262209		0.433	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	174	0.00	0	C	NM_018924		140750987	140750987	+1	no_errors	ENST00000576222	ensembl	human	known	69_37n	missense	168	17.24	35	SNP	1.000	A
PCDHGB3	56102	genome.wustl.edu	37	5	140750987	140750987	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr5:140750987C>A	ENST00000576222.1	+	1	1157	c.1026C>A	c.(1024-1026)gaC>gaA	p.D342E	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	342	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAAAATGACAATGCCCCGG	0.433																																						dbGAP											0													58.0	59.0	59.0					5																	140750987		1925	4140	6065	-	-	-	SO:0001583	missense	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1026C>A	5.37:g.140750987C>A	ENSP00000461862:p.Asp342Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D342E	ENST00000576222.1	37	c.1026	CCDS58980.1	5																																																																																			PCDHGB3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000262209		0.433	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	74	0.00	0	C	NM_018924		140750987	140750987	+1	no_errors	ENST00000576222	ensembl	human	known	69_37n	missense	168	17.24	35	SNP	1.000	A
PCDHGB3	56102	genome.wustl.edu	37	5	140751317	140751317	+	Silent	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr5:140751317C>T	ENST00000576222.1	+	1	1487	c.1356C>T	c.(1354-1356)ttC>ttT	p.F452F	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCCGTTTTCCACCAGGCCT	0.557																																						dbGAP											0													168.0	172.0	171.0					5																	140751317		2167	4264	6431	-	-	-	SO:0001819	synonymous_variant	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1356C>T	5.37:g.140751317C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E229|Q9Y5C7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.F452	ENST00000576222.1	37	c.1356	CCDS58980.1	5																																																																																			PCDHGB3	-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000262209		0.557	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	251	0.00	0	C	NM_018924		140751317	140751317	+1	no_errors	ENST00000576222	ensembl	human	known	69_37n	silent	308	15.15	55	SNP	0.913	T
PCDHGB3	56102	genome.wustl.edu	37	5	140751317	140751317	+	Silent	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr5:140751317C>T	ENST00000576222.1	+	1	1487	c.1356C>T	c.(1354-1356)ttC>ttT	p.F452F	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCCGTTTTCCACCAGGCCT	0.557																																						dbGAP											0													168.0	172.0	171.0					5																	140751317		2167	4264	6431	-	-	-	SO:0001819	synonymous_variant	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1356C>T	5.37:g.140751317C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E229|Q9Y5C7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.F452	ENST00000576222.1	37	c.1356	CCDS58980.1	5																																																																																			PCDHGB3	-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000262209		0.557	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	134	0.00	0	C	NM_018924		140751317	140751317	+1	no_errors	ENST00000576222	ensembl	human	known	69_37n	silent	308	15.15	55	SNP	0.913	T
OR2V2	285659	genome.wustl.edu	37	5	180582416	180582416	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr5:180582416G>C	ENST00000328275.1	+	1	474	c.474G>C	c.(472-474)ttG>ttC	p.L158F		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L158F(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCGATGGCTTGATCCAGATGG	0.493																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											219.0	209.0	212.0					5																	180582416		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.474G>C	5.37:g.180582416G>C	ENSP00000332185:p.Leu158Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFL6|Q8NGV1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L158F	ENST00000328275.1	37	c.474	CCDS4461.1	5	.	.	.	.	.	.	.	.	.	.	.	0.108	-1.142185	0.01728	.	.	ENSG00000182613	ENST00000328275	T	0.00274	8.35	3.27	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	1.488390	0.05075	N	0.482350	T	0.00210	0.0006	L	0.33093	0.98	0.19945	N	0.999947	P	0.49307	0.922	P	0.46850	0.529	T	0.45293	-0.9271	10	0.06099	T	0.92	.	7.9848	0.30205	0.0:0.0:0.5571:0.4429	.	158	Q96R30	OR2V2_HUMAN	F	158	ENSP00000332185:L158F	ENSP00000332185:L158F	L	+	3	2	OR2V2	180515022	0.000000	0.05858	0.490000	0.27465	0.026000	0.11368	-0.471000	0.06631	0.670000	0.31165	0.305000	0.20034	TTG	OR2V2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000182613		0.493	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V2	HGNC	protein_coding	OTTHUMT00000253529.1	347	0.00	0	G			180582416	180582416	+1	no_errors	ENST00000328275	ensembl	human	known	69_37n	missense	263	40.77	181	SNP	0.347	C
OR2V2	285659	genome.wustl.edu	37	5	180582416	180582416	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr5:180582416G>C	ENST00000328275.1	+	1	474	c.474G>C	c.(472-474)ttG>ttC	p.L158F		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L158F(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCGATGGCTTGATCCAGATGG	0.493																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											219.0	209.0	212.0					5																	180582416		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.474G>C	5.37:g.180582416G>C	ENSP00000332185:p.Leu158Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFL6|Q8NGV1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L158F	ENST00000328275.1	37	c.474	CCDS4461.1	5	.	.	.	.	.	.	.	.	.	.	.	0.108	-1.142185	0.01728	.	.	ENSG00000182613	ENST00000328275	T	0.00274	8.35	3.27	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	1.488390	0.05075	N	0.482350	T	0.00210	0.0006	L	0.33093	0.98	0.19945	N	0.999947	P	0.49307	0.922	P	0.46850	0.529	T	0.45293	-0.9271	10	0.06099	T	0.92	.	7.9848	0.30205	0.0:0.0:0.5571:0.4429	.	158	Q96R30	OR2V2_HUMAN	F	158	ENSP00000332185:L158F	ENSP00000332185:L158F	L	+	3	2	OR2V2	180515022	0.000000	0.05858	0.490000	0.27465	0.026000	0.11368	-0.471000	0.06631	0.670000	0.31165	0.305000	0.20034	TTG	OR2V2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000182613		0.493	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V2	HGNC	protein_coding	OTTHUMT00000253529.1	304	0.00	0	G			180582416	180582416	+1	no_errors	ENST00000328275	ensembl	human	known	69_37n	missense	263	40.77	181	SNP	0.347	C
POTEM	641455	genome.wustl.edu	37	14	20019842	20019842	+	Missense_Mutation	SNP	C	C	T	rs201157355	byFrequency	TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr14:20019842C>T	ENST00000551509.1	-	1	430	c.379G>A	c.(379-381)Gct>Act	p.A127T		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	127										endometrium(4)|kidney(1)|lung(4)	9						TCCATGAAAGCGCTGTCGTCG	0.597																																						dbGAP											0													38.0	47.0	45.0					14																	20019842		334	1037	1371	-	-	-	SO:0001583	missense	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.379G>A	14.37:g.20019842C>T	ENSP00000452296:p.Ala127Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A127T	ENST00000551509.1	37	c.379	CCDS45076.1	14	.	.	.	.	.	.	.	.	.	.	c	11.91	1.780130	0.31502	.	.	ENSG00000187537	ENST00000551509;ENST00000439503;ENST00000344684	T	0.27256	1.68	0.593	0.593	0.17478	.	.	.	.	.	T	0.39036	0.1063	L	0.58101	1.795	0.09310	N	1	D	0.76494	0.999	D	0.63033	0.91	T	0.14062	-1.0486	7	.	.	.	.	.	.	.	.	127	A6NI47	POTEM_HUMAN	T	127	ENSP00000452296:A127T	.	A	-	1	0	POTEM	19089842	0.001000	0.12720	0.005000	0.12908	0.014000	0.08584	1.342000	0.33919	0.593000	0.29745	0.162000	0.16502	GCT	POTEM	-	NULL	ENSG00000187537		0.597	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	16	0.00	0	C	NM_001145442		20019842	20019842	-1	no_errors	ENST00000547848	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.005	T
PRKRA	8575	genome.wustl.edu	37	2	179300974	179300974	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr2:179300974A>T	ENST00000325748.4	-	7	882	c.682T>A	c.(682-684)Tta>Ata	p.L228I	AC009948.5_ENST00000454488.1_RNA|PRKRA_ENST00000487082.1_Missense_Mutation_p.L203I|PRKRA_ENST00000438687.3_Missense_Mutation_p.L115I|AC009948.5_ENST00000436616.2_RNA|PRKRA_ENST00000432031.2_Missense_Mutation_p.L217I|AC009948.5_ENST00000453026.2_RNA	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator	228	Sufficient for self-association and interaction with TARBP2.				cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			CTTTTCAGTAAGTTGATCTTT	0.348																																					Melanoma(200;68 3001 23825 48764)	dbGAP											0													159.0	182.0	174.0					2																	179300974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.682T>A	2.37:g.179300974A>T	ENSP00000318176:p.Leu228Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Missense_Mutation	SNP	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	p.L228I	ENST00000325748.4	37	c.682	CCDS2279.1	2	.	.	.	.	.	.	.	.	.	.	A	14.89	2.671596	0.47781	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	T;T;T;T	0.72505	-0.64;-0.66;-0.63;-0.63	5.92	0.967	0.19674	.	0.096180	0.39475	N	0.001359	T	0.53238	0.1784	L	0.43152	1.355	0.34329	D	0.687422	B;P	0.37207	0.105;0.587	B;B	0.31290	0.02;0.127	T	0.55477	-0.8135	10	0.19590	T	0.45	.	8.8378	0.35123	0.5889:0.0:0.4111:0.0	.	228;217	O75569;O75569-2	PRKRA_HUMAN;.	I	228;115;203;217	ENSP00000318176:L228I;ENSP00000398980:L115I;ENSP00000430604:L203I;ENSP00000393883:L217I	ENSP00000318176:L228I	L	-	1	2	PRKRA	179009220	0.999000	0.42202	0.997000	0.53966	0.989000	0.77384	0.701000	0.25616	-0.049000	0.13379	-0.263000	0.10527	TTA	PRKRA	-	NULL	ENSG00000180228		0.348	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRA	HGNC	protein_coding	OTTHUMT00000255782.2	355	0.00	0	A	NM_003690		179300974	179300974	-1	no_errors	ENST00000325748	ensembl	human	known	69_37n	missense	184	18.58	42	SNP	0.998	T
PRKRA	8575	genome.wustl.edu	37	2	179300974	179300974	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr2:179300974A>T	ENST00000325748.4	-	7	882	c.682T>A	c.(682-684)Tta>Ata	p.L228I	AC009948.5_ENST00000454488.1_RNA|PRKRA_ENST00000487082.1_Missense_Mutation_p.L203I|PRKRA_ENST00000438687.3_Missense_Mutation_p.L115I|AC009948.5_ENST00000436616.2_RNA|PRKRA_ENST00000432031.2_Missense_Mutation_p.L217I|AC009948.5_ENST00000453026.2_RNA	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator	228	Sufficient for self-association and interaction with TARBP2.				cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			CTTTTCAGTAAGTTGATCTTT	0.348																																					Melanoma(200;68 3001 23825 48764)	dbGAP											0													159.0	182.0	174.0					2																	179300974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.682T>A	2.37:g.179300974A>T	ENSP00000318176:p.Leu228Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Missense_Mutation	SNP	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	p.L228I	ENST00000325748.4	37	c.682	CCDS2279.1	2	.	.	.	.	.	.	.	.	.	.	A	14.89	2.671596	0.47781	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	T;T;T;T	0.72505	-0.64;-0.66;-0.63;-0.63	5.92	0.967	0.19674	.	0.096180	0.39475	N	0.001359	T	0.53238	0.1784	L	0.43152	1.355	0.34329	D	0.687422	B;P	0.37207	0.105;0.587	B;B	0.31290	0.02;0.127	T	0.55477	-0.8135	10	0.19590	T	0.45	.	8.8378	0.35123	0.5889:0.0:0.4111:0.0	.	228;217	O75569;O75569-2	PRKRA_HUMAN;.	I	228;115;203;217	ENSP00000318176:L228I;ENSP00000398980:L115I;ENSP00000430604:L203I;ENSP00000393883:L217I	ENSP00000318176:L228I	L	-	1	2	PRKRA	179009220	0.999000	0.42202	0.997000	0.53966	0.989000	0.77384	0.701000	0.25616	-0.049000	0.13379	-0.263000	0.10527	TTA	PRKRA	-	NULL	ENSG00000180228		0.348	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRA	HGNC	protein_coding	OTTHUMT00000255782.2	219	0.00	0	A	NM_003690		179300974	179300974	-1	no_errors	ENST00000325748	ensembl	human	known	69_37n	missense	184	18.58	42	SNP	0.998	T
RLF	6018	genome.wustl.edu	37	1	40654738	40654738	+	Silent	SNP	A	A	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr1:40654738A>G	ENST00000372771.4	+	2	276	c.249A>G	c.(247-249)caA>caG	p.Q83Q		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	83					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			CCTTATTGCAATATGCAAGCA	0.338																																						dbGAP											0													68.0	56.0	60.0					1																	40654738		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.249A>G	1.37:g.40654738A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ1|Q9NU60	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q83	ENST00000372771.4	37	c.249	CCDS448.1	1																																																																																			RLF	-	NULL	ENSG00000117000		0.338	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	40	0.00	0	A	NM_012421		40654738	40654738	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	silent	65	23.53	20	SNP	0.998	G
SCN2A	6326	genome.wustl.edu	37	2	166246050	166246050	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr2:166246050A>T	ENST00000375437.2	+	27	6024	c.5734A>T	c.(5734-5736)Atc>Ttc	p.I1912F	SCN2A_ENST00000283256.6_Missense_Mutation_p.I1912F|SCN2A_ENST00000357398.3_Missense_Mutation_p.I1912F|SCN2A_ENST00000375427.2_Missense_Mutation_p.I1912F	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1912	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTATTATTATCCAGAGGGC	0.423																																						dbGAP											0													82.0	77.0	79.0					2																	166246050		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5734A>T	2.37:g.166246050A>T	ENSP00000364586:p.Ile1912Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.I1912F	ENST00000375437.2	37	c.5734	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	18.87	3.716444	0.68844	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	D	0.98877	0.9620	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.995	D	0.99787	1.1030	10	0.87932	D	0	.	16.2632	0.82562	1.0:0.0:0.0:0.0	.	1912;1912	Q99250-2;Q99250	.;SCN2A_HUMAN	F	1912	ENSP00000364586:I1912F;ENSP00000349973:I1912F;ENSP00000283256:I1912F;ENSP00000364576:I1912F	ENSP00000283256:I1912F	I	+	1	0	SCN2A	165954296	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	9.339000	0.96797	2.247000	0.74100	0.477000	0.44152	ATC	SCN2A	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000136531		0.423	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	579	0.17	1	A	NM_021007		166246050	166246050	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	235	21.40	64	SNP	1.000	T
SCN2A	6326	genome.wustl.edu	37	2	166246050	166246050	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr2:166246050A>T	ENST00000375437.2	+	27	6024	c.5734A>T	c.(5734-5736)Atc>Ttc	p.I1912F	SCN2A_ENST00000283256.6_Missense_Mutation_p.I1912F|SCN2A_ENST00000357398.3_Missense_Mutation_p.I1912F|SCN2A_ENST00000375427.2_Missense_Mutation_p.I1912F	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1912	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTATTATTATCCAGAGGGC	0.423																																						dbGAP											0													82.0	77.0	79.0					2																	166246050		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5734A>T	2.37:g.166246050A>T	ENSP00000364586:p.Ile1912Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.I1912F	ENST00000375437.2	37	c.5734	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	18.87	3.716444	0.68844	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	D	0.98877	0.9620	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.995	D	0.99787	1.1030	10	0.87932	D	0	.	16.2632	0.82562	1.0:0.0:0.0:0.0	.	1912;1912	Q99250-2;Q99250	.;SCN2A_HUMAN	F	1912	ENSP00000364586:I1912F;ENSP00000349973:I1912F;ENSP00000283256:I1912F;ENSP00000364576:I1912F	ENSP00000283256:I1912F	I	+	1	0	SCN2A	165954296	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	9.339000	0.96797	2.247000	0.74100	0.477000	0.44152	ATC	SCN2A	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000136531		0.423	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	309	0.00	0	A	NM_021007		166246050	166246050	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	235	21.40	64	SNP	1.000	T
SCN7A	6332	genome.wustl.edu	37	2	167298131	167298131	+	Missense_Mutation	SNP	G	G	T	rs72886662	byFrequency	TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr2:167298131G>T	ENST00000409855.1	-	14	2058	c.1932C>A	c.(1930-1932)ttC>ttA	p.F644L		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	644					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GCTTCATGCCGAATGCAGCAG	0.433																																						dbGAP											0													111.0	116.0	114.0					2																	167298131		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1932C>A	2.37:g.167298131G>T	ENSP00000386796:p.Phe644Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.F644L	ENST00000409855.1	37	c.1932	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	G	9.789	1.177279	0.21787	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.98329	-4.87;-4.87	4.78	-4.23	0.03789	Ion transport (1);	0.696895	0.13020	N	0.420173	D	0.92047	0.7480	N	0.03917	-0.325	0.32780	N	0.502605	B	0.06786	0.001	B	0.09377	0.004	T	0.79579	-0.1745	10	0.87932	D	0	.	12.3038	0.54889	0.4731:0.0:0.5269:0.0	.	644	Q01118	SCN7A_HUMAN	L	644	ENSP00000386796:F644L;ENSP00000413699:F644L	ENSP00000259060:F644L	F	-	3	2	SCN7A	167006377	0.202000	0.23423	0.228000	0.23943	0.048000	0.14542	-0.344000	0.07780	-0.849000	0.04158	-1.353000	0.01230	TTC	SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.433	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	473	0.00	0	G			167298131	167298131	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	310	25.12	104	SNP	0.987	T
SCN7A	6332	genome.wustl.edu	37	2	167298131	167298131	+	Missense_Mutation	SNP	G	G	T	rs72886662	byFrequency	TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr2:167298131G>T	ENST00000409855.1	-	14	2058	c.1932C>A	c.(1930-1932)ttC>ttA	p.F644L		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	644					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GCTTCATGCCGAATGCAGCAG	0.433																																						dbGAP											0													111.0	116.0	114.0					2																	167298131		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1932C>A	2.37:g.167298131G>T	ENSP00000386796:p.Phe644Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.F644L	ENST00000409855.1	37	c.1932	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	G	9.789	1.177279	0.21787	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.98329	-4.87;-4.87	4.78	-4.23	0.03789	Ion transport (1);	0.696895	0.13020	N	0.420173	D	0.92047	0.7480	N	0.03917	-0.325	0.32780	N	0.502605	B	0.06786	0.001	B	0.09377	0.004	T	0.79579	-0.1745	10	0.87932	D	0	.	12.3038	0.54889	0.4731:0.0:0.5269:0.0	.	644	Q01118	SCN7A_HUMAN	L	644	ENSP00000386796:F644L;ENSP00000413699:F644L	ENSP00000259060:F644L	F	-	3	2	SCN7A	167006377	0.202000	0.23423	0.228000	0.23943	0.048000	0.14542	-0.344000	0.07780	-0.849000	0.04158	-1.353000	0.01230	TTC	SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.433	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	278	0.00	0	G			167298131	167298131	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	310	25.12	104	SNP	0.987	T
SEPHS1	22929	genome.wustl.edu	37	10	13386865	13386865	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr10:13386865G>A	ENST00000327347.5	-	2	461	c.86C>T	c.(85-87)aCa>aTa	p.T29I	SEPHS1_ENST00000378614.4_Missense_Mutation_p.T29I|SEPHS1_ENST00000537130.1_Intron|SEPHS1_ENST00000545675.1_Missense_Mutation_p.T29I|SEPHS1_ENST00000494329.1_5'UTR	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	29					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						TTTGCAGCCTGTGCCCTTCAG	0.502																																						dbGAP											0													121.0	127.0	125.0					10																	13386865		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.86C>T	10.37:g.13386865G>A	ENSP00000367893:p.Thr29Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	pfam_AIR_synth_C,pfam_AIR_synth,superfamily_AIR_synth_C,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.T29I	ENST00000327347.5	37	c.86	CCDS7098.1	10	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775088	0.49786	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000545675;ENST00000413411	T;T;T	0.42900	0.96;0.97;0.97	4.7	4.7	0.59300	.	.	.	.	.	T	0.36386	0.0965	L	0.44542	1.39	0.80722	D	1	B;B;B;B	0.31100	0.308;0.046;0.105;0.046	B;B;B;B	0.20384	0.029;0.016;0.025;0.016	T	0.36962	-0.9726	9	0.87932	D	0	-10.3677	16.6278	0.84984	0.0:0.0:1.0:0.0	.	29;29;29;29	Q5T5U9;P49903;D6PSQ9;D3DRS9	.;SPS1_HUMAN;.;.	I	29	ENSP00000367893:T29I;ENSP00000367877:T29I;ENSP00000441119:T29I	ENSP00000367887:T29I	T	-	2	0	SEPHS1	13426871	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	6.485000	0.73625	2.148000	0.66965	0.313000	0.20887	ACA	SEPHS1	-	pirsf_SelD,tigrfam_SelD	ENSG00000086475		0.502	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPHS1	HGNC	protein_coding	OTTHUMT00000046856.1	313	0.00	0	G	NM_012247		13386865	13386865	-1	no_errors	ENST00000327347	ensembl	human	known	69_37n	missense	56	69.06	125	SNP	1.000	A
SEPHS1	22929	genome.wustl.edu	37	10	13386865	13386865	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr10:13386865G>A	ENST00000327347.5	-	2	461	c.86C>T	c.(85-87)aCa>aTa	p.T29I	SEPHS1_ENST00000378614.4_Missense_Mutation_p.T29I|SEPHS1_ENST00000537130.1_Intron|SEPHS1_ENST00000545675.1_Missense_Mutation_p.T29I|SEPHS1_ENST00000494329.1_5'UTR	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	29					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						TTTGCAGCCTGTGCCCTTCAG	0.502																																						dbGAP											0													121.0	127.0	125.0					10																	13386865		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.86C>T	10.37:g.13386865G>A	ENSP00000367893:p.Thr29Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	pfam_AIR_synth_C,pfam_AIR_synth,superfamily_AIR_synth_C,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.T29I	ENST00000327347.5	37	c.86	CCDS7098.1	10	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775088	0.49786	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000545675;ENST00000413411	T;T;T	0.42900	0.96;0.97;0.97	4.7	4.7	0.59300	.	.	.	.	.	T	0.36386	0.0965	L	0.44542	1.39	0.80722	D	1	B;B;B;B	0.31100	0.308;0.046;0.105;0.046	B;B;B;B	0.20384	0.029;0.016;0.025;0.016	T	0.36962	-0.9726	9	0.87932	D	0	-10.3677	16.6278	0.84984	0.0:0.0:1.0:0.0	.	29;29;29;29	Q5T5U9;P49903;D6PSQ9;D3DRS9	.;SPS1_HUMAN;.;.	I	29	ENSP00000367893:T29I;ENSP00000367877:T29I;ENSP00000441119:T29I	ENSP00000367887:T29I	T	-	2	0	SEPHS1	13426871	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	6.485000	0.73625	2.148000	0.66965	0.313000	0.20887	ACA	SEPHS1	-	pirsf_SelD,tigrfam_SelD	ENSG00000086475		0.502	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPHS1	HGNC	protein_coding	OTTHUMT00000046856.1	118	0.00	0	G	NM_012247		13386865	13386865	-1	no_errors	ENST00000327347	ensembl	human	known	69_37n	missense	56	69.06	125	SNP	1.000	A
SEPT10	151011	genome.wustl.edu	37	2	110301779	110301779	+	3'UTR	SNP	A	A	C	rs200598502	byFrequency	TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr2:110301779A>C	ENST00000397712.2	-	0	1850				SEPT10_ENST00000356688.4_Missense_Mutation_p.F519V|SEPT10_ENST00000397714.2_3'UTR|SEPT10_ENST00000334001.6_3'UTR|SEPT10_ENST00000468616.1_5'Flank	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10						cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						TGTTCACCAAATATAGAAGTG	0.338																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.*107T>G	2.37:g.110301779A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRQ9|Q86VP5|Q9HAH6	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd	p.F519V	ENST00000397712.2	37	c.1555	CCDS46383.1	2	.	.	.	.	.	.	.	.	.	.	A	8.972	0.973228	0.18736	.	.	ENSG00000186522	ENST00000356688	T	0.54279	0.58	5.37	1.66	0.24008	.	1.901300	0.02724	N	0.114273	T	0.40645	0.1125	.	.	.	0.20638	N	0.999879	B	0.06786	0.001	B	0.08055	0.003	T	0.31194	-0.9952	9	0.87932	D	0	.	2.1719	0.03852	0.5923:0.1635:0.0874:0.1567	.	519	B5ME97	.	V	519	ENSP00000349116:F519V	ENSP00000349116:F519V	F	-	1	0	SEPT10	109659068	0.087000	0.21565	0.491000	0.27477	0.028000	0.11728	0.685000	0.25378	0.099000	0.17552	0.482000	0.46254	TTT	SEPT10	-	NULL	ENSG00000186522		0.338	SEPT10-001	KNOWN	basic|CCDS	protein_coding	SEPT10	HGNC	protein_coding	OTTHUMT00000337804.1	30	0.00	0	A	NM_144710		110301779	110301779	-1	no_errors	ENST00000356688	ensembl	human	putative	69_37n	missense	19	24.00	6	SNP	0.348	C
SHROOM3	57619	genome.wustl.edu	37	4	77662080	77662081	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr4:77662080_77662081insT	ENST00000296043.6	+	5	3707_3708	c.2754_2755insT	c.(2755-2757)cccfs	p.P919fs		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	919					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGCTGGATGCCCCCTTCAGCCG	0.688																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	Exception_encountered	4.37:g.77662080_77662081insT	ENSP00000296043:p.Pro919fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Frame_Shift_Ins	INS	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P918fs	ENST00000296043.6	37	c.2754_2755	CCDS3579.2	4																																																																																			SHROOM3	-	pfam_ASD1	ENSG00000138771		0.688	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	24	0.00	0	-	NM_020859		77662080	77662081	+1	no_errors	ENST00000296043	ensembl	human	known	69_37n	frame_shift_ins	6	45.45	5	INS	0.000:0.457	T
SHROOM3	57619	genome.wustl.edu	37	4	77662080	77662081	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr4:77662080_77662081insT	ENST00000296043.6	+	5	3707_3708	c.2754_2755insT	c.(2755-2757)cccfs	p.P919fs		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	919					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGCTGGATGCCCCCTTCAGCCG	0.688																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	Exception_encountered	4.37:g.77662080_77662081insT	ENSP00000296043:p.Pro919fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Frame_Shift_Ins	INS	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P918fs	ENST00000296043.6	37	c.2754_2755	CCDS3579.2	4																																																																																			SHROOM3	-	pfam_ASD1	ENSG00000138771		0.688	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	15	0.00	0	-	NM_020859		77662080	77662081	+1	no_errors	ENST00000296043	ensembl	human	known	69_37n	frame_shift_ins	6	45.45	5	INS	0.000:0.457	T
SNCAIP	9627	genome.wustl.edu	37	5	121786792	121786792	+	Silent	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr5:121786792C>A	ENST00000261368.8	+	10	2512	c.2250C>A	c.(2248-2250)ccC>ccA	p.P750P	SNCAIP_ENST00000379538.3_Silent_p.P384P|SNCAIP_ENST00000414317.2_Silent_p.P352P|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000379533.2_Silent_p.P797P|CTC-210G5.1_ENST00000510972.1_RNA|CTC-210G5.1_ENST00000506053.1_RNA|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000503116.2_3'UTR|SNCAIP_ENST00000261367.7_Silent_p.P797P|SNCAIP_ENST00000379536.2_Silent_p.P690P|CTC-210G5.1_ENST00000503529.1_RNA|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000542191.1_Silent_p.P308P	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	750					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GCCCATCTCCCACCTCAGAGA	0.562																																						dbGAP											0													81.0	85.0	84.0					5																	121786792		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.2250C>A	5.37:g.121786792C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P797	ENST00000261368.8	37	c.2391	CCDS4131.1	5	.	.	.	.	.	.	.	.	.	.	C	7.740	0.701016	0.15172	.	.	ENSG00000064692	ENST00000447854	.	.	.	6.06	3.95	0.45737	.	0.051494	0.85682	D	0.000000	T	0.65165	0.2665	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68288	-0.5448	6	0.87932	D	0	-22.1647	9.0462	0.36347	0.0:0.6206:0.278:0.1014	.	.	.	.	Q	373	.	ENSP00000416985:P373Q	P	+	2	0	SNCAIP	121814691	0.913000	0.31002	1.000000	0.80357	0.956000	0.61745	-0.011000	0.12721	1.557000	0.49525	0.655000	0.94253	CCA	SNCAIP	-	NULL	ENSG00000064692		0.562	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	171	0.00	0	C			121786792	121786792	+1	no_errors	ENST00000379533	ensembl	human	known	69_37n	silent	73	40.16	49	SNP	1.000	A
SNCAIP	9627	genome.wustl.edu	37	5	121786792	121786792	+	Silent	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr5:121786792C>A	ENST00000261368.8	+	10	2512	c.2250C>A	c.(2248-2250)ccC>ccA	p.P750P	SNCAIP_ENST00000379538.3_Silent_p.P384P|SNCAIP_ENST00000414317.2_Silent_p.P352P|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000379533.2_Silent_p.P797P|CTC-210G5.1_ENST00000510972.1_RNA|CTC-210G5.1_ENST00000506053.1_RNA|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000503116.2_3'UTR|SNCAIP_ENST00000261367.7_Silent_p.P797P|SNCAIP_ENST00000379536.2_Silent_p.P690P|CTC-210G5.1_ENST00000503529.1_RNA|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000542191.1_Silent_p.P308P	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	750					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GCCCATCTCCCACCTCAGAGA	0.562																																						dbGAP											0													81.0	85.0	84.0					5																	121786792		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.2250C>A	5.37:g.121786792C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P797	ENST00000261368.8	37	c.2391	CCDS4131.1	5	.	.	.	.	.	.	.	.	.	.	C	7.740	0.701016	0.15172	.	.	ENSG00000064692	ENST00000447854	.	.	.	6.06	3.95	0.45737	.	0.051494	0.85682	D	0.000000	T	0.65165	0.2665	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68288	-0.5448	6	0.87932	D	0	-22.1647	9.0462	0.36347	0.0:0.6206:0.278:0.1014	.	.	.	.	Q	373	.	ENSP00000416985:P373Q	P	+	2	0	SNCAIP	121814691	0.913000	0.31002	1.000000	0.80357	0.956000	0.61745	-0.011000	0.12721	1.557000	0.49525	0.655000	0.94253	CCA	SNCAIP	-	NULL	ENSG00000064692		0.562	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	250	0.00	0	C			121786792	121786792	+1	no_errors	ENST00000379533	ensembl	human	known	69_37n	silent	73	40.16	49	SNP	1.000	A
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	31	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	72	25.77	25	SNP	0.994	A
TFAP2C	7022	genome.wustl.edu	37	20	55208476	55208476	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr20:55208476G>A	ENST00000201031.2	+	4	897	c.654G>A	c.(652-654)atG>atA	p.M218I	TFAP2C_ENST00000544508.1_Missense_Mutation_p.M49I	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	218					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			GGGCCGTAATGAACCCCACTG	0.532																																						dbGAP											0													99.0	87.0	91.0					20																	55208476		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.654G>A	20.37:g.55208476G>A	ENSP00000201031:p.Met218Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.M218I	ENST00000201031.2	37	c.654	CCDS13454.1	20	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285998	0.23478	.	.	ENSG00000087510	ENST00000201031;ENST00000544508	D;D	0.96774	-4.12;-4.04	5.93	4.93	0.64822	.	0.300915	0.41712	D	0.000829	D	0.85712	0.5760	N	0.02539	-0.55	0.30500	N	0.770461	B	0.02656	0.0	B	0.04013	0.001	T	0.75789	-0.3194	10	0.31617	T	0.26	-10.8397	3.2808	0.06915	0.0834:0.1806:0.4646:0.2714	.	218	Q92754	AP2C_HUMAN	I	218;49	ENSP00000201031:M218I;ENSP00000442274:M49I	ENSP00000201031:M218I	M	+	3	0	TFAP2C	54641883	0.952000	0.32445	1.000000	0.80357	0.325000	0.28411	0.073000	0.14640	2.815000	0.96918	0.561000	0.74099	ATG	TFAP2C	-	prints_TF_AP2_gamma	ENSG00000087510		0.532	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	HGNC	protein_coding	OTTHUMT00000079823.2	67	0.00	0	G	NM_003222		55208476	55208476	+1	no_errors	ENST00000201031	ensembl	human	known	69_37n	missense	65	13.33	10	SNP	0.994	A
TFAP2C	7022	genome.wustl.edu	37	20	55208476	55208476	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr20:55208476G>A	ENST00000201031.2	+	4	897	c.654G>A	c.(652-654)atG>atA	p.M218I	TFAP2C_ENST00000544508.1_Missense_Mutation_p.M49I	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	218					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			GGGCCGTAATGAACCCCACTG	0.532																																						dbGAP											0													99.0	87.0	91.0					20																	55208476		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.654G>A	20.37:g.55208476G>A	ENSP00000201031:p.Met218Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.M218I	ENST00000201031.2	37	c.654	CCDS13454.1	20	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285998	0.23478	.	.	ENSG00000087510	ENST00000201031;ENST00000544508	D;D	0.96774	-4.12;-4.04	5.93	4.93	0.64822	.	0.300915	0.41712	D	0.000829	D	0.85712	0.5760	N	0.02539	-0.55	0.30500	N	0.770461	B	0.02656	0.0	B	0.04013	0.001	T	0.75789	-0.3194	10	0.31617	T	0.26	-10.8397	3.2808	0.06915	0.0834:0.1806:0.4646:0.2714	.	218	Q92754	AP2C_HUMAN	I	218;49	ENSP00000201031:M218I;ENSP00000442274:M49I	ENSP00000201031:M218I	M	+	3	0	TFAP2C	54641883	0.952000	0.32445	1.000000	0.80357	0.325000	0.28411	0.073000	0.14640	2.815000	0.96918	0.561000	0.74099	ATG	TFAP2C	-	prints_TF_AP2_gamma	ENSG00000087510		0.532	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	HGNC	protein_coding	OTTHUMT00000079823.2	70	0.00	0	G	NM_003222		55208476	55208476	+1	no_errors	ENST00000201031	ensembl	human	known	69_37n	missense	65	13.33	10	SNP	0.994	A
TMEM106B	54664	genome.wustl.edu	37	7	12258148	12258148	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr7:12258148G>A	ENST00000396667.3	+	4	603		c.e4+1		TMEM106B_ENST00000396668.3_Splice_Site	NM_018374.3	NP_060844.2	Q9NUM4	T106B_HUMAN	transmembrane protein 106B						cell death (GO:0008219)|dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(8)|large_intestine(2)|lung(7)	18				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)		CAAGAAGAACGTAAGTGATTC	0.279																																						dbGAP											0													107.0	107.0	107.0					7																	12258148		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC033901	CCDS5358.1	7p21.3	2012-06-06			ENSG00000106460	ENSG00000106460			22407	protein-coding gene	gene with protein product		613413				20154673, 22511793	Standard	NM_018374		Approved	MGC33727, FLJ11273	uc003ssh.3	Q9NUM4	OTTHUMG00000125537	ENST00000396667.3:c.281+1G>A	7.37:g.12258148G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D108|Q53FL9|Q8N4L0	Splice_Site	SNP	-	e2+1	ENST00000396667.3	37	c.281+1	CCDS5358.1	7	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295924	0.81025	.	.	ENSG00000106460	ENST00000396668;ENST00000444443;ENST00000396667	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5011	0.90880	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM106B	12224673	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.339000	0.96797	2.513000	0.84729	0.650000	0.86243	.	TMEM106B	-	-	ENSG00000106460		0.279	TMEM106B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM106B	HGNC	protein_coding	OTTHUMT00000246870.3	187	0.00	0	G	NM_018374	Intron	12258148	12258148	+1	no_errors	ENST00000396667	ensembl	human	known	69_37n	splice_site	123	10.22	14	SNP	1.000	A
TMEM106B	54664	genome.wustl.edu	37	7	12258148	12258148	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr7:12258148G>A	ENST00000396667.3	+	4	603		c.e4+1		TMEM106B_ENST00000396668.3_Splice_Site	NM_018374.3	NP_060844.2	Q9NUM4	T106B_HUMAN	transmembrane protein 106B						cell death (GO:0008219)|dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(8)|large_intestine(2)|lung(7)	18				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)		CAAGAAGAACGTAAGTGATTC	0.279																																						dbGAP											0													107.0	107.0	107.0					7																	12258148		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC033901	CCDS5358.1	7p21.3	2012-06-06			ENSG00000106460	ENSG00000106460			22407	protein-coding gene	gene with protein product		613413				20154673, 22511793	Standard	NM_018374		Approved	MGC33727, FLJ11273	uc003ssh.3	Q9NUM4	OTTHUMG00000125537	ENST00000396667.3:c.281+1G>A	7.37:g.12258148G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D108|Q53FL9|Q8N4L0	Splice_Site	SNP	-	e2+1	ENST00000396667.3	37	c.281+1	CCDS5358.1	7	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295924	0.81025	.	.	ENSG00000106460	ENST00000396668;ENST00000444443;ENST00000396667	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5011	0.90880	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM106B	12224673	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.339000	0.96797	2.513000	0.84729	0.650000	0.86243	.	TMEM106B	-	-	ENSG00000106460		0.279	TMEM106B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM106B	HGNC	protein_coding	OTTHUMT00000246870.3	101	0.00	0	G	NM_018374	Intron	12258148	12258148	+1	no_errors	ENST00000396667	ensembl	human	known	69_37n	splice_site	123	10.22	14	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr17:7578203C>T	ENST00000269305.4	-	6	835	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.V216M|TP53_ENST00000413465.2_Missense_Mutation_p.V216M|TP53_ENST00000359597.4_Missense_Mutation_p.V216M|TP53_ENST00000420246.2_Missense_Mutation_p.V216M|TP53_ENST00000445888.2_Missense_Mutation_p.V216M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	216	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V216M(61)|p.V216del(8)|p.0?(8)|p.V216L(7)|p.?(5)|p.V84M(3)|p.V123M(3)|p.V216fs*6(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACCACCACACTATGTCGA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	113	Substitution - Missense(74)|Deletion - In frame(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(17)|lung(14)|haematopoietic_and_lymphoid_tissue(12)|ovary(12)|upper_aerodigestive_tract(10)|large_intestine(9)|oesophagus(9)|biliary_tract(5)|central_nervous_system(5)|bone(5)|stomach(4)|liver(4)|pancreas(3)|soft_tissue(2)|urinary_tract(1)|skin(1)	GRCh37	CX952222	TP53	X							123.0	111.0	115.0					17																	7578203		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.646G>A	17.37:g.7578203C>T	ENSP00000269305:p.Val216Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V216M	ENST00000269305.4	37	c.646	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958421	0.92726	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	M	0.92169	3.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.996;1.0;1.0;1.0;1.0	D	0.96411	0.9304	10	0.87932	D	0	-12.2832	16.7921	0.85592	0.0:1.0:0.0:0.0	.	177;216;216;123;216;216;216	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	216;216;216;216;216;216;205;123;84;123;84	ENSP00000410739:V216M;ENSP00000352610:V216M;ENSP00000269305:V216M;ENSP00000398846:V216M;ENSP00000391127:V216M;ENSP00000391478:V216M;ENSP00000425104:V84M;ENSP00000423862:V123M	ENSP00000269305:V216M	V	-	1	0	TP53	7518928	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	91	0.00	0	C	NM_000546		7578203	7578203	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	56	49.09	54	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr17:7578203C>T	ENST00000269305.4	-	6	835	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.V216M|TP53_ENST00000413465.2_Missense_Mutation_p.V216M|TP53_ENST00000359597.4_Missense_Mutation_p.V216M|TP53_ENST00000420246.2_Missense_Mutation_p.V216M|TP53_ENST00000445888.2_Missense_Mutation_p.V216M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	216	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V216M(61)|p.V216del(8)|p.0?(8)|p.V216L(7)|p.?(5)|p.V84M(3)|p.V123M(3)|p.V216fs*6(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACCACCACACTATGTCGA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	113	Substitution - Missense(74)|Deletion - In frame(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(17)|lung(14)|haematopoietic_and_lymphoid_tissue(12)|ovary(12)|upper_aerodigestive_tract(10)|large_intestine(9)|oesophagus(9)|biliary_tract(5)|central_nervous_system(5)|bone(5)|stomach(4)|liver(4)|pancreas(3)|soft_tissue(2)|urinary_tract(1)|skin(1)	GRCh37	CX952222	TP53	X							123.0	111.0	115.0					17																	7578203		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.646G>A	17.37:g.7578203C>T	ENSP00000269305:p.Val216Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V216M	ENST00000269305.4	37	c.646	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958421	0.92726	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	M	0.92169	3.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.996;1.0;1.0;1.0;1.0	D	0.96411	0.9304	10	0.87932	D	0	-12.2832	16.7921	0.85592	0.0:1.0:0.0:0.0	.	177;216;216;123;216;216;216	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	216;216;216;216;216;216;205;123;84;123;84	ENSP00000410739:V216M;ENSP00000352610:V216M;ENSP00000269305:V216M;ENSP00000398846:V216M;ENSP00000391127:V216M;ENSP00000391478:V216M;ENSP00000425104:V84M;ENSP00000423862:V123M	ENSP00000269305:V216M	V	-	1	0	TP53	7518928	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	135	0.74	1	C	NM_000546		7578203	7578203	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	56	49.09	54	SNP	1.000	T
UNC13C	440279	genome.wustl.edu	37	15	54306670	54306670	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr15:54306670A>G	ENST00000260323.11	+	1	1570	c.1570A>G	c.(1570-1572)Acc>Gcc	p.T524A	UNC13C_ENST00000537900.1_Missense_Mutation_p.T524A|UNC13C_ENST00000545554.1_Missense_Mutation_p.T524A	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	524					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGAAAAGCAAACCACAACCCA	0.363																																						dbGAP											0													57.0	56.0	57.0					15																	54306670		1858	4105	5963	-	-	-	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1570A>G	15.37:g.54306670A>G	ENSP00000260323:p.Thr524Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T524A	ENST00000260323.11	37	c.1570	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	A	0.007	-2.006840	0.00426	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.77877	-1.13;-1.13;-1.13	4.64	2.14	0.27477	.	.	.	.	.	T	0.50973	0.1647	N	0.08118	0	0.21967	N	0.999443	B	0.06786	0.001	B	0.01281	0.0	T	0.30822	-0.9965	9	0.25751	T	0.34	.	0.2892	0.00256	0.4146:0.1461:0.1941:0.2452	.	524	Q8NB66	UN13C_HUMAN	A	524	ENSP00000260323:T524A;ENSP00000438156:T524A;ENSP00000442569:T524A	ENSP00000260323:T524A	T	+	1	0	UNC13C	52093962	0.010000	0.17322	0.062000	0.19696	0.998000	0.95712	0.260000	0.18424	0.805000	0.34159	0.533000	0.62120	ACC	UNC13C	-	NULL	ENSG00000137766		0.363	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	360	0.00	0	A	NM_173166		54306670	54306670	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	missense	168	13.40	26	SNP	0.934	G
UNC13C	440279	genome.wustl.edu	37	15	54306670	54306670	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr15:54306670A>G	ENST00000260323.11	+	1	1570	c.1570A>G	c.(1570-1572)Acc>Gcc	p.T524A	UNC13C_ENST00000537900.1_Missense_Mutation_p.T524A|UNC13C_ENST00000545554.1_Missense_Mutation_p.T524A	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	524					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGAAAAGCAAACCACAACCCA	0.363																																						dbGAP											0													57.0	56.0	57.0					15																	54306670		1858	4105	5963	-	-	-	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1570A>G	15.37:g.54306670A>G	ENSP00000260323:p.Thr524Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T524A	ENST00000260323.11	37	c.1570	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	A	0.007	-2.006840	0.00426	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.77877	-1.13;-1.13;-1.13	4.64	2.14	0.27477	.	.	.	.	.	T	0.50973	0.1647	N	0.08118	0	0.21967	N	0.999443	B	0.06786	0.001	B	0.01281	0.0	T	0.30822	-0.9965	9	0.25751	T	0.34	.	0.2892	0.00256	0.4146:0.1461:0.1941:0.2452	.	524	Q8NB66	UN13C_HUMAN	A	524	ENSP00000260323:T524A;ENSP00000438156:T524A;ENSP00000442569:T524A	ENSP00000260323:T524A	T	+	1	0	UNC13C	52093962	0.010000	0.17322	0.062000	0.19696	0.998000	0.95712	0.260000	0.18424	0.805000	0.34159	0.533000	0.62120	ACC	UNC13C	-	NULL	ENSG00000137766		0.363	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	166	0.00	0	A	NM_173166		54306670	54306670	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	missense	168	13.40	26	SNP	0.934	G
VWF	7450	genome.wustl.edu	37	12	6134806	6134806	+	Silent	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr12:6134806C>A	ENST00000261405.5	-	24	3416	c.3162G>T	c.(3160-3162)acG>acT	p.T1054T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1054	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AATCCACCATCGTCTGCTTCA	0.557																																						dbGAP											0													23.0	23.0	23.0					12																	6134806		2201	4274	6475	-	-	-	SO:0001819	synonymous_variant	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3162G>T	12.37:g.6134806C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T1054	ENST00000261405.5	37	c.3162	CCDS8539.1	12																																																																																			VWF	-	pirsf_VWF,smart_Unchr_dom_Cys-rich	ENSG00000110799		0.557	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	69	0.00	0	C	NM_000552		6134806	6134806	-1	no_errors	ENST00000261405	ensembl	human	known	69_37n	silent	63	13.70	10	SNP	0.587	A
VWF	7450	genome.wustl.edu	37	12	6134806	6134806	+	Silent	SNP	C	C	A			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr12:6134806C>A	ENST00000261405.5	-	24	3416	c.3162G>T	c.(3160-3162)acG>acT	p.T1054T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1054	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AATCCACCATCGTCTGCTTCA	0.557																																						dbGAP											0													23.0	23.0	23.0					12																	6134806		2201	4274	6475	-	-	-	SO:0001819	synonymous_variant	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3162G>T	12.37:g.6134806C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T1054	ENST00000261405.5	37	c.3162	CCDS8539.1	12																																																																																			VWF	-	pirsf_VWF,smart_Unchr_dom_Cys-rich	ENSG00000110799		0.557	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	45	0.00	0	C	NM_000552		6134806	6134806	-1	no_errors	ENST00000261405	ensembl	human	known	69_37n	silent	63	13.70	10	SNP	0.587	A
XIST	7503	genome.wustl.edu	37	X	73062010	73062011	+	lincRNA	INS	-	-	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chrX:73062010_73062011insT	ENST00000429829.1	-	0	10577_10578					NR_001564.2				X inactive specific transcript (non-protein coding)																		TCttaaaaaaatttttttaata	0.337																																						dbGAP											0																																										-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73062017_73062017dupT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.337	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	10	0.00	0	-	NR_001564		73062010	73062011	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	4	50.00	4	INS	0.000:0.000	T
XIST	7503	genome.wustl.edu	37	X	73062010	73062011	+	lincRNA	INS	-	-	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chrX:73062010_73062011insT	ENST00000429829.1	-	0	10577_10578					NR_001564.2				X inactive specific transcript (non-protein coding)																		TCttaaaaaaatttttttaata	0.337																																						dbGAP											0																																										-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73062017_73062017dupT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.337	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	20	0.00	0	-	NR_001564		73062010	73062011	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	4	50.00	4	INS	0.000:0.000	T
ZEB2	9839	genome.wustl.edu	37	2	145147116	145147116	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chr2:145147116C>T	ENST00000558170.2	-	10	4731	c.3547G>A	c.(3547-3549)Gaa>Aaa	p.E1183K	ZEB2_ENST00000539609.3_Missense_Mutation_p.E1159K|ZEB2_ENST00000409487.3_Missense_Mutation_p.E1183K|ZEB2_ENST00000303660.4_Missense_Mutation_p.E1183K	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1183	Glu-rich (acidic).				cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCAGTCTCTTCTTCATCTCGT	0.463																																					Melanoma(33;1235 1264 5755 16332)	dbGAP											0													267.0	251.0	256.0					2																	145147116		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3547G>A	2.37:g.145147116C>T	ENSP00000454157:p.Glu1183Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.E1183K	ENST00000558170.2	37	c.3547	CCDS2186.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349494	0.82132	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.14516	2.53;2.5;2.5	5.51	5.51	0.81932	.	0.045565	0.85682	D	0.000000	T	0.09949	0.0244	N	0.08118	0	0.80722	D	1	B;B;B	0.28178	0.202;0.128;0.128	B;B;B	0.27887	0.084;0.039;0.039	T	0.27806	-1.0063	10	0.46703	T	0.11	-11.2704	19.7945	0.96474	0.0:1.0:0.0:0.0	.	1159;1182;1183	F5H814;A0JP08;O60315	.;.;ZEB2_HUMAN	K	1159;1183;1183	ENSP00000443792:E1159K;ENSP00000302501:E1183K;ENSP00000386854:E1183K	ENSP00000302501:E1183K	E	-	1	0	ZEB2	144863586	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.746000	0.94184	0.591000	0.81541	GAA	ZEB2	-	NULL	ENSG00000169554		0.463	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	397	0.00	0	C	NM_014795		145147116	145147116	-1	no_errors	ENST00000303660	ensembl	human	known	69_37n	missense	358	19.19	85	SNP	1.000	T
ZEB2	9839	genome.wustl.edu	37	2	145147116	145147116	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	14a2a9bb-b4d3-4402-81b7-34d2bd314e4b	g.chr2:145147116C>T	ENST00000558170.2	-	10	4731	c.3547G>A	c.(3547-3549)Gaa>Aaa	p.E1183K	ZEB2_ENST00000539609.3_Missense_Mutation_p.E1159K|ZEB2_ENST00000409487.3_Missense_Mutation_p.E1183K|ZEB2_ENST00000303660.4_Missense_Mutation_p.E1183K	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1183	Glu-rich (acidic).				cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCAGTCTCTTCTTCATCTCGT	0.463																																					Melanoma(33;1235 1264 5755 16332)	dbGAP											0													267.0	251.0	256.0					2																	145147116		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3547G>A	2.37:g.145147116C>T	ENSP00000454157:p.Glu1183Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.E1183K	ENST00000558170.2	37	c.3547	CCDS2186.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349494	0.82132	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.14516	2.53;2.5;2.5	5.51	5.51	0.81932	.	0.045565	0.85682	D	0.000000	T	0.09949	0.0244	N	0.08118	0	0.80722	D	1	B;B;B	0.28178	0.202;0.128;0.128	B;B;B	0.27887	0.084;0.039;0.039	T	0.27806	-1.0063	10	0.46703	T	0.11	-11.2704	19.7945	0.96474	0.0:1.0:0.0:0.0	.	1159;1182;1183	F5H814;A0JP08;O60315	.;.;ZEB2_HUMAN	K	1159;1183;1183	ENSP00000443792:E1159K;ENSP00000302501:E1183K;ENSP00000386854:E1183K	ENSP00000302501:E1183K	E	-	1	0	ZEB2	144863586	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.746000	0.94184	0.591000	0.81541	GAA	ZEB2	-	NULL	ENSG00000169554		0.463	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	356	0.28	1	C	NM_014795		145147116	145147116	-1	no_errors	ENST00000303660	ensembl	human	known	69_37n	missense	358	19.19	85	SNP	1.000	T
ZMYM3	9203	genome.wustl.edu	37	X	70472853	70472854	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0B3-01A-11W-A071-09	TCGA-BH-A0B3-11B-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f4504db-45d9-4873-9532-69ad466fdf2f	bcb878fe-26c0-462a-83db-a6a586a25534	g.chrX:70472853_70472854insC	ENST00000353904.2	-	2	439_440	c.252_253insG	c.(250-255)gggctgfs	p.L85fs	ZMYM3_ENST00000373988.1_Frame_Shift_Ins_p.L85fs|ZMYM3_ENST00000373982.1_Frame_Shift_Ins_p.L85fs|ZMYM3_ENST00000314425.5_Frame_Shift_Ins_p.L85fs|ZMYM3_ENST00000373981.1_Frame_Shift_Ins_p.L85fs|ZMYM3_ENST00000373998.1_Frame_Shift_Ins_p.L85fs|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373978.1_Frame_Shift_Ins_p.L85fs|ZMYM3_ENST00000373984.3_Frame_Shift_Ins_p.L85fs	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	85					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TTATAGAGCAGCCCCCCCAGCC	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.253dupG	X.37:g.70472860_70472860dupC	ENSP00000343909:p.Leu85fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVV3|O15089|Q96E26	Frame_Shift_Ins	INS	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.L84fs	ENST00000353904.2	37	c.253_252	CCDS14409.1	X																																																																																			ZMYM3	-	NULL	ENSG00000147130		0.644	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	45	0.00	0	-	NM_201599		70472853	70472854	-1	no_errors	ENST00000373988	ensembl	human	known	69_37n	frame_shift_ins	27	10.00	3	INS	1.000:1.000	C
