#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTN2	88	genome.wustl.edu	37	1	236918367	236918367	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr1:236918367A>C	ENST00000366578.4	+	17	2189	c.2023A>C	c.(2023-2025)Atg>Ctg	p.M675L	ACTN2_ENST00000546208.1_Missense_Mutation_p.M169L|ACTN2_ENST00000542672.1_Missense_Mutation_p.M675L	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	675					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GGAAGACCAGATGAACCAGCT	0.537																																						dbGAP											0													151.0	146.0	147.0					1																	236918367		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2023A>C	1.37:g.236918367A>C	ENSP00000355537:p.Met675Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.M675L	ENST00000366578.4	37	c.2023	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	A	5.261	0.233552	0.09969	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.34472	1.36;1.36;1.36	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	N	0.03999	-0.3	0.58432	D	0.999999	P;B;D;P	0.53462	0.929;0.001;0.96;0.525	D;B;D;P	0.68765	0.96;0.002;0.96;0.715	T	0.12578	-1.0542	10	0.02654	T	1	.	14.0331	0.64629	1.0:0.0:0.0:0.0	.	460;675;445;675	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	L	675;675;169;444	ENSP00000443495:M675L;ENSP00000355537:M675L;ENSP00000438384:M169L	ENSP00000355537:M675L	M	+	1	0	ACTN2	234984990	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.028000	0.70889	1.707000	0.51288	0.455000	0.32223	ATG	ACTN2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000077522		0.537	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	172	0.00	0	A	NM_001103		236918367	236918367	+1	no_errors	ENST00000366578	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	1.000	C
ANKRD30BL	554226	genome.wustl.edu	37	2	133015476	133015476	+	5'UTR	SNP	A	A	T	rs437455		TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr2:133015476A>T	ENST00000470729.1	-	0	66				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CTCCAAGTAAACCCACACACA	0.692																																						dbGAP											0													63.0	62.0	62.0					2																	133015476		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1359T>A	2.37:g.133015476A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.692	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	48	0.00	0	A	NR_027019		133015476	133015476	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	42	14.00	7	SNP	0.002	T
C11orf16	56673	genome.wustl.edu	37	11	8950998	8950998	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr11:8950998C>A	ENST00000326053.5	-	3	356	c.250G>T	c.(250-252)Gcc>Tcc	p.A84S	C11orf16_ENST00000528998.1_Intron|C11orf16_ENST00000525780.1_Missense_Mutation_p.A84S	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	84										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		CATGTGTTGGCAGCATCTCCA	0.572																																						dbGAP											0													102.0	99.0	100.0					11																	8950998		2201	4296	6497	-	-	-	SO:0001583	missense	0			AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.250G>T	11.37:g.8950998C>A	ENSP00000318999:p.Ala84Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FB2|Q8N6Y9	Missense_Mutation	SNP	NULL	p.A84S	ENST00000326053.5	37	c.250	CCDS7794.1	11	.	.	.	.	.	.	.	.	.	.	C	15.90	2.970758	0.53614	.	.	ENSG00000176029	ENST00000525780;ENST00000326053;ENST00000526227	T;T	0.32023	1.48;1.47	4.66	2.8	0.32819	.	0.702222	0.13381	N	0.392178	T	0.28962	0.0719	L	0.57536	1.79	0.09310	N	1	B;B	0.30937	0.301;0.301	B;B	0.34489	0.184;0.184	T	0.20806	-1.0264	10	0.35671	T	0.21	-19.5754	6.1692	0.20408	0.0:0.652:0.0:0.348	.	84;84	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	S	84	ENSP00000436818:A84S;ENSP00000318999:A84S	ENSP00000318999:A84S	A	-	1	0	C11orf16	8907574	0.004000	0.15560	0.362000	0.25862	0.924000	0.55760	0.900000	0.28431	0.694000	0.31654	0.655000	0.94253	GCC	C11orf16	-	NULL	ENSG00000176029		0.572	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf16	HGNC	protein_coding	OTTHUMT00000385626.1	203	0.00	0	C	NM_020643		8950998	8950998	-1	no_errors	ENST00000326053	ensembl	human	known	69_37n	missense	67	19.28	16	SNP	0.020	A
CDKN2AIP	55602	genome.wustl.edu	37	4	184367676	184367676	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr4:184367676C>T	ENST00000504169.1	+	3	1046	c.839C>T	c.(838-840)tCa>tTa	p.S280L	CDKN2AIP_ENST00000506835.1_3'UTR|CDKN2AIP_ENST00000302350.4_3'UTR	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	280	Ser-rich.				negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		TCTTCAGCCTCAGCTTCTCAA	0.468																																						dbGAP											0													67.0	65.0	66.0					4																	184367676		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.839C>T	4.37:g.184367676C>T	ENSP00000427108:p.Ser280Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBM5|Q9NYH0	Missense_Mutation	SNP	pfam_DUF3469,pfscan_Ds-RNA-bd	p.S280L	ENST00000504169.1	37	c.839	CCDS34110.1	4	.	.	.	.	.	.	.	.	.	.	C	3.724	-0.056860	0.07362	.	.	ENSG00000168564	ENST00000504169	.	.	.	5.55	2.7	0.31948	.	0.818199	0.10602	N	0.655538	T	0.22859	0.0552	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17319	-1.0373	9	0.39692	T	0.17	-0.0875	8.2742	0.31862	0.0:0.6761:0.0:0.3239	.	280	Q9NXV6	CARF_HUMAN	L	280	.	ENSP00000427108:S280L	S	+	2	0	CDKN2AIP	184604670	0.000000	0.05858	0.001000	0.08648	0.345000	0.29048	0.117000	0.15583	0.901000	0.36495	0.655000	0.94253	TCA	CDKN2AIP	-	NULL	ENSG00000168564		0.468	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2AIP	HGNC	protein_coding	OTTHUMT00000361488.1	111	0.00	0	C	NM_017632		184367676	184367676	+1	no_errors	ENST00000504169	ensembl	human	known	69_37n	missense	67	20.24	17	SNP	0.000	T
CEL	1056	genome.wustl.edu	37	9	135944195	135944195	+	Silent	SNP	C	C	T	rs201748116	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr9:135944195C>T	ENST00000372080.4	+	8	1057	c.1041C>T	c.(1039-1041)ttC>ttT	p.F347F	CEL_ENST00000351304.7_Silent_p.F344F	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	344					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		GCCACATCTTCGCCAGCATCG	0.602																																						dbGAP											0													6.0	8.0	7.0					9																	135944195		1754	3968	5722	-	-	-	SO:0001819	synonymous_variant	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1041C>T	9.37:g.135944195C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.F347	ENST00000372080.4	37	c.1041	CCDS43896.1	9																																																																																			CEL	-	pfam_CarbesteraseB	ENSG00000170835		0.602	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	97	0.00	0	C			135944195	135944195	+1	no_errors	ENST00000372080	ensembl	human	known	69_37n	silent	11	21.43	3	SNP	0.979	T
CENPF	1063	genome.wustl.edu	37	1	214794222	214794222	+	Silent	SNP	T	T	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr1:214794222T>C	ENST00000366955.3	+	6	966	c.798T>C	c.(796-798)gcT>gcC	p.A266A		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAAGAGATGCTAATAGCAGTT	0.368																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													71.0	78.0	76.0					1																	214794222		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.798T>C	1.37:g.214794222T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13171|Q13246|Q5VVM7	Silent	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.A266	ENST00000366955.3	37	c.798	CCDS31023.1	1																																																																																			CENPF	-	pfam_Centromere_CenpF_N	ENSG00000117724		0.368	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	40	0.00	0	T	NM_016343		214794222	214794222	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	silent	69	52.41	76	SNP	0.000	C
CGB7	94027	genome.wustl.edu	37	19	49557572	49557572	+	Silent	SNP	T	T	C	rs62127880	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr19:49557572T>C	ENST00000597853.1	-	5	3345	c.474A>G	c.(472-474)tcA>tcG	p.S158S	CGB7_ENST00000356213.4_Silent_p.S156S|CGB7_ENST00000593309.1_5'Flank|CGB7_ENST00000377280.3_Silent_p.S158S|CGB7_ENST00000596965.1_Silent_p.S158S			P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 7	158					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|peptide hormone processing (GO:0016486)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			lung(3)|urinary_tract(2)	5		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		TCGGGGTGTCTGAGGGCCCCG	0.627																																						dbGAP											0													31.0	31.0	31.0					19																	49557572		1499	2656	4155	-	-	-	SO:0001819	synonymous_variant	0			K00092	CCDS33071.1	19q13.32	2008-02-05				ENSG00000196337			16451	protein-coding gene	gene with protein product		608826				6194155	Standard	NM_033142		Approved	CG-beta-a		P01233		ENST00000597853.1:c.474A>G	19.37:g.49557572T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5E0|B9ZVP5|Q13991|Q14000|Q3KPI3|Q3SY41|Q8WTT5|Q8WXL1|Q8WXL2|Q8WXL3|Q8WXL4	Silent	SNP	pfam_Cys_knot,smart_Gonadotropin_bsu	p.S158	ENST00000597853.1	37	c.474	CCDS33071.1	19																																																																																			CGB7	-	NULL	ENSG00000196337		0.627	CGB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CGB7	HGNC	protein_coding	OTTHUMT00000466254.1	17	0.00	0	T	NM_033142		49557572	49557572	-1	no_errors	ENST00000377280	ensembl	human	known	69_37n	silent	37	21.28	10	SNP	0.123	C
CHRM1	1128	genome.wustl.edu	37	11	62677587	62677587	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr11:62677587G>C	ENST00000306960.3	-	2	1527	c.986C>G	c.(985-987)cCg>cGg	p.P329R	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	329					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	TTTCTTAGTCGGCCTCTTGAC	0.612																																						dbGAP											0													48.0	51.0	50.0					11																	62677587		2201	4298	6499	-	-	-	SO:0001583	missense	0			Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.986C>G	11.37:g.62677587G>C	ENSP00000306490:p.Pro329Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96RH1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Musac_M1_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P329R	ENST00000306960.3	37	c.986	CCDS8040.1	11	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600957	0.46423	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.60040	0.25;0.22	4.79	4.79	0.61399	GPCR, rhodopsin-like superfamily (1);	0.292425	0.23298	N	0.049711	T	0.53190	0.1781	N	0.20483	0.58	0.38363	D	0.944675	D	0.60575	0.988	P	0.58130	0.833	T	0.51220	-0.8733	10	0.25106	T	0.35	-27.1545	10.4148	0.44316	0.0:0.0:0.8052:0.1948	.	329	P11229	ACM1_HUMAN	R	329	ENSP00000306490:P329R;ENSP00000441188:P329R	ENSP00000306490:P329R	P	-	2	0	CHRM1	62434163	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.782000	0.47758	2.481000	0.83766	0.563000	0.77884	CCG	CHRM1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000168539		0.612	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM1	HGNC	protein_coding	OTTHUMT00000396178.1	27	0.00	0	G	NM_000738		62677587	62677587	-1	no_errors	ENST00000306960	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	C
CHSY3	337876	genome.wustl.edu	37	5	129520027	129520027	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr5:129520027A>T	ENST00000305031.4	+	3	1550	c.1192A>T	c.(1192-1194)Agg>Tgg	p.R398W	CHSY3_ENST00000507545.1_3'UTR	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	398					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TCCCAACAAAAGGCCTGCATA	0.448																																						dbGAP											0													110.0	102.0	105.0					5																	129520027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1192A>T	5.37:g.129520027A>T	ENSP00000302629:p.Arg398Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.R398W	ENST00000305031.4	37	c.1192	CCDS34223.1	5	.	.	.	.	.	.	.	.	.	.	A	19.08	3.757164	0.69648	.	.	ENSG00000198108	ENST00000305031	T	0.16196	2.36	4.46	1.99	0.26369	.	0.096496	0.45126	D	0.000385	T	0.32041	0.0816	L	0.53249	1.67	0.40170	D	0.977168	D	0.69078	0.997	D	0.70227	0.968	T	0.02015	-1.1229	9	.	.	.	-0.5409	11.8216	0.52242	0.7217:0.2783:0.0:0.0	.	398	Q70JA7	CHSS3_HUMAN	W	398	ENSP00000302629:R398W	.	R	+	1	2	CHSY3	129547926	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.812000	0.55628	0.444000	0.26612	-0.331000	0.08364	AGG	CHSY3	-	pfam_Chond_GalNAc	ENSG00000198108		0.448	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	HGNC	protein_coding	OTTHUMT00000371453.1	107	0.00	0	A	NM_175856		129520027	129520027	+1	no_errors	ENST00000305031	ensembl	human	known	69_37n	missense	18	60.42	29	SNP	1.000	T
DIAPH3	81624	genome.wustl.edu	37	13	60240935	60240935	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr13:60240935T>C	ENST00000400324.4	-	28	3585	c.3365A>G	c.(3364-3366)aAt>aGt	p.N1122S	DIAPH3_ENST00000400320.1_Missense_Mutation_p.N1076S|DIAPH3_ENST00000377908.2_Missense_Mutation_p.N1111S|DIAPH3_ENST00000400319.1_Missense_Mutation_p.N1052S|DIAPH3_ENST00000400330.1_Missense_Mutation_p.N1122S	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	1122					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		GCAATTGATATTGTAGTGTGA	0.403																																						dbGAP											0													150.0	138.0	142.0					13																	60240935		1902	4126	6028	-	-	-	SO:0001583	missense	0			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.3365A>G	13.37:g.60240935T>C	ENSP00000383178:p.Asn1122Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Drf_DAD,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.N1122S	ENST00000400324.4	37	c.3365	CCDS41898.1	13	.	.	.	.	.	.	.	.	.	.	T	8.569	0.879694	0.17467	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320	T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37	5.46	-4.95	0.03048	.	0.965190	0.08351	N	0.959271	T	0.48259	0.1490	N	0.01874	-0.695	0.19300	N	0.999976	B	0.02656	0.0	B	0.06405	0.002	T	0.52697	-0.8541	10	0.02654	T	1	.	10.0141	0.42003	0.0:0.4925:0.107:0.4005	.	1122	Q9NSV4	DIAP3_HUMAN	S	1122;1122;1111;1076;1052;1111;1052;1076	ENSP00000383178:N1122S;ENSP00000383184:N1122S;ENSP00000367141:N1111S;ENSP00000383173:N1052S;ENSP00000383174:N1076S	ENSP00000367141:N1111S	N	-	2	0	DIAPH3	59138936	0.996000	0.38824	0.860000	0.33809	0.987000	0.75469	0.177000	0.16801	-0.485000	0.06754	0.533000	0.62120	AAT	DIAPH3	-	NULL	ENSG00000139734		0.403	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	HGNC	protein_coding	OTTHUMT00000045166.3	89	0.00	0	T	NM_001042517		60240935	60240935	-1	no_errors	ENST00000400324	ensembl	human	known	69_37n	missense	96	39.24	62	SNP	0.933	C
FAM120C	54954	genome.wustl.edu	37	X	54099576	54099576	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chrX:54099576C>G	ENST00000375180.2	-	16	3237	c.3181G>C	c.(3181-3183)Gac>Cac	p.D1061H	FAM120C_ENST00000328235.4_3'UTR	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	1061							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TCATTGCTGTCTCTGGATAAG	0.458																																						dbGAP											0													219.0	164.0	183.0					X																	54099576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.3181G>C	X.37:g.54099576C>G	ENSP00000364324:p.Asp1061His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMT7	Missense_Mutation	SNP	NULL	p.D1061H	ENST00000375180.2	37	c.3181	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	C	19.86	3.906055	0.72868	.	.	ENSG00000184083	ENST00000375180	T	0.30448	1.53	5.11	5.11	0.69529	.	0.278923	0.31709	N	0.007193	T	0.39886	0.1095	N	0.24115	0.695	0.80722	D	1	D	0.56521	0.976	P	0.61477	0.889	T	0.34750	-0.9816	10	0.62326	D	0.03	-9.01	16.5817	0.84717	0.0:1.0:0.0:0.0	.	1061	Q9NX05	F120C_HUMAN	H	1061	ENSP00000364324:D1061H	ENSP00000364324:D1061H	D	-	1	0	FAM120C	54116301	1.000000	0.71417	0.985000	0.45067	0.957000	0.61999	4.218000	0.58554	2.260000	0.74910	0.600000	0.82982	GAC	FAM120C	-	NULL	ENSG00000184083		0.458	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	126	0.00	0	C	NM_017848		54099576	54099576	-1	no_errors	ENST00000375180	ensembl	human	known	69_37n	missense	69	50.36	70	SNP	1.000	G
FAM171A1	221061	genome.wustl.edu	37	10	15256057	15256057	+	Silent	SNP	T	T	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr10:15256057T>C	ENST00000378116.4	-	8	1536	c.1530A>G	c.(1528-1530)ggA>ggG	p.G510G	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	510						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TGAGTTTGCTTCCCGTGGAGG	0.522																																						dbGAP											0													157.0	138.0	144.0					10																	15256057		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1530A>G	10.37:g.15256057T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	pfam_Uncharacterised_FAM171	p.G510	ENST00000378116.4	37	c.1530	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	T	0.023	-1.400368	0.01165	.	.	ENSG00000148468	ENST00000396781	.	.	.	5.25	-1.12	0.09808	.	.	.	.	.	T	0.40119	0.1104	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23476	-1.0187	4	.	.	.	-21.7049	1.6458	0.02761	0.1119:0.1931:0.2324:0.4626	.	.	.	.	G	510	.	.	E	-	2	0	FAM171A1	15296063	1.000000	0.71417	0.966000	0.40874	0.008000	0.06430	0.538000	0.23160	-0.360000	0.08138	-1.293000	0.01348	GAA	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.522	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	53	0.00	0	T	XM_167709		15256057	15256057	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	silent	37	31.48	17	SNP	0.959	C
NUTM2D	728130	genome.wustl.edu	37	10	89124862	89124862	+	Missense_Mutation	SNP	G	G	A	rs200907148	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr10:89124862G>A	ENST00000381697.2	+	5	2018	c.1420G>A	c.(1420-1422)Gaa>Aaa	p.E474K	NUTM2D_ENST00000412718.1_Missense_Mutation_p.E474K			Q5VT03	NTM2D_HUMAN	NUT family member 2D	474																	GGAAGAGGGCGAAGTGAAGCA	0.617													N|||	593	0.118411	0.0605	0.134	5008	,	,		10359	0.0536		0.175	False		,,,				2504	0.1943					dbGAP											0																																										-	-	-	SO:0001583	missense	0					10q23.31	2013-03-14	2013-03-14	2013-03-14	ENSG00000214562	ENSG00000214562			23447	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member D"""	FAM22D			Standard	NR_075100		Approved		uc001kes.3	Q5VT03	OTTHUMG00000018672	ENST00000381697.2:c.1420G>A	10.37:g.89124862G>A	ENSP00000371116:p.Glu474Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGV9	Missense_Mutation	SNP	NULL	p.E474K	ENST00000381697.2	37	c.1420		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	4.715|4.715	0.132979|0.132979	0.09032|0.09032	.|.	.|.	ENSG00000214562|ENSG00000214562	ENST00000330762;ENST00000381697;ENST00000381691;ENST00000412718|ENST00000451669	T;T|.	0.23147|.	2.72;1.92|.	0.628|0.628	-0.517|-0.517	0.11947|0.11947	Nuclear Testis protein, C-terminal (1);|.	2.599710|.	0.01260|.	N|.	0.009155|.	T|T	0.23886|0.23886	0.0578|0.0578	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B;B|.	0.24317|.	0.101;0.066|.	B;B|.	0.20767|.	0.031;0.012|.	T|T	0.26815|0.26815	-1.0092|-1.0092	8|3	0.14252|.	T|.	0.57|.	.|.	.|.	.|.	.|.	.|.	474;474|.	Q5VT03-2;Q5VT03|.	.;FA22D_HUMAN|.	K|Q	545;474;23;474|12	ENSP00000371116:E474K;ENSP00000396080:E474K|.	ENSP00000328439:E545K|.	E|R	+|+	1|2	0|0	FAM22D|FAM22D	89114842|89114842	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.247000|0.247000	0.25773|0.25773	-0.178000|-0.178000	0.09782|0.09782	-0.238000|-0.238000	0.09724|0.09724	0.195000|0.195000	0.17529|0.17529	GAA|CGA	FAM22D	-	NULL	ENSG00000214562		0.617	NUTM2D-004	KNOWN	basic|appris_candidate_longest	protein_coding	FAM22D	HGNC	protein_coding	OTTHUMT00000470142.1	10	0.00	0	G	NR_075100		89124862	89124862	+1	no_errors	ENST00000381697	ensembl	human	known	69_37n	missense	2	75.00	6	SNP	0.000	A
FAM3C	10447	genome.wustl.edu	37	7	121018965	121018965	+	Splice_Site	SNP	A	A	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr7:121018965A>C	ENST00000359943.3	-	3	330	c.117T>G	c.(115-117)ttT>ttG	p.F39L		NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C	39					multicellular organismal development (GO:0007275)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	cytokine activity (GO:0005125)			kidney(1)|lung(8)	9	all_neural(327;0.117)					AAAACTTACCAAATAGATTTC	0.313																																						dbGAP											0													37.0	38.0	38.0					7																	121018965		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			D87120	CCDS5782.1	7q22.1-q31.1	2014-08-14			ENSG00000196937	ENSG00000196937			18664	protein-coding gene	gene with protein product	"""predicted osteoblast protein"", ""interleukin-like EMT inducer"", ""interleukin-like epithelial-mesenchymal transition inducer"""	608618				12160727	Standard	NM_014888		Approved	GS3876, ILEI	uc010lkm.3	Q92520	OTTHUMG00000156979	ENST00000359943.3:c.118+1T>G	7.37:g.121018965A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDN2|A8K3R7	Missense_Mutation	SNP	NULL	p.F39L	ENST00000359943.3	37	c.117	CCDS5782.1	7	.	.	.	.	.	.	.	.	.	.	A	15.96	2.988033	0.53934	.	.	ENSG00000196937	ENST00000359943;ENST00000412653;ENST00000426156;ENST00000455828	T;T;T	0.40476	1.03;2.35;1.63	5.6	5.6	0.85130	.	0.417238	0.29676	N	0.011481	T	0.35335	0.0928	L	0.45285	1.41	0.58432	D	0.999996	B	0.17268	0.021	B	0.09377	0.004	T	0.14839	-1.0458	10	0.14656	T	0.56	-25.4633	15.4391	0.75168	1.0:0.0:0.0:0.0	.	39	Q92520	FAM3C_HUMAN	L	39;39;9;39	ENSP00000353025:F39L;ENSP00000408636:F39L;ENSP00000414940:F9L	ENSP00000353025:F39L	F	-	3	2	FAM3C	120806201	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.409000	0.59768	2.135000	0.66039	0.482000	0.46254	TTT	FAM3C	-	NULL	ENSG00000196937		0.313	FAM3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM3C	HGNC	protein_coding	OTTHUMT00000346945.1	28	0.00	0	A	NM_001040020	Missense_Mutation	121018965	121018965	-1	no_errors	ENST00000359943	ensembl	human	known	69_37n	missense	62	28.74	25	SNP	1.000	C
FBXO39	162517	genome.wustl.edu	37	17	6684022	6684022	+	Missense_Mutation	SNP	C	C	A	rs144312029	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr17:6684022C>A	ENST00000321535.4	+	2	965	c.835C>A	c.(835-837)Cag>Aag	p.Q279K		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	279										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						GCTGGCCAGGCAGGCCACCAA	0.552																																						dbGAP											0													71.0	60.0	64.0					17																	6684022		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.835C>A	17.37:g.6684022C>A	ENSP00000321386:p.Gln279Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q279K	ENST00000321535.4	37	c.835	CCDS11082.1	17	.	.	.	.	.	.	.	.	.	.	C	0.038	-1.297244	0.01364	.	.	ENSG00000177294	ENST00000321535	T	0.51325	0.71	5.02	3.02	0.34903	.	0.468898	0.19974	N	0.101921	T	0.20618	0.0496	N	0.08118	0	0.24442	N	0.994524	B	0.10296	0.003	B	0.06405	0.002	T	0.26985	-1.0087	10	0.02654	T	1	-9.7087	7.8445	0.29419	0.0:0.7493:0.1618:0.0889	.	279	Q8N4B4	FBX39_HUMAN	K	279	ENSP00000321386:Q279K	ENSP00000321386:Q279K	Q	+	1	0	FBXO39	6624746	0.996000	0.38824	0.954000	0.39281	0.614000	0.37383	1.043000	0.30316	0.780000	0.33566	-0.156000	0.13503	CAG	FBXO39	-	NULL	ENSG00000177294		0.552	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO39	HGNC	protein_coding	OTTHUMT00000219866.2	78	0.00	0	C	NM_153230		6684022	6684022	+1	no_errors	ENST00000321535	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.997	A
FRG1	2483	genome.wustl.edu	37	4	190874281	190874281	+	Splice_Site	SNP	G	G	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr4:190874281G>T	ENST00000226798.4	+	4	539		c.e4+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		CTGATTCCAGGTGAGCTTATG	0.308																																						dbGAP											0													11.0	11.0	11.0					4																	190874281		2073	4199	6272	-	-	-	SO:0001630	splice_region_variant	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.317+1G>T	4.37:g.190874281G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K775	Splice_Site	SNP	-	e4+1	ENST00000226798.4	37	c.317+1	CCDS34121.1	4	.	.	.	.	.	.	.	.	.	.	N	16.60	3.167697	0.57476	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	.	.	.	3.53	3.53	0.40419	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4576	0.61208	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191111275	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	8.872000	0.92352	1.917000	0.55516	0.632000	0.83419	.	FRG1	-	-	ENSG00000109536		0.308	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	HGNC	protein_coding	OTTHUMT00000359622.4	40	0.00	0	G	NM_004477	Intron	190874281	190874281	+1	no_errors	ENST00000226798	ensembl	human	known	69_37n	splice_site	259	13.38	40	SNP	1.000	T
GTPBP8	29083	genome.wustl.edu	37	3	112710242	112710242	+	Intron	SNP	T	T	C	rs2248029	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr3:112710242T>C	ENST00000383678.2	+	1	418				GTPBP8_ENST00000467752.1_5'Flank|GTPBP8_ENST00000383677.3_Intron|GTPBP8_ENST00000473129.1_5'Flank|RP11-484K9.4_ENST00000609673.1_RNA	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)						barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						ACCGCTTCCCTGGCCGTCCGG	0.567													T|||	720	0.14377	0.0318	0.1916	5008	,	,		17646	0.0784		0.2913	False		,,,				2504	0.1769					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.336+60T>C	3.37:g.112710242T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE99|A6NN11|A8K0P6|Q5I0Y4	Silent	SNP	NULL	p.P132	ENST00000383678.2	37	c.396	CCDS33820.1	3																																																																																			GTPBP8	-	NULL	ENSG00000163607		0.567	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP8	HGNC	protein_coding	OTTHUMT00000354260.2	11	0.00	0	T	NM_014170		112710242	112710242	+1	no_errors	ENST00000471627	ensembl	human	known	69_37n	silent	0	100.00	6	SNP	0.000	C
HERC2P2	400322	genome.wustl.edu	37	15	23318586	23318586	+	RNA	SNP	C	C	A	rs199761523	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr15:23318586C>A	ENST00000560464.1	-	0	2497									hect domain and RLD 2 pseudogene 2																		ATCATGGCAGCCAGTTCTGGC	0.493													c|||	72	0.014377	0.0023	0.0101	5008	,	,		20509	0.0337		0.0179	False		,,,				2504	0.0102					dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23318586C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.493	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	46	0.00	0	C			23318586	23318586	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	25	13.79	4	SNP	1.000	A
HSPG2	3339	genome.wustl.edu	37	1	22176924	22176924	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr1:22176924A>C	ENST00000374695.3	-	56	7305	c.7226T>G	c.(7225-7227)gTg>gGg	p.V2409G	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2409	Ig-like C2-type 9.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCTGCCCAACACTCGGCACAC	0.667																																						dbGAP											0													30.0	30.0	30.0					1																	22176924		2203	4299	6502	-	-	-	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.7226T>G	1.37:g.22176924A>C	ENSP00000363827:p.Val2409Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.V2409G	ENST00000374695.3	37	c.7226	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	A	14.66	2.601640	0.46423	.	.	ENSG00000142798	ENST00000374695	T	0.71934	-0.61	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34853	N	0.003638	T	0.79997	0.4543	M	0.83384	2.64	0.58432	D	0.999994	B;P	0.48589	0.201;0.912	B;P	0.51516	0.2;0.672	D	0.83385	0.0014	10	0.72032	D	0.01	.	13.4578	0.61210	1.0:0.0:0.0:0.0	.	349;2409	Q59EG0;P98160	.;PGBM_HUMAN	G	2409	ENSP00000363827:V2409G	ENSP00000363827:V2409G	V	-	2	0	HSPG2	22049511	0.861000	0.29849	0.322000	0.25334	0.039000	0.13416	4.774000	0.62339	2.077000	0.62373	0.459000	0.35465	GTG	HSPG2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000142798		0.667	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	25	0.00	0	A	NM_005529		22176924	22176924	-1	no_errors	ENST00000374695	ensembl	human	known	69_37n	missense	7	50.00	7	SNP	0.751	C
KDM4C	23081	genome.wustl.edu	37	9	7011799	7011799	+	Missense_Mutation	SNP	G	G	T	rs191848178		TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr9:7011799G>T	ENST00000381309.3	+	13	2453	c.1888G>T	c.(1888-1890)Gct>Tct	p.A630S	KDM4C_ENST00000536108.1_Missense_Mutation_p.A449S|KDM4C_ENST00000381306.3_Missense_Mutation_p.A630S|KDM4C_ENST00000442236.2_Missense_Mutation_p.A375S|KDM4C_ENST00000535193.1_Missense_Mutation_p.A652S|KDM4C_ENST00000428870.2_Missense_Mutation_p.A317S|KDM4C_ENST00000543771.1_Missense_Mutation_p.A630S	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	630					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						TAACTTCGCAGCTGAGCAAGA	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		20553	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													95.0	86.0	89.0					9																	7011799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1888G>T	9.37:g.7011799G>T	ENSP00000370710:p.Ala630Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.A630S	ENST00000381309.3	37	c.1888	CCDS6471.1	9	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	20.4	3.977812	0.74360	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870	T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.76	5.76	0.90799	.	0.109669	0.64402	D	0.000009	T	0.74015	0.3661	M	0.76328	2.33	0.54753	D	0.999987	P;P;D;D;D	0.89917	0.856;0.911;1.0;0.997;0.999	B;B;D;D;D	0.77557	0.355;0.434;0.99;0.957;0.972	T	0.73151	-0.4073	10	0.48119	T	0.1	-13.2061	19.9759	0.97304	0.0:0.0:1.0:0.0	.	375;630;652;630;630	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	S	652;630;630;630;375;449;317	ENSP00000442382:A652S;ENSP00000445427:A630S;ENSP00000370710:A630S;ENSP00000370707:A630S;ENSP00000409353:A375S;ENSP00000440656:A449S;ENSP00000405739:A317S	ENSP00000370707:A630S	A	+	1	0	KDM4C	7001799	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	7.457000	0.80775	2.713000	0.92767	0.655000	0.94253	GCT	KDM4C	-	NULL	ENSG00000107077		0.512	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	83	0.00	0	G	NM_015061		7011799	7011799	+1	no_errors	ENST00000381309	ensembl	human	known	69_37n	missense	18	64.00	32	SNP	1.000	T
KHDRBS3	10656	genome.wustl.edu	37	8	136619254	136619254	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr8:136619254T>A	ENST00000355849.5	+	7	1274	c.864T>A	c.(862-864)gaT>gaA	p.D288E	KHDRBS3_ENST00000520981.1_Missense_Mutation_p.D61E	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	288	Tyr-rich.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			ATTCCTATGATAACAGCTATA	0.398																																						dbGAP											0													204.0	190.0	195.0					8																	136619254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.864T>A	8.37:g.136619254T>A	ENSP00000348108:p.Asp288Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUL8|Q9UPA8	Missense_Mutation	SNP	smart_KH_dom	p.D288E	ENST00000355849.5	37	c.864	CCDS6374.1	8	.	.	.	.	.	.	.	.	.	.	T	14.83	2.652386	0.47362	.	.	ENSG00000131773	ENST00000355849;ENST00000524199;ENST00000520981	T;T	0.42513	1.02;0.97	6.01	0.984	0.19773	.	0.049590	0.85682	D	0.000000	T	0.22003	0.0530	L	0.31120	0.905	0.48185	D	0.999607	B	0.14438	0.01	B	0.17979	0.02	T	0.13710	-1.0499	10	0.07030	T	0.85	-24.4995	5.039	0.14449	0.0:0.2048:0.2716:0.5236	.	288	O75525	KHDR3_HUMAN	E	288;260;61	ENSP00000348108:D288E;ENSP00000428607:D61E	ENSP00000348108:D288E	D	+	3	2	KHDRBS3	136688436	0.991000	0.36638	0.998000	0.56505	0.987000	0.75469	0.121000	0.15667	-0.049000	0.13379	-0.299000	0.09455	GAT	KHDRBS3	-	NULL	ENSG00000131773		0.398	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS3	HGNC	protein_coding	OTTHUMT00000377529.1	158	0.00	0	T			136619254	136619254	+1	no_errors	ENST00000355849	ensembl	human	known	69_37n	missense	440	11.45	57	SNP	1.000	A
KLHDC8B	200942	genome.wustl.edu	37	3	49211701	49211701	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr3:49211701G>A	ENST00000332780.2	+	3	615	c.406G>A	c.(406-408)Ggc>Agc	p.G136S	KLHDC8B_ENST00000476495.2_3'UTR	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	136						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGGGGGAATGGGCCCTGACAC	0.612																																						dbGAP											0													103.0	98.0	100.0					3																	49211701		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.406G>A	3.37:g.49211701G>A	ENSP00000327468:p.Gly136Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.G136S	ENST00000332780.2	37	c.406	CCDS2791.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.551630	0.96501	.	.	ENSG00000185909	ENST00000332780	T	0.64803	-0.12	5.72	5.72	0.89469	Kelch-type beta propeller (1);	0.120394	0.53938	D	0.000049	T	0.76695	0.4023	L	0.61387	1.9	0.80722	D	1	D	0.62365	0.991	D	0.65987	0.94	T	0.74999	-0.3472	10	0.44086	T	0.13	-7.5168	18.8619	0.92276	0.0:0.0:1.0:0.0	.	136	Q8IXV7	KLD8B_HUMAN	S	136	ENSP00000327468:G136S	ENSP00000327468:G136S	G	+	1	0	KLHDC8B	49186705	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.815000	0.99349	2.687000	0.91594	0.655000	0.94253	GGC	KLHDC8B	-	pfam_Kelch_1,smart_Kelch_1	ENSG00000185909		0.612	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC8B	HGNC	protein_coding	OTTHUMT00000345974.1	37	0.00	0	G	NM_173546		49211701	49211701	+1	no_errors	ENST00000332780	ensembl	human	known	69_37n	missense	17	52.78	19	SNP	1.000	A
LAMB4	22798	genome.wustl.edu	37	7	107732103	107732103	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr7:107732103C>T	ENST00000388781.3	-	14	1752	c.1669G>A	c.(1669-1671)Gaa>Aaa	p.E557K	LAMB4_ENST00000205386.4_Missense_Mutation_p.E557K|LAMB4_ENST00000414450.2_Missense_Mutation_p.E557K|LAMB4_ENST00000388780.3_Missense_Mutation_p.E557K|LAMB4_ENST00000418464.1_Missense_Mutation_p.E557K	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	557	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GTTGTGGCTTCCTCTGCCTCG	0.488																																						dbGAP											0													104.0	97.0	99.0					7																	107732103		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.1669G>A	7.37:g.107732103C>T	ENSP00000373433:p.Glu557Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E557K	ENST00000388781.3	37	c.1669	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	11.03	1.519711	0.27211	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.32753	1.45;1.45;1.47;1.44;1.49	4.69	4.69	0.59074	Laminin IV (1);EGF-like, laminin (1);	0.300602	0.23724	N	0.045188	T	0.24236	0.0587	L	0.58101	1.795	0.24473	N	0.994388	P	0.34462	0.454	B	0.29598	0.104	T	0.12760	-1.0535	10	0.19147	T	0.46	.	8.0049	0.30319	0.0:0.7504:0.1628:0.0868	.	557	A4D0S4	LAMB4_HUMAN	K	557	ENSP00000205386:E557K;ENSP00000373433:E557K;ENSP00000373432:E557K;ENSP00000402353:E557K;ENSP00000402265:E557K	ENSP00000205386:E557K	E	-	1	0	LAMB4	107519339	0.939000	0.31865	1.000000	0.80357	0.095000	0.18619	0.980000	0.29513	2.421000	0.82119	0.655000	0.94253	GAA	LAMB4	-	smart_EGF_laminin,pfscan_Laminin_IV	ENSG00000091128		0.488	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	64	0.00	0	C	XM_209857		107732103	107732103	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	1.000	T
HS3ST3A1	9955	genome.wustl.edu	37	17	13446924	13446924	+	Intron	SNP	G	G	A	rs9913045	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr17:13446924G>A	ENST00000284110.1	-	2	1397				MIR548H3_ENST00000408771.1_RNA|HS3ST3A1_ENST00000578576.1_Intron	NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1						carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		gacaaaaaccgcgattacttt	0.328													G|||	2158	0.430911	0.7088	0.3689	5008	,	,		17056	0.2302		0.3618	False		,,,				2504	0.3773					dbGAP											0													77.0	66.0	70.0					17																	13446924		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.600-46789C>T	17.37:g.13446924G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7N2	RNA	SNP	-	NULL	ENST00000284110.1	37	NULL	CCDS11165.1	17																																																																																			MIR548H3	-	-	ENSG00000221698		0.328	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR548H3	HGNC	protein_coding	OTTHUMT00000129952.1	8	0.00	0	G	NM_006042		13446924	13446924	-1	no_errors	ENST00000408771	ensembl	human	known	69_37n	rna	26	82.43	122	SNP	0.003	A
MED24	9862	genome.wustl.edu	37	17	38187823	38187823	+	Silent	SNP	G	G	A	rs201064170		TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr17:38187823G>A	ENST00000394128.2	-	11	1116	c.1035C>T	c.(1033-1035)acC>acT	p.T345T	MED24_ENST00000479829.1_5'Flank|MED24_ENST00000356271.3_Silent_p.T332T|MED24_ENST00000501516.3_Silent_p.T364T|MED24_ENST00000394127.2_Silent_p.T332T|MED24_ENST00000394126.1_Silent_p.T370T	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	345					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CCAACAAGGGGGTGAGCTTCA	0.572																																						dbGAP											0													97.0	90.0	92.0					17																	38187823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1035C>T	17.37:g.38187823G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	pfam_Mediator_Med24_N	p.T345	ENST00000394128.2	37	c.1035	CCDS11359.1	17																																																																																			MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.572	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	42	0.00	0	G	NM_014815		38187823	38187823	-1	no_errors	ENST00000394128	ensembl	human	known	69_37n	silent	14	65.85	27	SNP	0.018	A
MYRIP	25924	genome.wustl.edu	37	3	40291713	40291713	+	Splice_Site	SNP	A	A	G			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr3:40291713A>G	ENST00000302541.6	+	14	2605	c.2263A>G	c.(2263-2265)Att>Gtt	p.I755V	MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000396217.3_Splice_Site_p.I666V|MYRIP_ENST00000539167.1_Splice_Site_p.I568V|MYRIP_ENST00000444716.1_Splice_Site_p.I755V|MYRIP_ENST00000425621.1_Splice_Site_p.I690V	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	755	Actin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		TTGCTTTAAGATTTCAGATAT	0.393																																						dbGAP											0													85.0	86.0	85.0					3																	40291713		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.2263-1A>G	3.37:g.40291713A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	pfam_Myelin-assoc_OBP,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.I755V	ENST00000302541.6	37	c.2263	CCDS2689.1	3	.	.	.	.	.	.	.	.	.	.	A	12.54	1.968916	0.34754	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.72	5.72	0.89469	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.055300	0.64402	D	0.000004	T	0.43299	0.1241	L	0.33293	1	0.41997	D	0.990874	D;D;B	0.62365	0.96;0.991;0.178	P;D;P	0.72625	0.906;0.978;0.536	T	0.23190	-1.0195	9	.	.	.	.	13.9558	0.64147	1.0:0.0:0.0:0.0	.	666;690;755	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	V	755;755;690;666;568	ENSP00000398665:I755V;ENSP00000301972:I755V;ENSP00000389323:I690V;ENSP00000379519:I666V;ENSP00000438297:I568V	.	I	+	1	0	MYRIP	40266717	1.000000	0.71417	0.997000	0.53966	0.097000	0.18754	6.590000	0.74085	2.184000	0.69523	0.533000	0.62120	ATT	MYRIP	-	pfam_Myelin-assoc_OBP	ENSG00000170011		0.393	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	157	0.00	0	A	NM_015460	Missense_Mutation	40291713	40291713	+1	no_errors	ENST00000302541	ensembl	human	known	69_37n	missense	44	54.64	53	SNP	1.000	G
NBPF10	100132406	genome.wustl.edu	37	1	145302775	145302775	+	Missense_Mutation	SNP	T	T	G	rs376014420		TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr1:145302775T>G	ENST00000369339.3	+	5	653	c.400T>G	c.(400-402)Tat>Gat	p.Y134D	NBPF10_ENST00000342960.5_Missense_Mutation_p.Y405D|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Missense_Mutation_p.Y134D			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	405						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCTCACTCCGTATGAGCCGGA	0.577																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.400T>G	1.37:g.145302775T>G	ENSP00000358345:p.Tyr134Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.Y405D	ENST00000369339.3	37	c.1213		1	.	.	.	.	.	.	.	.	.	.	.	0	-2.664813	0.00107	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.46063	0.88;4.33	0.712	-0.91	0.10511	.	.	.	.	.	T	0.03390	0.0098	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33189	-0.9878	7	0.02654	T	1	.	.	.	.	.	134	A8MQ30	.	D	330;134;134;405	ENSP00000358344:Y134D;ENSP00000345684:Y405D	ENSP00000345684:Y405D	Y	+	1	0	NBPF10	144014132	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.464000	0.06688	-1.158000	0.02811	-1.371000	0.01190	TAT	NBPF10	-	NULL	ENSG00000163386		0.577	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	NBPF10	HGNC	protein_coding	OTTHUMT00000038550.3	8	0.00	0	T	NM_001039703		145302775	145302775	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	0	100.00	13	SNP	0.000	G
OR4P4	81300	genome.wustl.edu	37	11	55406228	55406228	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr11:55406228T>A	ENST00000314612.2	+	1	395	c.395T>A	c.(394-396)aTt>aAt	p.I132N		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						CACTACACCATTATTATGAGC	0.433																																						dbGAP											0													81.0	71.0	75.0					11																	55406228		2179	4011	6190	-	-	-	SO:0001583	missense	0			AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	ENST00000314612.2:c.395T>A	11.37:g.55406228T>A	ENSP00000324831:p.Ile132Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I132N	ENST00000314612.2	37	c.395	CCDS31504.1	11	.	.	.	.	.	.	.	.	.	.	T	4.077	0.012164	0.07912	.	.	ENSG00000181927	ENST00000314612	T	0.00578	6.44	4.84	-0.139	0.13460	GPCR, rhodopsin-like superfamily (1);	1.778480	0.03296	N	0.188228	T	0.01061	0.0035	M	0.62266	1.93	0.09310	N	1	B	0.33857	0.429	B	0.35813	0.211	T	0.49495	-0.8934	10	0.56958	D	0.05	-1.0618	9.3391	0.38069	0.0:0.497:0.0:0.503	.	132	Q8NGL7	OR4P4_HUMAN	N	132	ENSP00000324831:I132N	ENSP00000324831:I132N	I	+	2	0	OR4P4	55162804	0.000000	0.05858	0.133000	0.22050	0.000000	0.00434	-1.639000	0.02011	0.052000	0.16007	-1.065000	0.02276	ATT	OR4P4	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181927		0.433	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4P4	HGNC	protein_coding	OTTHUMT00000383356.1	117	0.00	0	T	NM_001004124		55406228	55406228	+1	no_errors	ENST00000314612	ensembl	human	known	69_37n	missense	114	14.29	19	SNP	0.035	A
PLEKHM2	23207	genome.wustl.edu	37	1	16043237	16043237	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr1:16043237T>C	ENST00000375799.3	+	3	430	c.203T>C	c.(202-204)gTg>gCg	p.V68A	PLEKHM2_ENST00000375793.2_Missense_Mutation_p.V68A	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	68	Interaction with KIF5B.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		TGGGTGCTCGTGGTGCATTTT	0.602																																						dbGAP											0													42.0	43.0	42.0					1																	16043237		2072	4215	6287	-	-	-	SO:0001583	missense	0			AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.203T>C	1.37:g.16043237T>C	ENSP00000364956:p.Val68Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.V68A	ENST00000375799.3	37	c.203	CCDS44063.1	1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.899445	0.91962	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.31769	1.48;1.48	5.72	5.72	0.89469	RUN (2);	0.000000	0.85682	D	0.000000	T	0.45498	0.1345	L	0.37750	1.13	0.80722	D	1	D	0.61080	0.989	D	0.70487	0.969	T	0.26677	-1.0096	10	0.38643	T	0.18	-19.9636	15.9886	0.80183	0.0:0.0:0.0:1.0	.	68	Q8IWE5	PKHM2_HUMAN	A	68	ENSP00000364956:V68A;ENSP00000364950:V68A	ENSP00000364950:V68A	V	+	2	0	PLEKHM2	15915824	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.913000	0.87471	2.177000	0.69029	0.528000	0.53228	GTG	PLEKHM2	-	pfam_Run,pfscan_Run	ENSG00000116786		0.602	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1	139	0.00	0	T	NM_015164		16043237	16043237	+1	no_errors	ENST00000375799	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	C
PCNXL2	80003	genome.wustl.edu	37	1	233397811	233397811	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr1:233397811G>A	ENST00000258229.9	-	3	694	c.460C>T	c.(460-462)Cat>Tat	p.H154Y	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	154						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GAAGAGTGATGAGAGGTTATG	0.498																																						dbGAP											0													189.0	202.0	198.0					1																	233397811		2007	4172	6179	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.460C>T	1.37:g.233397811G>A	ENSP00000258229:p.His154Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.H154Y	ENST00000258229.9	37	c.460	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147285	0.37923	.	.	ENSG00000135749	ENST00000258229	T	0.63417	-0.04	5.59	5.59	0.84812	.	.	.	.	.	T	0.45256	0.1333	N	0.14661	0.345	0.80722	D	1	P	0.36048	0.534	B	0.28553	0.091	T	0.52102	-0.8620	9	0.59425	D	0.04	.	17.0868	0.86613	0.0:0.0:1.0:0.0	.	154	A6NKB5	PCX2_HUMAN	Y	154	ENSP00000258229:H154Y	ENSP00000258229:H154Y	H	-	1	0	PCNXL2	231464434	0.772000	0.28567	0.055000	0.19348	0.032000	0.12392	4.093000	0.57714	2.787000	0.95880	0.655000	0.94253	CAT	PCNXL2	-	NULL	ENSG00000135749		0.498	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	183	0.00	0	G	NM_014801		233397811	233397811	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	120	14.89	21	SNP	0.322	A
PMP22	5376	genome.wustl.edu	37	17	15134333	15134333	+	Silent	SNP	C	C	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr17:15134333C>T	ENST00000395938.2	-	5	578	c.384G>A	c.(382-384)tcG>tcA	p.S128S	PMP22_ENST00000312280.3_Silent_p.S128S|PMP22_ENST00000395936.1_3'UTR|PMP22_ENST00000494511.1_Missense_Mutation_p.G69R	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	128					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		AGGAGTAATCCGAGTTGAGAT	0.597																																						dbGAP											0													73.0	64.0	67.0					17																	15134333		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.384G>A	17.37:g.15134333C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WV01	Missense_Mutation	SNP	NULL	p.G69R	ENST00000395938.2	37	c.205	CCDS11168.1	17																																																																																			PMP22	-	NULL	ENSG00000109099		0.597	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP22	HGNC	protein_coding	OTTHUMT00000130378.1	34	0.00	0	C	NM_000304		15134333	15134333	-1	no_errors	ENST00000494511	ensembl	human	novel	69_37n	missense	5	76.19	16	SNP	0.000	T
RBMX	27316	genome.wustl.edu	37	X	135956571	135956572	+	Frame_Shift_Ins	INS	-	-	GG	rs369155856		TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chrX:135956571_135956572insGG	ENST00000320676.7	-	9	1059_1060	c.905_906insCC	c.(904-906)ccafs	p.P302fs	RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000562646.1_3'UTR|RBMX_ENST00000565438.1_Frame_Shift_Ins_p.P174fs|RBMX_ENST00000570135.1_Frame_Shift_Ins_p.P167fs|RBMX_ENST00000431446.3_Intron	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	302					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CACCATAAGATGGCGGGGGCCC	0.465																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.904_905dupCC	X.37:g.135956572_135956573dupGG	ENSP00000359645:p.Pro302fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.S303fs	ENST00000320676.7	37	c.906_905	CCDS14661.1	X																																																																																			RBMX	-	NULL	ENSG00000147274		0.465	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	HGNC	protein_coding	OTTHUMT00000058507.1	66	0.00	0	-	NM_002139		135956571	135956572	-1	no_errors	ENST00000320676	ensembl	human	known	69_37n	frame_shift_ins	26	13.33	4	INS	1.000:1.000	GG
SAP25	100316904	genome.wustl.edu	37	7	100170027	100170027	+	Silent	SNP	G	G	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr7:100170027G>C	ENST00000538735.1	-	6	660	c.483C>G	c.(481-483)tcC>tcG	p.S161S		NM_001168682.1	NP_001162153.1	Q8TEE9	SAP25_HUMAN	Sin3A-associated protein, 25kDa	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CAACCGCGGAGGAGCTGGGCC	0.692																																						dbGAP											0													20.0	24.0	23.0					7																	100170027		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS55137.1	7q22.1	2011-05-19			ENSG00000205307	ENSG00000205307			41908	protein-coding gene	gene with protein product						16449650	Standard	NM_001168682		Approved	FLJ00248	uc022aip.1	Q8TEE9		ENST00000538735.1:c.483C>G	7.37:g.100170027G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.S161	ENST00000538735.1	37	c.483	CCDS55137.1	7																																																																																			SAP25	-	NULL	ENSG00000205307		0.692	SAP25-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SAP25	HGNC	protein_coding		22	0.00	0	G			100170027	100170027	-1	no_errors	ENST00000538735	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	0.000	C
SDHAP1	255812	genome.wustl.edu	37	3	195701310	195701311	+	RNA	INS	-	-	AA	rs369138533		TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr3:195701310_195701311insAA	ENST00000427841.1	-	0	1513_1514					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		CATGCCTGACCAGACAACCAGG	0.574																																					Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195701310_195701311insAA		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	INS	-	NULL	ENST00000427841.1	37	c.NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.574	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	27	0.00	0	-			195701310	195701311	-1	no_coding_region:pseudogene	ENST00000354937	ensembl	human	known	69_37n	splice_site_ins	19	47.22	17	INS	1.000:0.999	AA
SLC37A2	219855	genome.wustl.edu	37	11	124947362	124947362	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr11:124947362G>C	ENST00000403796.2	+	4	553	c.252G>C	c.(250-252)aaG>aaC	p.K84N	SLC37A2_ENST00000407458.1_Missense_Mutation_p.K84N|SLC37A2_ENST00000298280.5_Missense_Mutation_p.K84N|SLC37A2_ENST00000308074.4_Missense_Mutation_p.K84N	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	84					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		ACAACTATAAGGAGTTACTAG	0.547																																					Melanoma(11;373 620 21213 26083 47768)	dbGAP											0													109.0	105.0	107.0					11																	124947362		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.252G>C	11.37:g.124947362G>C	ENSP00000384407:p.Lys84Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.K84N	ENST00000403796.2	37	c.252	CCDS44757.1	11	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972822	0.34848	.	.	ENSG00000134955	ENST00000403796;ENST00000407458;ENST00000298280;ENST00000532000;ENST00000308074	T;T;T;T;T	0.58797	0.31;0.31;0.31;0.82;0.31	4.71	2.75	0.32379	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.244385	0.41500	N	0.000868	T	0.51329	0.1668	M	0.66378	2.025	0.38799	D	0.955158	B;B	0.09022	0.002;0.001	B;B	0.18561	0.012;0.022	T	0.49606	-0.8922	10	0.46703	T	0.11	-3.5142	6.8964	0.24259	0.0804:0.0:0.6041:0.3155	.	84;84	Q8TED4-2;Q8TED4	.;SPX2_HUMAN	N	84;84;84;47;84	ENSP00000384407:K84N;ENSP00000385126:K84N;ENSP00000298280:K84N;ENSP00000432254:K47N;ENSP00000311833:K84N	ENSP00000298280:K84N	K	+	3	2	SLC37A2	124452572	1.000000	0.71417	0.820000	0.32676	0.793000	0.44817	3.258000	0.51507	0.546000	0.28920	0.555000	0.69702	AAG	SLC37A2	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000134955		0.547	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC37A2	HGNC	protein_coding	OTTHUMT00000386837.1	92	0.00	0	G	XM_166184		124947362	124947362	+1	no_errors	ENST00000308074	ensembl	human	known	69_37n	missense	21	55.32	26	SNP	0.998	C
SMG1	23049	genome.wustl.edu	37	16	18872050	18872050	+	Silent	SNP	C	C	T	rs62046312	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr16:18872050C>T	ENST00000446231.2	-	26	4156	c.3744G>A	c.(3742-3744)caG>caA	p.Q1248Q	SMG1_ENST00000389467.3_Silent_p.Q1248Q			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1248	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ACAATTCTAACTGCTCGGTAC	0.328													c|||	917	0.183107	0.2738	0.2378	5008	,	,		17259	0.1151		0.1282	False		,,,				2504	0.1483					dbGAP											0													21.0	20.0	20.0					16																	18872050		1612	3627	5239	-	-	-	SO:0001819	synonymous_variant	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.3744G>A	16.37:g.18872050C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q1248	ENST00000446231.2	37	c.3744	CCDS45430.1	16																																																																																			SMG1	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000157106		0.328	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	12	0.00	0	C	NM_015092		18872050	18872050	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	silent	98	48.42	92	SNP	0.981	T
TP53	7157	genome.wustl.edu	37	17	7578246	7578247	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr17:7578246_7578247insA	ENST00000269305.4	-	6	791_792	c.602_603insT	c.(601-603)ttgfs	p.L201fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.L201fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Frame_Shift_Ins_p.L201fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.L201fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.L201fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.L201fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	201	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> P (in a sporadic cancer; somatic mutation).|L -> S (in a sporadic cancer; somatic mutation).|LR -> FC (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L201F(7)|p.?(5)|p.N200fs*4(1)|p.L201P(1)|p.L201S(1)|p.E198fs*7(1)|p.L201fs*46(1)|p.R202fs*9(1)|p.R202fs*8(1)|p.P191fs*6(1)|p.L201*(1)|p.L201_R202>FC(1)|p.G199fs*42(1)|p.R202fs*7(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACTCCACACGCAAATTTCCTTC	0.55		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	32	Substitution - Missense(9)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Substitution - Nonsense(1)|Complex - frameshift(1)|Complex - compound substitution(1)	biliary_tract(5)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(3)|stomach(2)|central_nervous_system(2)|thymus(2)|oesophagus(2)|breast(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|lung(1)|ovary(1)|pancreas(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.603dupT	17.37:g.7578249_7578249dupA	ENSP00000269305:p.Leu201fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L201fs	ENST00000269305.4	37	c.603_602	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.550	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	181	0.00	0	-	NM_000546		7578246	7578247	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_ins	56	57.58	76	INS	0.000:0.000	A
TRAPPC10	7109	genome.wustl.edu	37	21	45479068	45479068	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr21:45479068C>T	ENST00000291574.4	+	6	938	c.763C>T	c.(763-765)Cag>Tag	p.Q255*	TRAPPC10_ENST00000380221.3_Nonsense_Mutation_p.Q255*	NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	255					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						CCTCTTCTCTCAGTATGTGGT	0.527																																						dbGAP											0													65.0	53.0	57.0					21																	45479068		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.763C>T	21.37:g.45479068C>T	ENSP00000291574:p.Gln255*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Nonsense_Mutation	SNP	NULL	p.Q255*	ENST00000291574.4	37	c.763	CCDS13704.1	21	.	.	.	.	.	.	.	.	.	.	C	38	7.019449	0.98006	.	.	ENSG00000160218	ENST00000380221;ENST00000291574	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.2839	0.94063	0.0:1.0:0.0:0.0	.	.	.	.	X	255	.	ENSP00000291574:Q255X	Q	+	1	0	TRAPPC10	44303496	1.000000	0.71417	0.994000	0.49952	0.968000	0.65278	7.553000	0.82203	2.554000	0.86153	0.561000	0.74099	CAG	TRAPPC10	-	NULL	ENSG00000160218		0.527	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TRAPPC10	HGNC	protein_coding	OTTHUMT00000195737.1	62	0.00	0	C	NM_003274		45479068	45479068	+1	no_errors	ENST00000291574	ensembl	human	known	69_37n	nonsense	16	33.33	8	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179443676	179443676	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr2:179443676C>T	ENST00000591111.1	-	270	63382	c.63158G>A	c.(63157-63159)tGc>tAc	p.C21053Y	RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.C13821Y|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.C13754Y|TTN_ENST00000460472.2_Missense_Mutation_p.C13629Y|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.C20126Y|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.C22694Y|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21053	Fibronectin type-III 52. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTGAGGCGCACGTCACCCA	0.463																																						dbGAP											0													97.0	96.0	96.0					2																	179443676		1987	4151	6138	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63158G>A	2.37:g.179443676C>T	ENSP00000465570:p.Cys21053Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.C20126Y	ENST00000591111.1	37	c.60377		2	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600977	0.28534	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.87	4.99	0.66335	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60599	0.2281	L	0.51422	1.61	0.42181	D	0.991681	P;P;P;P	0.49696	0.927;0.927;0.927;0.873	P;P;P;P	0.52109	0.69;0.69;0.69;0.602	T	0.65825	-0.6074	9	0.87932	D	0	.	16.6084	0.84837	0.1308:0.8692:0.0:0.0	.	13629;13754;13821;21053	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Y	20126;13629;13821;13754;13627	ENSP00000343764:C20126Y;ENSP00000434586:C13629Y;ENSP00000340554:C13821Y;ENSP00000352154:C13754Y	ENSP00000340554:C13821Y	C	-	2	0	TTN	179151922	1.000000	0.71417	0.880000	0.34516	0.991000	0.79684	6.199000	0.72112	1.461000	0.47929	0.650000	0.86243	TGC	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	101	0.00	0	C	NM_133378		179443676	179443676	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	54	34.52	29	SNP	0.998	T
AC002472.1	0	genome.wustl.edu	37	22	21363561	21363561	+	5'Flank	SNP	T	T	C	rs4820723	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr22:21363561T>C	ENST00000547793.2	-	0	0				THAP7-AS1_ENST00000436079.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|TUBA3FP_ENST00000422086.1_RNA																							CAGGATGGAGTTGTAGGGCTC	0.557													T|||	872	0.174121	0.1974	0.1124	5008	,	,		19020	0.245		0.1421	False		,,,				2504	0.1462					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0																															22.37:g.21363561T>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000547793.2	37	NULL		22																																																																																			TUBA3FP	-	-	ENSG00000161149		0.557	AC002472.1-201	NOVEL	basic|appris_principal	protein_coding	TUBA3FP	HGNC	protein_coding		13	0.00	0	T			21363561	21363561	-1	no_errors	ENST00000292748	ensembl	human	known	69_37n	rna	48	45.56	41	SNP	1.000	C
XKR4	114786	genome.wustl.edu	37	8	56435907	56435907	+	Silent	SNP	G	G	A			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr8:56435907G>A	ENST00000327381.6	+	3	1174	c.1074G>A	c.(1072-1074)cgG>cgA	p.R358R	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	358						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			AGGCCCTCCGGGACTCTCGAG	0.582																																						dbGAP											0													113.0	96.0	102.0					8																	56435907		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1074G>A	8.37:g.56435907G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ8	Silent	SNP	pfam_Transport_prot_XK	p.R358	ENST00000327381.6	37	c.1074	CCDS34893.1	8																																																																																			XKR4	-	pfam_Transport_prot_XK	ENSG00000206579		0.582	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	297	0.33	1	G	NM_052898		56435907	56435907	+1	no_errors	ENST00000327381	ensembl	human	known	69_37n	silent	43	37.68	26	SNP	1.000	A
XPO4	64328	genome.wustl.edu	37	13	21382693	21382693	+	Silent	SNP	G	G	C			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr13:21382693G>C	ENST00000255305.6	-	12	1592	c.1521C>G	c.(1519-1521)ctC>ctG	p.L507L	XPO4_ENST00000400602.2_Silent_p.L507L			Q9C0E2	XPO4_HUMAN	exportin 4	507					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		ACTGACCATGGAGTCTTGTTA	0.358																																						dbGAP											0													91.0	85.0	87.0					13																	21382693		1848	4079	5927	-	-	-	SO:0001819	synonymous_variant	0			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.1521C>G	13.37:g.21382693G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUZ5|Q8N3V6|Q9H934	Silent	SNP	superfamily_ARM-type_fold	p.L507	ENST00000255305.6	37	c.1521	CCDS41872.1	13																																																																																			XPO4	-	superfamily_ARM-type_fold	ENSG00000132953		0.358	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	82	0.00	0	G	NM_022459		21382693	21382693	-1	no_errors	ENST00000255305	ensembl	human	known	69_37n	silent	91	35.00	49	SNP	1.000	C
ZNF254	9534	genome.wustl.edu	37	19	24310770	24310770	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr19:24310770C>G	ENST00000357002.4	+	4	2083	c.1968C>G	c.(1966-1968)atC>atG	p.I656M	ZNF254_ENST00000342944.6_Missense_Mutation_p.I571M	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	656				WREILQV -> TGEKSYKYE (in Ref. 1; AAC39913). {ECO:0000305}.	negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				GGAGAGAAATCTTACAAGTAT	0.388																																						dbGAP											0													68.0	73.0	71.0					19																	24310770		2201	4294	6495	-	-	-	SO:0001583	missense	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.1968C>G	19.37:g.24310770C>G	ENSP00000349494:p.Ile656Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPC0|Q86XL7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I656M	ENST00000357002.4	37	c.1968	CCDS32983.1	19	.	.	.	.	.	.	.	.	.	.	C	0.511	-0.866662	0.02590	.	.	ENSG00000213096	ENST00000342944;ENST00000357002;ENST00000392281	T;T	0.08193	3.12;3.29	1.11	-0.266	0.12942	.	.	.	.	.	T	0.04588	0.0125	N	0.14661	0.345	0.09310	N	1	B	0.30542	0.284	B	0.14023	0.01	T	0.28396	-1.0045	9	0.87932	D	0	.	8.4451	0.32836	0.2312:0.7687:0.0:0.0	.	656	O75437	ZN254_HUMAN	M	571;656;348	ENSP00000445527:I571M;ENSP00000349494:I656M	ENSP00000445527:I571M	I	+	3	3	ZNF254	24102610	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.454000	0.21827	-2.130000	0.00816	-2.386000	0.00229	ATC	ZNF254	-	NULL	ENSG00000213096		0.388	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	HGNC	protein_coding	OTTHUMT00000466453.1	25	0.00	0	C	NM_004876		24310770	24310770	+1	no_errors	ENST00000357002	ensembl	human	known	69_37n	missense	20	39.39	13	SNP	0.134	G
ZNF469	84627	genome.wustl.edu	37	16	88501728	88501728	+	Missense_Mutation	SNP	G	G	C	rs200019229	byFrequency	TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr16:88501728G>C	ENST00000437464.1	+	2	7766	c.7766G>C	c.(7765-7767)cGa>cCa	p.R2589P	ZNF469_ENST00000565624.1_Missense_Mutation_p.R2617P	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R2589Q(1)		breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						AGGTGGCGCCGAGAGCCCACC	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											19.0	24.0	23.0					16																	88501728		692	1590	2282	-	-	-	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7766G>C	16.37:g.88501728G>C	ENSP00000402343:p.Arg2589Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R2589P	ENST00000437464.1	37	c.7766	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758856	0.31137	.	.	ENSG00000225614	ENST00000437464	T	0.42131	0.98	4.67	0.867	0.19085	.	.	.	.	.	T	0.36552	0.0971	N	0.19112	0.55	0.09310	N	1	D	0.61697	0.99	P	0.55345	0.774	T	0.16897	-1.0387	9	0.72032	D	0.01	.	5.6289	0.17499	0.6011:0.0:0.3989:0.0	.	2589	Q96JG9	ZN469_HUMAN	P	2589	ENSP00000402343:R2589P	ENSP00000402343:R2589P	R	+	2	0	ZNF469	87029229	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.012000	0.13287	0.271000	0.22005	0.491000	0.48974	CGA	ZNF469	-	NULL	ENSG00000225614		0.577	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		9	0.00	0	G	NG_012236		88501728	88501728	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.000	C
ZNF644	84146	genome.wustl.edu	37	1	91406655	91406655	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BG-01A-11D-A10Y-09	TCGA-BH-A0BG-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	923ee16a-2c42-46ee-b2cb-82075f2dd603	483a4feb-931f-40f8-964d-29104030ebe7	g.chr1:91406655C>T	ENST00000370440.1	-	3	473	c.256G>A	c.(256-258)Gcc>Acc	p.A86T	ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.A86T|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CCACTTAAGGCGTTTTCAGAT	0.403																																						dbGAP											0													140.0	135.0	136.0					1																	91406655		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.256G>A	1.37:g.91406655C>T	ENSP00000359469:p.Ala86Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A86T	ENST00000370440.1	37	c.256	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730575	0.69074	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000541557	T;T	0.00649	5.98;5.98	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.01287	0.0042	L	0.32530	0.975	0.58432	D	0.999994	D	0.76494	0.999	D	0.72625	0.978	T	0.78290	-0.2261	10	0.66056	D	0.02	-5.7498	20.2983	0.98569	0.0:1.0:0.0:0.0	.	86	Q9H582	ZN644_HUMAN	T	86	ENSP00000359469:A86T;ENSP00000337008:A86T	ENSP00000337008:A86T	A	-	1	0	ZNF644	91179243	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.915000	0.69973	2.802000	0.96397	0.655000	0.94253	GCC	ZNF644	-	NULL	ENSG00000122482		0.403	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	108	0.00	0	C	NM_032186		91406655	91406655	-1	no_errors	ENST00000337393	ensembl	human	known	69_37n	missense	158	22.93	47	SNP	1.000	T
