#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSL3	2181	genome.wustl.edu	37	2	223806218	223806218	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr2:223806218G>A	ENST00000357430.3	+	17	2540	c.2009G>A	c.(2008-2010)aGt>aAt	p.S670N	ACSL3_ENST00000392066.3_Missense_Mutation_p.S670N	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	670					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	ATCTTAGCAAGTCTGGAAAAG	0.378			T	ETV1	prostate																																	dbGAP		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	0													42.0	46.0	45.0					2																	223806218		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.2009G>A	2.37:g.223806218G>A	ENSP00000350012:p.Ser670Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q60I92|Q8IUM9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.S670N	ENST00000357430.3	37	c.2009	CCDS2455.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.21|13.21	2.170177|2.170177	0.38315|0.38315	.|.	.|.	ENSG00000123983|ENSG00000123983	ENST00000357430;ENST00000392066|ENST00000407441	T;T|.	0.17054|.	2.3;2.3|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.201542|.	0.53938|.	D|.	0.000050|.	T|T	0.18593|0.18593	0.0446|0.0446	N|N	0.02685|0.02685	-0.53|-0.53	0.33512|0.33512	D|D	0.591333|0.591333	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.28202|0.28202	-1.0051|-1.0051	10|5	0.44086|.	T|.	0.13|.	-25.4903|-25.4903	6.7747|6.7747	0.23613|0.23613	0.1108:0.1768:0.7124:0.0|0.1108:0.1768:0.7124:0.0	.|.	670|.	O95573|.	ACSL3_HUMAN|.	N|I	670|171	ENSP00000350012:S670N;ENSP00000375918:S670N|.	ENSP00000350012:S670N|.	S|V	+|+	2|1	0|0	ACSL3|ACSL3	223514462|223514462	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.873000|4.873000	0.63057|0.63057	2.739000|2.739000	0.93911|0.93911	0.655000|0.655000	0.94253|0.94253	AGT|GTC	ACSL3	-	NULL	ENSG00000123983		0.378	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL3	HGNC	protein_coding	OTTHUMT00000256862.2	62	0.00	0	G	NM_004457		223806218	223806218	+1	no_errors	ENST00000357430	ensembl	human	known	69_37n	missense	69	25.81	24	SNP	1.000	A
ACSL3	2181	genome.wustl.edu	37	2	223806218	223806218	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr2:223806218G>A	ENST00000357430.3	+	17	2540	c.2009G>A	c.(2008-2010)aGt>aAt	p.S670N	ACSL3_ENST00000392066.3_Missense_Mutation_p.S670N	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	670					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	ATCTTAGCAAGTCTGGAAAAG	0.378			T	ETV1	prostate																																	dbGAP		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	0													42.0	46.0	45.0					2																	223806218		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.2009G>A	2.37:g.223806218G>A	ENSP00000350012:p.Ser670Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q60I92|Q8IUM9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.S670N	ENST00000357430.3	37	c.2009	CCDS2455.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.21|13.21	2.170177|2.170177	0.38315|0.38315	.|.	.|.	ENSG00000123983|ENSG00000123983	ENST00000357430;ENST00000392066|ENST00000407441	T;T|.	0.17054|.	2.3;2.3|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.201542|.	0.53938|.	D|.	0.000050|.	T|T	0.18593|0.18593	0.0446|0.0446	N|N	0.02685|0.02685	-0.53|-0.53	0.33512|0.33512	D|D	0.591333|0.591333	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.28202|0.28202	-1.0051|-1.0051	10|5	0.44086|.	T|.	0.13|.	-25.4903|-25.4903	6.7747|6.7747	0.23613|0.23613	0.1108:0.1768:0.7124:0.0|0.1108:0.1768:0.7124:0.0	.|.	670|.	O95573|.	ACSL3_HUMAN|.	N|I	670|171	ENSP00000350012:S670N;ENSP00000375918:S670N|.	ENSP00000350012:S670N|.	S|V	+|+	2|1	0|0	ACSL3|ACSL3	223514462|223514462	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.873000|4.873000	0.63057|0.63057	2.739000|2.739000	0.93911|0.93911	0.655000|0.655000	0.94253|0.94253	AGT|GTC	ACSL3	-	NULL	ENSG00000123983		0.378	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL3	HGNC	protein_coding	OTTHUMT00000256862.2	109	0.00	0	G	NM_004457		223806218	223806218	+1	no_errors	ENST00000357430	ensembl	human	known	69_37n	missense	69	25.81	24	SNP	1.000	A
ALS2CL	259173	genome.wustl.edu	37	3	46717150	46717150	+	Missense_Mutation	SNP	C	C	A	rs554056115	byFrequency	TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr3:46717150C>A	ENST00000318962.4	-	20	2296	c.2213G>T	c.(2212-2214)cGc>cTc	p.R738L	ALS2CL_ENST00000383742.3_Missense_Mutation_p.R85L|ALS2CL_ENST00000415953.1_Missense_Mutation_p.R738L	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	738					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CTGGCCCTTGCGCTCTAAGGC	0.592																																						dbGAP											0													99.0	92.0	94.0					3																	46717150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2213G>T	3.37:g.46717150C>A	ENSP00000313670:p.Arg738Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.R738L	ENST00000318962.4	37	c.2213	CCDS2743.1	3	.	.	.	.	.	.	.	.	.	.	C	11.93	1.785227	0.31593	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.26223	1.75;1.75;1.75	4.66	0.875	0.19130	.	1.165660	0.06443	N	0.726293	T	0.25680	0.0625	L	0.47716	1.5	0.27896	N	0.939148	P	0.44877	0.845	B	0.42738	0.396	T	0.28933	-1.0028	10	0.66056	D	0.02	.	6.6069	0.22729	0.0:0.6023:0.0:0.3977	.	738	Q60I27	AL2CL_HUMAN	L	738;738;85	ENSP00000313670:R738L;ENSP00000413223:R738L;ENSP00000373248:R85L	ENSP00000313670:R738L	R	-	2	0	ALS2CL	46692154	0.996000	0.38824	0.988000	0.46212	0.050000	0.14768	0.378000	0.20569	0.303000	0.22785	-1.075000	0.02238	CGC	ALS2CL	-	NULL	ENSG00000178038		0.592	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	HGNC	protein_coding	OTTHUMT00000250567.3	77	0.00	0	C	NM_147129		46717150	46717150	-1	no_errors	ENST00000318962	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.675	A
ALS2CL	259173	genome.wustl.edu	37	3	46717150	46717150	+	Missense_Mutation	SNP	C	C	A	rs554056115	byFrequency	TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr3:46717150C>A	ENST00000318962.4	-	20	2296	c.2213G>T	c.(2212-2214)cGc>cTc	p.R738L	ALS2CL_ENST00000383742.3_Missense_Mutation_p.R85L|ALS2CL_ENST00000415953.1_Missense_Mutation_p.R738L	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	738					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CTGGCCCTTGCGCTCTAAGGC	0.592																																						dbGAP											0													99.0	92.0	94.0					3																	46717150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2213G>T	3.37:g.46717150C>A	ENSP00000313670:p.Arg738Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.R738L	ENST00000318962.4	37	c.2213	CCDS2743.1	3	.	.	.	.	.	.	.	.	.	.	C	11.93	1.785227	0.31593	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.26223	1.75;1.75;1.75	4.66	0.875	0.19130	.	1.165660	0.06443	N	0.726293	T	0.25680	0.0625	L	0.47716	1.5	0.27896	N	0.939148	P	0.44877	0.845	B	0.42738	0.396	T	0.28933	-1.0028	10	0.66056	D	0.02	.	6.6069	0.22729	0.0:0.6023:0.0:0.3977	.	738	Q60I27	AL2CL_HUMAN	L	738;738;85	ENSP00000313670:R738L;ENSP00000413223:R738L;ENSP00000373248:R85L	ENSP00000313670:R738L	R	-	2	0	ALS2CL	46692154	0.996000	0.38824	0.988000	0.46212	0.050000	0.14768	0.378000	0.20569	0.303000	0.22785	-1.075000	0.02238	CGC	ALS2CL	-	NULL	ENSG00000178038		0.592	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	HGNC	protein_coding	OTTHUMT00000250567.3	103	0.00	0	C	NM_147129		46717150	46717150	-1	no_errors	ENST00000318962	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.675	A
CFAP20	29105	genome.wustl.edu	37	16	58149339	58149339	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr16:58149339C>T	ENST00000262498.3	-	4	633	c.299G>A	c.(298-300)cGt>cAt	p.R100H	CTB-134F13.1_ENST00000564672.1_RNA|C16orf80_ENST00000562443.1_5'UTR	NM_013242.2	NP_037374.1														kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						AAAGCGACGACGCACATTCTT	0.517																																					Pancreas(103;1212 1612 18629 30162 52390)	dbGAP											0													124.0	109.0	114.0					16																	58149339		2198	4300	6498	-	-	-	SO:0001583	missense	0																														ENST00000262498.3:c.299G>A	16.37:g.58149339C>T	ENSP00000262498:p.Arg100His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF667	p.R100H	ENST00000262498.3	37	c.299	CCDS10793.1	16	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226419	0.79576	.	.	ENSG00000070761	ENST00000262498	T	0.50001	0.76	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.50103	0.1596	M	0.71581	2.175	0.80722	D	1	B	0.26602	0.154	B	0.24269	0.052	T	0.42464	-0.9450	10	0.34782	T	0.22	-7.144	17.4545	0.87603	0.0:1.0:0.0:0.0	.	100	Q9Y6A4	CP080_HUMAN	H	100	ENSP00000262498:R100H	ENSP00000262498:R100H	R	-	2	0	C16orf80	56706840	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.282000	0.78630	2.793000	0.96121	0.655000	0.94253	CGT	C16orf80	-	pfam_DUF667	ENSG00000070761		0.517	C16orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf80	HGNC	protein_coding	OTTHUMT00000257388.2	260	0.00	0	C			58149339	58149339	-1	no_errors	ENST00000262498	ensembl	human	known	69_37n	missense	86	30.08	37	SNP	1.000	T
CFAP20	29105	genome.wustl.edu	37	16	58149339	58149339	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr16:58149339C>T	ENST00000262498.3	-	4	633	c.299G>A	c.(298-300)cGt>cAt	p.R100H	CTB-134F13.1_ENST00000564672.1_RNA|C16orf80_ENST00000562443.1_5'UTR	NM_013242.2	NP_037374.1														kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						AAAGCGACGACGCACATTCTT	0.517																																					Pancreas(103;1212 1612 18629 30162 52390)	dbGAP											0													124.0	109.0	114.0					16																	58149339		2198	4300	6498	-	-	-	SO:0001583	missense	0																														ENST00000262498.3:c.299G>A	16.37:g.58149339C>T	ENSP00000262498:p.Arg100His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF667	p.R100H	ENST00000262498.3	37	c.299	CCDS10793.1	16	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226419	0.79576	.	.	ENSG00000070761	ENST00000262498	T	0.50001	0.76	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.50103	0.1596	M	0.71581	2.175	0.80722	D	1	B	0.26602	0.154	B	0.24269	0.052	T	0.42464	-0.9450	10	0.34782	T	0.22	-7.144	17.4545	0.87603	0.0:1.0:0.0:0.0	.	100	Q9Y6A4	CP080_HUMAN	H	100	ENSP00000262498:R100H	ENSP00000262498:R100H	R	-	2	0	C16orf80	56706840	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.282000	0.78630	2.793000	0.96121	0.655000	0.94253	CGT	C16orf80	-	pfam_DUF667	ENSG00000070761		0.517	C16orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf80	HGNC	protein_coding	OTTHUMT00000257388.2	385	0.00	0	C			58149339	58149339	-1	no_errors	ENST00000262498	ensembl	human	known	69_37n	missense	86	30.08	37	SNP	1.000	T
CNGA1	1259	genome.wustl.edu	37	4	47939288	47939288	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr4:47939288G>T	ENST00000514170.1	-	11	1542	c.1223C>A	c.(1222-1224)gCa>gAa	p.A408E	CNGA1_ENST00000420489.2_Missense_Mutation_p.A408E|CNGA1_ENST00000402813.3_Missense_Mutation_p.A477E|CNGA1_ENST00000544810.1_Missense_Mutation_p.A408E|CNGA1_ENST00000358519.4_Missense_Mutation_p.A408E			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	408					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						TTGAAATTCTGCTCTGGCTGC	0.353																																						dbGAP											0													92.0	89.0	90.0					4																	47939288		1862	4109	5971	-	-	-	SO:0001583	missense	0			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1223C>A	4.37:g.47939288G>T	ENSP00000426862:p.Ala408Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.A477E	ENST00000514170.1	37	c.1430	CCDS43226.1	4	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845456	0.32606	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.96396	-4.0;-4.0;-4.0;-4.0;-4.0	5.31	5.31	0.75309	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.94499	0.8229	L	0.58669	1.825	0.53005	D	0.999969	B;B	0.18863	0.031;0.031	B;B	0.19391	0.025;0.025	D	0.91732	0.5397	10	0.31617	T	0.26	.	14.7009	0.69154	0.0:0.0:0.8546:0.1454	.	408;408	Q4W5E3;P29973	.;CNGA1_HUMAN	E	477;408;408;408;408	ENSP00000384264:A477E;ENSP00000426862:A408E;ENSP00000443401:A408E;ENSP00000351320:A408E;ENSP00000389881:A408E	ENSP00000351320:A408E	A	-	2	0	CNGA1	47634045	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	7.546000	0.82137	2.481000	0.83766	0.561000	0.74099	GCA	CNGA1	-	superfamily_cNMP-bd-like	ENSG00000198515		0.353	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	CNGA1	HGNC	protein_coding	OTTHUMT00000372070.2	135	0.00	0	G	NM_000087		47939288	47939288	-1	no_errors	ENST00000402813	ensembl	human	known	69_37n	missense	76	24.00	24	SNP	1.000	T
CNN2	1265	genome.wustl.edu	37	19	1037646	1037646	+	Frame_Shift_Del	DEL	C	C	-	rs371146424		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr19:1037646delC	ENST00000263097.4	+	7	1040	c.677delC	c.(676-678)accfs	p.T226fs	ABCA7_ENST00000263094.6_5'Flank|AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000562958.2_Frame_Shift_Del_p.T247fs|CNN2_ENST00000565096.2_Frame_Shift_Del_p.T215fs|CNN2_ENST00000348419.3_Frame_Shift_Del_p.T187fs|CNN2_ENST00000606983.1_3'UTR	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	226					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCCGGGACCCGGCGGCAC	0.632																																						dbGAP											0									,	229,3873		14,201,1836	77.0	90.0	86.0		,	4.3	1.0	19		87	311,7625		16,279,3673	no	frameshift,frameshift	CNN2	NM_201277.1,NM_004368.2	,	30,480,5509	A1A1,A1R,RR		3.9189,5.5826,4.4858	,	,	1037646	540,11498	2119	4148	6267	-	-	-	SO:0001589	frameshift_variant	0			D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.677delC	19.37:g.1037646delC	ENSP00000263097:p.Thr226fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8U8|A6NFI4|D6W5X9|Q92578	Frame_Shift_Del	DEL	pfam_Calponin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin,prints_Calponin	p.R227fs	ENST00000263097.4	37	c.677	CCDS12053.1	19																																																																																			CNN2	-	pfam_Calponin_repeat,pfscan_Calponin_repeat	ENSG00000064666		0.632	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN2	HGNC	protein_coding	OTTHUMT00000420293.3	11	0.00	0	C	NM_004368		1037646	1037646	+1	no_errors	ENST00000263097	ensembl	human	known	69_37n	frame_shift_del	5	37.50	3	DEL	1.000	-
CNOT3	4849	genome.wustl.edu	37	19	54655991	54655991	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr19:54655991delC	ENST00000406403.1	+	13	3237	c.1634delC	c.(1633-1635)tccfs	p.S545fs	CNOT3_ENST00000496327.1_3'UTR|CNOT3_ENST00000221232.5_Frame_Shift_Del_p.S545fs|CNOT3_ENST00000358389.3_Frame_Shift_Del_p.S364fs			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	545	Pro-rich.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TCCTTGAAGTCCATGGCGGAA	0.642																																						dbGAP											0													52.0	51.0	51.0					19																	54655991		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.1634delC	19.37:g.54655991delC	ENSP00000383954:p.Ser545fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZN7|Q9UF76	Frame_Shift_Del	DEL	pfam_Not_N,pfam_NOT,pirsf_CCR4-NOT_su3/5	p.M546fs	ENST00000406403.1	37	c.1634	CCDS12880.1	19																																																																																			CNOT3	-	pirsf_CCR4-NOT_su3/5	ENSG00000088038		0.642	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	HGNC	protein_coding	OTTHUMT00000142130.3	68	0.00	0	C	NM_014516		54655991	54655991	+1	no_errors	ENST00000221232	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	1.000	-
CNOT3	4849	genome.wustl.edu	37	19	54655991	54655991	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr19:54655991delC	ENST00000406403.1	+	13	3237	c.1634delC	c.(1633-1635)tccfs	p.S545fs	CNOT3_ENST00000496327.1_3'UTR|CNOT3_ENST00000221232.5_Frame_Shift_Del_p.S545fs|CNOT3_ENST00000358389.3_Frame_Shift_Del_p.S364fs			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	545	Pro-rich.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TCCTTGAAGTCCATGGCGGAA	0.642																																						dbGAP											0													52.0	51.0	51.0					19																	54655991		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.1634delC	19.37:g.54655991delC	ENSP00000383954:p.Ser545fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZN7|Q9UF76	Frame_Shift_Del	DEL	pfam_Not_N,pfam_NOT,pirsf_CCR4-NOT_su3/5	p.M546fs	ENST00000406403.1	37	c.1634	CCDS12880.1	19																																																																																			CNOT3	-	pirsf_CCR4-NOT_su3/5	ENSG00000088038		0.642	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	HGNC	protein_coding	OTTHUMT00000142130.3	71	0.00	0	C	NM_014516		54655991	54655991	+1	no_errors	ENST00000221232	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	1.000	-
CSMD3	114788	genome.wustl.edu	37	8	113504808	113504808	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr8:113504808C>A	ENST00000297405.5	-	31	5432	c.5188G>T	c.(5188-5190)Ggt>Tgt	p.G1730C	CSMD3_ENST00000343508.3_Missense_Mutation_p.G1690C|CSMD3_ENST00000455883.2_Missense_Mutation_p.G1626C|CSMD3_ENST00000352409.3_Missense_Mutation_p.G1730C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1730	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGAACATAACCAGCATCACAG	0.428										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													187.0	162.0	170.0					8																	113504808		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5188G>T	8.37:g.113504808C>A	ENSP00000297405:p.Gly1730Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.G1730C	ENST00000297405.5	37	c.5188	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657370	0.88154	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1	4.9	4.9	0.64082	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.93805	0.8019	H	0.99582	4.64	0.51482	D	0.999929	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;0.997;1.0	D	0.96422	0.9312	10	0.87932	D	0	.	18.6241	0.91331	0.0:1.0:0.0:0.0	.	1626;1730;1690	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1690;1730;1070;1626;1730	ENSP00000345799:G1690C;ENSP00000297405:G1730C;ENSP00000341558:G1070C;ENSP00000412263:G1626C;ENSP00000343124:G1730C	ENSP00000297405:G1730C	G	-	1	0	CSMD3	113573984	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.493000	0.81493	2.704000	0.92352	0.585000	0.79938	GGT	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.428	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	221	0.00	0	C	NM_052900		113504808	113504808	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	198	29.54	83	SNP	1.000	A
CSMD3	114788	genome.wustl.edu	37	8	113504808	113504808	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr8:113504808C>A	ENST00000297405.5	-	31	5432	c.5188G>T	c.(5188-5190)Ggt>Tgt	p.G1730C	CSMD3_ENST00000343508.3_Missense_Mutation_p.G1690C|CSMD3_ENST00000455883.2_Missense_Mutation_p.G1626C|CSMD3_ENST00000352409.3_Missense_Mutation_p.G1730C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1730	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGAACATAACCAGCATCACAG	0.428										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													187.0	162.0	170.0					8																	113504808		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5188G>T	8.37:g.113504808C>A	ENSP00000297405:p.Gly1730Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.G1730C	ENST00000297405.5	37	c.5188	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657370	0.88154	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1	4.9	4.9	0.64082	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.93805	0.8019	H	0.99582	4.64	0.51482	D	0.999929	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;0.997;1.0	D	0.96422	0.9312	10	0.87932	D	0	.	18.6241	0.91331	0.0:1.0:0.0:0.0	.	1626;1730;1690	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1690;1730;1070;1626;1730	ENSP00000345799:G1690C;ENSP00000297405:G1730C;ENSP00000341558:G1070C;ENSP00000412263:G1626C;ENSP00000343124:G1730C	ENSP00000297405:G1730C	G	-	1	0	CSMD3	113573984	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.493000	0.81493	2.704000	0.92352	0.585000	0.79938	GGT	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.428	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	399	0.00	0	C	NM_052900		113504808	113504808	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	198	29.54	83	SNP	1.000	A
DLX5	1749	genome.wustl.edu	37	7	96653899	96653899	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr7:96653899G>A	ENST00000222598.4	-	1	510	c.37C>T	c.(37-39)Cga>Tga	p.R13*	DLX5_ENST00000486603.2_Nonsense_Mutation_p.R13*|DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	13					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					TCGCCGGATCGGATGCTGGGG	0.612																																						dbGAP											0													58.0	59.0	59.0					7																	96653899		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.37C>T	7.37:g.96653899G>A	ENSP00000222598:p.Arg13*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P3|Q9UPL1	Nonsense_Mutation	SNP	pfam_Distal-less_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.R13*	ENST00000222598.4	37	c.37	CCDS5647.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.781733	0.98952	.	.	ENSG00000105880	ENST00000222598	.	.	.	5.14	5.14	0.70334	.	0.056437	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-2.9753	12.9929	0.58630	0.0:0.0:0.7408:0.2592	.	.	.	.	X	13	.	ENSP00000222598:R13X	R	-	1	2	DLX5	96491835	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.887000	0.48586	2.666000	0.90696	0.561000	0.74099	CGA	DLX5	-	NULL	ENSG00000105880		0.612	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX5	HGNC	protein_coding	OTTHUMT00000334371.2	60	0.00	0	G			96653899	96653899	-1	no_errors	ENST00000222598	ensembl	human	known	69_37n	nonsense	23	14.81	4	SNP	1.000	A
DLX5	1749	genome.wustl.edu	37	7	96653899	96653899	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr7:96653899G>A	ENST00000222598.4	-	1	510	c.37C>T	c.(37-39)Cga>Tga	p.R13*	DLX5_ENST00000486603.2_Nonsense_Mutation_p.R13*|DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	13					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					TCGCCGGATCGGATGCTGGGG	0.612																																						dbGAP											0													58.0	59.0	59.0					7																	96653899		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.37C>T	7.37:g.96653899G>A	ENSP00000222598:p.Arg13*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P3|Q9UPL1	Nonsense_Mutation	SNP	pfam_Distal-less_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.R13*	ENST00000222598.4	37	c.37	CCDS5647.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.781733	0.98952	.	.	ENSG00000105880	ENST00000222598	.	.	.	5.14	5.14	0.70334	.	0.056437	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-2.9753	12.9929	0.58630	0.0:0.0:0.7408:0.2592	.	.	.	.	X	13	.	ENSP00000222598:R13X	R	-	1	2	DLX5	96491835	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.887000	0.48586	2.666000	0.90696	0.561000	0.74099	CGA	DLX5	-	NULL	ENSG00000105880		0.612	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX5	HGNC	protein_coding	OTTHUMT00000334371.2	52	0.00	0	G			96653899	96653899	-1	no_errors	ENST00000222598	ensembl	human	known	69_37n	nonsense	23	14.81	4	SNP	1.000	A
ENDOV	284131	genome.wustl.edu	37	17	78403668	78403668	+	Intron	SNP	C	C	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr17:78403668C>G	ENST00000518137.1	+	9	866				ENDOV_ENST00000323854.5_Missense_Mutation_p.P247R|ENDOV_ENST00000518901.1_Intron|ENDOV_ENST00000517295.2_Intron|ENDOV_ENST00000517795.1_Intron|ENDOV_ENST00000520284.1_Intron|ENDOV_ENST00000522751.1_Missense_Mutation_p.P98R|ENDOV_ENST00000520367.1_Intron|ENDOV_ENST00000518907.1_Intron	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V						DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						AGCCCAGGCCCCAGGACAGCC	0.682								Direct reversal of damage																														dbGAP											0													25.0	34.0	31.0					17																	78403668		1970	4156	6126	-	-	-	SO:0001627	intron_variant	0				CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.838+37C>G	17.37:g.78403668C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Missense_Mutation	SNP	pfam_Endonuclease-V	p.P247R	ENST00000518137.1	37	c.740	CCDS54172.1	17	.	.	.	.	.	.	.	.	.	.	C	9.760	1.169705	0.21621	.	.	ENSG00000173818	ENST00000323854	T	0.20598	2.06	3.34	1.35	0.21983	.	.	.	.	.	T	0.13500	0.0327	.	.	.	0.09310	N	1	P	0.43701	0.815	B	0.39258	0.295	T	0.14615	-1.0466	7	.	.	.	.	5.3772	0.16172	0.0:0.7387:0.0:0.2613	.	247	Q8N8Q3-3	.	R	247	ENSP00000317810:P247R	.	P	+	2	0	ENDOV	76018263	0.024000	0.19004	0.000000	0.03702	0.024000	0.10985	1.577000	0.36515	0.436000	0.26393	0.655000	0.94253	CCC	ENDOV	-	NULL	ENSG00000173818		0.682	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENDOV	HGNC	protein_coding	OTTHUMT00000379487.1	36	0.00	0	C	NM_173627		78403668	78403668	+1	no_errors	ENST00000323854	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.000	G
ENDOV	284131	genome.wustl.edu	37	17	78403668	78403668	+	Intron	SNP	C	C	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr17:78403668C>G	ENST00000518137.1	+	9	866				ENDOV_ENST00000323854.5_Missense_Mutation_p.P247R|ENDOV_ENST00000518901.1_Intron|ENDOV_ENST00000517295.2_Intron|ENDOV_ENST00000517795.1_Intron|ENDOV_ENST00000520284.1_Intron|ENDOV_ENST00000522751.1_Missense_Mutation_p.P98R|ENDOV_ENST00000520367.1_Intron|ENDOV_ENST00000518907.1_Intron	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V						DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						AGCCCAGGCCCCAGGACAGCC	0.682								Direct reversal of damage																														dbGAP											0													25.0	34.0	31.0					17																	78403668		1970	4156	6126	-	-	-	SO:0001627	intron_variant	0				CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.838+37C>G	17.37:g.78403668C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Missense_Mutation	SNP	pfam_Endonuclease-V	p.P247R	ENST00000518137.1	37	c.740	CCDS54172.1	17	.	.	.	.	.	.	.	.	.	.	C	9.760	1.169705	0.21621	.	.	ENSG00000173818	ENST00000323854	T	0.20598	2.06	3.34	1.35	0.21983	.	.	.	.	.	T	0.13500	0.0327	.	.	.	0.09310	N	1	P	0.43701	0.815	B	0.39258	0.295	T	0.14615	-1.0466	7	.	.	.	.	5.3772	0.16172	0.0:0.7387:0.0:0.2613	.	247	Q8N8Q3-3	.	R	247	ENSP00000317810:P247R	.	P	+	2	0	ENDOV	76018263	0.024000	0.19004	0.000000	0.03702	0.024000	0.10985	1.577000	0.36515	0.436000	0.26393	0.655000	0.94253	CCC	ENDOV	-	NULL	ENSG00000173818		0.682	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENDOV	HGNC	protein_coding	OTTHUMT00000379487.1	39	0.00	0	C	NM_173627		78403668	78403668	+1	no_errors	ENST00000323854	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.000	G
ENPP3	5169	genome.wustl.edu	37	6	132041440	132041440	+	Silent	SNP	T	T	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr6:132041440T>C	ENST00000414305.1	+	18	1816	c.1488T>C	c.(1486-1488)ttT>ttC	p.F496F	ENPP3_ENST00000357639.3_Silent_p.F496F|ENPP3_ENST00000358229.5_Silent_p.F496F			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	496	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AGGCTATCTTTCTGGCACATG	0.299																																						dbGAP											0													110.0	121.0	117.0					6																	132041440		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1488T>C	6.37:g.132041440T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTL3	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.F496	ENST00000414305.1	37	c.1488	CCDS5148.1	6																																																																																			ENPP3	-	superfamily_Alkaline_phosphatase_core	ENSG00000154269		0.299	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	134	0.00	0	T			132041440	132041440	+1	no_errors	ENST00000357639	ensembl	human	known	69_37n	silent	267	25.21	90	SNP	0.295	C
ENPP3	5169	genome.wustl.edu	37	6	132041440	132041440	+	Silent	SNP	T	T	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr6:132041440T>C	ENST00000414305.1	+	18	1816	c.1488T>C	c.(1486-1488)ttT>ttC	p.F496F	ENPP3_ENST00000357639.3_Silent_p.F496F|ENPP3_ENST00000358229.5_Silent_p.F496F			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	496	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AGGCTATCTTTCTGGCACATG	0.299																																						dbGAP											0													110.0	121.0	117.0					6																	132041440		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1488T>C	6.37:g.132041440T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTL3	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.F496	ENST00000414305.1	37	c.1488	CCDS5148.1	6																																																																																			ENPP3	-	superfamily_Alkaline_phosphatase_core	ENSG00000154269		0.299	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	270	0.00	0	T			132041440	132041440	+1	no_errors	ENST00000357639	ensembl	human	known	69_37n	silent	267	25.21	90	SNP	0.295	C
SPATA31D5P	347127	genome.wustl.edu	37	9	84530613	84530613	+	RNA	SNP	C	C	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr9:84530613C>G	ENST00000527857.1	+	0	635					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		TCTCCCCTGACCTGATCACCA	0.537																																						dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84530613C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.537	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	516	0.00	0	C	NR_026851		84530613	84530613	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	376	20.68	98	SNP	0.001	G
SPATA31D5P	347127	genome.wustl.edu	37	9	84530613	84530613	+	RNA	SNP	C	C	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr9:84530613C>G	ENST00000527857.1	+	0	635					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		TCTCCCCTGACCTGATCACCA	0.537																																						dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84530613C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.537	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	642	0.00	0	C	NR_026851		84530613	84530613	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	376	20.68	98	SNP	0.001	G
FBL	2091	genome.wustl.edu	37	19	40331123	40331123	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr19:40331123G>C	ENST00000221801.3	-	3	327	c.214C>G	c.(214-216)Cgt>Ggt	p.R72G	FBL_ENST00000593503.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	72	DMA/Gly-rich.				histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		CCCCGACCACGACCCCGGTTG	0.592																																						dbGAP											0													214.0	190.0	198.0					19																	40331123		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.214C>G	19.37:g.40331123G>C	ENSP00000221801:p.Arg72Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUE8|O75259|Q6IAT5|Q9UPI6	Missense_Mutation	SNP	pfam_Fibrillarin,pirsf_Fibrillarin,prints_Fibrillarin	p.R72G	ENST00000221801.3	37	c.214	CCDS12545.1	19	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659802	0.47572	.	.	ENSG00000105202	ENST00000221801	.	.	.	4.79	4.79	0.61399	.	1.661510	0.04228	N	0.334703	T	0.41166	0.1147	N	0.03608	-0.345	0.50632	D	0.999889	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.00824	-1.1551	9	0.26408	T	0.33	-2.3638	15.3294	0.74196	0.0:0.0:1.0:0.0	.	72;11;72	B4DLD4;Q96BS4;P22087	.;.;FBRL_HUMAN	G	72	.	ENSP00000221801:R72G	R	-	1	0	FBL	45022963	0.989000	0.36119	1.000000	0.80357	0.975000	0.68041	2.210000	0.42816	2.190000	0.69967	0.511000	0.50034	CGT	FBL	-	pirsf_Fibrillarin	ENSG00000105202		0.592	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBL	HGNC	protein_coding	OTTHUMT00000462509.4	297	0.33	1	G	NM_001436		40331123	40331123	-1	no_errors	ENST00000221801	ensembl	human	known	69_37n	missense	129	14.00	21	SNP	1.000	C
FBL	2091	genome.wustl.edu	37	19	40331123	40331123	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr19:40331123G>C	ENST00000221801.3	-	3	327	c.214C>G	c.(214-216)Cgt>Ggt	p.R72G	FBL_ENST00000593503.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	72	DMA/Gly-rich.				histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		CCCCGACCACGACCCCGGTTG	0.592																																						dbGAP											0													214.0	190.0	198.0					19																	40331123		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.214C>G	19.37:g.40331123G>C	ENSP00000221801:p.Arg72Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUE8|O75259|Q6IAT5|Q9UPI6	Missense_Mutation	SNP	pfam_Fibrillarin,pirsf_Fibrillarin,prints_Fibrillarin	p.R72G	ENST00000221801.3	37	c.214	CCDS12545.1	19	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659802	0.47572	.	.	ENSG00000105202	ENST00000221801	.	.	.	4.79	4.79	0.61399	.	1.661510	0.04228	N	0.334703	T	0.41166	0.1147	N	0.03608	-0.345	0.50632	D	0.999889	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.00824	-1.1551	9	0.26408	T	0.33	-2.3638	15.3294	0.74196	0.0:0.0:1.0:0.0	.	72;11;72	B4DLD4;Q96BS4;P22087	.;.;FBRL_HUMAN	G	72	.	ENSP00000221801:R72G	R	-	1	0	FBL	45022963	0.989000	0.36119	1.000000	0.80357	0.975000	0.68041	2.210000	0.42816	2.190000	0.69967	0.511000	0.50034	CGT	FBL	-	pirsf_Fibrillarin	ENSG00000105202		0.592	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBL	HGNC	protein_coding	OTTHUMT00000462509.4	336	0.30	1	G	NM_001436		40331123	40331123	-1	no_errors	ENST00000221801	ensembl	human	known	69_37n	missense	129	14.00	21	SNP	1.000	C
FBXO44	93611	genome.wustl.edu	37	1	11718332	11718332	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr1:11718332G>T	ENST00000251547.5	+	3	356	c.274G>T	c.(274-276)Gag>Tag	p.E92*	FBXO44_ENST00000376760.1_Nonsense_Mutation_p.E92*|FBXO44_ENST00000376770.1_Nonsense_Mutation_p.E92*|FBXO44_ENST00000376768.1_Nonsense_Mutation_p.E92*|FBXO44_ENST00000376762.4_Nonsense_Mutation_p.E92*|FBXO44_ENST00000251546.4_Nonsense_Mutation_p.E92*	NM_033182.5	NP_149438.2	Q9H4M3	FBX44_HUMAN	F-box protein 44	92	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		AGAGGGGTTCGAGTTCTGGAG	0.552																																						dbGAP											0													108.0	113.0	112.0					1																	11718332		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY040878	CCDS131.1, CCDS132.1	1p36.21	2008-03-26			ENSG00000132879	ENSG00000132879		"""F-boxes /  ""other"""""	24847	protein-coding gene	gene with protein product		609111				12383498	Standard	XM_005263535		Approved	FBX30, FBG3, MGC14140, Fbxo6a, Fbx44	uc001asm.3	Q9H4M3	OTTHUMG00000002071	ENST00000251547.5:c.274G>T	1.37:g.11718332G>T	ENSP00000251547:p.Glu92*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNZ2|B7Z743|Q5TGX2|Q5TGX4|Q5TGX5|Q68DJ9|Q8WWY2	Nonsense_Mutation	SNP	pfam_F-box-assoc_dom,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,superfamily_Galactose-bd-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like,pfscan_F-box-assoc_dom	p.E92*	ENST00000251547.5	37	c.274	CCDS132.1	1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961233	0.92791	.	.	ENSG00000132879	ENST00000251546;ENST00000425796;ENST00000376770;ENST00000376768;ENST00000251547;ENST00000376762;ENST00000376760	.	.	.	5.02	3.15	0.36227	.	0.425641	0.27442	N	0.019355	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-21.1042	6.1782	0.20455	0.1652:0.3155:0.5194:0.0	.	.	.	.	X	92	.	ENSP00000251546:E92X	E	+	1	0	FBXO44	11640919	0.910000	0.30920	0.870000	0.34147	0.931000	0.56810	0.402000	0.20965	0.535000	0.28714	-0.465000	0.05216	GAG	FBXO44	-	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	ENSG00000132879		0.552	FBXO44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO44	HGNC	protein_coding	OTTHUMT00000005761.1	232	0.00	0	G	NM_183412		11718332	11718332	+1	no_errors	ENST00000376768	ensembl	human	known	69_37n	nonsense	117	30.36	51	SNP	0.867	T
FBXO44	93611	genome.wustl.edu	37	1	11718332	11718332	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr1:11718332G>T	ENST00000251547.5	+	3	356	c.274G>T	c.(274-276)Gag>Tag	p.E92*	FBXO44_ENST00000376760.1_Nonsense_Mutation_p.E92*|FBXO44_ENST00000376770.1_Nonsense_Mutation_p.E92*|FBXO44_ENST00000376768.1_Nonsense_Mutation_p.E92*|FBXO44_ENST00000376762.4_Nonsense_Mutation_p.E92*|FBXO44_ENST00000251546.4_Nonsense_Mutation_p.E92*	NM_033182.5	NP_149438.2	Q9H4M3	FBX44_HUMAN	F-box protein 44	92	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		AGAGGGGTTCGAGTTCTGGAG	0.552																																						dbGAP											0													108.0	113.0	112.0					1																	11718332		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY040878	CCDS131.1, CCDS132.1	1p36.21	2008-03-26			ENSG00000132879	ENSG00000132879		"""F-boxes /  ""other"""""	24847	protein-coding gene	gene with protein product		609111				12383498	Standard	XM_005263535		Approved	FBX30, FBG3, MGC14140, Fbxo6a, Fbx44	uc001asm.3	Q9H4M3	OTTHUMG00000002071	ENST00000251547.5:c.274G>T	1.37:g.11718332G>T	ENSP00000251547:p.Glu92*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNZ2|B7Z743|Q5TGX2|Q5TGX4|Q5TGX5|Q68DJ9|Q8WWY2	Nonsense_Mutation	SNP	pfam_F-box-assoc_dom,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,superfamily_Galactose-bd-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like,pfscan_F-box-assoc_dom	p.E92*	ENST00000251547.5	37	c.274	CCDS132.1	1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961233	0.92791	.	.	ENSG00000132879	ENST00000251546;ENST00000425796;ENST00000376770;ENST00000376768;ENST00000251547;ENST00000376762;ENST00000376760	.	.	.	5.02	3.15	0.36227	.	0.425641	0.27442	N	0.019355	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-21.1042	6.1782	0.20455	0.1652:0.3155:0.5194:0.0	.	.	.	.	X	92	.	ENSP00000251546:E92X	E	+	1	0	FBXO44	11640919	0.910000	0.30920	0.870000	0.34147	0.931000	0.56810	0.402000	0.20965	0.535000	0.28714	-0.465000	0.05216	GAG	FBXO44	-	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	ENSG00000132879		0.552	FBXO44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO44	HGNC	protein_coding	OTTHUMT00000005761.1	305	0.00	0	G	NM_183412		11718332	11718332	+1	no_errors	ENST00000376768	ensembl	human	known	69_37n	nonsense	117	30.36	51	SNP	0.867	T
FCAR	2204	genome.wustl.edu	37	19	55399555	55399555	+	Silent	SNP	T	T	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr19:55399555T>C	ENST00000355524.3	+	4	553	c.543T>C	c.(541-543)ggT>ggC	p.G181G	FCAR_ENST00000359272.4_Silent_p.G169G|FCAR_ENST00000391726.3_Intron|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391724.3_Silent_p.G169G|FCAR_ENST00000391725.3_Silent_p.G181G|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000391723.3_Silent_p.G169G|FCAR_ENST00000353758.4_Silent_p.G72G|FCAR_ENST00000345937.4_Intron|FCAR_ENST00000469767.1_Silent_p.G181G	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	181	Ig-like C2-type 2.				immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		TCTCTTTGGGTCCTGTGGACC	0.537																																						dbGAP											0													72.0	63.0	66.0					19																	55399555		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.543T>C	19.37:g.55399555T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Silent	SNP	smart_Ig_sub	p.G181	ENST00000355524.3	37	c.543	CCDS12907.1	19																																																																																			FCAR	-	smart_Ig_sub	ENSG00000186431		0.537	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCAR	HGNC	protein_coding	OTTHUMT00000141243.1	110	0.89	1	T	NM_002000		55399555	55399555	+1	no_errors	ENST00000355524	ensembl	human	known	69_37n	silent	63	12.50	9	SNP	0.191	C
FCAR	2204	genome.wustl.edu	37	19	55399555	55399555	+	Silent	SNP	T	T	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr19:55399555T>C	ENST00000355524.3	+	4	553	c.543T>C	c.(541-543)ggT>ggC	p.G181G	FCAR_ENST00000359272.4_Silent_p.G169G|FCAR_ENST00000391726.3_Intron|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391724.3_Silent_p.G169G|FCAR_ENST00000391725.3_Silent_p.G181G|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000391723.3_Silent_p.G169G|FCAR_ENST00000353758.4_Silent_p.G72G|FCAR_ENST00000345937.4_Intron|FCAR_ENST00000469767.1_Silent_p.G181G	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	181	Ig-like C2-type 2.				immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		TCTCTTTGGGTCCTGTGGACC	0.537																																						dbGAP											0													72.0	63.0	66.0					19																	55399555		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.543T>C	19.37:g.55399555T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Silent	SNP	smart_Ig_sub	p.G181	ENST00000355524.3	37	c.543	CCDS12907.1	19																																																																																			FCAR	-	smart_Ig_sub	ENSG00000186431		0.537	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCAR	HGNC	protein_coding	OTTHUMT00000141243.1	171	0.00	0	T	NM_002000		55399555	55399555	+1	no_errors	ENST00000355524	ensembl	human	known	69_37n	silent	63	12.50	9	SNP	0.191	C
FLVCR1	28982	genome.wustl.edu	37	1	213058714	213058715	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr1:213058714_213058715GG>AT	ENST00000366971.4	+	5	1370_1371	c.1172_1173GG>AT	c.(1171-1173)tGG>tAT	p.W391Y	FLVCR1_ENST00000483790.1_3'UTR	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	391					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		TGTGGCTTATGGCTGGATTATA	0.351																																					Esophageal Squamous(199;2235 2952 19233 26256)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	Exception_encountered	1.37:g.213058714_213058715delinsAT	ENSP00000355938:p.Trp391Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1HE16|Q86XY9|Q9NVR9	Nonsense_Mutation|Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.W391*|p.W391C	ENST00000366971.4	37	c.1172|c.1173	CCDS1510.1	1																																																																																			FLVCR1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000162769		0.351	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR1	HGNC	protein_coding	OTTHUMT00000089678.2	384|381	0.26	1	G	NM_014053		213058714|213058715	213058714|213058715	+1	no_errors	ENST00000366971	ensembl	human	known	69_37n	nonsense|missense	351|345	22.00|22.12	99|98	SNP	1.000	A|T
FLVCR1	28982	genome.wustl.edu	37	1	213058714	213058715	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr1:213058714_213058715GG>AT	ENST00000366971.4	+	5	1370_1371	c.1172_1173GG>AT	c.(1171-1173)tGG>tAT	p.W391Y	FLVCR1_ENST00000483790.1_3'UTR	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	391					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		TGTGGCTTATGGCTGGATTATA	0.351																																					Esophageal Squamous(199;2235 2952 19233 26256)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	Exception_encountered	1.37:g.213058714_213058715delinsAT	ENSP00000355938:p.Trp391Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1HE16|Q86XY9|Q9NVR9	Nonsense_Mutation|Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.W391*|p.W391C	ENST00000366971.4	37	c.1172|c.1173	CCDS1510.1	1																																																																																			FLVCR1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000162769		0.351	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR1	HGNC	protein_coding	OTTHUMT00000089678.2	573|566	0.00	0	G	NM_014053		213058714|213058715	213058714|213058715	+1	no_errors	ENST00000366971	ensembl	human	known	69_37n	nonsense|missense	351|345	22.00|22.12	99|98	SNP	1.000	A|T
FYB	2533	genome.wustl.edu	37	5	39202164	39202164	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr5:39202164T>C	ENST00000351578.6	-	2	1089	c.899A>G	c.(898-900)aAt>aGt	p.N300S	FYB_ENST00000515010.1_Missense_Mutation_p.N300S|FYB_ENST00000540520.1_Missense_Mutation_p.N310S|FYB_ENST00000505428.1_Missense_Mutation_p.N300S|FYB_ENST00000512982.1_Missense_Mutation_p.N300S	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	300					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTCTTCCTGATTTATTTTGCT	0.522																																						dbGAP											0													101.0	101.0	101.0					5																	39202164		1839	4091	5930	-	-	-	SO:0001583	missense	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.899A>G	5.37:g.39202164T>C	ENSP00000316460:p.Asn300Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.N310S	ENST00000351578.6	37	c.929	CCDS47200.1	5	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.971222	0.00457	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.23754	1.9;1.9;1.91;1.91;1.89	6.17	-4.23	0.03789	.	0.413669	0.22740	N	0.056215	T	0.13457	0.0326	M	0.63428	1.95	0.09310	N	1	B;B	0.15473	0.01;0.013	B;B	0.10450	0.003;0.005	T	0.45673	-0.9245	10	0.05436	T	0.98	-8.6223	0.4196	0.00454	0.2638:0.1636:0.2713:0.3014	.	310;300	B4DLN2;O15117	.;FYB_HUMAN	S	300;300;300;300;310;300	ENSP00000316460:N300S;ENSP00000426346:N300S;ENSP00000425845:N300S;ENSP00000427114:N300S;ENSP00000442840:N310S	ENSP00000316460:N300S	N	-	2	0	FYB	39237921	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.337000	0.07852	-0.680000	0.05211	-0.333000	0.08304	AAT	FYB	-	NULL	ENSG00000082074		0.522	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	243	0.41	1	T	NM_001465		39202164	39202164	-1	no_errors	ENST00000540520	ensembl	human	known	69_37n	missense	267	22.16	76	SNP	0.000	C
FYB	2533	genome.wustl.edu	37	5	39202164	39202164	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr5:39202164T>C	ENST00000351578.6	-	2	1089	c.899A>G	c.(898-900)aAt>aGt	p.N300S	FYB_ENST00000515010.1_Missense_Mutation_p.N300S|FYB_ENST00000540520.1_Missense_Mutation_p.N310S|FYB_ENST00000505428.1_Missense_Mutation_p.N300S|FYB_ENST00000512982.1_Missense_Mutation_p.N300S	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	300					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTCTTCCTGATTTATTTTGCT	0.522																																						dbGAP											0													101.0	101.0	101.0					5																	39202164		1839	4091	5930	-	-	-	SO:0001583	missense	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.899A>G	5.37:g.39202164T>C	ENSP00000316460:p.Asn300Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.N310S	ENST00000351578.6	37	c.929	CCDS47200.1	5	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.971222	0.00457	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.23754	1.9;1.9;1.91;1.91;1.89	6.17	-4.23	0.03789	.	0.413669	0.22740	N	0.056215	T	0.13457	0.0326	M	0.63428	1.95	0.09310	N	1	B;B	0.15473	0.01;0.013	B;B	0.10450	0.003;0.005	T	0.45673	-0.9245	10	0.05436	T	0.98	-8.6223	0.4196	0.00454	0.2638:0.1636:0.2713:0.3014	.	310;300	B4DLN2;O15117	.;FYB_HUMAN	S	300;300;300;300;310;300	ENSP00000316460:N300S;ENSP00000426346:N300S;ENSP00000425845:N300S;ENSP00000427114:N300S;ENSP00000442840:N310S	ENSP00000316460:N300S	N	-	2	0	FYB	39237921	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.337000	0.07852	-0.680000	0.05211	-0.333000	0.08304	AAT	FYB	-	NULL	ENSG00000082074		0.522	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	422	0.00	0	T	NM_001465		39202164	39202164	-1	no_errors	ENST00000540520	ensembl	human	known	69_37n	missense	267	22.16	76	SNP	0.000	C
GOLGA6L6	727832	genome.wustl.edu	37	15	20740459	20740461	+	In_Frame_Del	DEL	TCG	TCG	-			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	TCG	TCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr15:20740459_20740461delTCG	ENST00000427390.2	-	8	1379_1381	c.1289_1291delCGA	c.(1288-1293)gcgaag>gag	p.430_431AK>E		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	430	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctccacatcttcgcctcctgctc	0.552																																						dbGAP											0										16,452		5,6,223							0.0			1	60,546		25,10,268	no	coding	GOLGA6L6	NM_001145004.1		30,16,491	A1A1,A1R,RR		9.901,3.4188,7.0764				76,998				-	-	-	SO:0001651	inframe_deletion	0			AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1289_1291delCGA	15.37:g.20740459_20740461delTCG	ENSP00000398615:p.Ala430_Lys431delinsGlu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3YTC0	In_Frame_Del	DEL	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.AK430in_frame_delE	ENST00000427390.2	37	c.1291_1289	CCDS45184.1	15																																																																																			GOLGA6L6	-	NULL	ENSG00000215405		0.552	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	HGNC	protein_coding	OTTHUMT00000414660.3	37	0.00	0	TCG	NM_001145004		20740459	20740461	-1	no_errors	ENST00000427390	ensembl	human	known	69_37n	in_frame_del	18	35.71	10	DEL	0.966:0.963:0.960	-
GOLGB1	2804	genome.wustl.edu	37	3	121409630	121409630	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr3:121409630G>A	ENST00000340645.5	-	14	8691	c.8566C>T	c.(8566-8568)Cga>Tga	p.R2856*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.R2861*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2856					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCTGACTTTCGAAATTTCTCC	0.453																																						dbGAP											0													63.0	61.0	61.0					3																	121409630		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8566C>T	3.37:g.121409630G>A	ENSP00000341848:p.Arg2856*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.R2856*	ENST00000340645.5	37	c.8566	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	49	15.222149	0.99826	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	.	.	.	5.3	3.48	0.39840	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2571	0.20879	0.085:0.0:0.5882:0.3269	.	.	.	.	X	2856;2861	.	ENSP00000341848:R2856X	R	-	1	2	GOLGB1	122892320	0.997000	0.39634	0.993000	0.49108	0.981000	0.71138	4.138000	0.58017	0.776000	0.33473	0.655000	0.94253	CGA	GOLGB1	-	superfamily_STAT_TF_coiled-coil	ENSG00000173230		0.453	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	123	0.00	0	G	NM_004487		121409630	121409630	-1	no_errors	ENST00000340645	ensembl	human	known	69_37n	nonsense	109	17.42	23	SNP	0.994	A
GOLGB1	2804	genome.wustl.edu	37	3	121409630	121409630	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr3:121409630G>A	ENST00000340645.5	-	14	8691	c.8566C>T	c.(8566-8568)Cga>Tga	p.R2856*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.R2861*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2856					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCTGACTTTCGAAATTTCTCC	0.453																																						dbGAP											0													63.0	61.0	61.0					3																	121409630		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8566C>T	3.37:g.121409630G>A	ENSP00000341848:p.Arg2856*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.R2856*	ENST00000340645.5	37	c.8566	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	49	15.222149	0.99826	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	.	.	.	5.3	3.48	0.39840	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2571	0.20879	0.085:0.0:0.5882:0.3269	.	.	.	.	X	2856;2861	.	ENSP00000341848:R2856X	R	-	1	2	GOLGB1	122892320	0.997000	0.39634	0.993000	0.49108	0.981000	0.71138	4.138000	0.58017	0.776000	0.33473	0.655000	0.94253	CGA	GOLGB1	-	superfamily_STAT_TF_coiled-coil	ENSG00000173230		0.453	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	207	0.00	0	G	NM_004487		121409630	121409630	-1	no_errors	ENST00000340645	ensembl	human	known	69_37n	nonsense	109	17.42	23	SNP	0.994	A
HLF	3131	genome.wustl.edu	37	17	53398125	53398125	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr17:53398125C>T	ENST00000226067.5	+	4	1246	c.773C>T	c.(772-774)tCg>tTg	p.S258L	HLF_ENST00000430986.2_Missense_Mutation_p.S173L|HLF_ENST00000573945.1_Missense_Mutation_p.S173L|HLF_ENST00000575345.1_Missense_Mutation_p.S173L|HLF_ENST00000575307.1_3'UTR	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	258	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S258W(1)		large_intestine(1)|ovary(2)	3						ATCCGGGCCTCGTTCCTGGAG	0.592			T	TCF3	ALL																																	dbGAP		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	1	Substitution - Missense(1)	lung(1)											28.0	32.0	31.0					17																	53398125		2201	4295	6496	-	-	-	SO:0001583	missense	0				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.773C>T	17.37:g.53398125C>T	ENSP00000226067:p.Ser258Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X8|Q6FHS9	Missense_Mutation	SNP	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.S258L	ENST00000226067.5	37	c.773	CCDS11585.1	17	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410546	0.42715	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	T;T	0.38887	1.11;1.11	5.77	4.8	0.61643	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.149402	0.47852	D	0.000216	T	0.43277	0.1240	N	0.16098	0.37	0.50813	D	0.999892	D;D	0.61697	0.99;0.958	P;B	0.60415	0.874;0.37	T	0.46400	-0.9194	10	0.51188	T	0.08	.	13.9362	0.64026	0.0:0.9273:0.0:0.0727	.	206;258	B4DIQ5;Q16534	.;HLF_HUMAN	L	258;173	ENSP00000226067:S258L;ENSP00000402496:S173L	ENSP00000226067:S258L	S	+	2	0	HLF	50753124	0.730000	0.28100	0.996000	0.52242	0.634000	0.38068	2.417000	0.44653	1.449000	0.47699	-0.140000	0.14226	TCG	HLF	-	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	ENSG00000108924		0.592	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLF	HGNC	protein_coding	OTTHUMT00000439185.1	45	0.00	0	C	NM_002126		53398125	53398125	+1	no_errors	ENST00000226067	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	0.999	T
HLF	3131	genome.wustl.edu	37	17	53398125	53398125	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr17:53398125C>T	ENST00000226067.5	+	4	1246	c.773C>T	c.(772-774)tCg>tTg	p.S258L	HLF_ENST00000430986.2_Missense_Mutation_p.S173L|HLF_ENST00000573945.1_Missense_Mutation_p.S173L|HLF_ENST00000575345.1_Missense_Mutation_p.S173L|HLF_ENST00000575307.1_3'UTR	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	258	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S258W(1)		large_intestine(1)|ovary(2)	3						ATCCGGGCCTCGTTCCTGGAG	0.592			T	TCF3	ALL																																	dbGAP		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	1	Substitution - Missense(1)	lung(1)											28.0	32.0	31.0					17																	53398125		2201	4295	6496	-	-	-	SO:0001583	missense	0				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.773C>T	17.37:g.53398125C>T	ENSP00000226067:p.Ser258Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X8|Q6FHS9	Missense_Mutation	SNP	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.S258L	ENST00000226067.5	37	c.773	CCDS11585.1	17	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410546	0.42715	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	T;T	0.38887	1.11;1.11	5.77	4.8	0.61643	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.149402	0.47852	D	0.000216	T	0.43277	0.1240	N	0.16098	0.37	0.50813	D	0.999892	D;D	0.61697	0.99;0.958	P;B	0.60415	0.874;0.37	T	0.46400	-0.9194	10	0.51188	T	0.08	.	13.9362	0.64026	0.0:0.9273:0.0:0.0727	.	206;258	B4DIQ5;Q16534	.;HLF_HUMAN	L	258;173	ENSP00000226067:S258L;ENSP00000402496:S173L	ENSP00000226067:S258L	S	+	2	0	HLF	50753124	0.730000	0.28100	0.996000	0.52242	0.634000	0.38068	2.417000	0.44653	1.449000	0.47699	-0.140000	0.14226	TCG	HLF	-	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	ENSG00000108924		0.592	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLF	HGNC	protein_coding	OTTHUMT00000439185.1	79	0.00	0	C	NM_002126		53398125	53398125	+1	no_errors	ENST00000226067	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	0.999	T
HMHA1	23526	genome.wustl.edu	37	19	1084238	1084238	+	Splice_Site	DEL	A	A	-			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr19:1084238delA	ENST00000313093.2	+	22	3188	c.2957delA	c.(2956-2958)gac>gc	p.D986fs	HMHA1_ENST00000586866.1_Splice_Site_p.D990fs|HMHA1_ENST00000590577.1_Splice_Site_p.D621fs|HMHA1_ENST00000591169.1_3'UTR|HMHA1_ENST00000536472.1_Splice_Site_p.D854fs|HMHA1_ENST00000543365.1_Splice_Site_p.D869fs|HMHA1_ENST00000590214.1_Splice_Site_p.D1013fs|HMHA1_ENST00000539243.2_Splice_Site_p.D1002fs	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	986					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACTTGCAGGACGAGTCATCC	0.607																																						dbGAP											0													57.0	56.0	56.0					19																	1084238		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2956-1A>-	19.37:g.1084238delA		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.D986fs	ENST00000313093.2	37	c.2957	CCDS32863.1	19																																																																																			HMHA1	-	NULL	ENSG00000180448		0.607	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	28	0.00	0	A		Frame_Shift_Del	1084238	1084238	+1	no_errors	ENST00000313093	ensembl	human	known	69_37n	frame_shift_del	3	40.00	2	DEL	0.113	-
HMHA1	23526	genome.wustl.edu	37	19	1084238	1084238	+	Splice_Site	DEL	A	A	-			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr19:1084238delA	ENST00000313093.2	+	22	3188	c.2957delA	c.(2956-2958)gac>gc	p.D986fs	HMHA1_ENST00000586866.1_Splice_Site_p.D990fs|HMHA1_ENST00000590577.1_Splice_Site_p.D621fs|HMHA1_ENST00000591169.1_3'UTR|HMHA1_ENST00000536472.1_Splice_Site_p.D854fs|HMHA1_ENST00000543365.1_Splice_Site_p.D869fs|HMHA1_ENST00000590214.1_Splice_Site_p.D1013fs|HMHA1_ENST00000539243.2_Splice_Site_p.D1002fs	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	986					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACTTGCAGGACGAGTCATCC	0.607																																						dbGAP											0													57.0	56.0	56.0					19																	1084238		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2956-1A>-	19.37:g.1084238delA		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.D986fs	ENST00000313093.2	37	c.2957	CCDS32863.1	19																																																																																			HMHA1	-	NULL	ENSG00000180448		0.607	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	38	0.00	0	A		Frame_Shift_Del	1084238	1084238	+1	no_errors	ENST00000313093	ensembl	human	known	69_37n	frame_shift_del	3	40.00	2	DEL	0.113	-
HYDIN	54768	genome.wustl.edu	37	16	70900083	70900083	+	Silent	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr16:70900083G>T	ENST00000393567.2	-	67	11610	c.11460C>A	c.(11458-11460)acC>acA	p.T3820T	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3820					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CAAACACTCGGGTCTGGTAAA	0.423																																						dbGAP											0													56.0	55.0	55.0					16																	70900083		1853	4097	5950	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11460C>A	16.37:g.70900083G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	NULL	p.P40T	ENST00000393567.2	37	c.118	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.423	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	168	0.59	1	G			70900083	70900083	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000378856	ensembl	human	known	69_37n	missense	118	25.62	41	SNP	0.989	T
HYDIN	54768	genome.wustl.edu	37	16	70900083	70900083	+	Silent	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr16:70900083G>T	ENST00000393567.2	-	67	11610	c.11460C>A	c.(11458-11460)acC>acA	p.T3820T	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3820					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CAAACACTCGGGTCTGGTAAA	0.423																																						dbGAP											0													56.0	55.0	55.0					16																	70900083		1853	4097	5950	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11460C>A	16.37:g.70900083G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	NULL	p.P40T	ENST00000393567.2	37	c.118	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.423	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	348	0.00	0	G			70900083	70900083	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000378856	ensembl	human	known	69_37n	missense	118	25.62	41	SNP	0.989	T
HYDIN	54768	genome.wustl.edu	37	16	70954676	70954676	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr16:70954676G>C	ENST00000393567.2	-	46	7753	c.7603C>G	c.(7603-7605)Cgc>Ggc	p.R2535G		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2535					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ttctccaggcgctcccgctcc	0.687																																						dbGAP											0													20.0	22.0	21.0					16																	70954676		1954	4121	6075	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7603C>G	16.37:g.70954676G>C	ENSP00000377197:p.Arg2535Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.R2534G	ENST00000393567.2	37	c.7600	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584999	0.66105	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01043	5.41	5.89	5.89	0.94794	.	0.000000	0.29699	U	0.011429	T	0.03390	0.0098	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.65051	-0.6262	10	0.56958	D	0.05	.	18.0178	0.89247	0.0:0.0:1.0:0.0	.	2534	F8WD23	.	G	2535;2534	ENSP00000377197:R2535G	ENSP00000313052:R2534G	R	-	1	0	HYDIN	69512177	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.988000	0.70579	2.790000	0.95986	0.609000	0.83330	CGC	HYDIN	-	NULL	ENSG00000157423		0.687	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	129	0.00	0	G			70954676	70954676	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	82	18.00	18	SNP	1.000	C
HYDIN	54768	genome.wustl.edu	37	16	70954676	70954676	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr16:70954676G>C	ENST00000393567.2	-	46	7753	c.7603C>G	c.(7603-7605)Cgc>Ggc	p.R2535G		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2535					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ttctccaggcgctcccgctcc	0.687																																						dbGAP											0													20.0	22.0	21.0					16																	70954676		1954	4121	6075	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7603C>G	16.37:g.70954676G>C	ENSP00000377197:p.Arg2535Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.R2534G	ENST00000393567.2	37	c.7600	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584999	0.66105	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01043	5.41	5.89	5.89	0.94794	.	0.000000	0.29699	U	0.011429	T	0.03390	0.0098	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.65051	-0.6262	10	0.56958	D	0.05	.	18.0178	0.89247	0.0:0.0:1.0:0.0	.	2534	F8WD23	.	G	2535;2534	ENSP00000377197:R2535G	ENSP00000313052:R2534G	R	-	1	0	HYDIN	69512177	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.988000	0.70579	2.790000	0.95986	0.609000	0.83330	CGC	HYDIN	-	NULL	ENSG00000157423		0.687	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	171	0.00	0	G			70954676	70954676	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	82	18.00	18	SNP	1.000	C
KCNQ5	56479	genome.wustl.edu	37	6	73904812	73904812	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr6:73904812A>G	ENST00000370398.1	+	14	2583	c.2474A>G	c.(2473-2475)gAc>gGc	p.D825G	KCNQ5_ENST00000355194.4_Missense_Mutation_p.D825G|KCNQ5_ENST00000342056.2_Missense_Mutation_p.D844G|KCNQ5_ENST00000403813.2_Missense_Mutation_p.D816G|KCNQ5_ENST00000414165.2_Missense_Mutation_p.D715G|KCNQ5_ENST00000402622.2_Missense_Mutation_p.D835G|KCNQ5_ENST00000355635.3_Missense_Mutation_p.D826G	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	825					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GTGCCGAAGGACTTGGGCAAA	0.493																																					GBM(142;1375 1859 14391 23261 44706)	dbGAP											0													123.0	99.0	107.0					6																	73904812		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2474A>G	6.37:g.73904812A>G	ENSP00000359425:p.Asp825Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.D835G	ENST00000370398.1	37	c.2504	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	A	9.621	1.133803	0.21123	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99319	-5.44;-5.45;-5.45;-5.44;-5.45;-5.49;-5.74	5.97	5.97	0.96955	.	0.128419	0.53938	D	0.000053	D	0.98504	0.9501	L	0.39633	1.23	0.31794	N	0.629301	D;B;P;B;B	0.67145	0.996;0.004;0.817;0.004;0.002	P;B;B;B;B	0.61874	0.895;0.005;0.217;0.006;0.002	D	0.98312	1.0524	10	0.33940	T	0.23	.	16.4461	0.83932	1.0:0.0:0.0:0.0	.	715;835;844;816;825	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	G	844;844;825;825;835;826;816;715	ENSP00000345055:D844G;ENSP00000347326:D825G;ENSP00000359425:D825G;ENSP00000385501:D835G;ENSP00000347853:D826G;ENSP00000384453:D816G;ENSP00000409861:D715G	ENSP00000345055:D844G	D	+	2	0	KCNQ5	73961533	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.475000	0.73582	2.285000	0.76669	0.528000	0.53228	GAC	KCNQ5	-	NULL	ENSG00000185760		0.493	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	117	0.00	0	A	NM_019842		73904812	73904812	+1	no_errors	ENST00000402622	ensembl	human	known	69_37n	missense	86	22.52	25	SNP	1.000	G
KCNQ5	56479	genome.wustl.edu	37	6	73904812	73904812	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr6:73904812A>G	ENST00000370398.1	+	14	2583	c.2474A>G	c.(2473-2475)gAc>gGc	p.D825G	KCNQ5_ENST00000355194.4_Missense_Mutation_p.D825G|KCNQ5_ENST00000342056.2_Missense_Mutation_p.D844G|KCNQ5_ENST00000403813.2_Missense_Mutation_p.D816G|KCNQ5_ENST00000414165.2_Missense_Mutation_p.D715G|KCNQ5_ENST00000402622.2_Missense_Mutation_p.D835G|KCNQ5_ENST00000355635.3_Missense_Mutation_p.D826G	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	825					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GTGCCGAAGGACTTGGGCAAA	0.493																																					GBM(142;1375 1859 14391 23261 44706)	dbGAP											0													123.0	99.0	107.0					6																	73904812		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2474A>G	6.37:g.73904812A>G	ENSP00000359425:p.Asp825Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.D835G	ENST00000370398.1	37	c.2504	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	A	9.621	1.133803	0.21123	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99319	-5.44;-5.45;-5.45;-5.44;-5.45;-5.49;-5.74	5.97	5.97	0.96955	.	0.128419	0.53938	D	0.000053	D	0.98504	0.9501	L	0.39633	1.23	0.31794	N	0.629301	D;B;P;B;B	0.67145	0.996;0.004;0.817;0.004;0.002	P;B;B;B;B	0.61874	0.895;0.005;0.217;0.006;0.002	D	0.98312	1.0524	10	0.33940	T	0.23	.	16.4461	0.83932	1.0:0.0:0.0:0.0	.	715;835;844;816;825	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	G	844;844;825;825;835;826;816;715	ENSP00000345055:D844G;ENSP00000347326:D825G;ENSP00000359425:D825G;ENSP00000385501:D835G;ENSP00000347853:D826G;ENSP00000384453:D816G;ENSP00000409861:D715G	ENSP00000345055:D844G	D	+	2	0	KCNQ5	73961533	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.475000	0.73582	2.285000	0.76669	0.528000	0.53228	GAC	KCNQ5	-	NULL	ENSG00000185760		0.493	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	214	0.00	0	A	NM_019842		73904812	73904812	+1	no_errors	ENST00000402622	ensembl	human	known	69_37n	missense	86	22.52	25	SNP	1.000	G
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240791	39240791	+	Silent	SNP	C	C	T	rs553572799	byFrequency	TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr17:39240791C>T	ENST00000391417.4	+	1	333	c.333C>T	c.(331-333)cgC>cgT	p.R111R		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	136	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cctgctgccgccccagctgct	0.662																																						dbGAP											2	Unknown(1)|Deletion - In frame(1)	NS(2)																																								-	-	-	SO:0001819	synonymous_variant	0			AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.333C>T	17.37:g.39240791C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	pfam_Keratin-assoc	p.R111	ENST00000391417.4	37	c.333	CCDS45673.1	17																																																																																			KRTAP4-7	-	NULL	ENSG00000240871		0.662	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-7	HGNC	protein_coding	OTTHUMT00000257686.1	126	0.79	1	C			39240791	39240791	+1	no_errors	ENST00000391417	ensembl	human	known	69_37n	silent	22	15.38	4	SNP	0.000	T
LZTR1	8216	genome.wustl.edu	37	22	21351225	21351225	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr22:21351225C>A	ENST00000215739.8	+	20	2735	c.2376C>A	c.(2374-2376)tgC>tgA	p.C792*	LZTR1_ENST00000389355.3_Nonsense_Mutation_p.C773*|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	792					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AGCGGCACTGCCTGCACATCA	0.622																																						dbGAP											0													77.0	69.0	72.0					22																	21351225		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.2376C>A	22.37:g.21351225C>A	ENSP00000215739:p.Cys792*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14776|Q20WK0	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.C792*	ENST00000215739.8	37	c.2376	CCDS33606.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.691533|9.691533	0.99240|0.99240	.|.	.|.	ENSG00000099949|ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355|ENST00000415817	.|.	.|.	.|.	5.41|5.41	2.16|2.16	0.27623|0.27623	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.55401	.|0.1918	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.46541	.|-0.9184	.|4	0.02654|.	T|.	1|.	-37.5828|-37.5828	7.6194|7.6194	0.28177|0.28177	0.0:0.6735:0.0:0.3265|0.0:0.6735:0.0:0.3265	.|.	.|.	.|.	.|.	X|T	751;792;773|92	.|.	ENSP00000215739:C792X|.	C|P	+|+	3|1	2|0	LZTR1|LZTR1	19681225|19681225	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	0.982000|0.982000	0.29539|0.29539	0.402000|0.402000	0.25451|0.25451	0.563000|0.563000	0.77884|0.77884	TGC|CCT	LZTR1	-	superfamily_BTB/POZ_fold	ENSG00000099949		0.622	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	64	0.00	0	C	NM_006767		21351225	21351225	+1	no_errors	ENST00000215739	ensembl	human	known	69_37n	nonsense	3	70.00	7	SNP	1.000	A
LZTR1	8216	genome.wustl.edu	37	22	21351225	21351225	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr22:21351225C>A	ENST00000215739.8	+	20	2735	c.2376C>A	c.(2374-2376)tgC>tgA	p.C792*	LZTR1_ENST00000389355.3_Nonsense_Mutation_p.C773*|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	792					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AGCGGCACTGCCTGCACATCA	0.622																																						dbGAP											0													77.0	69.0	72.0					22																	21351225		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.2376C>A	22.37:g.21351225C>A	ENSP00000215739:p.Cys792*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14776|Q20WK0	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.C792*	ENST00000215739.8	37	c.2376	CCDS33606.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.691533|9.691533	0.99240|0.99240	.|.	.|.	ENSG00000099949|ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355|ENST00000415817	.|.	.|.	.|.	5.41|5.41	2.16|2.16	0.27623|0.27623	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.55401	.|0.1918	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.46541	.|-0.9184	.|4	0.02654|.	T|.	1|.	-37.5828|-37.5828	7.6194|7.6194	0.28177|0.28177	0.0:0.6735:0.0:0.3265|0.0:0.6735:0.0:0.3265	.|.	.|.	.|.	.|.	X|T	751;792;773|92	.|.	ENSP00000215739:C792X|.	C|P	+|+	3|1	2|0	LZTR1|LZTR1	19681225|19681225	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	0.982000|0.982000	0.29539|0.29539	0.402000|0.402000	0.25451|0.25451	0.563000|0.563000	0.77884|0.77884	TGC|CCT	LZTR1	-	superfamily_BTB/POZ_fold	ENSG00000099949		0.622	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	95	0.00	0	C	NM_006767		21351225	21351225	+1	no_errors	ENST00000215739	ensembl	human	known	69_37n	nonsense	3	70.00	7	SNP	1.000	A
MMAA	166785	genome.wustl.edu	37	4	146560483	146560483	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr4:146560483A>C	ENST00000281317.5	+	2	1402	c.192A>C	c.(190-192)aaA>aaC	p.K64N	MMAA_ENST00000541599.1_5'UTR	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	64					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TAAAGAGAAAATTATGTGTAC	0.398																																						dbGAP											0													112.0	111.0	111.0					4																	146560483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.192A>C	4.37:g.146560483A>C	ENSP00000281317:p.Lys64Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX40|Q495G7	Missense_Mutation	SNP	pfam_ArgK,pfam_Cbl_biosynth_CobW-like,tigrfam_ArgK	p.K64N	ENST00000281317.5	37	c.192	CCDS3766.1	4	.	.	.	.	.	.	.	.	.	.	a	12.89	2.074554	0.36566	.	.	ENSG00000151611	ENST00000281317;ENST00000537246	D	0.91843	-2.92	5.42	0.266	0.15617	.	0.867550	0.10745	N	0.639019	D	0.83166	0.5195	L	0.31294	0.92	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.68981	-0.5266	10	0.19590	T	0.45	-33.4199	4.249	0.10686	0.5101:0.0:0.3388:0.1511	.	64;64	Q8IVH4;D6RIS5	MMAA_HUMAN;.	N	64	ENSP00000281317:K64N	ENSP00000281317:K64N	K	+	3	2	MMAA	146779933	0.993000	0.37304	0.965000	0.40720	0.995000	0.86356	0.295000	0.19065	0.099000	0.17552	0.533000	0.62120	AAA	MMAA	-	NULL	ENSG00000151611		0.398	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMAA	HGNC	protein_coding	OTTHUMT00000364668.2	330	0.00	0	A			146560483	146560483	+1	no_errors	ENST00000281317	ensembl	human	known	69_37n	missense	143	22.70	42	SNP	0.971	C
MUC5B	727897	genome.wustl.edu	37	11	1253327	1253327	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr11:1253327C>G	ENST00000529681.1	+	15	1838	c.1780C>G	c.(1780-1782)Cag>Gag	p.Q594E	MUC5B_ENST00000447027.1_Missense_Mutation_p.Q597E	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	594	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGGAAGGCCCAGGCTGCCTG	0.647																																						dbGAP											0													49.0	58.0	55.0					11																	1253327		2116	4207	6323	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1780C>G	11.37:g.1253327C>G	ENSP00000436812:p.Gln594Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.Q597E	ENST00000529681.1	37	c.1789	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	9.234	1.036599	0.19669	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.16073	2.37;2.56	3.77	3.77	0.43336	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.30070	0.0753	M	0.69248	2.105	0.25115	N	0.990684	P;D;D	0.63880	0.634;0.979;0.993	B;P;P	0.49799	0.158;0.622;0.622	T	0.15065	-1.0450	9	0.87932	D	0	.	15.5992	0.76611	0.0:1.0:0.0:0.0	.	594;1253;597	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	E	594;597;595;630	ENSP00000436812:Q594E;ENSP00000415793:Q597E	ENSP00000343037:Q595E	Q	+	1	0	MUC5B	1209903	0.000000	0.05858	1.000000	0.80357	0.644000	0.38419	0.423000	0.21313	1.636000	0.50526	0.462000	0.41574	CAG	MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	109	0.00	0	C	XM_001126093		1253327	1253327	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.997	G
MYO1B	4430	genome.wustl.edu	37	2	192225417	192225417	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr2:192225417T>G	ENST00000392318.3	+	8	870	c.623T>G	c.(622-624)tTc>tGc	p.F208C	MYO1B_ENST00000339514.4_Missense_Mutation_p.F208C|MYO1B_ENST00000392316.1_Missense_Mutation_p.F208C|MYO1B_ENST00000304164.4_Missense_Mutation_p.F208C	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	208	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			TTCCATGTGTTCTATCAGCTG	0.393																																						dbGAP											0													212.0	207.0	209.0					2																	192225417		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.623T>G	2.37:g.192225417T>G	ENSP00000376132:p.Phe208Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43794|Q7Z6L5	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F208C	ENST00000392318.3	37	c.623	CCDS46477.1	2	.	.	.	.	.	.	.	.	.	.	T	23.8	4.456425	0.84317	.	.	ENSG00000128641	ENST00000339514;ENST00000439452;ENST00000392318;ENST00000304164;ENST00000451437;ENST00000392316	D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94	5.71	5.71	0.89125	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.95822	0.8640	H	0.99169	4.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97546	1.0089	10	0.87932	D	0	.	14.5565	0.68103	0.0:0.0:0.0:1.0	.	208;208	O43795;O43795-2	MYO1B_HUMAN;.	C	208	ENSP00000341903:F208C;ENSP00000376132:F208C;ENSP00000306382:F208C;ENSP00000388140:F208C;ENSP00000376130:F208C	ENSP00000306382:F208C	F	+	2	0	MYO1B	191933662	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.314000	0.78988	2.165000	0.68154	0.533000	0.62120	TTC	MYO1B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000128641		0.393	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1B	HGNC	protein_coding	OTTHUMT00000334774.1	256	0.00	0	T	NM_012223		192225417	192225417	+1	no_errors	ENST00000304164	ensembl	human	known	69_37n	missense	293	21.66	81	SNP	1.000	G
MYO1B	4430	genome.wustl.edu	37	2	192225417	192225417	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr2:192225417T>G	ENST00000392318.3	+	8	870	c.623T>G	c.(622-624)tTc>tGc	p.F208C	MYO1B_ENST00000339514.4_Missense_Mutation_p.F208C|MYO1B_ENST00000392316.1_Missense_Mutation_p.F208C|MYO1B_ENST00000304164.4_Missense_Mutation_p.F208C	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	208	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			TTCCATGTGTTCTATCAGCTG	0.393																																						dbGAP											0													212.0	207.0	209.0					2																	192225417		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.623T>G	2.37:g.192225417T>G	ENSP00000376132:p.Phe208Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43794|Q7Z6L5	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F208C	ENST00000392318.3	37	c.623	CCDS46477.1	2	.	.	.	.	.	.	.	.	.	.	T	23.8	4.456425	0.84317	.	.	ENSG00000128641	ENST00000339514;ENST00000439452;ENST00000392318;ENST00000304164;ENST00000451437;ENST00000392316	D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94	5.71	5.71	0.89125	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.95822	0.8640	H	0.99169	4.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97546	1.0089	10	0.87932	D	0	.	14.5565	0.68103	0.0:0.0:0.0:1.0	.	208;208	O43795;O43795-2	MYO1B_HUMAN;.	C	208	ENSP00000341903:F208C;ENSP00000376132:F208C;ENSP00000306382:F208C;ENSP00000388140:F208C;ENSP00000376130:F208C	ENSP00000306382:F208C	F	+	2	0	MYO1B	191933662	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.314000	0.78988	2.165000	0.68154	0.533000	0.62120	TTC	MYO1B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000128641		0.393	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1B	HGNC	protein_coding	OTTHUMT00000334774.1	552	0.18	1	T	NM_012223		192225417	192225417	+1	no_errors	ENST00000304164	ensembl	human	known	69_37n	missense	293	21.66	81	SNP	1.000	G
NAMPT	10135	genome.wustl.edu	37	7	105915391	105915392	+	Splice_Site	DNP	CC	CC	AG			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr7:105915391_105915392CC>AG	ENST00000222553.3	-	3	625_626	c.318_319GG>CT	c.(316-321)gaGGag>gaCTag	p.106_107EE>D*	NAMPT_ENST00000354289.4_Splice_Site_p.106_107EE>D*|NAMPT_ENST00000484527.1_5'UTR	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	106					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						CCATCTTTTACCTCAAGAATGT	0.322																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.318_319delinsAG	7.37:g.105915391_105915392delinsAG		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Splice_Site|Missense_Mutation	SNP	-|pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	e3+1|p.E106D	ENST00000222553.3	37	c.318+1|c.318	CCDS5737.1	7																																																																																			NAMPT	-	-|pirsf_Nicotinamide_PRibTrfase	ENSG00000105835		0.322	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAMPT	HGNC	protein_coding	OTTHUMT00000277146.1	286	0.00	0	C	NM_182790	Nonsense_Mutation	105915391|105915392	105915391|105915392	-1	no_errors	ENST00000222553	ensembl	human	known	69_37n	splice_site|missense	470|480	27.91|27.27	182|180	SNP	1.000	A|G
NAMPT	10135	genome.wustl.edu	37	7	105915391	105915392	+	Splice_Site	DNP	CC	CC	AG			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr7:105915391_105915392CC>AG	ENST00000222553.3	-	3	625_626	c.318_319GG>CT	c.(316-321)gaGGag>gaCTag	p.106_107EE>D*	NAMPT_ENST00000354289.4_Splice_Site_p.106_107EE>D*|NAMPT_ENST00000484527.1_5'UTR	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	106					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						CCATCTTTTACCTCAAGAATGT	0.322																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.318_319delinsAG	7.37:g.105915391_105915392delinsAG		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Splice_Site|Missense_Mutation	SNP	-|pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	e3+1|p.E106D	ENST00000222553.3	37	c.318+1|c.318	CCDS5737.1	7																																																																																			NAMPT	-	-|pirsf_Nicotinamide_PRibTrfase	ENSG00000105835		0.322	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAMPT	HGNC	protein_coding	OTTHUMT00000277146.1	557|565	0.00	0	C	NM_182790	Nonsense_Mutation	105915391|105915392	105915391|105915392	-1	no_errors	ENST00000222553	ensembl	human	known	69_37n	splice_site|missense	470|480	27.91|27.27	182|180	SNP	1.000	A|G
ICE2	79664	genome.wustl.edu	37	15	60741135	60741135	+	Silent	SNP	A	A	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr15:60741135A>G	ENST00000261520.4	-	10	2265	c.2031T>C	c.(2029-2031)ccT>ccC	p.P677P	NARG2_ENST00000439632.1_Silent_p.P540P	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						CAGAAACAGAAGGCTGTTTAG	0.393																																						dbGAP											0													62.0	66.0	65.0					15																	60741135		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000261520.4:c.2031T>C	15.37:g.60741135A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_NARG2_C	p.P677	ENST00000261520.4	37	c.2031	CCDS10176.1	15																																																																																			NARG2	-	NULL	ENSG00000128915		0.393	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARG2	HGNC	protein_coding	OTTHUMT00000256136.1	120	0.00	0	A			60741135	60741135	-1	no_errors	ENST00000261520	ensembl	human	known	69_37n	silent	93	35.42	51	SNP	0.000	G
OR2V1	26693	genome.wustl.edu	37	5	180551841	180551841	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr5:180551841A>T	ENST00000329365.2	-	1	463	c.464T>A	c.(463-465)aTa>aAa	p.I155K		NM_001258283.1	NP_001245212.1	Q8NHB1	OR2V1_HUMAN	olfactory receptor, family 2, subfamily V, member 1	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(4)	4						CACTCCATCTATTATCCCAAA	0.512																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB065465	CCDS58992.1	5q35.3	2012-08-09		2004-03-10	ENSG00000185372	ENSG00000185372		"""GPCR / Class A : Olfactory receptors"""	8280	protein-coding gene	gene with protein product				OR2V1P			Standard	NM_001258283		Approved	OST265	uc031smg.1	Q8NHB1	OTTHUMG00000162118	ENST00000329365.2:c.464T>A	5.37:g.180551841A>T	ENSP00000404102:p.Ile155Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I155K	ENST00000329365.2	37	c.464	CCDS58992.1	5	.	.	.	.	.	.	.	.	.	.	.	7.754	0.703861	0.15172	.	.	ENSG00000185372	ENST00000329365	T	0.39592	1.07	5.08	3.93	0.45458	.	.	.	.	.	T	0.44603	0.1301	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36841	-0.9731	6	0.72032	D	0.01	.	8.823	0.35039	0.9115:0.0:0.0885:0.0	.	.	.	.	K	155	ENSP00000404102:I155K	ENSP00000404102:I155K	I	-	2	0	OR2V1	180484447	0.043000	0.20138	0.001000	0.08648	0.001000	0.01503	2.690000	0.47001	0.969000	0.38237	0.418000	0.28097	ATA	OR2V1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000185372		0.512	OR2V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V1	HGNC	protein_coding	OTTHUMT00000367367.1	114	0.00	0	A			180551841	180551841	-1	no_errors	ENST00000329365	ensembl	human	known	69_37n	missense	61	18.67	14	SNP	0.004	T
OR2V1	26693	genome.wustl.edu	37	5	180551841	180551841	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr5:180551841A>T	ENST00000329365.2	-	1	463	c.464T>A	c.(463-465)aTa>aAa	p.I155K		NM_001258283.1	NP_001245212.1	Q8NHB1	OR2V1_HUMAN	olfactory receptor, family 2, subfamily V, member 1	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(4)	4						CACTCCATCTATTATCCCAAA	0.512																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB065465	CCDS58992.1	5q35.3	2012-08-09		2004-03-10	ENSG00000185372	ENSG00000185372		"""GPCR / Class A : Olfactory receptors"""	8280	protein-coding gene	gene with protein product				OR2V1P			Standard	NM_001258283		Approved	OST265	uc031smg.1	Q8NHB1	OTTHUMG00000162118	ENST00000329365.2:c.464T>A	5.37:g.180551841A>T	ENSP00000404102:p.Ile155Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I155K	ENST00000329365.2	37	c.464	CCDS58992.1	5	.	.	.	.	.	.	.	.	.	.	.	7.754	0.703861	0.15172	.	.	ENSG00000185372	ENST00000329365	T	0.39592	1.07	5.08	3.93	0.45458	.	.	.	.	.	T	0.44603	0.1301	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36841	-0.9731	6	0.72032	D	0.01	.	8.823	0.35039	0.9115:0.0:0.0885:0.0	.	.	.	.	K	155	ENSP00000404102:I155K	ENSP00000404102:I155K	I	-	2	0	OR2V1	180484447	0.043000	0.20138	0.001000	0.08648	0.001000	0.01503	2.690000	0.47001	0.969000	0.38237	0.418000	0.28097	ATA	OR2V1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000185372		0.512	OR2V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V1	HGNC	protein_coding	OTTHUMT00000367367.1	169	0.00	0	A			180551841	180551841	-1	no_errors	ENST00000329365	ensembl	human	known	69_37n	missense	61	18.67	14	SNP	0.004	T
PDILT	204474	genome.wustl.edu	37	16	20396021	20396021	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr16:20396021G>T	ENST00000302451.4	-	3	603	c.355C>A	c.(355-357)Ccg>Acg	p.P119T	RP11-429K17.1_ENST00000577173.1_RNA	NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	119					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						TTCAACTCCGGGGCCTTGGTA	0.493																																						dbGAP											0													193.0	191.0	192.0					16																	20396021		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.355C>A	16.37:g.20396021G>T	ENSP00000305465:p.Pro119Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVQ5	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.P119T	ENST00000302451.4	37	c.355	CCDS10584.1	16	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153669	0.38021	.	.	ENSG00000169340	ENST00000302451	T	0.39787	1.06	5.43	5.43	0.79202	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.120315	0.56097	D	0.000023	T	0.66819	0.2828	M	0.83384	2.64	0.30203	N	0.798459	D	0.76494	0.999	D	0.77557	0.99	T	0.69053	-0.5247	10	0.87932	D	0	.	14.599	0.68427	0.0:0.0:1.0:0.0	.	119	Q8N807	PDILT_HUMAN	T	119	ENSP00000305465:P119T	ENSP00000305465:P119T	P	-	1	0	PDILT	20303522	0.998000	0.40836	0.311000	0.25182	0.023000	0.10783	4.586000	0.60984	2.825000	0.97269	0.655000	0.94253	CCG	PDILT	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000169340		0.493	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	HGNC	protein_coding	OTTHUMT00000254332.1	222	0.45	1	G	NM_174924		20396021	20396021	-1	no_errors	ENST00000302451	ensembl	human	known	69_37n	missense	153	18.62	35	SNP	0.478	T
PDILT	204474	genome.wustl.edu	37	16	20396021	20396021	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr16:20396021G>T	ENST00000302451.4	-	3	603	c.355C>A	c.(355-357)Ccg>Acg	p.P119T	RP11-429K17.1_ENST00000577173.1_RNA	NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	119					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						TTCAACTCCGGGGCCTTGGTA	0.493																																						dbGAP											0													193.0	191.0	192.0					16																	20396021		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.355C>A	16.37:g.20396021G>T	ENSP00000305465:p.Pro119Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVQ5	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.P119T	ENST00000302451.4	37	c.355	CCDS10584.1	16	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153669	0.38021	.	.	ENSG00000169340	ENST00000302451	T	0.39787	1.06	5.43	5.43	0.79202	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.120315	0.56097	D	0.000023	T	0.66819	0.2828	M	0.83384	2.64	0.30203	N	0.798459	D	0.76494	0.999	D	0.77557	0.99	T	0.69053	-0.5247	10	0.87932	D	0	.	14.599	0.68427	0.0:0.0:1.0:0.0	.	119	Q8N807	PDILT_HUMAN	T	119	ENSP00000305465:P119T	ENSP00000305465:P119T	P	-	1	0	PDILT	20303522	0.998000	0.40836	0.311000	0.25182	0.023000	0.10783	4.586000	0.60984	2.825000	0.97269	0.655000	0.94253	CCG	PDILT	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000169340		0.493	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	HGNC	protein_coding	OTTHUMT00000254332.1	370	0.54	2	G	NM_174924		20396021	20396021	-1	no_errors	ENST00000302451	ensembl	human	known	69_37n	missense	153	18.62	35	SNP	0.478	T
PDK3	5165	genome.wustl.edu	37	X	24552117	24552117	+	Silent	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chrX:24552117G>T	ENST00000379162.4	+	11	1384	c.1149G>T	c.(1147-1149)acG>acT	p.T383T	PDK3_ENST00000441463.2_Silent_p.T383T	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	383					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						ACAAGACCACGCCTGAAGCCG	0.408																																						dbGAP											0													75.0	63.0	67.0					X																	24552117		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.1149G>T	X.37:g.24552117G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXG6	Silent	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.T383	ENST00000379162.4	37	c.1149	CCDS14212.1	X																																																																																			PDK3	-	NULL	ENSG00000067992		0.408	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK3	HGNC	protein_coding	OTTHUMT00000056097.1	95	0.00	0	G	NM_005391		24552117	24552117	+1	no_errors	ENST00000441463	ensembl	human	known	69_37n	silent	117	27.88	46	SNP	0.642	T
PDK3	5165	genome.wustl.edu	37	X	24552117	24552117	+	Silent	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chrX:24552117G>T	ENST00000379162.4	+	11	1384	c.1149G>T	c.(1147-1149)acG>acT	p.T383T	PDK3_ENST00000441463.2_Silent_p.T383T	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	383					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						ACAAGACCACGCCTGAAGCCG	0.408																																						dbGAP											0													75.0	63.0	67.0					X																	24552117		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.1149G>T	X.37:g.24552117G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXG6	Silent	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.T383	ENST00000379162.4	37	c.1149	CCDS14212.1	X																																																																																			PDK3	-	NULL	ENSG00000067992		0.408	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK3	HGNC	protein_coding	OTTHUMT00000056097.1	211	0.00	0	G	NM_005391		24552117	24552117	+1	no_errors	ENST00000441463	ensembl	human	known	69_37n	silent	117	27.88	46	SNP	0.642	T
PLA2G2E	30814	genome.wustl.edu	37	1	20250034	20250034	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr1:20250034G>T	ENST00000375116.3	-	1	76	c.19C>A	c.(19-21)Ctg>Atg	p.L7M		NM_014589.1	NP_055404.1	Q9NZK7	PA2GE_HUMAN	phospholipase A2, group IIE	7					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|endometrium(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|GBM - Glioblastoma multiforme(114;0.000146)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aminosalicylic Acid(DB00233)	AGGAACACCAGCACGTGGGGA	0.582																																						dbGAP											0													86.0	67.0	74.0					1																	20250034		2179	4230	6409	-	-	-	SO:0001583	missense	0			AF189279	CCDS200.1	1p36.13	2008-09-19			ENSG00000188784	ENSG00000188784	3.1.1.4		13414	protein-coding gene	gene with protein product						10681567, 11922621	Standard	NM_014589		Approved		uc001bct.1	Q9NZK7	OTTHUMG00000002702	ENST00000375116.3:c.19C>A	1.37:g.20250034G>T	ENSP00000364257:p.Leu7Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXJ8	Missense_Mutation	SNP	pfam_PLipase_A2_euk,superfamily_PLipase_A2,smart_PLipase_A2,prints_PLipase_A2_euk	p.L7M	ENST00000375116.3	37	c.19	CCDS200.1	1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607558	0.46527	.	.	ENSG00000188784	ENST00000375116	T	0.29917	1.55	5.24	0.786	0.18590	.	0.744674	0.11862	N	0.522303	T	0.22475	0.0542	L	0.43554	1.36	0.09310	N	1	B	0.21905	0.062	B	0.18561	0.022	T	0.26155	-1.0111	10	0.66056	D	0.02	-8.5736	4.3317	0.11066	0.1866:0.0:0.5586:0.2548	.	7	Q9NZK7	PA2GE_HUMAN	M	7	ENSP00000364257:L7M	ENSP00000364257:L7M	L	-	1	2	PLA2G2E	20122621	0.595000	0.26857	0.001000	0.08648	0.109000	0.19521	1.540000	0.36115	0.593000	0.29745	0.655000	0.94253	CTG	PLA2G2E	-	NULL	ENSG00000188784		0.582	PLA2G2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2E	HGNC	protein_coding	OTTHUMT00000007684.1	212	0.47	1	G	NM_014589		20250034	20250034	-1	no_errors	ENST00000375116	ensembl	human	known	69_37n	missense	79	25.47	27	SNP	0.000	T
PLA2G2E	30814	genome.wustl.edu	37	1	20250034	20250034	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr1:20250034G>T	ENST00000375116.3	-	1	76	c.19C>A	c.(19-21)Ctg>Atg	p.L7M		NM_014589.1	NP_055404.1	Q9NZK7	PA2GE_HUMAN	phospholipase A2, group IIE	7					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|endometrium(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|GBM - Glioblastoma multiforme(114;0.000146)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aminosalicylic Acid(DB00233)	AGGAACACCAGCACGTGGGGA	0.582																																						dbGAP											0													86.0	67.0	74.0					1																	20250034		2179	4230	6409	-	-	-	SO:0001583	missense	0			AF189279	CCDS200.1	1p36.13	2008-09-19			ENSG00000188784	ENSG00000188784	3.1.1.4		13414	protein-coding gene	gene with protein product						10681567, 11922621	Standard	NM_014589		Approved		uc001bct.1	Q9NZK7	OTTHUMG00000002702	ENST00000375116.3:c.19C>A	1.37:g.20250034G>T	ENSP00000364257:p.Leu7Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXJ8	Missense_Mutation	SNP	pfam_PLipase_A2_euk,superfamily_PLipase_A2,smart_PLipase_A2,prints_PLipase_A2_euk	p.L7M	ENST00000375116.3	37	c.19	CCDS200.1	1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607558	0.46527	.	.	ENSG00000188784	ENST00000375116	T	0.29917	1.55	5.24	0.786	0.18590	.	0.744674	0.11862	N	0.522303	T	0.22475	0.0542	L	0.43554	1.36	0.09310	N	1	B	0.21905	0.062	B	0.18561	0.022	T	0.26155	-1.0111	10	0.66056	D	0.02	-8.5736	4.3317	0.11066	0.1866:0.0:0.5586:0.2548	.	7	Q9NZK7	PA2GE_HUMAN	M	7	ENSP00000364257:L7M	ENSP00000364257:L7M	L	-	1	2	PLA2G2E	20122621	0.595000	0.26857	0.001000	0.08648	0.109000	0.19521	1.540000	0.36115	0.593000	0.29745	0.655000	0.94253	CTG	PLA2G2E	-	NULL	ENSG00000188784		0.582	PLA2G2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2E	HGNC	protein_coding	OTTHUMT00000007684.1	227	0.00	0	G	NM_014589		20250034	20250034	-1	no_errors	ENST00000375116	ensembl	human	known	69_37n	missense	79	25.47	27	SNP	0.000	T
PRPF3	9129	genome.wustl.edu	37	1	150325444	150325444	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr1:150325444T>A	ENST00000324862.6	+	16	2206	c.2041T>A	c.(2041-2043)Tcc>Acc	p.S681T	PRPF3_ENST00000467329.1_3'UTR|PRPF3_ENST00000414970.2_Missense_Mutation_p.S632T	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	681					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		TGTGTTAGAGTCCACTGATTG	0.483																																					Ovarian(168;1070 2670 5178 20729)	dbGAP											0													151.0	146.0	148.0					1																	150325444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.2041T>A	1.37:g.150325444T>A	ENSP00000315379:p.Ser681Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSY9|O43446|Q5VT54	Missense_Mutation	SNP	pfam_Pre-mRNA_splic_Prp3,pfam_DUF1115,pfam_PWI,superfamily_PWI,smart_PWI	p.S681T	ENST00000324862.6	37	c.2041	CCDS951.1	1	.	.	.	.	.	.	.	.	.	.	T	10.24	1.294806	0.23564	.	.	ENSG00000117360	ENST00000324862;ENST00000414970	T;T	0.76709	-1.03;-1.04	5.7	4.54	0.55810	.	0.573410	0.18796	N	0.130920	T	0.29620	0.0739	N	0.01576	-0.805	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.17018	-1.0383	10	0.23891	T	0.37	-0.2585	8.1221	0.30978	0.1341:0.0:0.1404:0.7255	.	632;681	E7EVD1;O43395	.;PRPF3_HUMAN	T	681;632	ENSP00000315379:S681T;ENSP00000387844:S632T	ENSP00000315379:S681T	S	+	1	0	PRPF3	148592068	0.998000	0.40836	0.998000	0.56505	0.987000	0.75469	1.686000	0.37669	0.953000	0.37825	0.467000	0.42956	TCC	PRPF3	-	NULL	ENSG00000117360		0.483	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	169	0.00	0	T	NM_004698		150325444	150325444	+1	no_errors	ENST00000324862	ensembl	human	known	69_37n	missense	126	20.75	33	SNP	1.000	A
PRPF3	9129	genome.wustl.edu	37	1	150325444	150325444	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr1:150325444T>A	ENST00000324862.6	+	16	2206	c.2041T>A	c.(2041-2043)Tcc>Acc	p.S681T	PRPF3_ENST00000467329.1_3'UTR|PRPF3_ENST00000414970.2_Missense_Mutation_p.S632T	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	681					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		TGTGTTAGAGTCCACTGATTG	0.483																																					Ovarian(168;1070 2670 5178 20729)	dbGAP											0													151.0	146.0	148.0					1																	150325444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.2041T>A	1.37:g.150325444T>A	ENSP00000315379:p.Ser681Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSY9|O43446|Q5VT54	Missense_Mutation	SNP	pfam_Pre-mRNA_splic_Prp3,pfam_DUF1115,pfam_PWI,superfamily_PWI,smart_PWI	p.S681T	ENST00000324862.6	37	c.2041	CCDS951.1	1	.	.	.	.	.	.	.	.	.	.	T	10.24	1.294806	0.23564	.	.	ENSG00000117360	ENST00000324862;ENST00000414970	T;T	0.76709	-1.03;-1.04	5.7	4.54	0.55810	.	0.573410	0.18796	N	0.130920	T	0.29620	0.0739	N	0.01576	-0.805	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.17018	-1.0383	10	0.23891	T	0.37	-0.2585	8.1221	0.30978	0.1341:0.0:0.1404:0.7255	.	632;681	E7EVD1;O43395	.;PRPF3_HUMAN	T	681;632	ENSP00000315379:S681T;ENSP00000387844:S632T	ENSP00000315379:S681T	S	+	1	0	PRPF3	148592068	0.998000	0.40836	0.998000	0.56505	0.987000	0.75469	1.686000	0.37669	0.953000	0.37825	0.467000	0.42956	TCC	PRPF3	-	NULL	ENSG00000117360		0.483	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	217	0.00	0	T	NM_004698		150325444	150325444	+1	no_errors	ENST00000324862	ensembl	human	known	69_37n	missense	126	20.75	33	SNP	1.000	A
RGPD4	285190	genome.wustl.edu	37	2	108479240	108479240	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr2:108479240C>T	ENST00000408999.3	+	16	2385	c.2308C>T	c.(2308-2310)Cga>Tga	p.R770*	RGPD4_ENST00000354986.4_Nonsense_Mutation_p.R770*	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	770					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGGTTCTTTGCGAAATGCGGA	0.388																																						dbGAP											0													43.0	38.0	40.0					2																	108479240		370	915	1285	-	-	-	SO:0001587	stop_gained	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2308C>T	2.37:g.108479240C>T	ENSP00000386810:p.Arg770*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A029	Nonsense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.R770*	ENST00000408999.3	37	c.2308	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	21.9	4.209978	0.79240	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	.	.	.	2.3	2.3	0.28687	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.5094	8.2796	0.31892	0.0:0.7525:0.2474:0.0	.	.	.	.	X	770;770;528	.	ENSP00000347081:R770X	R	+	1	2	RGPD4	107845672	0.158000	0.22850	0.863000	0.33907	0.050000	0.14768	0.561000	0.23515	1.299000	0.44798	0.152000	0.16155	CGA	RGPD4	-	NULL	ENSG00000196862		0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	140	0.00	0	C	XM_496581		108479240	108479240	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	nonsense	207	45.38	172	SNP	0.592	T
RGPD4	285190	genome.wustl.edu	37	2	108479240	108479240	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr2:108479240C>T	ENST00000408999.3	+	16	2385	c.2308C>T	c.(2308-2310)Cga>Tga	p.R770*	RGPD4_ENST00000354986.4_Nonsense_Mutation_p.R770*	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	770					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGGTTCTTTGCGAAATGCGGA	0.388																																						dbGAP											0													43.0	38.0	40.0					2																	108479240		370	915	1285	-	-	-	SO:0001587	stop_gained	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2308C>T	2.37:g.108479240C>T	ENSP00000386810:p.Arg770*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A029	Nonsense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.R770*	ENST00000408999.3	37	c.2308	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	21.9	4.209978	0.79240	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	.	.	.	2.3	2.3	0.28687	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.5094	8.2796	0.31892	0.0:0.7525:0.2474:0.0	.	.	.	.	X	770;770;528	.	ENSP00000347081:R770X	R	+	1	2	RGPD4	107845672	0.158000	0.22850	0.863000	0.33907	0.050000	0.14768	0.561000	0.23515	1.299000	0.44798	0.152000	0.16155	CGA	RGPD4	-	NULL	ENSG00000196862		0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	262	0.00	0	C	XM_496581		108479240	108479240	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	nonsense	207	45.38	172	SNP	0.592	T
RIMKLB	57494	genome.wustl.edu	37	12	8904625	8904625	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr12:8904625C>T	ENST00000538135.1	+	4	1304	c.479C>T	c.(478-480)aCg>aTg	p.T160M	RIMKLB_ENST00000535829.1_Missense_Mutation_p.T160M|RIMKLB_ENST00000299673.5_3'UTR|RIMKLB_ENST00000357529.3_Missense_Mutation_p.T160M			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	160	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GTAAAGAATACGCGGGGTCAC	0.368																																						dbGAP											0													157.0	145.0	148.0					12																	8904625		1849	4086	5935	-	-	-	SO:0001583	missense	0			AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.479C>T	12.37:g.8904625C>T	ENSP00000440943:p.Thr160Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Missense_Mutation	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.T160M	ENST00000538135.1	37	c.479	CCDS41748.1	12	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911806	0.52439	.	.	ENSG00000166532	ENST00000535829;ENST00000357529;ENST00000538135	.	.	.	4.96	4.96	0.65561	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 1 (1);	0.069433	0.64402	U	0.000018	T	0.56426	0.1984	L	0.41824	1.3	0.54753	D	0.999986	B;B	0.19445	0.036;0.018	B;B	0.20767	0.031;0.019	T	0.56661	-0.7942	9	0.66056	D	0.02	.	16.9516	0.86247	0.0:1.0:0.0:0.0	.	160;160	Q9ULI2-2;Q9ULI2	.;RIMKB_HUMAN	M	160	.	ENSP00000350136:T160M	T	+	2	0	RIMKLB	8795892	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.141000	0.77330	2.576000	0.86940	0.591000	0.81541	ACG	RIMKLB	-	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	ENSG00000166532		0.368	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLB	HGNC	protein_coding	OTTHUMT00000398874.1	523	0.00	0	C	NM_020734		8904625	8904625	+1	no_errors	ENST00000357529	ensembl	human	known	69_37n	missense	446	20.07	112	SNP	1.000	T
RPS6KA3	6197	genome.wustl.edu	37	X	20185730	20185730	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chrX:20185730C>T	ENST00000379565.3	-	17	1786	c.1579G>A	c.(1579-1581)Gtt>Att	p.V527I	RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.V499I|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.V497I|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.V498I	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	527	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	AGATATTCAACGGTTTTAGTT	0.348																																						dbGAP											0													181.0	180.0	181.0					X																	20185730		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1579G>A	X.37:g.20185730C>T	ENSP00000368884:p.Val527Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V527I	ENST00000379565.3	37	c.1579	CCDS14197.1	X	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371928	0.61624	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.8	5.8	0.92144	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.063495	0.64402	D	0.000008	T	0.33381	0.0861	N	0.13003	0.285	0.80722	D	1	B;B;B;B	0.14805	0.001;0.011;0.0;0.005	B;B;B;B	0.24974	0.024;0.034;0.011;0.057	T	0.09885	-1.0654	10	0.52906	T	0.07	.	18.9908	0.92791	0.0:1.0:0.0:0.0	.	498;497;499;527	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	I	527;499;497;498	ENSP00000368884:V527I;ENSP00000440220:V499I;ENSP00000368865:V497I;ENSP00000444837:V498I	ENSP00000368865:V497I	V	-	1	0	RPS6KA3	20095651	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.056000	0.71111	2.434000	0.82447	0.513000	0.50165	GTT	RPS6KA3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000177189		0.348	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS6KA3	HGNC	protein_coding	OTTHUMT00000056011.3	216	0.46	1	C	NM_004586		20185730	20185730	-1	no_errors	ENST00000379565	ensembl	human	known	69_37n	missense	298	19.89	74	SNP	1.000	T
RPS6KA3	6197	genome.wustl.edu	37	X	20185730	20185730	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chrX:20185730C>T	ENST00000379565.3	-	17	1786	c.1579G>A	c.(1579-1581)Gtt>Att	p.V527I	RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.V499I|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.V497I|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.V498I	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	527	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	AGATATTCAACGGTTTTAGTT	0.348																																						dbGAP											0													181.0	180.0	181.0					X																	20185730		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1579G>A	X.37:g.20185730C>T	ENSP00000368884:p.Val527Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V527I	ENST00000379565.3	37	c.1579	CCDS14197.1	X	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371928	0.61624	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.8	5.8	0.92144	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.063495	0.64402	D	0.000008	T	0.33381	0.0861	N	0.13003	0.285	0.80722	D	1	B;B;B;B	0.14805	0.001;0.011;0.0;0.005	B;B;B;B	0.24974	0.024;0.034;0.011;0.057	T	0.09885	-1.0654	10	0.52906	T	0.07	.	18.9908	0.92791	0.0:1.0:0.0:0.0	.	498;497;499;527	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	I	527;499;497;498	ENSP00000368884:V527I;ENSP00000440220:V499I;ENSP00000368865:V497I;ENSP00000444837:V498I	ENSP00000368865:V497I	V	-	1	0	RPS6KA3	20095651	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.056000	0.71111	2.434000	0.82447	0.513000	0.50165	GTT	RPS6KA3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000177189		0.348	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS6KA3	HGNC	protein_coding	OTTHUMT00000056011.3	415	0.00	0	C	NM_004586		20185730	20185730	-1	no_errors	ENST00000379565	ensembl	human	known	69_37n	missense	298	19.89	74	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237889592	237889592	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr1:237889592G>A	ENST00000366574.2	+	75	11026	c.10709G>A	c.(10708-10710)cGg>cAg	p.R3570Q	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.R3554Q|RYR2_ENST00000360064.6_Missense_Mutation_p.R3568Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3570					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGTGTGGGTCGGAGACATTAC	0.303																																						dbGAP											0													69.0	66.0	67.0					1																	237889592		1814	4071	5885	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10709G>A	1.37:g.237889592G>A	ENSP00000355533:p.Arg3570Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.R3568Q	ENST00000366574.2	37	c.10703	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	9.058	0.993682	0.19043	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96491	-4.03;-3.99;-4.02	5.48	5.48	0.80851	.	0.707951	0.11980	U	0.510852	D	0.90741	0.7094	N	0.08118	0	0.42137	D	0.991496	B	0.27679	0.185	B	0.17433	0.018	D	0.85884	0.1424	10	0.29301	T	0.29	.	16.0703	0.80922	0.0:0.0:1.0:0.0	.	3570	Q92736	RYR2_HUMAN	Q	3570;3568;3554;525	ENSP00000355533:R3570Q;ENSP00000353174:R3568Q;ENSP00000443798:R3554Q	ENSP00000353174:R3568Q	R	+	2	0	RYR2	235956215	0.789000	0.28775	0.037000	0.18230	0.033000	0.12548	1.424000	0.34848	2.579000	0.87056	0.650000	0.86243	CGG	RYR2	-	NULL	ENSG00000198626		0.303	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	255	0.78	2	G	NM_001035		237889592	237889592	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	218	40.92	151	SNP	0.019	A
SEMA4F	10505	genome.wustl.edu	37	2	74884993	74884993	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr2:74884993A>G	ENST00000357877.2	+	4	520	c.371A>G	c.(370-372)aAt>aGt	p.N124S	SEMA4F_ENST00000339773.5_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	124	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						GAATGTCACAATTTTGTCCAG	0.507																																						dbGAP											0													195.0	168.0	177.0					2																	74884993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.371A>G	2.37:g.74884993A>G	ENSP00000350547:p.Asn124Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q542Y7|Q9NS35	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.N124S	ENST00000357877.2	37	c.371	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193727	0.78902	.	.	ENSG00000135622	ENST00000357877	T	0.23552	1.9	5.46	5.46	0.80206	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.124653	0.51477	D	0.000091	T	0.59128	0.2171	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68930	-0.5279	10	0.87932	D	0	.	11.9404	0.52896	1.0:0.0:0.0:0.0	.	124	O95754	SEM4F_HUMAN	S	124	ENSP00000350547:N124S	ENSP00000350547:N124S	N	+	2	0	SEMA4F	74738501	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.619000	0.61218	2.081000	0.62600	0.533000	0.62120	AAT	SEMA4F	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000135622		0.507	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	HGNC	protein_coding	OTTHUMT00000252214.2	407	0.49	2	A	NM_004263		74884993	74884993	+1	no_errors	ENST00000357877	ensembl	human	known	69_37n	missense	191	13.96	31	SNP	1.000	G
SEMA4F	10505	genome.wustl.edu	37	2	74884993	74884993	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr2:74884993A>G	ENST00000357877.2	+	4	520	c.371A>G	c.(370-372)aAt>aGt	p.N124S	SEMA4F_ENST00000339773.5_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	124	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						GAATGTCACAATTTTGTCCAG	0.507																																						dbGAP											0													195.0	168.0	177.0					2																	74884993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.371A>G	2.37:g.74884993A>G	ENSP00000350547:p.Asn124Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q542Y7|Q9NS35	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.N124S	ENST00000357877.2	37	c.371	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193727	0.78902	.	.	ENSG00000135622	ENST00000357877	T	0.23552	1.9	5.46	5.46	0.80206	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.124653	0.51477	D	0.000091	T	0.59128	0.2171	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68930	-0.5279	10	0.87932	D	0	.	11.9404	0.52896	1.0:0.0:0.0:0.0	.	124	O95754	SEM4F_HUMAN	S	124	ENSP00000350547:N124S	ENSP00000350547:N124S	N	+	2	0	SEMA4F	74738501	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.619000	0.61218	2.081000	0.62600	0.533000	0.62120	AAT	SEMA4F	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000135622		0.507	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	HGNC	protein_coding	OTTHUMT00000252214.2	574	0.00	0	A	NM_004263		74884993	74884993	+1	no_errors	ENST00000357877	ensembl	human	known	69_37n	missense	191	13.96	31	SNP	1.000	G
SLC25A25	114789	genome.wustl.edu	37	9	130863453	130863453	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr9:130863453G>T	ENST00000373064.5	+	2	501	c.238G>T	c.(238-240)Gag>Tag	p.E80*	SLC25A25_ENST00000432073.2_Nonsense_Mutation_p.E100*|SLC25A25_ENST00000373066.5_Nonsense_Mutation_p.E100*|SLC25A25_ENST00000373069.5_Nonsense_Mutation_p.E114*|SLC25A25_ENST00000433501.1_5'UTR|SLC25A25_ENST00000373068.2_Nonsense_Mutation_p.E114*	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	80	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						CCAAGATCATGAGAAGAAGCT	0.453																																						dbGAP											0													106.0	111.0	109.0					9																	130863453		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.238G>T	9.37:g.130863453G>T	ENSP00000362155:p.Glu80*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Nonsense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_Ca-bd,prints_Mit_carrier,prints_Graves_DC,pfscan_EF_HAND_2,pfscan_Mitochondrial_sb/sol_carrier	p.E114*	ENST00000373064.5	37	c.340	CCDS6890.1	9	.	.	.	.	.	.	.	.	.	.	G	41	9.001897	0.99033	.	.	ENSG00000148339	ENST00000373068;ENST00000373069;ENST00000432073;ENST00000373066;ENST00000373064	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-33.0715	18.009	0.89217	0.0:0.0:1.0:0.0	.	.	.	.	X	114;114;100;100;80	.	ENSP00000362155:E80X	E	+	1	0	SLC25A25	129903274	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	9.869000	0.99810	2.487000	0.83934	0.462000	0.41574	GAG	SLC25A25	-	pfscan_EF_HAND_2	ENSG00000148339		0.453	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A25	HGNC	protein_coding	OTTHUMT00000054407.1	169	0.00	0	G	NM_052901		130863453	130863453	+1	no_errors	ENST00000373069	ensembl	human	known	69_37n	nonsense	165	10.33	19	SNP	1.000	T
SLC25A25	114789	genome.wustl.edu	37	9	130863453	130863453	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr9:130863453G>T	ENST00000373064.5	+	2	501	c.238G>T	c.(238-240)Gag>Tag	p.E80*	SLC25A25_ENST00000432073.2_Nonsense_Mutation_p.E100*|SLC25A25_ENST00000373066.5_Nonsense_Mutation_p.E100*|SLC25A25_ENST00000373069.5_Nonsense_Mutation_p.E114*|SLC25A25_ENST00000433501.1_5'UTR|SLC25A25_ENST00000373068.2_Nonsense_Mutation_p.E114*	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	80	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						CCAAGATCATGAGAAGAAGCT	0.453																																						dbGAP											0													106.0	111.0	109.0					9																	130863453		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.238G>T	9.37:g.130863453G>T	ENSP00000362155:p.Glu80*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Nonsense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_Ca-bd,prints_Mit_carrier,prints_Graves_DC,pfscan_EF_HAND_2,pfscan_Mitochondrial_sb/sol_carrier	p.E114*	ENST00000373064.5	37	c.340	CCDS6890.1	9	.	.	.	.	.	.	.	.	.	.	G	41	9.001897	0.99033	.	.	ENSG00000148339	ENST00000373068;ENST00000373069;ENST00000432073;ENST00000373066;ENST00000373064	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-33.0715	18.009	0.89217	0.0:0.0:1.0:0.0	.	.	.	.	X	114;114;100;100;80	.	ENSP00000362155:E80X	E	+	1	0	SLC25A25	129903274	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	9.869000	0.99810	2.487000	0.83934	0.462000	0.41574	GAG	SLC25A25	-	pfscan_EF_HAND_2	ENSG00000148339		0.453	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A25	HGNC	protein_coding	OTTHUMT00000054407.1	305	0.00	0	G	NM_052901		130863453	130863453	+1	no_errors	ENST00000373069	ensembl	human	known	69_37n	nonsense	165	10.33	19	SNP	1.000	T
SLC39A14	23516	genome.wustl.edu	37	8	22262288	22262288	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr8:22262288delG	ENST00000381237.1	+	2	184	c.65delG	c.(64-66)tggfs	p.W22fs	SLC39A14_ENST00000359741.5_Frame_Shift_Del_p.W22fs|SLC39A14_ENST00000289952.5_Frame_Shift_Del_p.W22fs|SLC39A14_ENST00000240095.6_Frame_Shift_Del_p.W22fs	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	22					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		CTTGGCTTATGGAGAACCACC	0.572																																						dbGAP											0													88.0	94.0	92.0					8																	22262288		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.65delG	8.37:g.22262288delG	ENSP00000370635:p.Trp22fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Frame_Shift_Del	DEL	pfam_ZIP	p.W22fs	ENST00000381237.1	37	c.65	CCDS47823.1	8																																																																																			SLC39A14	-	NULL	ENSG00000104635		0.572	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A14	HGNC	protein_coding	OTTHUMT00000215039.2	58	0.00	0	G	XM_046677		22262288	22262288	+1	no_errors	ENST00000359741	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	0.232	-
SSTR5	6755	genome.wustl.edu	37	16	1129206	1129206	+	Missense_Mutation	SNP	G	G	A	rs200422161		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr16:1129206G>A	ENST00000293897.4	+	1	426	c.338G>A	c.(337-339)cGc>cAc	p.R113H	SSTR5_ENST00000397547.2_Missense_Mutation_p.R113H|SSTR5_ENST00000562758.1_Missense_Mutation_p.R113H|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	113					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.R113H(1)		endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	GTCCTGTGCCGCCTGGTCATG	0.652													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15183	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	endometrium(1)											56.0	50.0	52.0					16																	1129206		2194	4297	6491	-	-	-	SO:0001583	missense	0			D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.338G>A	16.37:g.1129206G>A	ENSP00000293897:p.Arg113His	Somatic		WXS	Illumina GAIIx	Phase_IV	P34988|Q541E0|Q9UJI5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,prints_Somatstn_rcpt_5,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.R113H	ENST00000293897.4	37	c.338	CCDS10429.1	16	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	26.1	4.705785	0.89018	.	.	ENSG00000162009	ENST00000397547;ENST00000293897;ENST00000539762	T;T	0.19532	2.14;2.14	4.87	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.069740	0.56097	D	0.000032	T	0.37972	0.1023	L	0.54863	1.705	0.48696	D	0.999693	D	0.60160	0.987	P	0.57846	0.828	T	0.17107	-1.0380	10	0.62326	D	0.03	.	16.9817	0.86329	0.0:0.0:1.0:0.0	.	113	P35346	SSR5_HUMAN	H	113	ENSP00000380680:R113H;ENSP00000293897:R113H	ENSP00000293897:R113H	R	+	2	0	SSTR5	1069207	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.360000	0.66086	2.260000	0.74910	0.561000	0.74099	CGC	SSTR5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Somatstn_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000162009		0.652	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR5	HGNC	protein_coding	OTTHUMT00000420836.1	47	0.00	0	G			1129206	1129206	+1	no_errors	ENST00000293897	ensembl	human	known	69_37n	missense	13	26.32	5	SNP	1.000	A
SSTR5	6755	genome.wustl.edu	37	16	1129206	1129206	+	Missense_Mutation	SNP	G	G	A	rs200422161		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr16:1129206G>A	ENST00000293897.4	+	1	426	c.338G>A	c.(337-339)cGc>cAc	p.R113H	SSTR5_ENST00000397547.2_Missense_Mutation_p.R113H|SSTR5_ENST00000562758.1_Missense_Mutation_p.R113H|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	113					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.R113H(1)		endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	GTCCTGTGCCGCCTGGTCATG	0.652													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15183	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	endometrium(1)											56.0	50.0	52.0					16																	1129206		2194	4297	6491	-	-	-	SO:0001583	missense	0			D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.338G>A	16.37:g.1129206G>A	ENSP00000293897:p.Arg113His	Somatic		WXS	Illumina GAIIx	Phase_IV	P34988|Q541E0|Q9UJI5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,prints_Somatstn_rcpt_5,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.R113H	ENST00000293897.4	37	c.338	CCDS10429.1	16	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	26.1	4.705785	0.89018	.	.	ENSG00000162009	ENST00000397547;ENST00000293897;ENST00000539762	T;T	0.19532	2.14;2.14	4.87	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.069740	0.56097	D	0.000032	T	0.37972	0.1023	L	0.54863	1.705	0.48696	D	0.999693	D	0.60160	0.987	P	0.57846	0.828	T	0.17107	-1.0380	10	0.62326	D	0.03	.	16.9817	0.86329	0.0:0.0:1.0:0.0	.	113	P35346	SSR5_HUMAN	H	113	ENSP00000380680:R113H;ENSP00000293897:R113H	ENSP00000293897:R113H	R	+	2	0	SSTR5	1069207	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.360000	0.66086	2.260000	0.74910	0.561000	0.74099	CGC	SSTR5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Somatstn_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000162009		0.652	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR5	HGNC	protein_coding	OTTHUMT00000420836.1	65	0.00	0	G			1129206	1129206	+1	no_errors	ENST00000293897	ensembl	human	known	69_37n	missense	13	26.32	5	SNP	1.000	A
SUOX	6821	genome.wustl.edu	37	12	56397550	56397550	+	Missense_Mutation	SNP	T	T	G	rs201162460		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr12:56397550T>G	ENST00000394109.3	+	3	1101	c.377T>G	c.(376-378)aTg>aGg	p.M126R	SUOX_ENST00000551841.2_Intron|SUOX_ENST00000266971.3_Missense_Mutation_p.M126R|SUOX_ENST00000550478.1_3'UTR|SUOX_ENST00000356124.4_Missense_Mutation_p.M126R|SUOX_ENST00000394115.2_Missense_Mutation_p.M126R|SUOX_ENST00000548274.1_Missense_Mutation_p.M126R			P51687	SUOX_HUMAN	sulfite oxidase	126	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			TCAAAGCTGATGCTAGCAGCT	0.562													T|||	1	0.000199681	0.0	0.0	5008	,	,		17327	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	85.0	84.0					12																	56397550		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.377T>G	12.37:g.56397550T>G	ENSP00000377668:p.Met126Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_OxRdtase_Mopterin-bd_dom,pfam_MoCF_OxRdtse_dimer,pfam_Cyt_B5,superfamily_OxRdtase_Mopterin-bd_dom,superfamily_Ig_E-set,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Mopterin_OxRdtase_euk,prints_Cyt_B5	p.M126R	ENST00000394109.3	37	c.377	CCDS8901.2	12	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	18.67	3.673755	0.67928	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000546833;ENST00000394109	T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	4.99	4.99	0.66335	Cytochrome b5 (5);	0.049556	0.85682	D	0.000000	D	0.85553	0.5723	M	0.66560	2.04	0.58432	D	0.999992	D	0.63046	0.992	D	0.66497	0.944	D	0.87234	0.2262	10	0.87932	D	0	-8.3851	14.1174	0.65164	0.0:0.0:0.0:1.0	.	126	P51687	SUOX_HUMAN	R	126	ENSP00000348440:M126R;ENSP00000266971:M126R;ENSP00000377674:M126R;ENSP00000450245:M126R;ENSP00000449872:M126R;ENSP00000377668:M126R	ENSP00000266971:M126R	M	+	2	0	SUOX	54683817	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.411000	0.80078	2.233000	0.73108	0.533000	0.62120	ATG	SUOX	-	pfam_Cyt_B5,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Cyt_B5	ENSG00000139531		0.562	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUOX	HGNC	protein_coding	OTTHUMT00000250309.1	106	0.93	1	T	NM_000456		56397550	56397550	+1	no_errors	ENST00000266971	ensembl	human	known	69_37n	missense	38	29.63	16	SNP	1.000	G
SUOX	6821	genome.wustl.edu	37	12	56397550	56397550	+	Missense_Mutation	SNP	T	T	G	rs201162460		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr12:56397550T>G	ENST00000394109.3	+	3	1101	c.377T>G	c.(376-378)aTg>aGg	p.M126R	SUOX_ENST00000551841.2_Intron|SUOX_ENST00000266971.3_Missense_Mutation_p.M126R|SUOX_ENST00000550478.1_3'UTR|SUOX_ENST00000356124.4_Missense_Mutation_p.M126R|SUOX_ENST00000394115.2_Missense_Mutation_p.M126R|SUOX_ENST00000548274.1_Missense_Mutation_p.M126R			P51687	SUOX_HUMAN	sulfite oxidase	126	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			TCAAAGCTGATGCTAGCAGCT	0.562													T|||	1	0.000199681	0.0	0.0	5008	,	,		17327	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	85.0	84.0					12																	56397550		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.377T>G	12.37:g.56397550T>G	ENSP00000377668:p.Met126Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_OxRdtase_Mopterin-bd_dom,pfam_MoCF_OxRdtse_dimer,pfam_Cyt_B5,superfamily_OxRdtase_Mopterin-bd_dom,superfamily_Ig_E-set,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Mopterin_OxRdtase_euk,prints_Cyt_B5	p.M126R	ENST00000394109.3	37	c.377	CCDS8901.2	12	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	18.67	3.673755	0.67928	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000546833;ENST00000394109	T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	4.99	4.99	0.66335	Cytochrome b5 (5);	0.049556	0.85682	D	0.000000	D	0.85553	0.5723	M	0.66560	2.04	0.58432	D	0.999992	D	0.63046	0.992	D	0.66497	0.944	D	0.87234	0.2262	10	0.87932	D	0	-8.3851	14.1174	0.65164	0.0:0.0:0.0:1.0	.	126	P51687	SUOX_HUMAN	R	126	ENSP00000348440:M126R;ENSP00000266971:M126R;ENSP00000377674:M126R;ENSP00000450245:M126R;ENSP00000449872:M126R;ENSP00000377668:M126R	ENSP00000266971:M126R	M	+	2	0	SUOX	54683817	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.411000	0.80078	2.233000	0.73108	0.533000	0.62120	ATG	SUOX	-	pfam_Cyt_B5,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Cyt_B5	ENSG00000139531		0.562	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUOX	HGNC	protein_coding	OTTHUMT00000250309.1	139	0.00	0	T	NM_000456		56397550	56397550	+1	no_errors	ENST00000266971	ensembl	human	known	69_37n	missense	38	29.63	16	SNP	1.000	G
TCTEX1D1	200132	genome.wustl.edu	37	1	67242936	67242936	+	Silent	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr1:67242936T>G	ENST00000282670.2	+	5	467	c.339T>G	c.(337-339)gtT>gtG	p.V113V		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	113										large_intestine(2)|lung(10)|skin(1)	13						ATTTCTAGGTTATTAAAGCCC	0.338																																						dbGAP											0													77.0	80.0	79.0					1																	67242936		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.339T>G	1.37:g.67242936T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q06YR9|Q5VYE1	Silent	SNP	pfam_Tctex	p.V113	ENST00000282670.2	37	c.339	CCDS633.1	1																																																																																			TCTEX1D1	-	pfam_Tctex	ENSG00000152760		0.338	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D1	HGNC	protein_coding	OTTHUMT00000025399.2	88	0.00	0	T	NM_152665		67242936	67242936	+1	no_errors	ENST00000282670	ensembl	human	known	69_37n	silent	116	12.12	16	SNP	0.969	G
TCTEX1D1	200132	genome.wustl.edu	37	1	67242936	67242936	+	Silent	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr1:67242936T>G	ENST00000282670.2	+	5	467	c.339T>G	c.(337-339)gtT>gtG	p.V113V		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	113										large_intestine(2)|lung(10)|skin(1)	13						ATTTCTAGGTTATTAAAGCCC	0.338																																						dbGAP											0													77.0	80.0	79.0					1																	67242936		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.339T>G	1.37:g.67242936T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q06YR9|Q5VYE1	Silent	SNP	pfam_Tctex	p.V113	ENST00000282670.2	37	c.339	CCDS633.1	1																																																																																			TCTEX1D1	-	pfam_Tctex	ENSG00000152760		0.338	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D1	HGNC	protein_coding	OTTHUMT00000025399.2	150	0.00	0	T	NM_152665		67242936	67242936	+1	no_errors	ENST00000282670	ensembl	human	known	69_37n	silent	116	12.12	16	SNP	0.969	G
TOPBP1	11073	genome.wustl.edu	37	3	133379890	133379890	+	Missense_Mutation	SNP	C	C	T	rs74738463		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr3:133379890C>T	ENST00000260810.5	-	2	213	c.82G>A	c.(82-84)Gag>Aag	p.E28K	TFP1_ENST00000460564.1_RNA	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	28					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						ACTCTTACCTCGAGAGCTTTA	0.299								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	dbGAP											0													37.0	32.0	34.0					3																	133379890		1567	3580	5147	-	-	-	SO:0001583	missense	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.82G>A	3.37:g.133379890C>T	ENSP00000260810:p.Glu28Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.E28K	ENST00000260810.5	37	c.82	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730119	0.69074	.	.	ENSG00000163781	ENST00000260810	T	0.13196	2.61	5.64	4.77	0.60923	.	0.052961	0.64402	D	0.000001	T	0.13243	0.0321	L	0.50333	1.59	0.54753	D	0.999982	B	0.28233	0.204	B	0.17979	0.02	T	0.05115	-1.0905	10	0.24483	T	0.36	.	13.4871	0.61373	0.0:0.9231:0.0:0.0769	.	28	Q92547	TOPB1_HUMAN	K	28	ENSP00000260810:E28K	ENSP00000260810:E28K	E	-	1	0	TOPBP1	134862580	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.983000	0.70540	1.387000	0.46486	0.655000	0.94253	GAG	TOPBP1	-	NULL	ENSG00000163781		0.299	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	63	0.00	0	C	NM_007027		133379890	133379890	-1	no_errors	ENST00000260810	ensembl	human	known	69_37n	missense	218	18.05	48	SNP	1.000	T
TOPBP1	11073	genome.wustl.edu	37	3	133379890	133379890	+	Missense_Mutation	SNP	C	C	T	rs74738463		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr3:133379890C>T	ENST00000260810.5	-	2	213	c.82G>A	c.(82-84)Gag>Aag	p.E28K	TFP1_ENST00000460564.1_RNA	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	28					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						ACTCTTACCTCGAGAGCTTTA	0.299								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	dbGAP											0													37.0	32.0	34.0					3																	133379890		1567	3580	5147	-	-	-	SO:0001583	missense	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.82G>A	3.37:g.133379890C>T	ENSP00000260810:p.Glu28Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.E28K	ENST00000260810.5	37	c.82	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730119	0.69074	.	.	ENSG00000163781	ENST00000260810	T	0.13196	2.61	5.64	4.77	0.60923	.	0.052961	0.64402	D	0.000001	T	0.13243	0.0321	L	0.50333	1.59	0.54753	D	0.999982	B	0.28233	0.204	B	0.17979	0.02	T	0.05115	-1.0905	10	0.24483	T	0.36	.	13.4871	0.61373	0.0:0.9231:0.0:0.0769	.	28	Q92547	TOPB1_HUMAN	K	28	ENSP00000260810:E28K	ENSP00000260810:E28K	E	-	1	0	TOPBP1	134862580	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.983000	0.70540	1.387000	0.46486	0.655000	0.94253	GAG	TOPBP1	-	NULL	ENSG00000163781		0.299	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	157	0.00	0	C	NM_007027		133379890	133379890	-1	no_errors	ENST00000260810	ensembl	human	known	69_37n	missense	218	18.05	48	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578478	7578478	+	Missense_Mutation	SNP	G	G	T	rs137852790|rs137852791		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr17:7578478G>T	ENST00000269305.4	-	5	641	c.452C>A	c.(451-453)cCc>cAc	p.P151H	TP53_ENST00000445888.2_Missense_Mutation_p.P151H|TP53_ENST00000455263.2_Missense_Mutation_p.P151H|TP53_ENST00000420246.2_Missense_Mutation_p.P151H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.P151H|TP53_ENST00000359597.4_Missense_Mutation_p.P151H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151H(31)|p.P151R(9)|p.0?(8)|p.P151L(7)|p.T150fs*16(6)|p.?(5)|p.P58H(2)|p.P19H(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*28(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P58R(1)|p.Q144_G154del11(1)|p.P19R(1)|p.Q144fs*16(1)|p.P152fs*14(1)|p.P151fs*30(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCGGGCGGGGGTGTGGAATC	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	90	Substitution - Missense(53)|Deletion - Frameshift(14)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(2)	lung(17)|large_intestine(13)|ovary(10)|skin(8)|oesophagus(8)|breast(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|central_nervous_system(4)|bone(4)|upper_aerodigestive_tract(3)|soft_tissue(2)|urinary_tract(2)|liver(2)|vulva(1)											54.0	55.0	55.0					17																	7578478		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.452C>A	17.37:g.7578478G>T	ENSP00000269305:p.Pro151His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P151H	ENST00000269305.4	37	c.452	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040562	0.55003	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99887	-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99891	0.9948	M	0.91406	3.205	0.53688	D	0.999972	D;P;D;P;P;P;D	0.89917	0.99;0.807;1.0;0.793;0.948;0.84;1.0	P;P;D;P;P;P;D	0.97110	0.84;0.754;0.995;0.625;0.841;0.868;1.0	D	0.96236	0.9172	10	0.87932	D	0	-14.1156	12.4691	0.55777	0.0812:0.0:0.9188:0.0	.	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151H;ENSP00000352610:P151H;ENSP00000269305:P151H;ENSP00000398846:P151H;ENSP00000391127:P151H;ENSP00000391478:P151H;ENSP00000425104:P19H;ENSP00000423862:P58H;ENSP00000424104:P151H	ENSP00000269305:P151H	P	-	2	0	TP53	7519203	1.000000	0.71417	0.974000	0.42286	0.058000	0.15608	6.711000	0.74675	1.515000	0.48885	0.655000	0.94253	CCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	105	0.00	0	G	NM_000546		7578478	7578478	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.999	T
TP53	7157	genome.wustl.edu	37	17	7578478	7578478	+	Missense_Mutation	SNP	G	G	T	rs137852790|rs137852791		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr17:7578478G>T	ENST00000269305.4	-	5	641	c.452C>A	c.(451-453)cCc>cAc	p.P151H	TP53_ENST00000445888.2_Missense_Mutation_p.P151H|TP53_ENST00000455263.2_Missense_Mutation_p.P151H|TP53_ENST00000420246.2_Missense_Mutation_p.P151H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.P151H|TP53_ENST00000359597.4_Missense_Mutation_p.P151H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151H(31)|p.P151R(9)|p.0?(8)|p.P151L(7)|p.T150fs*16(6)|p.?(5)|p.P58H(2)|p.P19H(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*28(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P58R(1)|p.Q144_G154del11(1)|p.P19R(1)|p.Q144fs*16(1)|p.P152fs*14(1)|p.P151fs*30(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCGGGCGGGGGTGTGGAATC	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	90	Substitution - Missense(53)|Deletion - Frameshift(14)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(2)	lung(17)|large_intestine(13)|ovary(10)|skin(8)|oesophagus(8)|breast(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|central_nervous_system(4)|bone(4)|upper_aerodigestive_tract(3)|soft_tissue(2)|urinary_tract(2)|liver(2)|vulva(1)											54.0	55.0	55.0					17																	7578478		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.452C>A	17.37:g.7578478G>T	ENSP00000269305:p.Pro151His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P151H	ENST00000269305.4	37	c.452	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040562	0.55003	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99887	-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99891	0.9948	M	0.91406	3.205	0.53688	D	0.999972	D;P;D;P;P;P;D	0.89917	0.99;0.807;1.0;0.793;0.948;0.84;1.0	P;P;D;P;P;P;D	0.97110	0.84;0.754;0.995;0.625;0.841;0.868;1.0	D	0.96236	0.9172	10	0.87932	D	0	-14.1156	12.4691	0.55777	0.0812:0.0:0.9188:0.0	.	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151H;ENSP00000352610:P151H;ENSP00000269305:P151H;ENSP00000398846:P151H;ENSP00000391127:P151H;ENSP00000391478:P151H;ENSP00000425104:P19H;ENSP00000423862:P58H;ENSP00000424104:P151H	ENSP00000269305:P151H	P	-	2	0	TP53	7519203	1.000000	0.71417	0.974000	0.42286	0.058000	0.15608	6.711000	0.74675	1.515000	0.48885	0.655000	0.94253	CCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	106	0.00	0	G	NM_000546		7578478	7578478	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.999	T
USP54	159195	genome.wustl.edu	37	10	75264684	75264684	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr10:75264684A>G	ENST00000339859.4	-	21	4335	c.4235T>C	c.(4234-4236)tTa>tCa	p.L1412S	RP11-137L10.6_ENST00000593790.1_RNA|USP54_ENST00000394811.2_Intron|RP11-137L10.6_ENST00000595935.1_RNA|USP54_ENST00000428547.1_Missense_Mutation_p.L1262S|RP11-137L10.6_ENST00000597958.1_RNA|USP54_ENST00000408019.1_Missense_Mutation_p.L1412S|RP11-137L10.6_ENST00000596320.1_RNA|RP11-137L10.6_ENST00000600607.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|RP11-137L10.6_ENST00000442133.4_RNA|RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000422491.2_Intron			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1412					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					GATGCGACGTAAATTCTCTGC	0.517																																					Colon(195;880 2046 8854 25025 38456)	dbGAP											0													187.0	141.0	156.0					10																	75264684		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.4235T>C	10.37:g.75264684A>G	ENSP00000345216:p.Leu1412Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L1412S	ENST00000339859.4	37	c.4235	CCDS7329.2	10	.	.	.	.	.	.	.	.	.	.	A	15.74	2.923675	0.52653	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547	T;T;T	0.36340	1.26;1.26;1.26	5.5	3.12	0.35913	.	.	.	.	.	T	0.26048	0.0635	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.05616	-1.0874	9	0.87932	D	0	0.0014	7.3556	0.26717	0.8007:0.0:0.0703:0.129	.	1412	Q70EL1	UBP54_HUMAN	S	1412;1412;1262	ENSP00000345216:L1412S;ENSP00000386080:L1412S;ENSP00000408714:L1262S	ENSP00000345216:L1412S	L	-	2	0	USP54	74934690	1.000000	0.71417	0.351000	0.25721	0.970000	0.65996	3.941000	0.56607	0.365000	0.24400	0.467000	0.42956	TTA	USP54	-	NULL	ENSG00000166348		0.517	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP54	HGNC	protein_coding	OTTHUMT00000316563.2	261	0.00	0	A	NM_152586		75264684	75264684	-1	no_errors	ENST00000339859	ensembl	human	known	69_37n	missense	108	26.53	39	SNP	0.920	G
VAC14	55697	genome.wustl.edu	37	16	70818087	70818087	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr16:70818087T>G	ENST00000261776.5	-	5	783	c.523A>C	c.(523-525)Agc>Cgc	p.S175R		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	175					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GGGATGAAGCTCACCAGGTCA	0.552																																						dbGAP											0													102.0	77.0	86.0					16																	70818087		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.523A>C	16.37:g.70818087T>G	ENSP00000261776:p.Ser175Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_DUF3434,pfam_HEAT,superfamily_ARM-type_fold	p.S175R	ENST00000261776.5	37	c.523	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	T	13.99	2.402560	0.42613	.	.	ENSG00000103043	ENST00000261776	D	0.96967	-4.19	5.9	0.993	0.19825	Armadillo-like helical (1);Armadillo-type fold (1);	0.194028	0.53938	D	0.000044	D	0.88507	0.6455	N	0.05441	-0.05	0.80722	D	1	P	0.41041	0.736	B	0.38803	0.282	D	0.83543	0.0097	10	0.16896	T	0.51	-22.359	12.17	0.54152	0.0:0.6321:0.0:0.3679	.	175	Q08AM6	VAC14_HUMAN	R	175	ENSP00000261776:S175R	ENSP00000261776:S175R	S	-	1	0	VAC14	69375588	0.998000	0.40836	0.972000	0.41901	0.876000	0.50452	0.845000	0.27668	0.378000	0.24764	-0.182000	0.12963	AGC	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.552	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	75	0.00	0	T	NM_018052		70818087	70818087	-1	no_errors	ENST00000261776	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.939	G
VAC14	55697	genome.wustl.edu	37	16	70818087	70818087	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr16:70818087T>G	ENST00000261776.5	-	5	783	c.523A>C	c.(523-525)Agc>Cgc	p.S175R		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	175					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GGGATGAAGCTCACCAGGTCA	0.552																																						dbGAP											0													102.0	77.0	86.0					16																	70818087		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.523A>C	16.37:g.70818087T>G	ENSP00000261776:p.Ser175Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_DUF3434,pfam_HEAT,superfamily_ARM-type_fold	p.S175R	ENST00000261776.5	37	c.523	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	T	13.99	2.402560	0.42613	.	.	ENSG00000103043	ENST00000261776	D	0.96967	-4.19	5.9	0.993	0.19825	Armadillo-like helical (1);Armadillo-type fold (1);	0.194028	0.53938	D	0.000044	D	0.88507	0.6455	N	0.05441	-0.05	0.80722	D	1	P	0.41041	0.736	B	0.38803	0.282	D	0.83543	0.0097	10	0.16896	T	0.51	-22.359	12.17	0.54152	0.0:0.6321:0.0:0.3679	.	175	Q08AM6	VAC14_HUMAN	R	175	ENSP00000261776:S175R	ENSP00000261776:S175R	S	-	1	0	VAC14	69375588	0.998000	0.40836	0.972000	0.41901	0.876000	0.50452	0.845000	0.27668	0.378000	0.24764	-0.182000	0.12963	AGC	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.552	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	117	0.00	0	T	NM_018052		70818087	70818087	-1	no_errors	ENST00000261776	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.939	G
VPS4B	9525	genome.wustl.edu	37	18	61064481	61064481	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr18:61064481T>G	ENST00000238497.5	-	9	1081	c.878A>C	c.(877-879)gAg>gCg	p.E293A	VPS4B_ENST00000591383.1_5'Flank	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	293					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						AATTCGTTTCTCAAATCTTAA	0.388																																						dbGAP											0													32.0	34.0	33.0					18																	61064481		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.878A>C	18.37:g.61064481T>G	ENSP00000238497:p.Glu293Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69HW4|Q9GZS7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_MIT,smart_AAA+_ATPase	p.E293A	ENST00000238497.5	37	c.878	CCDS11983.1	18	.	.	.	.	.	.	.	.	.	.	T	28.7	4.946405	0.92593	.	.	ENSG00000119541	ENST00000238497	D	0.94862	-3.54	6.17	6.17	0.99709	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.95579	0.8563	L	0.35542	1.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96301	0.9221	10	0.87932	D	0	-34.2223	16.8222	0.85835	0.0:0.0:0.0:1.0	.	293;293;293	A8K5D8;A8K4G7;O75351	.;.;VPS4B_HUMAN	A	293	ENSP00000238497:E293A	ENSP00000238497:E293A	E	-	2	0	VPS4B	59215461	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.006000	0.88564	2.371000	0.80710	0.533000	0.62120	GAG	VPS4B	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000119541		0.388	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4B	HGNC	protein_coding	OTTHUMT00000256198.2	103	0.00	0	T	NM_004869		61064481	61064481	-1	no_errors	ENST00000238497	ensembl	human	known	69_37n	missense	118	18.62	27	SNP	1.000	G
VPS4B	9525	genome.wustl.edu	37	18	61064481	61064481	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr18:61064481T>G	ENST00000238497.5	-	9	1081	c.878A>C	c.(877-879)gAg>gCg	p.E293A	VPS4B_ENST00000591383.1_5'Flank	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	293					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						AATTCGTTTCTCAAATCTTAA	0.388																																						dbGAP											0													32.0	34.0	33.0					18																	61064481		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.878A>C	18.37:g.61064481T>G	ENSP00000238497:p.Glu293Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69HW4|Q9GZS7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_MIT,smart_AAA+_ATPase	p.E293A	ENST00000238497.5	37	c.878	CCDS11983.1	18	.	.	.	.	.	.	.	.	.	.	T	28.7	4.946405	0.92593	.	.	ENSG00000119541	ENST00000238497	D	0.94862	-3.54	6.17	6.17	0.99709	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.95579	0.8563	L	0.35542	1.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96301	0.9221	10	0.87932	D	0	-34.2223	16.8222	0.85835	0.0:0.0:0.0:1.0	.	293;293;293	A8K5D8;A8K4G7;O75351	.;.;VPS4B_HUMAN	A	293	ENSP00000238497:E293A	ENSP00000238497:E293A	E	-	2	0	VPS4B	59215461	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.006000	0.88564	2.371000	0.80710	0.533000	0.62120	GAG	VPS4B	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000119541		0.388	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4B	HGNC	protein_coding	OTTHUMT00000256198.2	150	0.00	0	T	NM_004869		61064481	61064481	-1	no_errors	ENST00000238497	ensembl	human	known	69_37n	missense	118	18.62	27	SNP	1.000	G
WDR81	124997	genome.wustl.edu	37	17	1630714	1630714	+	Missense_Mutation	SNP	G	G	A	rs572270076		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr17:1630714G>A	ENST00000409644.1	+	1	2461	c.2461G>A	c.(2461-2463)Gtg>Atg	p.V821M	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000309182.5_Intron|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000419248.1_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	821					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TTTGCAGCCCGTGCTGGACAC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		19339	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													26.0	30.0	29.0					17																	1630714		692	1589	2281	-	-	-	SO:0001583	missense	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.2461G>A	17.37:g.1630714G>A	ENSP00000386609:p.Val821Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V821M	ENST00000409644.1	37	c.2461	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	G	8.400	0.841678	0.16963	.	.	ENSG00000167716	ENST00000409644	T	0.54675	0.56	5.68	2.65	0.31530	.	.	.	.	.	T	0.53142	0.1778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47235	-0.9133	6	0.46703	T	0.11	.	5.6384	0.17550	0.2816:0.1308:0.5875:0.0	.	.	.	.	M	821	ENSP00000386609:V821M	ENSP00000386609:V821M	V	+	1	0	WDR81	1577464	0.943000	0.32029	0.949000	0.38748	0.541000	0.35023	1.466000	0.35310	0.355000	0.24131	-0.266000	0.10368	GTG	WDR81	-	NULL	ENSG00000167716		0.642	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2	29	0.00	0	G	NM_152348		1630714	1630714	+1	no_errors	ENST00000409644	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.982	A
WDR81	124997	genome.wustl.edu	37	17	1630714	1630714	+	Missense_Mutation	SNP	G	G	A	rs572270076		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr17:1630714G>A	ENST00000409644.1	+	1	2461	c.2461G>A	c.(2461-2463)Gtg>Atg	p.V821M	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000309182.5_Intron|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000419248.1_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	821					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TTTGCAGCCCGTGCTGGACAC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		19339	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													26.0	30.0	29.0					17																	1630714		692	1589	2281	-	-	-	SO:0001583	missense	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.2461G>A	17.37:g.1630714G>A	ENSP00000386609:p.Val821Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V821M	ENST00000409644.1	37	c.2461	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	G	8.400	0.841678	0.16963	.	.	ENSG00000167716	ENST00000409644	T	0.54675	0.56	5.68	2.65	0.31530	.	.	.	.	.	T	0.53142	0.1778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47235	-0.9133	6	0.46703	T	0.11	.	5.6384	0.17550	0.2816:0.1308:0.5875:0.0	.	.	.	.	M	821	ENSP00000386609:V821M	ENSP00000386609:V821M	V	+	1	0	WDR81	1577464	0.943000	0.32029	0.949000	0.38748	0.541000	0.35023	1.466000	0.35310	0.355000	0.24131	-0.266000	0.10368	GTG	WDR81	-	NULL	ENSG00000167716		0.642	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2	24	0.00	0	G	NM_152348		1630714	1630714	+1	no_errors	ENST00000409644	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.982	A
ZAN	7455	genome.wustl.edu	37	7	100349832	100349832	+	RNA	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr7:100349832G>T	ENST00000348028.3	+	0	2269				ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTCCATGGAAGAGACTATCAT	0.512																																						dbGAP											0													188.0	206.0	200.0					7																	100349832		1852	4093	5945	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349832G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.E702*	ENST00000348028.3	37	c.2104		7	.	.	.	.	.	.	.	.	.	.	g	27.7	4.851716	0.91355	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	.	.	.	2.93	-4.11	0.03928	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	5.3407	0.15982	0.5507:0.1504:0.2989:0.0	.	.	.	.	X	702	.	ENSP00000423579:E702X	E	+	1	0	ZAN	100187768	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.980000	0.03770	-0.901000	0.03891	-0.336000	0.08194	GAG	ZAN	-	NULL	ENSG00000146839		0.512	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	427	0.00	0	G	NM_003386		100349832	100349832	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	nonsense	956	25.55	328	SNP	0.000	T
ZAN	7455	genome.wustl.edu	37	7	100349832	100349832	+	RNA	SNP	G	G	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr7:100349832G>T	ENST00000348028.3	+	0	2269				ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTCCATGGAAGAGACTATCAT	0.512																																						dbGAP											0													188.0	206.0	200.0					7																	100349832		1852	4093	5945	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349832G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.E702*	ENST00000348028.3	37	c.2104		7	.	.	.	.	.	.	.	.	.	.	g	27.7	4.851716	0.91355	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	.	.	.	2.93	-4.11	0.03928	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	5.3407	0.15982	0.5507:0.1504:0.2989:0.0	.	.	.	.	X	702	.	ENSP00000423579:E702X	E	+	1	0	ZAN	100187768	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.980000	0.03770	-0.901000	0.03891	-0.336000	0.08194	GAG	ZAN	-	NULL	ENSG00000146839		0.512	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	668	0.00	0	G	NM_003386		100349832	100349832	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	nonsense	956	25.55	328	SNP	0.000	T
ZNF215	7762	genome.wustl.edu	37	11	6977547	6977547	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr11:6977547A>T	ENST00000278319.5	+	7	1927	c.1339A>T	c.(1339-1341)Agt>Tgt	p.S447C	ZNF215_ENST00000529903.1_Intron|ZNF215_ENST00000414517.2_Missense_Mutation_p.S447C	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	447					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CTTCAGTAAAAGTGAAGACAG	0.393																																						dbGAP											0													87.0	87.0	87.0					11																	6977547		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1339A>T	11.37:g.6977547A>T	ENSP00000278319:p.Ser447Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S447C	ENST00000278319.5	37	c.1339	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	A	6.466	0.454065	0.12283	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.61742	0.08;0.08	4.76	2.47	0.30058	.	0.858218	0.09959	N	0.733694	T	0.56381	0.1981	L	0.49126	1.545	0.09310	N	1	D	0.63880	0.993	P	0.49999	0.628	T	0.46498	-0.9187	10	0.72032	D	0.01	1.0638	4.8097	0.13337	0.6872:0.211:0.1018:0.0	.	447	Q9UL58	ZN215_HUMAN	C	447	ENSP00000278319:S447C;ENSP00000393202:S447C	ENSP00000278319:S447C	S	+	1	0	ZNF215	6934123	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.137000	0.10389	0.439000	0.26476	0.482000	0.46254	AGT	ZNF215	-	NULL	ENSG00000149054		0.393	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	107	0.00	0	A			6977547	6977547	+1	no_errors	ENST00000278319	ensembl	human	known	69_37n	missense	143	10.62	17	SNP	0.000	T
ZNF215	7762	genome.wustl.edu	37	11	6977547	6977547	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr11:6977547A>T	ENST00000278319.5	+	7	1927	c.1339A>T	c.(1339-1341)Agt>Tgt	p.S447C	ZNF215_ENST00000529903.1_Intron|ZNF215_ENST00000414517.2_Missense_Mutation_p.S447C	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	447					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CTTCAGTAAAAGTGAAGACAG	0.393																																						dbGAP											0													87.0	87.0	87.0					11																	6977547		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1339A>T	11.37:g.6977547A>T	ENSP00000278319:p.Ser447Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S447C	ENST00000278319.5	37	c.1339	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	A	6.466	0.454065	0.12283	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.61742	0.08;0.08	4.76	2.47	0.30058	.	0.858218	0.09959	N	0.733694	T	0.56381	0.1981	L	0.49126	1.545	0.09310	N	1	D	0.63880	0.993	P	0.49999	0.628	T	0.46498	-0.9187	10	0.72032	D	0.01	1.0638	4.8097	0.13337	0.6872:0.211:0.1018:0.0	.	447	Q9UL58	ZN215_HUMAN	C	447	ENSP00000278319:S447C;ENSP00000393202:S447C	ENSP00000278319:S447C	S	+	1	0	ZNF215	6934123	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.137000	0.10389	0.439000	0.26476	0.482000	0.46254	AGT	ZNF215	-	NULL	ENSG00000149054		0.393	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	204	0.00	0	A			6977547	6977547	+1	no_errors	ENST00000278319	ensembl	human	known	69_37n	missense	143	10.62	17	SNP	0.000	T
ZNF251	90987	genome.wustl.edu	37	8	145948698	145948698	+	Frame_Shift_Del	DEL	G	G	-	rs534759151		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	10add567-cef4-464f-98a7-23a153bc1c40	g.chr8:145948698delG	ENST00000292562.7	-	5	622	c.347delC	c.(346-348)ccafs	p.P116fs	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		TACAAATTCTGGGGTTTTTAC	0.408																																						dbGAP											0													17.0	18.0	17.0					8																	145948698		1789	4061	5850	-	-	-	SO:0001589	frameshift_variant	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.347delC	8.37:g.145948698delG	ENSP00000292562:p.Pro116fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M219	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P116fs	ENST00000292562.7	37	c.347	CCDS47944.1	8																																																																																			ZNF251	-	NULL	ENSG00000198169		0.408	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	45	0.00	0	G	NM_138367		145948698	145948698	-1	no_errors	ENST00000292562	ensembl	human	known	69_37n	frame_shift_del	49	13.79	8	DEL	0.130	-
ZNF251	90987	genome.wustl.edu	37	8	145948698	145948698	+	Frame_Shift_Del	DEL	G	G	-	rs534759151		TCGA-BH-A0BL-01A-11D-A10Y-09	TCGA-BH-A0BL-11A-12D-A10Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1eb22fbe-6108-46c9-b51b-814861c3e104	c02df4df-aa5a-4e13-b0a6-5a4d46e4f474	g.chr8:145948698delG	ENST00000292562.7	-	5	622	c.347delC	c.(346-348)ccafs	p.P116fs	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		TACAAATTCTGGGGTTTTTAC	0.408																																						dbGAP											0													17.0	18.0	17.0					8																	145948698		1789	4061	5850	-	-	-	SO:0001589	frameshift_variant	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.347delC	8.37:g.145948698delG	ENSP00000292562:p.Pro116fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M219	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P116fs	ENST00000292562.7	37	c.347	CCDS47944.1	8																																																																																			ZNF251	-	NULL	ENSG00000198169		0.408	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	23	0.00	0	G	NM_138367		145948698	145948698	-1	no_errors	ENST00000292562	ensembl	human	known	69_37n	frame_shift_del	49	13.79	8	DEL	0.130	-
