#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS6	11174	genome.wustl.edu	37	5	64747324	64747324	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr5:64747324C>T	ENST00000536360.1	-	7	1864	c.1051G>A	c.(1051-1053)Gat>Aat	p.D351N				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	351	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		ACTGCATTATCGTGGTGGGCA	0.378																																						dbGAP											0													180.0	163.0	168.0					5																	64747324		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.1051G>A	5.37:g.64747324C>T	ENSP00000440995:p.Asp351Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.D351N	ENST00000536360.1	37	c.1051		5	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715189	0.89112	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	D;D;D	0.91945	-2.94;-2.94;-2.94	5.13	5.13	0.70059	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.96787	0.8951	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97395	0.9992	10	0.87932	D	0	.	18.9372	0.92590	0.0:1.0:0.0:0.0	.	351	Q9UKP5	ATS6_HUMAN	N	351	ENSP00000370443:D351N;ENSP00000423551:D351N;ENSP00000440995:D351N	ENSP00000261306:D351N	D	-	1	0	ADAMTS6	64783080	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.548000	0.85928	0.655000	0.94253	GAT	ADAMTS6	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000049192		0.378	ADAMTS6-201	KNOWN	basic	protein_coding	ADAMTS6	HGNC	protein_coding		522	0.00	0	C	NM_197941		64747324	64747324	-1	no_errors	ENST00000381055	ensembl	human	known	69_37n	missense	385	16.41	76	SNP	1.000	T
ADAMTS6	11174	genome.wustl.edu	37	5	64747324	64747324	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr5:64747324C>T	ENST00000536360.1	-	7	1864	c.1051G>A	c.(1051-1053)Gat>Aat	p.D351N				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	351	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		ACTGCATTATCGTGGTGGGCA	0.378																																						dbGAP											0													180.0	163.0	168.0					5																	64747324		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.1051G>A	5.37:g.64747324C>T	ENSP00000440995:p.Asp351Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.D351N	ENST00000536360.1	37	c.1051		5	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715189	0.89112	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	D;D;D	0.91945	-2.94;-2.94;-2.94	5.13	5.13	0.70059	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.96787	0.8951	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97395	0.9992	10	0.87932	D	0	.	18.9372	0.92590	0.0:1.0:0.0:0.0	.	351	Q9UKP5	ATS6_HUMAN	N	351	ENSP00000370443:D351N;ENSP00000423551:D351N;ENSP00000440995:D351N	ENSP00000261306:D351N	D	-	1	0	ADAMTS6	64783080	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.548000	0.85928	0.655000	0.94253	GAT	ADAMTS6	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000049192		0.378	ADAMTS6-201	KNOWN	basic	protein_coding	ADAMTS6	HGNC	protein_coding		529	0.00	0	C	NM_197941		64747324	64747324	-1	no_errors	ENST00000381055	ensembl	human	known	69_37n	missense	385	16.41	76	SNP	1.000	T
ADAMTSL5	339366	genome.wustl.edu	37	19	1507614	1507614	+	Silent	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr19:1507614G>A	ENST00000413997.2	-	8	659	c.660C>T	c.(658-660)acC>acT	p.T220T	ADAMTSL5_ENST00000330475.4_Silent_p.T210T|ADAMTSL5_ENST00000590562.1_5'UTR|ADAMTSL5_ENST00000395467.2_5'UTR|CTB-25B13.9_ENST00000590252.1_RNA			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	220						extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGGATCAGGGTCACGTTCC	0.622																																						dbGAP											0													56.0	49.0	51.0					19																	1507614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.660C>T	19.37:g.1507614G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXK7|Q8IW95	Silent	SNP	pfam_ADAM_spacer1,pfam_Netrin_module_non-TIMP,pfam_Thrombospondin_1_rpt,superfamily_TIMP-like_OB-fold,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain,pfscan_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS	p.T220	ENST00000413997.2	37	c.660		19																																																																																			ADAMTSL5	-	pfam_ADAM_spacer1	ENSG00000185761		0.622	ADAMTSL5-202	KNOWN	basic	protein_coding	ADAMTSL5	HGNC	protein_coding		53	0.00	0	G	XM_294919		1507614	1507614	-1	no_errors	ENST00000413997	ensembl	human	known	69_37n	silent	47	15.79	9	SNP	1.000	A
ADAMTSL5	339366	genome.wustl.edu	37	19	1507614	1507614	+	Silent	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr19:1507614G>A	ENST00000413997.2	-	8	659	c.660C>T	c.(658-660)acC>acT	p.T220T	ADAMTSL5_ENST00000330475.4_Silent_p.T210T|ADAMTSL5_ENST00000590562.1_5'UTR|ADAMTSL5_ENST00000395467.2_5'UTR|CTB-25B13.9_ENST00000590252.1_RNA			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	220						extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGGATCAGGGTCACGTTCC	0.622																																						dbGAP											0													56.0	49.0	51.0					19																	1507614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.660C>T	19.37:g.1507614G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXK7|Q8IW95	Silent	SNP	pfam_ADAM_spacer1,pfam_Netrin_module_non-TIMP,pfam_Thrombospondin_1_rpt,superfamily_TIMP-like_OB-fold,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain,pfscan_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS	p.T220	ENST00000413997.2	37	c.660		19																																																																																			ADAMTSL5	-	pfam_ADAM_spacer1	ENSG00000185761		0.622	ADAMTSL5-202	KNOWN	basic	protein_coding	ADAMTSL5	HGNC	protein_coding		50	0.00	0	G	XM_294919		1507614	1507614	-1	no_errors	ENST00000413997	ensembl	human	known	69_37n	silent	47	15.79	9	SNP	1.000	A
CD86	942	genome.wustl.edu	37	3	121825056	121825056	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr3:121825056C>G	ENST00000330540.2	+	4	528	c.412C>G	c.(412-414)Caa>Gaa	p.Q138E	CD86_ENST00000264468.5_Intron|CD86_ENST00000469710.1_Missense_Mutation_p.Q56E|CD86_ENST00000393627.2_Missense_Mutation_p.Q132E|CD86_ENST00000493101.1_Missense_Mutation_p.Q26E	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	138					aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	TAACTTCAGTCAACCTGAAAT	0.353																																					GBM(67;1379 1389 36064 39806)	dbGAP											0													31.0	31.0	31.0					3																	121825056		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.412C>G	3.37:g.121825056C>G	ENSP00000332049:p.Gln138Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S133*	ENST00000330540.2	37	c.398	CCDS3009.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.07|12.07	1.828831|1.828831	0.32329|0.32329	.|.	.|.	ENSG00000114013|ENSG00000114013	ENST00000469710;ENST00000493101;ENST00000330540;ENST00000482356;ENST00000393627|ENST00000478741	T;T;T;T;T|.	0.14391|.	3.36;2.51;4.55;3.7;4.55|.	5.65|5.65	3.87|3.87	0.44632|0.44632	.|.	0.118364|.	0.38663|.	N|.	0.001607|.	T|.	0.57917|.	0.2086|.	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	P;B|.	0.35155|.	0.487;0.17|.	B;B|.	0.40659|.	0.203;0.336|.	T|.	0.58792|.	-0.7574|.	10|.	0.08837|0.72032	T|D	0.75|0.01	-9.2902|-9.2902	8.2248|8.2248	0.31562|0.31562	0.1531:0.637:0.2099:0.0|0.1531:0.637:0.2099:0.0	.|.	26;138|.	E9PC27;P42081|.	.;CD86_HUMAN|.	E|X	56;26;138;132;132|133	ENSP00000418988:Q56E;ENSP00000420230:Q26E;ENSP00000332049:Q138E;ENSP00000419116:Q132E;ENSP00000377248:Q132E|.	ENSP00000332049:Q138E|ENSP00000417195:S133X	Q|S	+|+	1|2	0|0	CD86|CD86	123307746|123307746	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.864000|0.864000	0.49448|0.49448	1.184000|1.184000	0.32053|0.32053	0.937000|0.937000	0.37394|0.37394	0.655000|0.655000	0.94253|0.94253	CAA|TCA	CD86	-	NULL	ENSG00000114013		0.353	CD86-001	KNOWN	basic|CCDS	protein_coding	CD86	HGNC	protein_coding	OTTHUMT00000355671.1	114	0.00	0	C	NM_006889		121825056	121825056	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000478741	ensembl	human	novel	69_37n	nonsense	84	18.45	19	SNP	1.000	G
CD86	942	genome.wustl.edu	37	3	121825056	121825056	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr3:121825056C>G	ENST00000330540.2	+	4	528	c.412C>G	c.(412-414)Caa>Gaa	p.Q138E	CD86_ENST00000264468.5_Intron|CD86_ENST00000469710.1_Missense_Mutation_p.Q56E|CD86_ENST00000393627.2_Missense_Mutation_p.Q132E|CD86_ENST00000493101.1_Missense_Mutation_p.Q26E	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	138					aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	TAACTTCAGTCAACCTGAAAT	0.353																																					GBM(67;1379 1389 36064 39806)	dbGAP											0													31.0	31.0	31.0					3																	121825056		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.412C>G	3.37:g.121825056C>G	ENSP00000332049:p.Gln138Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S133*	ENST00000330540.2	37	c.398	CCDS3009.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.07|12.07	1.828831|1.828831	0.32329|0.32329	.|.	.|.	ENSG00000114013|ENSG00000114013	ENST00000469710;ENST00000493101;ENST00000330540;ENST00000482356;ENST00000393627|ENST00000478741	T;T;T;T;T|.	0.14391|.	3.36;2.51;4.55;3.7;4.55|.	5.65|5.65	3.87|3.87	0.44632|0.44632	.|.	0.118364|.	0.38663|.	N|.	0.001607|.	T|.	0.57917|.	0.2086|.	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	P;B|.	0.35155|.	0.487;0.17|.	B;B|.	0.40659|.	0.203;0.336|.	T|.	0.58792|.	-0.7574|.	10|.	0.08837|0.72032	T|D	0.75|0.01	-9.2902|-9.2902	8.2248|8.2248	0.31562|0.31562	0.1531:0.637:0.2099:0.0|0.1531:0.637:0.2099:0.0	.|.	26;138|.	E9PC27;P42081|.	.;CD86_HUMAN|.	E|X	56;26;138;132;132|133	ENSP00000418988:Q56E;ENSP00000420230:Q26E;ENSP00000332049:Q138E;ENSP00000419116:Q132E;ENSP00000377248:Q132E|.	ENSP00000332049:Q138E|ENSP00000417195:S133X	Q|S	+|+	1|2	0|0	CD86|CD86	123307746|123307746	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.864000|0.864000	0.49448|0.49448	1.184000|1.184000	0.32053|0.32053	0.937000|0.937000	0.37394|0.37394	0.655000|0.655000	0.94253|0.94253	CAA|TCA	CD86	-	NULL	ENSG00000114013		0.353	CD86-001	KNOWN	basic|CCDS	protein_coding	CD86	HGNC	protein_coding	OTTHUMT00000355671.1	129	0.00	0	C	NM_006889		121825056	121825056	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000478741	ensembl	human	novel	69_37n	nonsense	84	18.45	19	SNP	1.000	G
CPNE5	57699	genome.wustl.edu	37	6	36713227	36713227	+	Silent	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr6:36713227G>A	ENST00000244751.2	-	17	1890	c.1266C>T	c.(1264-1266)agC>agT	p.S422S	CPNE5_ENST00000393189.2_Silent_p.S130S|CPNE5_ENST00000459703.1_5'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	422	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						CAGTGCGCAGGCTGCGGTGGT	0.667																																						dbGAP											0													39.0	28.0	32.0					6																	36713227		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1266C>T	6.37:g.36713227G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z6C8	Silent	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.S422	ENST00000244751.2	37	c.1266	CCDS4825.1	6																																																																																			CPNE5	-	pfam_Copine,smart_VWF_A,pfscan_VWF_A	ENSG00000124772		0.667	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE5	HGNC	protein_coding	OTTHUMT00000040351.1	24	0.00	0	G	NM_020939		36713227	36713227	-1	no_errors	ENST00000244751	ensembl	human	known	69_37n	silent	32	17.50	7	SNP	1.000	A
CPNE5	57699	genome.wustl.edu	37	6	36713227	36713227	+	Silent	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr6:36713227G>A	ENST00000244751.2	-	17	1890	c.1266C>T	c.(1264-1266)agC>agT	p.S422S	CPNE5_ENST00000393189.2_Silent_p.S130S|CPNE5_ENST00000459703.1_5'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	422	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						CAGTGCGCAGGCTGCGGTGGT	0.667																																						dbGAP											0													39.0	28.0	32.0					6																	36713227		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1266C>T	6.37:g.36713227G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z6C8	Silent	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.S422	ENST00000244751.2	37	c.1266	CCDS4825.1	6																																																																																			CPNE5	-	pfam_Copine,smart_VWF_A,pfscan_VWF_A	ENSG00000124772		0.667	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE5	HGNC	protein_coding	OTTHUMT00000040351.1	26	0.00	0	G	NM_020939		36713227	36713227	-1	no_errors	ENST00000244751	ensembl	human	known	69_37n	silent	32	17.50	7	SNP	1.000	A
MICU3	286097	genome.wustl.edu	37	8	16944529	16944529	+	Silent	SNP	A	A	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr8:16944529A>G	ENST00000318063.5	+	7	876	c.834A>G	c.(832-834)gaA>gaG	p.E278E		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	278						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)										GAGATGAAGAAAAGCGTGCAA	0.294																																						dbGAP											0													99.0	108.0	105.0					8																	16944529		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.834A>G	8.37:g.16944529A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYZ3	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.K136R	ENST00000318063.5	37	c.407	CCDS5999.1	8	.	.	.	.	.	.	.	.	.	.	A	7.820	0.717544	0.15372	.	.	ENSG00000155970	ENST00000519044	.	.	.	5.46	3.05	0.35203	.	.	.	.	.	T	0.58949	0.2158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55108	-0.8192	4	.	.	.	-16.0736	9.5595	0.39360	0.8451:0.0:0.1549:0.0	.	.	.	.	R	136	.	.	K	+	2	0	EFHA2	16988900	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.198000	0.32223	1.028000	0.39785	0.477000	0.44152	AAA	EFHA2	-	NULL	ENSG00000155970		0.294	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHA2	HGNC	protein_coding	OTTHUMT00000214031.1	529	0.00	0	A	NM_181723		16944529	16944529	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519044	ensembl	human	novel	69_37n	missense	375	14.77	65	SNP	1.000	G
MICU3	286097	genome.wustl.edu	37	8	16944529	16944529	+	Silent	SNP	A	A	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr8:16944529A>G	ENST00000318063.5	+	7	876	c.834A>G	c.(832-834)gaA>gaG	p.E278E		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	278						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)										GAGATGAAGAAAAGCGTGCAA	0.294																																						dbGAP											0													99.0	108.0	105.0					8																	16944529		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.834A>G	8.37:g.16944529A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYZ3	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.K136R	ENST00000318063.5	37	c.407	CCDS5999.1	8	.	.	.	.	.	.	.	.	.	.	A	7.820	0.717544	0.15372	.	.	ENSG00000155970	ENST00000519044	.	.	.	5.46	3.05	0.35203	.	.	.	.	.	T	0.58949	0.2158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55108	-0.8192	4	.	.	.	-16.0736	9.5595	0.39360	0.8451:0.0:0.1549:0.0	.	.	.	.	R	136	.	.	K	+	2	0	EFHA2	16988900	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.198000	0.32223	1.028000	0.39785	0.477000	0.44152	AAA	EFHA2	-	NULL	ENSG00000155970		0.294	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHA2	HGNC	protein_coding	OTTHUMT00000214031.1	473	0.00	0	A	NM_181723		16944529	16944529	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519044	ensembl	human	novel	69_37n	missense	375	14.77	65	SNP	1.000	G
FAM171A1	221061	genome.wustl.edu	37	10	15290661	15290661	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr10:15290661G>A	ENST00000378116.4	-	5	737	c.731C>T	c.(730-732)gCg>gTg	p.A244V	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	244						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						AAACCGCCACGCCGCGACATA	0.552																																						dbGAP											0													79.0	73.0	75.0					10																	15290661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.731C>T	10.37:g.15290661G>A	ENSP00000367356:p.Ala244Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.A244V	ENST00000378116.4	37	c.731	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648608	0.67358	.	.	ENSG00000148468	ENST00000378116;ENST00000378114;ENST00000396781;ENST00000455654	T;T	0.33865	1.39;1.39	5.2	5.2	0.72013	.	0.053509	0.64402	D	0.000001	T	0.37785	0.1016	L	0.39085	1.19	0.80722	D	1	D	0.58620	0.983	P	0.46685	0.524	T	0.10543	-1.0625	10	0.40728	T	0.16	-22.0362	19.1283	0.93394	0.0:0.0:1.0:0.0	.	244	Q5VUB5	F1711_HUMAN	V	244;191;245;191	ENSP00000367356:A244V;ENSP00000407796:A191V	ENSP00000367354:A191V	A	-	2	0	FAM171A1	15330667	1.000000	0.71417	0.215000	0.23724	0.751000	0.42716	6.477000	0.73591	2.584000	0.87258	0.563000	0.77884	GCG	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.552	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	47	0.00	0	G	XM_167709		15290661	15290661	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	0.966	A
FAM171A1	221061	genome.wustl.edu	37	10	15290661	15290661	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr10:15290661G>A	ENST00000378116.4	-	5	737	c.731C>T	c.(730-732)gCg>gTg	p.A244V	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	244						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						AAACCGCCACGCCGCGACATA	0.552																																						dbGAP											0													79.0	73.0	75.0					10																	15290661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.731C>T	10.37:g.15290661G>A	ENSP00000367356:p.Ala244Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.A244V	ENST00000378116.4	37	c.731	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648608	0.67358	.	.	ENSG00000148468	ENST00000378116;ENST00000378114;ENST00000396781;ENST00000455654	T;T	0.33865	1.39;1.39	5.2	5.2	0.72013	.	0.053509	0.64402	D	0.000001	T	0.37785	0.1016	L	0.39085	1.19	0.80722	D	1	D	0.58620	0.983	P	0.46685	0.524	T	0.10543	-1.0625	10	0.40728	T	0.16	-22.0362	19.1283	0.93394	0.0:0.0:1.0:0.0	.	244	Q5VUB5	F1711_HUMAN	V	244;191;245;191	ENSP00000367356:A244V;ENSP00000407796:A191V	ENSP00000367354:A191V	A	-	2	0	FAM171A1	15330667	1.000000	0.71417	0.215000	0.23724	0.751000	0.42716	6.477000	0.73591	2.584000	0.87258	0.563000	0.77884	GCG	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.552	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	49	0.00	0	G	XM_167709		15290661	15290661	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	0.966	A
FAM182A	284800	genome.wustl.edu	37	20	26063548	26063548	+	RNA	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr20:26063548G>A	ENST00000376398.2	+	0	1065					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						TCAGAGTGAGGAATGGAGTTG	0.418																																						dbGAP											0													57.0	43.0	48.0					20																	26063548		686	1501	2187	-	-	-			0			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26063548G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRD0|Q8N947	Missense_Mutation	SNP	NULL	p.E133K	ENST00000376398.2	37	c.397		20	.	.	.	.	.	.	.	.	.	.	N	6.827	0.521665	0.13005	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.329	0.329	0.15924	.	.	.	.	.	T	0.23688	0.0573	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28808	-1.0032	4	0.21014	T	0.42	.	.	.	.	.	.	.	.	K	133	.	ENSP00000246000:E133K	E	+	1	0	FAM182A	26011548	0.410000	0.25376	0.039000	0.18376	0.027000	0.11550	0.196000	0.17176	0.446000	0.26666	0.123000	0.15791	GAA	FAM182A	-	NULL	ENSG00000125804		0.418	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	HGNC	processed_transcript	OTTHUMT00000078473.2	335	0.00	0	G			26063548	26063548	+1	no_errors	ENST00000246000	ensembl	human	known	69_37n	missense	277	13.44	43	SNP	0.051	A
FAM182A	284800	genome.wustl.edu	37	20	26063548	26063548	+	RNA	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr20:26063548G>A	ENST00000376398.2	+	0	1065					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						TCAGAGTGAGGAATGGAGTTG	0.418																																						dbGAP											0													57.0	43.0	48.0					20																	26063548		686	1501	2187	-	-	-			0			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26063548G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRD0|Q8N947	Missense_Mutation	SNP	NULL	p.E133K	ENST00000376398.2	37	c.397		20	.	.	.	.	.	.	.	.	.	.	N	6.827	0.521665	0.13005	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.329	0.329	0.15924	.	.	.	.	.	T	0.23688	0.0573	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28808	-1.0032	4	0.21014	T	0.42	.	.	.	.	.	.	.	.	K	133	.	ENSP00000246000:E133K	E	+	1	0	FAM182A	26011548	0.410000	0.25376	0.039000	0.18376	0.027000	0.11550	0.196000	0.17176	0.446000	0.26666	0.123000	0.15791	GAA	FAM182A	-	NULL	ENSG00000125804		0.418	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	HGNC	processed_transcript	OTTHUMT00000078473.2	316	0.00	0	G			26063548	26063548	+1	no_errors	ENST00000246000	ensembl	human	known	69_37n	missense	277	13.44	43	SNP	0.051	A
GTF2F2	2963	genome.wustl.edu	37	13	45694797	45694797	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr13:45694797G>A	ENST00000340473.6	+	1	148	c.7G>A	c.(7-9)Gag>Aag	p.E3K	7SK_ENST00000606815.1_RNA	NM_004128.2	NP_004119.1	P13984	T2FB_HUMAN	general transcription factor IIF, polypeptide 2, 30kDa	3					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|prostate(1)|upper_aerodigestive_tract(1)	10		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)		ACCCATGGCCGAGCGCGGGGA	0.647																																						dbGAP											0													25.0	20.0	22.0					13																	45694797		2155	4210	6365	-	-	-	SO:0001583	missense	0			X16901	CCDS9395.1	13q14	2012-01-23	2002-08-29		ENSG00000188342	ENSG00000188342		"""General transcription factors"""	4653	protein-coding gene	gene with protein product		189969	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			8162052	Standard	NM_004128		Approved	TFIIF, BTF4, RAP30	uc001uzw.3	P13984	OTTHUMG00000016849	ENST00000340473.6:c.7G>A	13.37:g.45694797G>A	ENSP00000340823:p.Glu3Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNS5|Q5W0H3	Missense_Mutation	SNP	pfam_TFIIF_beta,superfamily_TFIIF_interaction,pirsf_TFIIF-beta_subgr	p.E3K	ENST00000340473.6	37	c.7	CCDS9395.1	13	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216250	0.58452	.	.	ENSG00000188342	ENST00000340473	.	.	.	5.53	5.53	0.82687	Transcription Factor IIF, Rap30/Rap74, interaction (1);	0.277991	0.41938	N	0.000791	T	0.39600	0.1084	N	0.11427	0.14	0.50039	D	0.999845	B	0.02656	0.0	B	0.01281	0.0	T	0.18023	-1.0350	9	0.38643	T	0.18	-11.8134	14.8344	0.70172	0.0:0.0:1.0:0.0	.	3	P13984	T2FB_HUMAN	K	3	.	ENSP00000340823:E3K	E	+	1	0	GTF2F2	44592797	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	4.787000	0.62432	2.882000	0.98803	0.655000	0.94253	GAG	GTF2F2	-	superfamily_TFIIF_interaction,pirsf_TFIIF-beta_subgr	ENSG00000188342		0.647	GTF2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F2	HGNC	protein_coding	OTTHUMT00000044767.2	30	0.00	0	G	NM_004128		45694797	45694797	+1	no_errors	ENST00000340473	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	A
GTF2F2	2963	genome.wustl.edu	37	13	45694797	45694797	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr13:45694797G>A	ENST00000340473.6	+	1	148	c.7G>A	c.(7-9)Gag>Aag	p.E3K	7SK_ENST00000606815.1_RNA	NM_004128.2	NP_004119.1	P13984	T2FB_HUMAN	general transcription factor IIF, polypeptide 2, 30kDa	3					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|prostate(1)|upper_aerodigestive_tract(1)	10		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)		ACCCATGGCCGAGCGCGGGGA	0.647																																						dbGAP											0													25.0	20.0	22.0					13																	45694797		2155	4210	6365	-	-	-	SO:0001583	missense	0			X16901	CCDS9395.1	13q14	2012-01-23	2002-08-29		ENSG00000188342	ENSG00000188342		"""General transcription factors"""	4653	protein-coding gene	gene with protein product		189969	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			8162052	Standard	NM_004128		Approved	TFIIF, BTF4, RAP30	uc001uzw.3	P13984	OTTHUMG00000016849	ENST00000340473.6:c.7G>A	13.37:g.45694797G>A	ENSP00000340823:p.Glu3Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNS5|Q5W0H3	Missense_Mutation	SNP	pfam_TFIIF_beta,superfamily_TFIIF_interaction,pirsf_TFIIF-beta_subgr	p.E3K	ENST00000340473.6	37	c.7	CCDS9395.1	13	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216250	0.58452	.	.	ENSG00000188342	ENST00000340473	.	.	.	5.53	5.53	0.82687	Transcription Factor IIF, Rap30/Rap74, interaction (1);	0.277991	0.41938	N	0.000791	T	0.39600	0.1084	N	0.11427	0.14	0.50039	D	0.999845	B	0.02656	0.0	B	0.01281	0.0	T	0.18023	-1.0350	9	0.38643	T	0.18	-11.8134	14.8344	0.70172	0.0:0.0:1.0:0.0	.	3	P13984	T2FB_HUMAN	K	3	.	ENSP00000340823:E3K	E	+	1	0	GTF2F2	44592797	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	4.787000	0.62432	2.882000	0.98803	0.655000	0.94253	GAG	GTF2F2	-	superfamily_TFIIF_interaction,pirsf_TFIIF-beta_subgr	ENSG00000188342		0.647	GTF2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F2	HGNC	protein_coding	OTTHUMT00000044767.2	32	0.00	0	G	NM_004128		45694797	45694797	+1	no_errors	ENST00000340473	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	A
HCFC2	29915	genome.wustl.edu	37	12	104461732	104461732	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr12:104461732G>A	ENST00000229330.4	+	3	424	c.320G>A	c.(319-321)cGt>cAt	p.R107H		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	107					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TAGGCAAGTCGTTGGTTATGG	0.373																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)	dbGAP											0													202.0	198.0	200.0					12																	104461732		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.320G>A	12.37:g.104461732G>A	ENSP00000229330:p.Arg107His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R107H	ENST00000229330.4	37	c.320	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.401945	0.96030	.	.	ENSG00000111727	ENST00000229330;ENST00000550444	T;T	0.73681	-0.77;-0.23	5.64	5.64	0.86602	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.87661	0.6233	M	0.81179	2.53	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.87775	0.2608	10	0.62326	D	0.03	-16.3093	20.0666	0.97706	0.0:0.0:1.0:0.0	.	107	Q9Y5Z7	HCFC2_HUMAN	H	107;18	ENSP00000229330:R107H;ENSP00000447952:R18H	ENSP00000229330:R107H	R	+	2	0	HCFC2	102985862	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.004000	0.88535	2.826000	0.97356	0.561000	0.74099	CGT	HCFC2	-	NULL	ENSG00000111727		0.373	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	420	0.00	0	G	NM_013320		104461732	104461732	+1	no_errors	ENST00000229330	ensembl	human	known	69_37n	missense	306	14.64	53	SNP	1.000	A
HCFC2	29915	genome.wustl.edu	37	12	104461732	104461732	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr12:104461732G>A	ENST00000229330.4	+	3	424	c.320G>A	c.(319-321)cGt>cAt	p.R107H		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	107					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TAGGCAAGTCGTTGGTTATGG	0.373																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)	dbGAP											0													202.0	198.0	200.0					12																	104461732		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.320G>A	12.37:g.104461732G>A	ENSP00000229330:p.Arg107His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R107H	ENST00000229330.4	37	c.320	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.401945	0.96030	.	.	ENSG00000111727	ENST00000229330;ENST00000550444	T;T	0.73681	-0.77;-0.23	5.64	5.64	0.86602	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.87661	0.6233	M	0.81179	2.53	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.87775	0.2608	10	0.62326	D	0.03	-16.3093	20.0666	0.97706	0.0:0.0:1.0:0.0	.	107	Q9Y5Z7	HCFC2_HUMAN	H	107;18	ENSP00000229330:R107H;ENSP00000447952:R18H	ENSP00000229330:R107H	R	+	2	0	HCFC2	102985862	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.004000	0.88535	2.826000	0.97356	0.561000	0.74099	CGT	HCFC2	-	NULL	ENSG00000111727		0.373	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	367	0.00	0	G	NM_013320		104461732	104461732	+1	no_errors	ENST00000229330	ensembl	human	known	69_37n	missense	306	14.64	53	SNP	1.000	A
HTT	3064	genome.wustl.edu	37	4	3148607	3148607	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr4:3148607C>G	ENST00000355072.5	+	25	3372	c.3227C>G	c.(3226-3228)tCa>tGa	p.S1076*		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1076					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTGCTCTCGTCAGCTTGGTTC	0.512																																						dbGAP											0													340.0	344.0	343.0					4																	3148607		2028	4194	6222	-	-	-	SO:0001587	stop_gained	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3227C>G	4.37:g.3148607C>G	ENSP00000347184:p.Ser1076*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQB7	Nonsense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.S1076*	ENST00000355072.5	37	c.3227	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	C	43	10.020042	0.99319	.	.	ENSG00000197386	ENST00000355072	.	.	.	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	17.7809	0.88523	0.0:1.0:0.0:0.0	.	.	.	.	X	1076	.	ENSP00000347184:S1076X	S	+	2	0	HTT	3118405	1.000000	0.71417	0.148000	0.22405	0.752000	0.42762	7.595000	0.82710	2.444000	0.82710	0.563000	0.77884	TCA	HTT	-	superfamily_ARM-type_fold	ENSG00000197386		0.512	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	312	0.00	0	C	NM_002111		3148607	3148607	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	nonsense	273	18.26	61	SNP	0.998	G
HTT	3064	genome.wustl.edu	37	4	3148607	3148607	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr4:3148607C>G	ENST00000355072.5	+	25	3372	c.3227C>G	c.(3226-3228)tCa>tGa	p.S1076*		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1076					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTGCTCTCGTCAGCTTGGTTC	0.512																																						dbGAP											0													340.0	344.0	343.0					4																	3148607		2028	4194	6222	-	-	-	SO:0001587	stop_gained	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3227C>G	4.37:g.3148607C>G	ENSP00000347184:p.Ser1076*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQB7	Nonsense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.S1076*	ENST00000355072.5	37	c.3227	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	C	43	10.020042	0.99319	.	.	ENSG00000197386	ENST00000355072	.	.	.	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	17.7809	0.88523	0.0:1.0:0.0:0.0	.	.	.	.	X	1076	.	ENSP00000347184:S1076X	S	+	2	0	HTT	3118405	1.000000	0.71417	0.148000	0.22405	0.752000	0.42762	7.595000	0.82710	2.444000	0.82710	0.563000	0.77884	TCA	HTT	-	superfamily_ARM-type_fold	ENSG00000197386		0.512	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	332	0.00	0	C	NM_002111		3148607	3148607	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	nonsense	273	18.26	61	SNP	0.998	G
LIFR	3977	genome.wustl.edu	37	5	38506735	38506735	+	Splice_Site	DEL	C	C	-			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr5:38506735delC	ENST00000263409.4	-	8	1154		c.e8-1		LIFR_ENST00000453190.2_Splice_Site|LIFR_ENST00000503088.1_Splice_Site	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha						cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TCTGGTGGATCTAACAGAAAA	0.338			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													43.0	45.0	44.0					5																	38506735		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.992-1G>-	5.37:g.38506735delC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Splice_Site	DEL	-	e7-1	ENST00000263409.4	37	c.992-1	CCDS3927.1	5																																																																																			LIFR	-	-	ENSG00000113594		0.338	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	150	0.00	0	C	NM_002310	Intron	38506735	38506735	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	splice_site_del	111	14.39	19	DEL	1.000	-
LIFR	3977	genome.wustl.edu	37	5	38506735	38506735	+	Splice_Site	DEL	C	C	-			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr5:38506735delC	ENST00000263409.4	-	8	1154		c.e8-1		LIFR_ENST00000453190.2_Splice_Site|LIFR_ENST00000503088.1_Splice_Site	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha						cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TCTGGTGGATCTAACAGAAAA	0.338			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													43.0	45.0	44.0					5																	38506735		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.992-1G>-	5.37:g.38506735delC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Splice_Site	DEL	-	e7-1	ENST00000263409.4	37	c.992-1	CCDS3927.1	5																																																																																			LIFR	-	-	ENSG00000113594		0.338	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	149	0.00	0	C	NM_002310	Intron	38506735	38506735	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	splice_site_del	111	14.39	19	DEL	1.000	-
LRRIQ1	84125	genome.wustl.edu	37	12	85460647	85460647	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr12:85460647A>C	ENST00000393217.2	+	10	2727	c.2666A>C	c.(2665-2667)gAa>gCa	p.E889A		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	889										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CAGTGTCTTGAACTTTCATAT	0.254																																						dbGAP											0													56.0	56.0	56.0					12																	85460647		2202	4290	6492	-	-	-	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2666A>C	12.37:g.85460647A>C	ENSP00000376910:p.Glu889Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E889A	ENST00000393217.2	37	c.2666	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	A	19.84	3.902055	0.72754	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.24723	1.84	5.44	5.44	0.79542	.	0.070263	0.56097	D	0.000036	T	0.44286	0.1286	L	0.44542	1.39	0.40855	D	0.983788	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.37842	-0.9688	10	0.56958	D	0.05	.	15.7904	0.78357	1.0:0.0:0.0:0.0	.	889;864	Q96JM4;C9JI57	LRIQ1_HUMAN;.	A	889;864;889	ENSP00000376910:E889A	ENSP00000256007:E889A	E	+	2	0	LRRIQ1	83984778	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.937000	0.75898	2.193000	0.70182	0.460000	0.39030	GAA	LRRIQ1	-	NULL	ENSG00000133640		0.254	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	254	0.39	1	A	NM_032165		85460647	85460647	+1	no_errors	ENST00000393217	ensembl	human	known	69_37n	missense	178	20.18	45	SNP	1.000	C
LRRIQ1	84125	genome.wustl.edu	37	12	85460647	85460647	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr12:85460647A>C	ENST00000393217.2	+	10	2727	c.2666A>C	c.(2665-2667)gAa>gCa	p.E889A		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	889										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CAGTGTCTTGAACTTTCATAT	0.254																																						dbGAP											0													56.0	56.0	56.0					12																	85460647		2202	4290	6492	-	-	-	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2666A>C	12.37:g.85460647A>C	ENSP00000376910:p.Glu889Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E889A	ENST00000393217.2	37	c.2666	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	A	19.84	3.902055	0.72754	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.24723	1.84	5.44	5.44	0.79542	.	0.070263	0.56097	D	0.000036	T	0.44286	0.1286	L	0.44542	1.39	0.40855	D	0.983788	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.37842	-0.9688	10	0.56958	D	0.05	.	15.7904	0.78357	1.0:0.0:0.0:0.0	.	889;864	Q96JM4;C9JI57	LRIQ1_HUMAN;.	A	889;864;889	ENSP00000376910:E889A	ENSP00000256007:E889A	E	+	2	0	LRRIQ1	83984778	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.937000	0.75898	2.193000	0.70182	0.460000	0.39030	GAA	LRRIQ1	-	NULL	ENSG00000133640		0.254	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	197	0.51	1	A	NM_032165		85460647	85460647	+1	no_errors	ENST00000393217	ensembl	human	known	69_37n	missense	178	20.18	45	SNP	1.000	C
LTBP1	4052	genome.wustl.edu	37	2	33540311	33540311	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr2:33540311C>G	ENST00000404816.2	+	24	4058	c.3705C>G	c.(3703-3705)atC>atG	p.I1235M	LTBP1_ENST00000418533.2_Missense_Mutation_p.I909M|LTBP1_ENST00000404525.1_Missense_Mutation_p.I856M|LTBP1_ENST00000402934.1_Missense_Mutation_p.I856M|LTBP1_ENST00000354476.3_Missense_Mutation_p.I1236M|LTBP1_ENST00000407925.1_Missense_Mutation_p.I909M|LTBP1_ENST00000390003.4_Missense_Mutation_p.I910M|LTBP1_ENST00000272273.5_Missense_Mutation_p.I175M			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1235	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GTTTCTCAATCTCTGCAGATG	0.433																																						dbGAP											0													116.0	102.0	107.0					2																	33540311		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3705C>G	2.37:g.33540311C>G	ENSP00000386043:p.Ile1235Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.I1236M	ENST00000404816.2	37	c.3708	CCDS33177.2	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.48|13.48	2.250356|2.250356	0.39797|0.39797	.|.	.|.	ENSG00000049323|ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273;ENST00000422669|ENST00000415140	D;D;D;D;D;D;D;D;D|.	0.91996|.	-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95|.	4.98|4.98	2.06|2.06	0.26882|0.26882	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	.|.	.|.	.|.	.|.	T|T	0.22666|0.22666	0.0547|0.0547	N|N	0.21617|0.21617	0.685|0.685	0.26247|0.26247	N|N	0.978772|0.978772	B;P;P;B;P;P;P|.	0.44776|.	0.44;0.843;0.82;0.024;0.811;0.811;0.811|.	B;P;B;B;B;B;P|.	0.52066|.	0.142;0.689;0.312;0.037;0.407;0.407;0.562|.	T|T	0.18713|0.18713	-1.0328|-1.0328	9|5	0.40728|.	T|.	0.16|.	.|.	4.3686|4.3686	0.11237|0.11237	0.0:0.4088:0.1818:0.4093|0.0:0.4088:0.1818:0.4093	.|.	175;1235;909;856;909;910;1236|.	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4|.	.;LTBP1_HUMAN;.;.;.;.;.|.	M|C	1235;1236;910;909;856;856;909;175;113|197	ENSP00000386043:I1235M;ENSP00000346467:I1236M;ENSP00000374653:I910M;ENSP00000393057:I909M;ENSP00000384373:I856M;ENSP00000385359:I856M;ENSP00000384091:I909M;ENSP00000272273:I175M;ENSP00000395211:I113M|.	ENSP00000272273:I175M|.	I|S	+|+	3|2	3|0	LTBP1|LTBP1	33393815|33393815	0.992000|0.992000	0.36948|0.36948	0.998000|0.998000	0.56505|0.56505	0.941000|0.941000	0.58515|0.58515	0.378000|0.378000	0.20569|0.20569	1.017000|1.017000	0.39495|0.39495	0.655000|0.655000	0.94253|0.94253	ATC|TCT	LTBP1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000049323		0.433	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	226	0.00	0	C	NM_206943		33540311	33540311	+1	no_errors	ENST00000354476	ensembl	human	known	69_37n	missense	168	16.34	33	SNP	0.964	G
LTBP1	4052	genome.wustl.edu	37	2	33540311	33540311	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr2:33540311C>G	ENST00000404816.2	+	24	4058	c.3705C>G	c.(3703-3705)atC>atG	p.I1235M	LTBP1_ENST00000418533.2_Missense_Mutation_p.I909M|LTBP1_ENST00000404525.1_Missense_Mutation_p.I856M|LTBP1_ENST00000402934.1_Missense_Mutation_p.I856M|LTBP1_ENST00000354476.3_Missense_Mutation_p.I1236M|LTBP1_ENST00000407925.1_Missense_Mutation_p.I909M|LTBP1_ENST00000390003.4_Missense_Mutation_p.I910M|LTBP1_ENST00000272273.5_Missense_Mutation_p.I175M			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1235	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GTTTCTCAATCTCTGCAGATG	0.433																																						dbGAP											0													116.0	102.0	107.0					2																	33540311		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3705C>G	2.37:g.33540311C>G	ENSP00000386043:p.Ile1235Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.I1236M	ENST00000404816.2	37	c.3708	CCDS33177.2	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.48|13.48	2.250356|2.250356	0.39797|0.39797	.|.	.|.	ENSG00000049323|ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273;ENST00000422669|ENST00000415140	D;D;D;D;D;D;D;D;D|.	0.91996|.	-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95|.	4.98|4.98	2.06|2.06	0.26882|0.26882	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	.|.	.|.	.|.	.|.	T|T	0.22666|0.22666	0.0547|0.0547	N|N	0.21617|0.21617	0.685|0.685	0.26247|0.26247	N|N	0.978772|0.978772	B;P;P;B;P;P;P|.	0.44776|.	0.44;0.843;0.82;0.024;0.811;0.811;0.811|.	B;P;B;B;B;B;P|.	0.52066|.	0.142;0.689;0.312;0.037;0.407;0.407;0.562|.	T|T	0.18713|0.18713	-1.0328|-1.0328	9|5	0.40728|.	T|.	0.16|.	.|.	4.3686|4.3686	0.11237|0.11237	0.0:0.4088:0.1818:0.4093|0.0:0.4088:0.1818:0.4093	.|.	175;1235;909;856;909;910;1236|.	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4|.	.;LTBP1_HUMAN;.;.;.;.;.|.	M|C	1235;1236;910;909;856;856;909;175;113|197	ENSP00000386043:I1235M;ENSP00000346467:I1236M;ENSP00000374653:I910M;ENSP00000393057:I909M;ENSP00000384373:I856M;ENSP00000385359:I856M;ENSP00000384091:I909M;ENSP00000272273:I175M;ENSP00000395211:I113M|.	ENSP00000272273:I175M|.	I|S	+|+	3|2	3|0	LTBP1|LTBP1	33393815|33393815	0.992000|0.992000	0.36948|0.36948	0.998000|0.998000	0.56505|0.56505	0.941000|0.941000	0.58515|0.58515	0.378000|0.378000	0.20569|0.20569	1.017000|1.017000	0.39495|0.39495	0.655000|0.655000	0.94253|0.94253	ATC|TCT	LTBP1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000049323		0.433	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	224	0.00	0	C	NM_206943		33540311	33540311	+1	no_errors	ENST00000354476	ensembl	human	known	69_37n	missense	168	16.34	33	SNP	0.964	G
MAP3K1	4214	genome.wustl.edu	37	5	56183240	56183241	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr5:56183240_56183241insT	ENST00000399503.3	+	18	4150_4151	c.4150_4151insT	c.(4150-4152)ctafs	p.L1384fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1384	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGGTCAGAGACTAAGAATTGCA	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4151dupT	5.37:g.56183241_56183241dupT	ENSP00000382423:p.Leu1384fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.R1385fs	ENST00000399503.3	37	c.4150_4151	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095015		0.421	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	417	0.00	0	-	XM_042066		56183240	56183241	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_ins	305	13.11	46	INS	1.000:1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56183240	56183241	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr5:56183240_56183241insT	ENST00000399503.3	+	18	4150_4151	c.4150_4151insT	c.(4150-4152)ctafs	p.L1384fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1384	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGGTCAGAGACTAAGAATTGCA	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4151dupT	5.37:g.56183241_56183241dupT	ENSP00000382423:p.Leu1384fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.R1385fs	ENST00000399503.3	37	c.4150_4151	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095015		0.421	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	402	0.00	0	-	XM_042066		56183240	56183241	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_ins	305	13.11	46	INS	1.000:1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56183296	56183297	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr5:56183296_56183297insG	ENST00000399503.3	+	18	4206_4207	c.4206_4207insG	c.(4207-4209)ggafs	p.G1403fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1403	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GAACTGGTGCAGGAGAGTTTCA	0.441																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4208dupG	5.37:g.56183298_56183298dupG	ENSP00000382423:p.Gly1403fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.E1403fs	ENST00000399503.3	37	c.4206_4207	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095015		0.441	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	498	0.00	0	-	XM_042066		56183296	56183297	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_ins	389	13.36	60	INS	0.930:1.000	G
MAP3K1	4214	genome.wustl.edu	37	5	56183296	56183297	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr5:56183296_56183297insG	ENST00000399503.3	+	18	4206_4207	c.4206_4207insG	c.(4207-4209)ggafs	p.G1403fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1403	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GAACTGGTGCAGGAGAGTTTCA	0.441																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4208dupG	5.37:g.56183298_56183298dupG	ENSP00000382423:p.Gly1403fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.E1403fs	ENST00000399503.3	37	c.4206_4207	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095015		0.441	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	471	0.00	0	-	XM_042066		56183296	56183297	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_ins	389	13.36	60	INS	0.930:1.000	G
MST1L	11223	genome.wustl.edu	37	1	17085995	17085996	+	RNA	INS	-	-	C	rs528252461	byFrequency	TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr1:17085995_17085996insC	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCCAACGCCCGCCCCCCCGCCC	0.658													|||unknown(NO_COVERAGE)	266	0.053115	0.0492	0.0821	5008	,	,		18719	0.002		0.0408	False		,,,				2504	0.1033					dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086002_17086002dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Frame_Shift_Ins	INS	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.A301fs	ENST00000455405.2	37	c.902_901		1																																																																																			MST1P9	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.658	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	27	0.00	0	-	NM_001271733		17085995	17085996	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	frame_shift_ins	24	11.11	3	INS	0.980:0.979	C
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	229	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	204	12.07	28	SNP	1.000	G
PPP3CA	5530	genome.wustl.edu	37	4	101950343	101950343	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr4:101950343T>C	ENST00000394854.3	-	13	2032	c.1349A>G	c.(1348-1350)gAg>gGg	p.E450G	PPP3CA_ENST00000323055.6_Intron|PPP3CA_ENST00000523694.2_Missense_Mutation_p.E383G|PPP3CA_ENST00000394853.4_Intron|PPP3CA_ENST00000512215.1_Missense_Mutation_p.E218G|PPP3CA_ENST00000507176.1_Missense_Mutation_p.E352G	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	450					calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		CTCAATAGCCTCAACAGTAGC	0.423																																						dbGAP											0													109.0	117.0	114.0					4																	101950343		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1349A>G	4.37:g.101950343T>C	ENSP00000378323:p.Glu450Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.E450G	ENST00000394854.3	37	c.1349	CCDS34037.1	4	.	.	.	.	.	.	.	.	.	.	T	19.05	3.752916	0.69648	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000507176;ENST00000523694	T;T;T;T	0.05786	3.39;3.39;3.39;3.39	5.27	5.27	0.74061	.	0.226631	0.38272	N	0.001756	T	0.05823	0.0152	N	0.08118	0	0.50813	D	0.999894	P;B;P	0.41420	0.749;0.166;0.749	B;B;B	0.43867	0.284;0.108;0.434	T	0.50767	-0.8789	10	0.52906	T	0.07	-17.65	15.494	0.75634	0.0:0.0:0.0:1.0	.	450;218;383	Q08209;A8W6Z8;A1A441	PP2BA_HUMAN;.;.	G	218;450;352;383	ENSP00000422781:E218G;ENSP00000378323:E450G;ENSP00000422990:E352G;ENSP00000429350:E383G	ENSP00000378323:E450G	E	-	2	0	PPP3CA	102169366	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.888000	0.69758	2.127000	0.65507	0.528000	0.53228	GAG	PPP3CA	-	NULL	ENSG00000138814		0.423	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPP3CA	HGNC	protein_coding	OTTHUMT00000258379.2	154	0.00	0	T	NM_000944		101950343	101950343	-1	no_errors	ENST00000394854	ensembl	human	known	69_37n	missense	126	11.89	17	SNP	1.000	C
PPP3CA	5530	genome.wustl.edu	37	4	101950343	101950343	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr4:101950343T>C	ENST00000394854.3	-	13	2032	c.1349A>G	c.(1348-1350)gAg>gGg	p.E450G	PPP3CA_ENST00000323055.6_Intron|PPP3CA_ENST00000523694.2_Missense_Mutation_p.E383G|PPP3CA_ENST00000394853.4_Intron|PPP3CA_ENST00000512215.1_Missense_Mutation_p.E218G|PPP3CA_ENST00000507176.1_Missense_Mutation_p.E352G	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	450					calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		CTCAATAGCCTCAACAGTAGC	0.423																																						dbGAP											0													109.0	117.0	114.0					4																	101950343		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1349A>G	4.37:g.101950343T>C	ENSP00000378323:p.Glu450Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.E450G	ENST00000394854.3	37	c.1349	CCDS34037.1	4	.	.	.	.	.	.	.	.	.	.	T	19.05	3.752916	0.69648	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000507176;ENST00000523694	T;T;T;T	0.05786	3.39;3.39;3.39;3.39	5.27	5.27	0.74061	.	0.226631	0.38272	N	0.001756	T	0.05823	0.0152	N	0.08118	0	0.50813	D	0.999894	P;B;P	0.41420	0.749;0.166;0.749	B;B;B	0.43867	0.284;0.108;0.434	T	0.50767	-0.8789	10	0.52906	T	0.07	-17.65	15.494	0.75634	0.0:0.0:0.0:1.0	.	450;218;383	Q08209;A8W6Z8;A1A441	PP2BA_HUMAN;.;.	G	218;450;352;383	ENSP00000422781:E218G;ENSP00000378323:E450G;ENSP00000422990:E352G;ENSP00000429350:E383G	ENSP00000378323:E450G	E	-	2	0	PPP3CA	102169366	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.888000	0.69758	2.127000	0.65507	0.528000	0.53228	GAG	PPP3CA	-	NULL	ENSG00000138814		0.423	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPP3CA	HGNC	protein_coding	OTTHUMT00000258379.2	180	0.00	0	T	NM_000944		101950343	101950343	-1	no_errors	ENST00000394854	ensembl	human	known	69_37n	missense	126	11.89	17	SNP	1.000	C
RFX2	5990	genome.wustl.edu	37	19	6001886	6001886	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr19:6001886G>T	ENST00000303657.5	-	15	1948	c.1799C>A	c.(1798-1800)gCc>gAc	p.A600D	RFX2_ENST00000592546.1_Missense_Mutation_p.A575D|RFX2_ENST00000359161.3_Missense_Mutation_p.A600D|CTC-232P5.1_ENST00000587836.1_RNA	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	600					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGGGCTGCCGGCATGCTGCTT	0.617																																					Colon(38;171 817 19800 47433 48051)	dbGAP											0													47.0	49.0	48.0					19																	6001886		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.1799C>A	19.37:g.6001886G>T	ENSP00000306335:p.Ala600Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.A600D	ENST00000303657.5	37	c.1799	CCDS12157.1	19	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782454	0.31502	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.48522	0.81	4.2	2.03	0.26663	.	0.329351	0.30602	N	0.009275	T	0.21631	0.0521	N	0.08118	0	0.22489	N	0.999052	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.08126	-1.0737	10	0.42905	T	0.14	-12.9228	3.3716	0.07223	0.2082:0.0:0.4746:0.3172	.	575;600	P48378-2;P48378	.;RFX2_HUMAN	D	600;575;387	ENSP00000306335:A600D	ENSP00000306335:A600D	A	-	2	0	RFX2	5952886	1.000000	0.71417	0.031000	0.17742	0.950000	0.60333	4.628000	0.61282	0.857000	0.35407	0.609000	0.83330	GCC	RFX2	-	NULL	ENSG00000087903		0.617	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452687.1	42	0.00	0	G	NM_000635		6001886	6001886	-1	no_errors	ENST00000303657	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.573	T
RFX2	5990	genome.wustl.edu	37	19	6001886	6001886	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr19:6001886G>T	ENST00000303657.5	-	15	1948	c.1799C>A	c.(1798-1800)gCc>gAc	p.A600D	RFX2_ENST00000592546.1_Missense_Mutation_p.A575D|RFX2_ENST00000359161.3_Missense_Mutation_p.A600D|CTC-232P5.1_ENST00000587836.1_RNA	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	600					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGGGCTGCCGGCATGCTGCTT	0.617																																					Colon(38;171 817 19800 47433 48051)	dbGAP											0													47.0	49.0	48.0					19																	6001886		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.1799C>A	19.37:g.6001886G>T	ENSP00000306335:p.Ala600Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.A600D	ENST00000303657.5	37	c.1799	CCDS12157.1	19	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782454	0.31502	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.48522	0.81	4.2	2.03	0.26663	.	0.329351	0.30602	N	0.009275	T	0.21631	0.0521	N	0.08118	0	0.22489	N	0.999052	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.08126	-1.0737	10	0.42905	T	0.14	-12.9228	3.3716	0.07223	0.2082:0.0:0.4746:0.3172	.	575;600	P48378-2;P48378	.;RFX2_HUMAN	D	600;575;387	ENSP00000306335:A600D	ENSP00000306335:A600D	A	-	2	0	RFX2	5952886	1.000000	0.71417	0.031000	0.17742	0.950000	0.60333	4.628000	0.61282	0.857000	0.35407	0.609000	0.83330	GCC	RFX2	-	NULL	ENSG00000087903		0.617	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452687.1	30	0.00	0	G	NM_000635		6001886	6001886	-1	no_errors	ENST00000303657	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.573	T
SPINK5	11005	genome.wustl.edu	37	5	147484520	147484520	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr5:147484520A>T	ENST00000256084.7	+	16	1478	c.1436A>T	c.(1435-1437)cAa>cTa	p.Q479L	SPINK5_ENST00000359874.3_Missense_Mutation_p.Q479L|SPINK5_ENST00000398454.1_Missense_Mutation_p.Q479L	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	479	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAAAGTCAACAAGAAGAAAGA	0.378																																						dbGAP											0													86.0	85.0	85.0					5																	147484520		1799	4088	5887	-	-	-	SO:0001583	missense	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1436A>T	5.37:g.147484520A>T	ENSP00000256084:p.Gln479Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	p.Q479L	ENST00000256084.7	37	c.1436	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	A	12.10	1.837494	0.32513	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.03860	3.78;3.78;3.78;3.78	3.91	2.69	0.31865	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.156761	0.30185	N	0.010213	T	0.14184	0.0343	M	0.76574	2.34	0.34453	D	0.700906	D;P;D;D	0.59357	0.974;0.86;0.974;0.985	D;P;P;P	0.65323	0.934;0.661;0.908;0.892	T	0.18618	-1.0331	10	0.25751	T	0.34	-16.186	7.1698	0.25712	0.7709:0.2291:0.0:0.0	.	460;479;479;479	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	L	479;479;460;479	ENSP00000381472:Q479L;ENSP00000352936:Q479L;ENSP00000421519:Q460L;ENSP00000256084:Q479L	ENSP00000256084:Q479L	Q	+	2	0	SPINK5	147464713	0.999000	0.42202	0.742000	0.31022	0.666000	0.39218	0.807000	0.27140	0.809000	0.34255	0.260000	0.18958	CAA	SPINK5	-	pfam_Kazal-type_dom,smart_Prot_inh_Kazal	ENSG00000133710		0.378	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	362	0.00	0	A	NM_001127698		147484520	147484520	+1	no_errors	ENST00000359874	ensembl	human	known	69_37n	missense	289	15.50	53	SNP	0.801	T
SPINK5	11005	genome.wustl.edu	37	5	147484520	147484520	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr5:147484520A>T	ENST00000256084.7	+	16	1478	c.1436A>T	c.(1435-1437)cAa>cTa	p.Q479L	SPINK5_ENST00000359874.3_Missense_Mutation_p.Q479L|SPINK5_ENST00000398454.1_Missense_Mutation_p.Q479L	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	479	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAAAGTCAACAAGAAGAAAGA	0.378																																						dbGAP											0													86.0	85.0	85.0					5																	147484520		1799	4088	5887	-	-	-	SO:0001583	missense	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1436A>T	5.37:g.147484520A>T	ENSP00000256084:p.Gln479Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	p.Q479L	ENST00000256084.7	37	c.1436	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	A	12.10	1.837494	0.32513	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.03860	3.78;3.78;3.78;3.78	3.91	2.69	0.31865	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.156761	0.30185	N	0.010213	T	0.14184	0.0343	M	0.76574	2.34	0.34453	D	0.700906	D;P;D;D	0.59357	0.974;0.86;0.974;0.985	D;P;P;P	0.65323	0.934;0.661;0.908;0.892	T	0.18618	-1.0331	10	0.25751	T	0.34	-16.186	7.1698	0.25712	0.7709:0.2291:0.0:0.0	.	460;479;479;479	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	L	479;479;460;479	ENSP00000381472:Q479L;ENSP00000352936:Q479L;ENSP00000421519:Q460L;ENSP00000256084:Q479L	ENSP00000256084:Q479L	Q	+	2	0	SPINK5	147464713	0.999000	0.42202	0.742000	0.31022	0.666000	0.39218	0.807000	0.27140	0.809000	0.34255	0.260000	0.18958	CAA	SPINK5	-	pfam_Kazal-type_dom,smart_Prot_inh_Kazal	ENSG00000133710		0.378	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	303	0.00	0	A	NM_001127698		147484520	147484520	+1	no_errors	ENST00000359874	ensembl	human	known	69_37n	missense	289	15.50	53	SNP	0.801	T
TMCC1	23023	genome.wustl.edu	37	3	129370451	129370451	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr3:129370451A>C	ENST00000393238.3	-	6	2175	c.1835T>G	c.(1834-1836)gTc>gGc	p.V612G	TMCC1_ENST00000432054.2_Missense_Mutation_p.V288G|TMCC1_ENST00000329333.5_Missense_Mutation_p.V433G|TMCC1_ENST00000426664.2_Missense_Mutation_p.V498G	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	612						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CATGAGGGGGACCACACAGTT	0.512																																						dbGAP											0													163.0	145.0	151.0					3																	129370451		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1835T>G	3.37:g.129370451A>C	ENSP00000376930:p.Val612Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.V612G	ENST00000393238.3	37	c.1835	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	A	15.32	2.797397	0.50208	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.26	5.26	0.73747	.	0.055125	0.64402	D	0.000001	T	0.58949	0.2158	L	0.59436	1.845	0.80722	D	1	P;D	0.76494	0.908;0.999	P;D	0.67231	0.849;0.95	T	0.57682	-0.7769	10	0.40728	T	0.16	-14.6796	15.3476	0.74350	1.0:0.0:0.0:0.0	.	433;612	B4DE04;O94876	.;TMCC1_HUMAN	G	288;612;498;433	ENSP00000404711:V288G;ENSP00000376930:V612G;ENSP00000389892:V498G;ENSP00000327349:V433G	ENSP00000327349:V433G	V	-	2	0	TMCC1	130853141	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	7.380000	0.79704	2.215000	0.71742	0.528000	0.53228	GTC	TMCC1	-	pfam_Predicted_TM_coiled-coil_2	ENSG00000172765		0.512	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	HGNC	protein_coding	OTTHUMT00000356418.2	217	0.46	1	A	NM_015008		129370451	129370451	-1	no_errors	ENST00000393238	ensembl	human	known	69_37n	missense	141	15.06	25	SNP	0.995	C
TTC17	55761	genome.wustl.edu	37	11	43428954	43428954	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr11:43428954G>A	ENST00000039989.4	+	15	1905	c.1891G>A	c.(1891-1893)Gca>Aca	p.A631T	TTC17_ENST00000299240.6_Missense_Mutation_p.A631T|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	631					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						ATACTGGAGAGCAGTAGGAAA	0.403																																						dbGAP											0													108.0	94.0	99.0					11																	43428954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.1891G>A	11.37:g.43428954G>A	ENSP00000039989:p.Ala631Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XAB3|Q8NEC0	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A631T	ENST00000039989.4	37	c.1891	CCDS31466.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.073211	0.94000	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.58210	0.35;0.35	5.74	5.74	0.90152	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.64886	0.2639	L	0.35723	1.085	0.80722	D	1	D;D;D	0.89917	0.992;1.0;0.998	P;D;D	0.87578	0.905;0.998;0.972	T	0.57159	-0.7859	10	0.24483	T	0.36	-13.0851	19.9265	0.97104	0.0:0.0:1.0:0.0	.	631;631;631	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	T	631	ENSP00000299240:A631T;ENSP00000039989:A631T	ENSP00000039989:A631T	A	+	1	0	TTC17	43385530	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.273000	0.78527	2.723000	0.93209	0.591000	0.81541	GCA	TTC17	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000052841		0.403	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	HGNC	protein_coding	OTTHUMT00000389577.2	324	0.00	0	G	NM_018259		43428954	43428954	+1	no_errors	ENST00000039989	ensembl	human	known	69_37n	missense	249	13.84	40	SNP	1.000	A
ZCCHC12	170261	genome.wustl.edu	37	X	117960412	117960412	+	Missense_Mutation	SNP	T	T	C	rs143931773		TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chrX:117960412T>C	ENST00000310164.2	+	4	1712	c.1205T>C	c.(1204-1206)cTg>cCg	p.L402P		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	402					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						TCTGAGCCACTGTAAGGGACC	0.512																																						dbGAP											0													56.0	56.0	56.0					X																	117960412		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.1205T>C	X.37:g.117960412T>C	ENSP00000308921:p.Leu402Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	superfamily_Znf_CCHC	p.L402P	ENST00000310164.2	37	c.1205	CCDS14574.1	X	.	.	.	.	.	.	.	.	.	.	T	3.518	-0.098351	0.07010	.	.	ENSG00000174460	ENST00000310164	T	0.36340	1.26	3.24	-0.78	0.10969	.	.	.	.	.	T	0.19525	0.0469	N	0.22421	0.69	0.09310	N	1	B	0.27068	0.167	B	0.23150	0.044	T	0.21280	-1.0250	9	0.87932	D	0	1.4557	2.5763	0.04807	0.4078:0.0:0.1376:0.4546	.	402	Q6PEW1	ZCH12_HUMAN	P	402	ENSP00000308921:L402P	ENSP00000308921:L402P	L	+	2	0	ZCCHC12	117844440	0.901000	0.30685	0.000000	0.03702	0.000000	0.00434	1.378000	0.34328	-0.264000	0.09365	-0.400000	0.06385	CTG	ZCCHC12	-	NULL	ENSG00000174460		0.512	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	HGNC	protein_coding	OTTHUMT00000058014.1	58	0.00	0	T	NM_173798		117960412	117960412	+1	no_errors	ENST00000310164	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	0.000	C
ZCCHC12	170261	genome.wustl.edu	37	X	117960412	117960412	+	Missense_Mutation	SNP	T	T	C	rs143931773		TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chrX:117960412T>C	ENST00000310164.2	+	4	1712	c.1205T>C	c.(1204-1206)cTg>cCg	p.L402P		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	402					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						TCTGAGCCACTGTAAGGGACC	0.512																																						dbGAP											0													56.0	56.0	56.0					X																	117960412		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.1205T>C	X.37:g.117960412T>C	ENSP00000308921:p.Leu402Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	superfamily_Znf_CCHC	p.L402P	ENST00000310164.2	37	c.1205	CCDS14574.1	X	.	.	.	.	.	.	.	.	.	.	T	3.518	-0.098351	0.07010	.	.	ENSG00000174460	ENST00000310164	T	0.36340	1.26	3.24	-0.78	0.10969	.	.	.	.	.	T	0.19525	0.0469	N	0.22421	0.69	0.09310	N	1	B	0.27068	0.167	B	0.23150	0.044	T	0.21280	-1.0250	9	0.87932	D	0	1.4557	2.5763	0.04807	0.4078:0.0:0.1376:0.4546	.	402	Q6PEW1	ZCH12_HUMAN	P	402	ENSP00000308921:L402P	ENSP00000308921:L402P	L	+	2	0	ZCCHC12	117844440	0.901000	0.30685	0.000000	0.03702	0.000000	0.00434	1.378000	0.34328	-0.264000	0.09365	-0.400000	0.06385	CTG	ZCCHC12	-	NULL	ENSG00000174460		0.512	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	HGNC	protein_coding	OTTHUMT00000058014.1	65	0.00	0	T	NM_173798		117960412	117960412	+1	no_errors	ENST00000310164	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	0.000	C
ZNF619	285267	genome.wustl.edu	37	3	40529529	40529529	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	42ae8faa-3a1c-4068-a71e-612c411bf102	g.chr3:40529529T>C	ENST00000314686.5	+	6	1885	c.1480T>C	c.(1480-1482)Tgc>Cgc	p.C494R	ZNF619_ENST00000521353.1_Missense_Mutation_p.C550R|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000456778.1_Missense_Mutation_p.C466R|ZNF619_ENST00000432264.2_Missense_Mutation_p.C510R|ZNF619_ENST00000429348.2_Missense_Mutation_p.C510R|ZNF619_ENST00000522736.1_Missense_Mutation_p.C501R|ZNF619_ENST00000447116.2_Missense_Mutation_p.C550R			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CCAACATACCTGCTCTGCCCT	0.542																																						dbGAP											0													148.0	104.0	119.0					3																	40529529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.1480T>C	3.37:g.40529529T>C	ENSP00000322529:p.Cys494Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E271|C9JRN5|D4PHA2|E9PCD9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C550R	ENST00000314686.5	37	c.1648		3	.	.	.	.	.	.	.	.	.	.	T	0.449	-0.894833	0.02491	.	.	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000442066;ENST00000522736;ENST00000521353;ENST00000432264	T;T;T;T;T;T;T	0.05513	3.43;3.49;3.64;3.44;3.44;3.49;3.64	1.97	-3.94	0.04130	.	.	.	.	.	T	0.02970	0.0088	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.0;0.001;0.001	T	0.42068	-0.9473	9	0.41790	T	0.15	.	2.3461	0.04271	0.4026:0.2866:0.0:0.3108	.	466;510;550;452;501;494	B4E271;C9JRN5;E9PCD9;B7Z9B3;Q17RW3;Q8N2I2	.;.;.;.;.;ZN619_HUMAN	R	494;550;510;466;131;501;550;510	ENSP00000322529:C494R;ENSP00000411132:C550R;ENSP00000398024:C510R;ENSP00000397232:C466R;ENSP00000428004:C501R;ENSP00000430705:C550R;ENSP00000388710:C510R	ENSP00000322529:C494R	C	+	1	0	ZNF619	40504533	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.187000	0.16998	-1.139000	0.02881	0.379000	0.24179	TGC	ZNF619	-	NULL	ENSG00000177873		0.542	ZNF619-001	KNOWN	basic	protein_coding	ZNF619	HGNC	protein_coding	OTTHUMT00000254180.2	411	0.00	0	T	NM_173656		40529529	40529529	+1	no_errors	ENST00000447116	ensembl	human	known	69_37n	missense	316	13.01	48	SNP	0.000	C
ZNF619	285267	genome.wustl.edu	37	3	40529529	40529529	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BO-01A-23D-A12B-09	TCGA-BH-A0BO-11A-11D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63af8579-99b1-4f81-92a6-4e3a31715be1	2f936210-a942-4f9b-8456-04c8e8cfb09f	g.chr3:40529529T>C	ENST00000314686.5	+	6	1885	c.1480T>C	c.(1480-1482)Tgc>Cgc	p.C494R	ZNF619_ENST00000521353.1_Missense_Mutation_p.C550R|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000456778.1_Missense_Mutation_p.C466R|ZNF619_ENST00000432264.2_Missense_Mutation_p.C510R|ZNF619_ENST00000429348.2_Missense_Mutation_p.C510R|ZNF619_ENST00000522736.1_Missense_Mutation_p.C501R|ZNF619_ENST00000447116.2_Missense_Mutation_p.C550R			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CCAACATACCTGCTCTGCCCT	0.542																																						dbGAP											0													148.0	104.0	119.0					3																	40529529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.1480T>C	3.37:g.40529529T>C	ENSP00000322529:p.Cys494Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E271|C9JRN5|D4PHA2|E9PCD9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C550R	ENST00000314686.5	37	c.1648		3	.	.	.	.	.	.	.	.	.	.	T	0.449	-0.894833	0.02491	.	.	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000442066;ENST00000522736;ENST00000521353;ENST00000432264	T;T;T;T;T;T;T	0.05513	3.43;3.49;3.64;3.44;3.44;3.49;3.64	1.97	-3.94	0.04130	.	.	.	.	.	T	0.02970	0.0088	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.0;0.001;0.001	T	0.42068	-0.9473	9	0.41790	T	0.15	.	2.3461	0.04271	0.4026:0.2866:0.0:0.3108	.	466;510;550;452;501;494	B4E271;C9JRN5;E9PCD9;B7Z9B3;Q17RW3;Q8N2I2	.;.;.;.;.;ZN619_HUMAN	R	494;550;510;466;131;501;550;510	ENSP00000322529:C494R;ENSP00000411132:C550R;ENSP00000398024:C510R;ENSP00000397232:C466R;ENSP00000428004:C501R;ENSP00000430705:C550R;ENSP00000388710:C510R	ENSP00000322529:C494R	C	+	1	0	ZNF619	40504533	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.187000	0.16998	-1.139000	0.02881	0.379000	0.24179	TGC	ZNF619	-	NULL	ENSG00000177873		0.542	ZNF619-001	KNOWN	basic	protein_coding	ZNF619	HGNC	protein_coding	OTTHUMT00000254180.2	392	0.25	1	T	NM_173656		40529529	40529529	+1	no_errors	ENST00000447116	ensembl	human	known	69_37n	missense	316	13.01	48	SNP	0.000	C
