#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA8	10351	genome.wustl.edu	37	17	66925207	66925207	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr17:66925207T>G	ENST00000269080.2	-	8	1245	c.1108A>C	c.(1108-1110)Atg>Ctg	p.M370L	ABCA8_ENST00000586539.1_Missense_Mutation_p.M370L|ABCA8_ENST00000430352.2_Missense_Mutation_p.M370L	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	370					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					ATTCCAAGCATGAAGGCAAAG	0.458																																						dbGAP											0													83.0	70.0	74.0					17																	66925207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1108A>C	17.37:g.66925207T>G	ENSP00000269080:p.Met370Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.M370L	ENST00000269080.2	37	c.1108	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	T	7.429	0.638333	0.14386	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000542396	T;T	0.57907	0.37;0.37	4.67	3.6	0.41247	.	0.539061	0.16489	N	0.212199	T	0.33876	0.0878	N	0.20766	0.605	0.19575	N	0.999966	B;B;B;B;B	0.15473	0.013;0.003;0.002;0.0;0.009	B;B;B;B;B	0.19666	0.015;0.012;0.002;0.004;0.026	T	0.09509	-1.0671	10	0.30854	T	0.27	.	6.9479	0.24528	0.0:0.1763:0.0:0.8237	.	309;370;370;370;370	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	L	370;370;309;1	ENSP00000269080:M370L;ENSP00000402814:M370L	ENSP00000269080:M370L	M	-	1	0	ABCA8	64436802	0.605000	0.26941	0.884000	0.34674	0.994000	0.84299	0.974000	0.29436	2.094000	0.63399	0.533000	0.62120	ATG	ABCA8	-	NULL	ENSG00000141338		0.458	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	110	0.90	1	T	NM_007168		66925207	66925207	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	missense	57	21.92	16	SNP	0.561	G
ACTN2	88	genome.wustl.edu	37	1	236914954	236914954	+	Splice_Site	SNP	T	T	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr1:236914954T>A	ENST00000366578.4	+	15	2005		c.e15+2		ACTN2_ENST00000542672.1_Splice_Site|ACTN2_ENST00000546208.1_Splice_Site	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGGGACAAGGTGGGTGGCTGA	0.562																																						dbGAP											0													82.0	74.0	77.0					1																	236914954		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1839+2T>A	1.37:g.236914954T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Splice_Site	SNP	-	e15+2	ENST00000366578.4	37	c.1839+2	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.040296	0.75732	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4964	0.67691	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACTN2	234981577	1.000000	0.71417	0.998000	0.56505	0.740000	0.42216	7.929000	0.87595	1.837000	0.53436	0.460000	0.39030	.	ACTN2	-	-	ENSG00000077522		0.562	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	341	0.00	0	T	NM_001103	Intron	236914954	236914954	+1	no_errors	ENST00000366578	ensembl	human	known	69_37n	splice_site	144	25.26	49	SNP	1.000	A
ANKRD20A8P	729171	genome.wustl.edu	37	2	95515028	95515028	+	RNA	SNP	C	C	T	rs372584374		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:95515028C>T	ENST00000432432.2	-	0	629				RNU6-1320P_ENST00000390838.1_RNA	NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		CAAATTATAGCGAATAAAAGT	0.323																																						dbGAP											0																																										-	-	-			0					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95515028C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC18	RNA	SNP	-	NULL	ENST00000432432.2	37	NULL		2																																																																																			ANKRD20A8P	-	-	ENSG00000229089		0.323	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20A8P	HGNC	pseudogene	OTTHUMT00000451404.1	402	0.00	0	C			95515028	95515028	-1	no_errors	ENST00000432432	ensembl	human	known	69_37n	rna	370	16.85	75	SNP	0.569	T
APOBEC3B	9582	genome.wustl.edu	37	22	39382037	39382037	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr22:39382037G>A	ENST00000333467.3	+	3	440	c.395G>A	c.(394-396)cGa>cAa	p.R132Q	APOBEC3B_ENST00000402182.3_Missense_Mutation_p.R132Q|APOBEC3B_ENST00000407298.3_Missense_Mutation_p.R132Q	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	132					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					AGAGATTACCGAAGGGCGCTC	0.607																																						dbGAP											0													47.0	52.0	51.0					22																	39382037		2200	4290	6490	-	-	-	SO:0001583	missense	0			AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.395G>A	22.37:g.39382037G>A	ENSP00000327459:p.Arg132Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.R132Q	ENST00000333467.3	37	c.395	CCDS13982.1	22	.	.	.	.	.	.	.	.	.	.	.	0.012	-1.653926	0.00779	.	.	ENSG00000179750	ENST00000407298;ENST00000402182;ENST00000333467	T;T;T	0.65364	-0.15;-0.15;-0.15	2.12	-4.0	0.04057	APOBEC-like, C-terminal (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.26991	0.0661	N	0.03194	-0.395	0.09310	N	1	B;B	0.14012	0.002;0.009	B;B	0.14578	0.002;0.011	T	0.31613	-0.9937	9	0.02654	T	1	.	6.0014	0.19523	0.2681:0.1886:0.5433:0.0	.	132;132	B0QYD2;Q9UH17	.;ABC3B_HUMAN	Q	132	ENSP00000385068:R132Q;ENSP00000385060:R132Q;ENSP00000327459:R132Q	ENSP00000327459:R132Q	R	+	2	0	APOBEC3B	37711983	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.221000	0.09202	-0.939000	0.03709	-1.050000	0.02344	CGA	APOBEC3B	-	pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	ENSG00000179750		0.607	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3B	HGNC	protein_coding	OTTHUMT00000321233.1	277	0.00	0	G	NM_004900		39382037	39382037	+1	no_errors	ENST00000333467	ensembl	human	known	69_37n	missense	149	19.46	36	SNP	0.000	A
ASCC1	51008	genome.wustl.edu	37	10	73912678	73912678	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:73912678C>T	ENST00000342444.4	-	8	880	c.779G>A	c.(778-780)gGc>gAc	p.G260D	ASCC1_ENST00000545550.1_Missense_Mutation_p.G254D|ASCC1_ENST00000394915.3_Missense_Mutation_p.G260D|ASCC1_ENST00000317168.6_Missense_Mutation_p.G232D|ASCC1_ENST00000317126.4_Missense_Mutation_p.G232D|ASCC1_ENST00000394919.1_Missense_Mutation_p.G232D	NM_001198799.2	NP_001185728.1	Q8N9N2	ASCC1_HUMAN	activating signal cointegrator 1 complex subunit 1	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|transcription factor complex (GO:0005667)	catalytic activity (GO:0003824)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	7						ATCCACCATGCCAGGATCATC	0.398																																						dbGAP											0													158.0	131.0	140.0					10																	73912678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY013290	CCDS31219.1, CCDS55713.1	10q22.1	2012-09-20			ENSG00000138303	ENSG00000138303			24268	protein-coding gene	gene with protein product		614215				10810093, 12077347	Standard	NM_001198799		Approved	CGI-18, ASC1p50, Em:AC022392.3	uc001jst.2	Q8N9N2	OTTHUMG00000018434	ENST00000342444.4:c.779G>A	10.37:g.73912678C>T	ENSP00000339404:p.Gly260Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SW06|Q5SW07|Q96EI8|Q9Y307	Nonsense_Mutation	SNP	pfam_Kinase-A_anchor_nucl_local_sig,pfam_KH_dom_type_1,superfamily_RNA_ligase/cNuc_Pdiesterase,pirsf_Euk_LigT,pfscan_KH_dom_type_1	p.W163*	ENST00000342444.4	37	c.489	CCDS55713.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	20.3|20.3|20.3	3.966926|3.966926|3.966926	0.74131|0.74131|0.74131	.|.|.	.|.|.	ENSG00000138303|ENSG00000138303|ENSG00000138303	ENST00000530394|ENST00000394919;ENST00000342444;ENST00000317168;ENST00000373101;ENST00000503308;ENST00000317126;ENST00000545550;ENST00000394915|ENST00000486689	.|T;T;T;T;T;T|.	.|0.43294|.	.|0.95;0.95;0.95;0.95;0.95;0.95|.	5.42|5.42|5.42	3.48|3.48|3.48	0.39840|0.39840|0.39840	.|Protein kinase A anchor protein, nuclear localisation signal domain (1);|.	.|0.339373|.	.|0.34314|.	.|N|.	.|0.004080|.	T|T|.	0.16599|0.16599|.	0.0399|0.0399|.	N|N|N	0.01874|0.01874|0.01874	-0.695|-0.695|-0.695	0.27185|0.27185|0.27185	N|N|N	0.960557|0.960557|0.960557	.|P;P;P|.	.|0.45634|.	.|0.828;0.863;0.695|.	.|B;P;B|.	.|0.51742|.	.|0.376;0.678;0.392|.	T|T|.	0.14980|0.14980|.	-1.0453|-1.0453|.	5|10|.	.|0.23302|.	.|T|.	.|0.38|.	.|.|.	15.4049|15.4049|15.4049	0.74868|0.74868|0.74868	0.0:0.442:0.558:0.0|0.0:0.442:0.558:0.0|0.0:0.442:0.558:0.0	.|.|.	.|254;260;147|.	.|F5H874;Q8N9N2;B3KU20|.	.|.;ASCC1_HUMAN;.|.	T|D|X	30|232;260;232;232;147;232;254;260|163	.|ENSP00000378377:G232D;ENSP00000339404:G260D;ENSP00000320810:G232D;ENSP00000320461:G232D;ENSP00000442121:G254D;ENSP00000378373:G260D|.	.|ENSP00000320461:G232D|.	A|G|W	-|-|-	1|2|3	0|0|0	ASCC1|ASCC1|ASCC1	73582684|73582684|73582684	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	3.925000|3.925000|3.925000	0.56484|0.56484|0.56484	0.699000|0.699000|0.699000	0.31761|0.31761|0.31761	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCA|GGC|TGG	ASCC1	-	pfam_Kinase-A_anchor_nucl_local_sig,superfamily_RNA_ligase/cNuc_Pdiesterase,pirsf_Euk_LigT	ENSG00000138303		0.398	ASCC1-004	KNOWN	basic|CCDS	protein_coding	ASCC1	HGNC	protein_coding	OTTHUMT00000048573.2	242	0.00	0	C	NM_015947		73912678	73912678	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000486689	ensembl	human	putative	69_37n	nonsense	156	18.75	36	SNP	0.995	T
ATAD2	29028	genome.wustl.edu	37	8	124359355	124359355	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr8:124359355C>T	ENST00000287394.5	-	16	2296	c.2189G>A	c.(2188-2190)aGa>aAa	p.R730K	ATAD2_ENST00000521903.1_Missense_Mutation_p.R48K|MIR548AA1_ENST00000384971.2_RNA	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	730					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TTTATTTGTTCTGAATTCTGC	0.363																																						dbGAP											0													92.0	93.0	92.0					8																	124359355		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.2189G>A	8.37:g.124359355C>T	ENSP00000287394:p.Arg730Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R730K	ENST00000287394.5	37	c.2189	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	C	6.081	0.383285	0.11524	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	D;T	0.91011	-2.77;1.66	5.31	2.2	0.27929	.	0.561695	0.18687	N	0.133973	T	0.68668	0.3026	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59172	-0.7504	10	0.05959	T	0.93	-1.3269	6.2553	0.20870	0.0:0.5558:0.1665:0.2777	.	730	Q6PL18	ATAD2_HUMAN	K	730;48	ENSP00000287394:R730K;ENSP00000429213:R48K	ENSP00000287394:R730K	R	-	2	0	ATAD2	124428536	0.008000	0.16893	0.011000	0.14972	0.938000	0.57974	0.622000	0.24433	0.185000	0.20105	-0.229000	0.12294	AGA	ATAD2	-	NULL	ENSG00000156802		0.363	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	214	0.00	0	C	NM_014109		124359355	124359355	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	missense	281	11.91	38	SNP	0.013	T
ATP11C	286410	genome.wustl.edu	37	X	138886719	138886719	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chrX:138886719G>A	ENST00000327569.3	-	6	573	c.475C>T	c.(475-477)Ccc>Tcc	p.P159S	ATP11C_ENST00000359686.2_Missense_Mutation_p.P159S|ATP11C_ENST00000361648.2_Missense_Mutation_p.P159S|ATP11C_ENST00000370557.1_Missense_Mutation_p.P156S|ATP11C_ENST00000370543.1_Missense_Mutation_p.P159S	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	159					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					AGATCACAGGGAAAGGTTTCA	0.368																																						dbGAP											0													190.0	166.0	174.0					X																	138886719		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.475C>T	X.37:g.138886719G>A	ENSP00000332756:p.Pro159Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.P159S	ENST00000327569.3	37	c.475	CCDS14668.1	X	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621406	0.87460	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.96041	-3.89;-3.89;-3.89;-3.89;-3.89	4.7	4.7	0.59300	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.98451	0.9484	H	0.96015	3.755	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99785	1.1029	10	0.87932	D	0	.	15.7628	0.78101	0.0:0.0:1.0:0.0	.	159;159	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	S	156;159;159;159;159	ENSP00000359588:P156S;ENSP00000355165:P159S;ENSP00000332756:P159S;ENSP00000359574:P159S;ENSP00000352715:P159S	ENSP00000332756:P159S	P	-	1	0	ATP11C	138714385	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.591000	0.98241	2.172000	0.68678	0.422000	0.28245	CCC	ATP11C	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000101974		0.368	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	265	0.00	0	G	NM_173694		138886719	138886719	-1	no_errors	ENST00000327569	ensembl	human	known	69_37n	missense	103	23.70	32	SNP	1.000	A
ATP8B3	148229	genome.wustl.edu	37	19	1783122	1783122	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:1783122G>C	ENST00000310127.6	-	29	4046	c.3808C>G	c.(3808-3810)Ctg>Gtg	p.L1270V	ATP8B3_ENST00000539485.1_Missense_Mutation_p.L1280V|ATP8B3_ENST00000525591.1_Missense_Mutation_p.L1233V	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1270					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCTCCGCAGAATTGTGCCC	0.562																																						dbGAP											0													71.0	71.0	71.0					19																	1783122		2042	4188	6230	-	-	-	SO:0001583	missense	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3808C>G	19.37:g.1783122G>C	ENSP00000311336:p.Leu1270Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.L1280V	ENST00000310127.6	37	c.3838	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902720	0.33628	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.58797	0.31;0.43;0.4	4.59	2.36	0.29203	.	0.604659	0.14273	N	0.330008	T	0.56366	0.1980	M	0.64404	1.975	0.24669	N	0.993421	D;D	0.54397	0.966;0.966	B;B	0.44224	0.401;0.444	T	0.49000	-0.8984	10	0.45353	T	0.12	.	12.4494	0.55669	0.0:0.0:0.6961:0.3039	.	1270;1233	O60423;Q7Z485	AT8B3_HUMAN;.	V	1270;1280;1233	ENSP00000311336:L1270V;ENSP00000443574:L1280V;ENSP00000437115:L1233V	ENSP00000311336:L1270V	L	-	1	2	ATP8B3	1734122	0.047000	0.20315	0.006000	0.13384	0.354000	0.29330	0.271000	0.18626	0.340000	0.23745	0.561000	0.74099	CTG	ATP8B3	-	NULL	ENSG00000130270		0.562	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	385	0.00	0	G	NM_138813		1783122	1783122	-1	no_errors	ENST00000539485	ensembl	human	known	69_37n	missense	101	33.11	50	SNP	0.849	C
BRPF3	27154	genome.wustl.edu	37	6	36177594	36177594	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr6:36177594G>C	ENST00000357641.6	+	5	2021	c.1768G>C	c.(1768-1770)Gag>Cag	p.E590Q	BRPF3_ENST00000534694.1_Missense_Mutation_p.E590Q|BRPF3_ENST00000534400.1_Missense_Mutation_p.E590Q|BRPF3_ENST00000339717.7_Missense_Mutation_p.E590Q|BRPF3_ENST00000443324.2_Missense_Mutation_p.E590Q|BRPF3_ENST00000543502.1_Missense_Mutation_p.E590Q	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	590					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						CATGGAGCTGGAGCTGATGCC	0.507																																						dbGAP											0													96.0	84.0	88.0					6																	36177594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.1768G>C	6.37:g.36177594G>C	ENSP00000350267:p.Glu590Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.E590Q	ENST00000357641.6	37	c.1768	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	1.377	-0.584558	0.03827	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400;ENST00000394572	T;T;T;T;T;T	0.15139	2.62;2.46;2.45;2.46;2.45;2.46	5.92	5.92	0.95590	Bromodomain (2);	0.215071	0.49916	D	0.000131	T	0.00998	0.0033	N	0.00135	-2.02	0.36633	D	0.87642	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.49390	-0.8945	10	0.02654	T	1	.	10.8087	0.46533	0.0:0.2806:0.5979:0.1215	.	590;590;590	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	Q	590;590;590;590;590;590;4	ENSP00000350267:E590Q;ENSP00000345419:E590Q;ENSP00000434501:E590Q;ENSP00000445352:E590Q;ENSP00000387368:E590Q;ENSP00000436504:E590Q	ENSP00000345419:E590Q	E	+	1	0	BRPF3	36285572	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	1.647000	0.37260	2.818000	0.97014	0.655000	0.94253	GAG	BRPF3	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000096070		0.507	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	258	0.00	0	G	NM_015695		36177594	36177594	+1	no_errors	ENST00000357641	ensembl	human	known	69_37n	missense	79	21.78	22	SNP	1.000	C
C3orf35	339883	genome.wustl.edu	37	3	37476359	37476359	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:37476359G>A	ENST00000328376.5	+	6	1230	c.251G>A	c.(250-252)aGg>aAg	p.R84K	C3orf35_ENST00000481400.1_3'UTR	NM_178339.2	NP_848029.2	Q8IVJ8	APRG1_HUMAN	chromosome 3 open reading frame 35	84						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	11						gttcagaaaagggaggggact	0.468																																						dbGAP											0													27.0	26.0	27.0					3																	37476359		1864	4083	5947	-	-	-	SO:0001583	missense	0			AJ493599	CCDS43065.1, CCDS46792.1	3p22.3	2014-05-22			ENSG00000198590	ENSG00000198590			24082	protein-coding gene	gene with protein product	"""AP20 region protein"", ""APRG1 tumor suppressor candidate"""	611429				12543795	Standard	NM_178342		Approved	APRG1	uc003cha.4	Q8IVJ8	OTTHUMG00000155923	ENST00000328376.5:c.251G>A	3.37:g.37476359G>A	ENSP00000331625:p.Arg84Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMA0|Q8IVJ5|Q8IVJ9	Missense_Mutation	SNP	NULL	p.R84K	ENST00000328376.5	37	c.251	CCDS43065.1	3	.	.	.	.	.	.	.	.	.	.	G	2.294	-0.361786	0.05103	.	.	ENSG00000198590	ENST00000328376	T	0.53640	0.61	0.565	-0.438	0.12268	.	.	.	.	.	T	0.23766	0.0575	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17715	-1.0360	8	0.87932	D	0	.	.	.	.	.	84	Q8IVJ8	APRG1_HUMAN	K	84	ENSP00000331625:R84K	ENSP00000331625:R84K	R	+	2	0	C3orf35	37451363	0.023000	0.18921	0.001000	0.08648	0.001000	0.01503	0.364000	0.20325	-0.258000	0.09446	-0.251000	0.11542	AGG	C3orf35	-	NULL	ENSG00000198590		0.468	C3orf35-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C3orf35	HGNC	protein_coding	OTTHUMT00000342344.2	82	0.00	0	G	NM_178338		37476359	37476359	+1	no_errors	ENST00000328376	ensembl	human	known	69_37n	missense	67	20.24	17	SNP	0.001	A
C9orf41	138199	genome.wustl.edu	37	9	77613613	77613613	+	Nonsense_Mutation	SNP	G	G	A	rs190060534		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr9:77613613G>A	ENST00000376834.3	-	5	963	c.811C>T	c.(811-813)Cga>Tga	p.R271*	RP11-197P3.4_ENST00000455609.1_RNA|C9orf41_ENST00000376837.3_3'UTR	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	271										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						AAGATGGGTCGAATCTGATCA	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		15450	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													71.0	77.0	75.0					9																	77613613		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.811C>T	9.37:g.77613613G>A	ENSP00000366030:p.Arg271*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z383|Q8N7C5	Nonsense_Mutation	SNP	pfam_N2227	p.R271*	ENST00000376834.3	37	c.811	CCDS6649.1	9	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	35	5.529392	0.96446	.	.	ENSG00000156017	ENST00000376834;ENST00000451153	.	.	.	6.08	4.24	0.50183	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1734	8.0245	0.30430	0.133:0.0:0.739:0.128	.	.	.	.	X	271;210	.	ENSP00000366030:R271X	R	-	1	2	C9orf41	76803433	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.852000	0.62904	1.592000	0.50018	0.591000	0.81541	CGA	C9orf41	-	pfam_N2227	ENSG00000156017		0.368	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	HGNC	protein_coding	OTTHUMT00000052703.1	119	0.83	1	G	NM_152420		77613613	77613613	-1	no_errors	ENST00000376834	ensembl	human	known	69_37n	nonsense	66	25.84	23	SNP	1.000	A
CACNA1A	773	genome.wustl.edu	37	19	13335577	13335577	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:13335577G>A	ENST00000360228.5	-	38	5634	c.5635C>T	c.(5635-5637)Cgg>Tgg	p.R1879W	CACNA1A_ENST00000573710.2_Missense_Mutation_p.R1880W	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1880					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGTCCATCCGCAGAAGCCGC	0.612																																						dbGAP											0													24.0	32.0	30.0					19																	13335577		1977	4149	6126	-	-	-	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5635C>T	19.37:g.13335577G>A	ENSP00000353362:p.Arg1879Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.R1879W	ENST00000360228.5	37	c.5635	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562951	0.65538	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96300	-3.97	4.31	4.31	0.51392	.	0.000000	0.64402	D	0.000006	D	0.98226	0.9413	M	0.88241	2.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.988;0.995;0.965;0.988	D	0.99391	1.0925	10	0.72032	D	0.01	.	15.5372	0.76013	0.0:0.0:1.0:0.0	.	1880;1885;1879;1880	O00555;E9PD31;Q9NS88;E7EVF2	CAC1A_HUMAN;.;.;.	W	1879;1885;1880;1880	ENSP00000353362:R1879W	ENSP00000317661:R1880W	R	-	1	2	CACNA1A	13196577	0.985000	0.35326	0.994000	0.49952	0.927000	0.56198	3.202000	0.51067	1.939000	0.56221	0.305000	0.20034	CGG	CACNA1A	-	NULL	ENSG00000141837		0.612	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	112	0.00	0	G	NM_000068		13335577	13335577	-1	no_errors	ENST00000360228	ensembl	human	known	69_37n	missense	145	13.17	22	SNP	1.000	A
CADPS2	93664	genome.wustl.edu	37	7	122114548	122114548	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:122114548C>G	ENST00000449022.2	-	13	1904	c.1885G>C	c.(1885-1887)Ggt>Cgt	p.G629R	CADPS2_ENST00000412584.2_Missense_Mutation_p.G626R|CADPS2_ENST00000313070.7_Missense_Mutation_p.G626R|CADPS2_ENST00000334010.7_Missense_Mutation_p.G630R	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	629					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						TCATCCATACCATGTTTCTGA	0.378																																						dbGAP											0													87.0	85.0	86.0					7																	122114548		1879	4112	5991	-	-	-	SO:0001583	missense	0				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1885G>C	7.37:g.122114548C>G	ENSP00000398481:p.Gly629Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,pfam_Pleckstrin_homology,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G629R	ENST00000449022.2	37	c.1885	CCDS55158.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.07|18.07	3.542788|3.542788	0.65198|0.65198	.|.	.|.	ENSG00000081803|ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022|ENST00000397721	T;T;T;T|.	0.36340|.	1.26;1.26;1.26;1.26|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.056975|.	0.64402|.	D|.	0.000001|.	T|T	0.78991|0.78991	0.4371|0.4371	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.991;0.978;1.0|.	D;P;D|.	0.97110|.	0.952;0.67;1.0|.	T|T	0.77571|0.77571	-0.2538|-0.2538	10|5	0.87932|.	D|.	0|.	-11.1959|-11.1959	20.1169|20.1169	0.97940|0.97940	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	626;629;626|.	Q86UW7-2;Q86UW7;Q86UW7-3|.	.;CAPS2_HUMAN;.|.	R|S	626;630;630;593;626;629|274	ENSP00000325581:G626R;ENSP00000333940:G630R;ENSP00000400401:G626R;ENSP00000398481:G629R|.	ENSP00000325581:G626R|.	G|W	-|-	1|2	0|0	CADPS2|CADPS2	121901784|121901784	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	6.048000|6.048000	0.71046|0.71046	2.835000|2.835000	0.97688|0.97688	0.591000|0.591000	0.81541|0.81541	GGT|TGG	CADPS2	-	NULL	ENSG00000081803		0.378	CADPS2-001	KNOWN	basic|CCDS	protein_coding	CADPS2	HGNC	protein_coding	OTTHUMT00000347414.2	225	0.00	0	C	NM_017954		122114548	122114548	-1	no_errors	ENST00000449022	ensembl	human	known	69_37n	missense	137	25.14	46	SNP	1.000	G
CAMK1D	57118	genome.wustl.edu	37	10	12595305	12595305	+	Silent	SNP	G	G	A	rs553333737		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:12595305G>A	ENST00000378847.3	+	2	511	c.174G>A	c.(172-174)gcG>gcA	p.A58A	CAMK1D_ENST00000378845.1_Silent_p.A58A|CAMK1D_ENST00000487696.1_Intron	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	58	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		CTAAGAAGGCGCTGAAGGGCA	0.522																																						dbGAP											0													132.0	120.0	124.0					10																	12595305		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.174G>A	10.37:g.12595305G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIY0|Q9HD31	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A58	ENST00000378847.3	37	c.174	CCDS7091.1	10																																																																																			CAMK1D	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000183049		0.522	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1D	HGNC	protein_coding	OTTHUMT00000046820.1	245	0.00	0	G	NM_020397		12595305	12595305	+1	no_errors	ENST00000378847	ensembl	human	known	69_37n	silent	166	30.83	74	SNP	0.992	A
CBFA2T3	863	genome.wustl.edu	37	16	88952427	88952427	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr16:88952427C>T	ENST00000268679.4	-	6	1231	c.835G>A	c.(835-837)Gac>Aac	p.D279N	RP11-830F9.5_ENST00000562574.1_RNA|RP11-830F9.5_ENST00000569249.1_RNA|RP11-830F9.5_ENST00000565053.1_RNA|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.D193N|CBFA2T3_ENST00000448839.1_Missense_Mutation_p.D203N|RP11-830F9.5_ENST00000562405.1_RNA|CBFA2T3_ENST00000436887.2_Missense_Mutation_p.D254N|CBFA2T3_ENST00000327483.5_Missense_Mutation_p.D193N	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	279	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		TCTGAGGAGTCGATGGGGGAG	0.667			T	RUNX1	AML																																	dbGAP		Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0													41.0	29.0	33.0					16																	88952427		2166	4268	6434	-	-	-	SO:0001583	missense	0			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.835G>A	16.37:g.88952427C>T	ENSP00000268679:p.Asp279Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG16	p.D279N	ENST00000268679.4	37	c.835	CCDS10972.1	16	.	.	.	.	.	.	.	.	.	.	C	19.73	3.882316	0.72294	.	.	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000448839;ENST00000360302	T;T;T;T;T	0.60797	0.82;0.16;0.53;0.8;0.82	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.78266	0.4256	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.99;0.998;0.994;0.998	T	0.81579	-0.0868	10	0.87932	D	0	-17.229	18.3668	0.90394	0.0:1.0:0.0:0.0	.	254;279;279;193	E7EU24;B2RBQ7;O75081;O75081-2	.;.;MTG16_HUMAN;.	N	193;279;254;203;193	ENSP00000332122:D193N;ENSP00000268679:D279N;ENSP00000395739:D254N;ENSP00000401254:D203N;ENSP00000353449:D193N	ENSP00000268679:D279N	D	-	1	0	CBFA2T3	87479928	1.000000	0.71417	0.944000	0.38274	0.012000	0.07955	5.842000	0.69417	2.499000	0.84300	0.462000	0.41574	GAC	CBFA2T3	-	NULL	ENSG00000129993		0.667	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CBFA2T3	HGNC	protein_coding	OTTHUMT00000269545.2	126	0.00	0	C	NM_005187		88952427	88952427	-1	no_errors	ENST00000268679	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	1.000	T
CCDC106	29903	genome.wustl.edu	37	19	56164049	56164049	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:56164049G>C	ENST00000586790.1	+	5	1684	c.780G>C	c.(778-780)aaG>aaC	p.K260N	U2AF2_ENST00000450554.2_5'Flank|CCDC106_ENST00000591578.1_Missense_Mutation_p.K260N|CCDC106_ENST00000308964.3_Missense_Mutation_p.K260N|CCDC106_ENST00000588740.1_Missense_Mutation_p.K260N|U2AF2_ENST00000308924.4_5'Flank|CCDC106_ENST00000591241.1_Missense_Mutation_p.K225N			Q9BWC9	CC106_HUMAN	coiled-coil domain containing 106	260						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|lung(5)|skin(1)	11		Colorectal(82;0.00403)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		AGACGCTCAAGAAGGTGCAGG	0.662																																						dbGAP											0													66.0	60.0	62.0					19																	56164049		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054984	CCDS33118.1	19q13.42	2013-09-20			ENSG00000173581	ENSG00000173581			30181	protein-coding gene	gene with protein product		613478				8619474, 9110174	Standard	XM_005258827		Approved	HSU79303	uc002qlr.3	Q9BWC9	OTTHUMG00000180907	ENST00000586790.1:c.780G>C	19.37:g.56164049G>C	ENSP00000465757:p.Lys260Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUF9|D3K183|Q99786	Missense_Mutation	SNP	NULL	p.K260N	ENST00000586790.1	37	c.780	CCDS33118.1	19	.	.	.	.	.	.	.	.	.	.	G	14.31	2.498294	0.44455	.	.	ENSG00000173581	ENST00000308964	.	.	.	3.82	1.66	0.24008	.	0.245199	0.41001	D	0.000966	T	0.28962	0.0719	N	0.08118	0	0.38176	D	0.939489	B	0.18013	0.025	B	0.16289	0.015	T	0.07966	-1.0745	9	0.28530	T	0.3	-20.1572	10.936	0.47245	0.1177:0.0:0.8823:0.0	.	260	Q9BWC9	CC106_HUMAN	N	260	.	ENSP00000309681:K260N	K	+	3	2	CCDC106	60855861	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	2.545000	0.45769	0.409000	0.25649	0.555000	0.69702	AAG	CCDC106	-	NULL	ENSG00000173581		0.662	CCDC106-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC106	HGNC	protein_coding	OTTHUMT00000453593.1	46	0.00	0	G	NM_013301		56164049	56164049	+1	no_errors	ENST00000308964	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	1.000	C
CCDC113	29070	genome.wustl.edu	37	16	58287992	58287992	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr16:58287992G>T	ENST00000219299.4	+	3	398	c.319G>T	c.(319-321)Gag>Tag	p.E107*	CCDC113_ENST00000443128.2_Intron	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113	107						cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)				large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						GGTACAAAAAGAGGTTGCGGA	0.562																																						dbGAP											0													145.0	112.0	123.0					16																	58287992		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	ENST00000219299.4:c.319G>T	16.37:g.58287992G>T	ENSP00000219299:p.Glu107*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAQ7|B4DR20|Q9NZX2	Nonsense_Mutation	SNP	NULL	p.E107*	ENST00000219299.4	37	c.319	CCDS10795.1	16	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439264	0.43326	.	.	ENSG00000103021	ENST00000219299	.	.	.	5.55	4.6	0.57074	.	0.051995	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-26.6662	10.3236	0.43780	0.0905:0.0:0.9095:0.0	.	.	.	.	X	107	.	ENSP00000219299:E107X	E	+	1	0	CCDC113	56845493	1.000000	0.71417	0.994000	0.49952	0.105000	0.19272	6.070000	0.71220	1.341000	0.45600	0.655000	0.94253	GAG	CCDC113	-	NULL	ENSG00000103021		0.562	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC113	HGNC	protein_coding	OTTHUMT00000257387.2	294	0.00	0	G	NM_014157		58287992	58287992	+1	no_errors	ENST00000219299	ensembl	human	known	69_37n	nonsense	98	24.43	32	SNP	0.995	T
CCDC13	152206	genome.wustl.edu	37	3	42754772	42754772	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:42754772C>G	ENST00000310232.6	-	14	1838	c.1755G>C	c.(1753-1755)gaG>gaC	p.E585D		NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	585										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						GCAGCTTCCTCTCTGACTCCA	0.617																																						dbGAP											0													104.0	97.0	99.0					3																	42754772		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1755G>C	3.37:g.42754772C>G	ENSP00000309836:p.Glu585Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Prefoldin	p.E585D	ENST00000310232.6	37	c.1755	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747376	0.30955	.	.	ENSG00000244607	ENST00000310232	T	0.12774	2.65	5.23	3.31	0.37934	.	0.256670	0.36893	N	0.002341	T	0.12561	0.0305	L	0.49126	1.545	0.29159	N	0.877856	B	0.13594	0.008	B	0.13407	0.009	T	0.07888	-1.0749	10	0.39692	T	0.17	.	8.44	0.32810	0.0:0.6908:0.143:0.1662	.	585	Q8IYE1	CCD13_HUMAN	D	585	ENSP00000309836:E585D	ENSP00000309836:E585D	E	-	3	2	CCDC13	42729776	1.000000	0.71417	0.622000	0.29159	0.796000	0.44982	1.183000	0.32041	1.224000	0.43551	0.585000	0.79938	GAG	CCDC13	-	NULL	ENSG00000244607		0.617	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	HGNC	protein_coding	OTTHUMT00000256652.1	155	0.00	0	C	NM_144719		42754772	42754772	-1	no_errors	ENST00000310232	ensembl	human	known	69_37n	missense	73	13.10	11	SNP	0.949	G
CCND1	595	genome.wustl.edu	37	11	69465940	69465940	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr11:69465940C>T	ENST00000227507.2	+	5	1005	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C	ORAOV1_ENST00000542515.1_5'Flank	NM_053056.2	NP_444284.1	P24385	CCND1_HUMAN	cyclin D1	260					canonical Wnt signaling pathway (GO:0060070)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|lactation (GO:0007595)|Leydig cell differentiation (GO:0033327)|liver development (GO:0001889)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ regeneration (GO:0031100)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|positive regulation of protein phosphorylation (GO:0001934)|re-entry into mitotic cell cycle (GO:0000320)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to organonitrogen compound (GO:0010243)|response to UV-A (GO:0070141)|response to vitamin E (GO:0033197)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)|transcriptional repressor complex (GO:0017053)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|proline-rich region binding (GO:0070064)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			NS(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|ovary(1)|urinary_tract(1)	23	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		Arsenic trioxide(DB01169)	GTCAAGCCTGCGCCAGGCCCA	0.662			T	"""IGH@, FSTL3"""	"""CLL, B-ALL, breast"""					Multiple Myeloma(6;0.086)																											Pancreas(65;393 884 2788 21700 24360 27795 36895)	dbGAP		Dom	yes		11	11q13	595	cyclin D1		"""L, E"""	0													35.0	31.0	32.0					11																	69465940		2200	4294	6494	-	-	-	SO:0001583	missense	0			Z23022	CCDS8191.1	11q13	2008-07-18	2005-09-12		ENSG00000110092	ENSG00000110092			1582	protein-coding gene	gene with protein product	"""parathyroid adenomatosis 1"", ""B-cell CLL/lymphoma 1"", ""G1/S-specific cyclin D1"""	168461	"""cyclin D1 (PRAD1: parathyroid adenomatosis 1)"""	BCL1, D11S287E, PRAD1		1826542, 1833066	Standard	XM_006718653		Approved	U21B31	uc001opa.3	P24385	OTTHUMG00000167877	ENST00000227507.2:c.778C>T	11.37:g.69465940C>T	ENSP00000227507:p.Arg260Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LEF0	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.R260C	ENST00000227507.2	37	c.778	CCDS8191.1	11	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937698	0.73557	.	.	ENSG00000110092	ENST00000227507;ENST00000542897	T	0.22743	1.94	5.15	5.15	0.70609	Cyclin, C-terminal (1);	0.054825	0.64402	D	0.000001	T	0.24470	0.0593	L	0.52126	1.63	0.80722	D	1	B	0.29936	0.262	B	0.28465	0.09	T	0.03403	-1.1040	10	0.52906	T	0.07	.	18.6432	0.91402	0.0:1.0:0.0:0.0	.	260	P24385	CCND1_HUMAN	C	260;126	ENSP00000227507:R260C	ENSP00000227507:R260C	R	+	1	0	CCND1	69175121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.561000	0.45905	2.403000	0.81681	0.561000	0.74099	CGC	CCND1	-	pfam_Cyclin_C,pirsf_Cyclin_A/B/D/E	ENSG00000110092		0.662	CCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCND1	HGNC	protein_coding	OTTHUMT00000396775.2	111	0.88	1	C	NM_053056		69465940	69465940	+1	no_errors	ENST00000227507	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	T
CD93	22918	genome.wustl.edu	37	20	23065739	23065739	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr20:23065739C>A	ENST00000246006.4	-	1	1238	c.1091G>T	c.(1090-1092)gGc>gTc	p.G364V		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	364	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCAGCGGAAGCCCCCAGGGGT	0.647																																						dbGAP											0													35.0	37.0	36.0					20																	23065739		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1091G>T	20.37:g.23065739C>A	ENSP00000246006:p.Gly364Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O00274	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_MFS_dom_general_subst_transpt,smart_C-type_lectin,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_CD93/CD141,pfscan_EG-like_dom,pfscan_C-type_lectin	p.G364V	ENST00000246006.4	37	c.1091	CCDS13149.1	20	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625849	0.46840	.	.	ENSG00000125810	ENST00000246006	T	0.29397	1.57	4.89	4.89	0.63831	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	1.041780	0.07524	N	0.910979	T	0.43875	0.1267	M	0.66297	2.02	0.47123	D	0.99932	P	0.46706	0.883	B	0.44224	0.444	T	0.49031	-0.8981	10	0.59425	D	0.04	-12.2761	17.5756	0.87947	0.0:1.0:0.0:0.0	.	364	Q9NPY3	C1QR1_HUMAN	V	364	ENSP00000246006:G364V	ENSP00000246006:G364V	G	-	2	0	CD93	23013739	1.000000	0.71417	0.959000	0.39883	0.443000	0.32047	4.344000	0.59354	2.696000	0.92011	0.650000	0.86243	GGC	CD93	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_CD93/CD141,pfscan_EG-like_dom	ENSG00000125810		0.647	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	HGNC	protein_coding	OTTHUMT00000078312.2	79	0.00	0	C	NM_012072		23065739	23065739	-1	no_errors	ENST00000246006	ensembl	human	known	69_37n	missense	43	35.82	24	SNP	0.996	A
CEACAM18	729767	genome.wustl.edu	37	19	51986358	51986358	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:51986358A>G	ENST00000396477.4	+	4	782	c.761A>G	c.(760-762)gAg>gGg	p.E254G	CEACAM18_ENST00000451626.1_Missense_Mutation_p.E315G	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	254	Ig-like C2-type.									breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GTGGAAATGGAGTGTATCTGC	0.507																																						dbGAP											0													209.0	202.0	204.0					19																	51986358		1999	4181	6180	-	-	-	SO:0001583	missense	0					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.761A>G	19.37:g.51986358A>G	ENSP00000379738:p.Glu254Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JN24	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E315G	ENST00000396477.4	37	c.944		19	.	.	.	.	.	.	.	.	.	.	.	12.44	1.938776	0.34189	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.12147	2.71	2.76	-4.11	0.03928	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.14356	0.0347	L	0.58669	1.825	0.09310	N	1	B	0.33549	0.417	B	0.41412	0.356	T	0.31916	-0.9926	9	0.27785	T	0.31	-0.5073	5.4784	0.16708	0.2527:0.512:0.2353:0.0	.	315	A8MTB9	CEA18_HUMAN	G	315;254;254	ENSP00000402203:E315G	ENSP00000379738:E254G	E	+	2	0	CEACAM18	56678170	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.364000	0.07583	-1.124000	0.02936	0.374000	0.22700	GAG	CEACAM18	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000213822		0.507	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2	273	0.36	1	A			51986358	51986358	+1	no_errors	ENST00000451626	ensembl	human	known	69_37n	missense	99	62.41	166	SNP	0.000	G
CHD3	1107	genome.wustl.edu	37	17	7798780	7798780	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr17:7798780C>T	ENST00000330494.7	+	10	1777	c.1627C>T	c.(1627-1629)Caa>Taa	p.Q543*	CHD3_ENST00000380358.4_Nonsense_Mutation_p.Q602*|CHD3_ENST00000358181.4_Nonsense_Mutation_p.Q543*	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	543	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CCGTCCTCTTCAAGGCAGATC	0.562																																						dbGAP											0													133.0	107.0	116.0					17																	7798780		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1627C>T	17.37:g.7798780C>T	ENSP00000332628:p.Gln543*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTQ9|E9PG89|Q9Y4I0	Nonsense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Q543*	ENST00000330494.7	37	c.1627	CCDS32554.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.579075|5.579075	0.96565|0.96565	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494|ENST00000452447	.|.	.|.	.|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.000000|.	0.44902|.	D|.	0.000418|.	.|T	.|0.55433	.|0.1920	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63444	.|-0.6636	.|3	0.16896|.	T|.	0.51|.	-15.7561|-15.7561	11.0224|11.0224	0.47726|0.47726	0.1344:0.7188:0.1468:0.0|0.1344:0.7188:0.1468:0.0	.|.	.|.	.|.	.|.	X|L	602;543;543|413	.|.	ENSP00000332628:Q543X|.	Q|S	+|+	1|2	0|0	CHD3|CHD3	7739505|7739505	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.893000|0.893000	0.52053|0.52053	0.881000|0.881000	0.28173|0.28173	2.733000|2.733000	0.93635|0.93635	0.561000|0.561000	0.74099|0.74099	CAA|TCA	CHD3	-	superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000170004		0.562	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	238	0.00	0	C	NM_001005273		7798780	7798780	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	nonsense	45	36.11	26	SNP	1.000	T
CHN1	1123	genome.wustl.edu	37	2	175673727	175673727	+	Silent	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:175673727G>A	ENST00000409900.3	-	11	1321	c.1008C>T	c.(1006-1008)atC>atT	p.I336I	CHN1_ENST00000409156.3_Silent_p.I310I|CHN1_ENST00000488080.1_5'UTR|CHN1_ENST00000409597.1_Silent_p.I152I|CHN1_ENST00000295497.7_Silent_p.I211I	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	336	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			TGATAATGTTGATATCTTCAT	0.348			T	TAF15	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	0													190.0	184.0	186.0					2																	175673727		1881	4112	5993	-	-	-	SO:0001819	synonymous_variant	0				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.1008C>T	2.37:g.175673727G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Silent	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pirsf_N-chimaerin,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.I336	ENST00000409900.3	37	c.1008	CCDS46455.1	2																																																																																			CHN1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pirsf_N-chimaerin,pfscan_RhoGAP_dom	ENSG00000128656		0.348	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHN1	HGNC	protein_coding	OTTHUMT00000334453.1	353	0.00	0	G	NM_001822		175673727	175673727	-1	no_errors	ENST00000409900	ensembl	human	known	69_37n	silent	188	14.16	31	SNP	1.000	A
CLPX	10845	genome.wustl.edu	37	15	65456441	65456441	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr15:65456441C>G	ENST00000300107.3	-	5	787	c.599G>C	c.(598-600)aGa>aCa	p.R200T		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	200					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						ATTATATATTCTCTTATAATG	0.358																																						dbGAP											0													94.0	99.0	97.0					15																	65456441		2202	4299	6501	-	-	-	SO:0001583	missense	0			AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.599G>C	15.37:g.65456441C>G	ENSP00000300107:p.Arg200Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L428|A8K8F1|B9EGI8|Q9H4D9	Missense_Mutation	SNP	pfam_ATPase_AAA-2,pfam_Clp_ATPase_C,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_Sigma_54_int,smart_AAA+_ATPase,tigrfam_Clp_protease_ATP-bd_su_ClpX	p.R200T	ENST00000300107.3	37	c.599	CCDS10202.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.282795	0.95489	.	.	ENSG00000166855	ENST00000300107;ENST00000546194	T	0.31247	1.5	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.65647	0.2711	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.91635	0.977;0.999	T	0.69367	-0.5164	10	0.72032	D	0.01	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	200;200	Q9H072;O76031	.;CLPX_HUMAN	T	200	ENSP00000300107:R200T	ENSP00000300107:R200T	R	-	2	0	CLPX	63243494	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.814000	0.86154	2.880000	0.98712	0.650000	0.86243	AGA	CLPX	-	NULL	ENSG00000166855		0.358	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPX	HGNC	protein_coding	OTTHUMT00000256828.2	160	0.00	0	C	NM_006660		65456441	65456441	-1	no_errors	ENST00000300107	ensembl	human	known	69_37n	missense	204	12.45	29	SNP	1.000	G
COG4	25839	genome.wustl.edu	37	16	70542309	70542309	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr16:70542309C>T	ENST00000323786.5	-	8	1082	c.1061G>A	c.(1060-1062)aGa>aAa	p.R354K		NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	350					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				GGATTATTACCTTGGTTCGAT	0.383																																						dbGAP											0													187.0	172.0	177.0					16																	70542309		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.1061+1G>A	16.37:g.70542309C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.R354K	ENST00000323786.5	37	c.1061	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541141	0.45280	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000539961	T	0.44083	0.93	5.8	5.8	0.92144	Conserved oligomeric Golgi complex, subunit 4 (2);	0.038752	0.85682	D	0.000000	T	0.31167	0.0788	N	0.17312	0.475	0.80722	D	1	B;B;B	0.30439	0.279;0.003;0.01	B;B;B	0.30029	0.11;0.015;0.039	T	0.06643	-1.0815	9	.	.	.	-17.2719	20.0706	0.97721	0.0:1.0:0.0:0.0	.	260;349;350	Q8N8L9;Q6PIW8;Q9H9E3	.;.;COG4_HUMAN	K	354;350;12	ENSP00000315775:R354K	.	R	-	2	0	COG4	69099810	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.829000	0.75314	2.744000	0.94065	0.655000	0.94253	AGA	COG4	-	pfam_COG_su4,smart_COG_su4	ENSG00000103051		0.383	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3	412	0.00	0	C		Missense_Mutation	70542309	70542309	-1	no_errors	ENST00000323786	ensembl	human	known	69_37n	missense	223	22.57	65	SNP	1.000	T
COL6A5	256076	genome.wustl.edu	37	3	130119918	130119918	+	Silent	SNP	T	T	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:130119918T>C	ENST00000432398.2	+	11	4529	c.4035T>C	c.(4033-4035)caT>caC	p.H1345H	COL6A5_ENST00000265379.6_Silent_p.H1345H	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1345	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CAACTGCTCATCATGAGTTTT	0.383																																						dbGAP											0													197.0	168.0	177.0					3																	130119918		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4035T>C	3.37:g.130119918T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.H1345	ENST00000432398.2	37	c.4035		3																																																																																			COL6A5	-	NULL	ENSG00000172752		0.383	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		306	0.00	0	T	NM_153264		130119918	130119918	+1	no_errors	ENST00000265379	ensembl	human	known	69_37n	silent	124	32.97	61	SNP	0.002	C
CSMD1	64478	genome.wustl.edu	37	8	3216706	3216706	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr8:3216706C>T	ENST00000520002.1	-	22	3830	c.3275G>A	c.(3274-3276)cGt>cAt	p.R1092H	CSMD1_ENST00000602723.1_Missense_Mutation_p.R1092H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1091H|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1092H|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1091H|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1092H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1091H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1092	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTCCACACACGGCGGCCCCC	0.562																																						dbGAP											0													70.0	74.0	72.0					8																	3216706		2203	4300	6503	-	-	-	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3275G>A	8.37:g.3216706C>T	ENSP00000430733:p.Arg1092His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.R1092H	ENST00000520002.1	37	c.3275		8	.	.	.	.	.	.	.	.	.	.	c	36	5.695321	0.96793	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	5.34	5.34	0.76211	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.84483	0.5482	M	0.92268	3.29	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.994	D;D;P	0.85130	0.997;0.957;0.837	D	0.87265	0.2282	10	0.52906	T	0.07	.	19.067	0.93116	0.0:1.0:0.0:0.0	.	1092;1092;1092	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	H	1092;1092;954;1091;1091;1091	ENSP00000383047:R1092H;ENSP00000430733:R1092H;ENSP00000441462:R1091H;ENSP00000446243:R1091H;ENSP00000441675:R1091H	ENSP00000320445:R954H	R	-	2	0	CSMD1	3204113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.762000	0.62250	2.489000	0.83994	0.550000	0.68814	CGT	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.562	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	108	0.00	0	C	NM_033225		3216706	3216706	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	T
CTCF	10664	genome.wustl.edu	37	16	67644837	67644837	+	Silent	SNP	A	A	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr16:67644837A>G	ENST00000264010.4	+	3	546	c.102A>G	c.(100-102)gaA>gaG	p.E34E	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	34					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GGGGCCAGGAAGAAGATGCCT	0.532																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											0													55.0	60.0	58.0					16																	67644837		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.102A>G	16.37:g.67644837A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC38|Q53XI7|Q59EL8	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E34	ENST00000264010.4	37	c.102	CCDS10841.1	16																																																																																			CTCF	-	NULL	ENSG00000102974		0.532	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	58	0.00	0	A	NM_006565		67644837	67644837	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	silent	39	22.00	11	SNP	1.000	G
CTNNA2	1496	genome.wustl.edu	37	2	80620360	80620360	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:80620360C>T	ENST00000402739.4	+	7	1086	c.1081C>T	c.(1081-1083)Cct>Tct	p.P361S	CTNNA2_ENST00000361291.4_Missense_Mutation_p.P395S|CTNNA2_ENST00000496558.1_Missense_Mutation_p.P361S|CTNNA2_ENST00000540488.1_Missense_Mutation_p.P361S|CTNNA2_ENST00000343114.3_Missense_Mutation_p.P40S|CTNNA2_ENST00000466387.1_Missense_Mutation_p.P361S|CTNNA2_ENST00000541047.1_Missense_Mutation_p.P361S	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	361					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AAAAGGAGATCCTCTCAACAT	0.284																																						dbGAP											0													93.0	88.0	90.0					2																	80620360		1823	4076	5899	-	-	-	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1081C>T	2.37:g.80620360C>T	ENSP00000384638:p.Pro361Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.P395S	ENST00000402739.4	37	c.1183		2	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474450	0.26423	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	T;T;T;T;T;T;T;T	0.61742	1.29;1.29;1.29;1.29;1.29;1.29;2.58;0.08	5.88	5.88	0.94601	.	0.059063	0.64402	D	0.000002	T	0.44435	0.1293	N	0.15975	0.35	0.58432	D	0.999999	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.23275	0.045;0.004;0.004	T	0.29336	-1.0015	9	.	.	.	.	19.8137	0.96557	0.0:1.0:0.0:0.0	.	361;361;361	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	S	361;361;395;361;361;361;40;26	ENSP00000418191:P361S;ENSP00000419295:P361S;ENSP00000355398:P395S;ENSP00000384638:P361S;ENSP00000444675:P361S;ENSP00000441705:P361S;ENSP00000341500:P40S;ENSP00000386587:P26S	.	P	+	1	0	CTNNA2	80473871	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	2.717000	0.47227	2.780000	0.95670	0.655000	0.94253	CCT	CTNNA2	-	pfam_Vinculin/catenin	ENSG00000066032		0.284	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	81	0.00	0	C	NM_004389		80620360	80620360	+1	no_errors	ENST00000361291	ensembl	human	known	69_37n	missense	96	13.51	15	SNP	1.000	T
DBNDD2	55861	genome.wustl.edu	37	20	44037247	44037248	+	Splice_Site	INS	-	-	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr20:44037247_44037248insT	ENST00000372720.3	+	2	664		c.e2+1		SYS1-DBNDD2_ENST00000452133.1_Splice_Site|DBNDD2_ENST00000372723.3_Splice_Site|DBNDD2_ENST00000372712.2_Splice_Site|DBNDD2_ENST00000372722.3_Splice_Site|TP53TG5_ENST00000494455.1_5'Flank|DBNDD2_ENST00000372717.1_Splice_Site|DBNDD2_ENST00000372710.3_Splice_Site|DBNDD2_ENST00000360981.4_Splice_Site|SYS1-DBNDD2_ENST00000475242.1_Splice_Site|DBNDD2_ENST00000357275.2_Splice_Site	NM_018478.3	NP_060948.3	Q9BQY9	DBND2_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 2						negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)				breast(1)|lung(2)	3		Myeloproliferative disorder(115;0.0122)				TCGCAGAGACGTAAGTCCCAAG	0.545																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AF220191	CCDS42880.1, CCDS42881.1, CCDS56193.1, CCDS56194.1	20q13.12	2007-07-23	2006-04-04	2006-04-04	ENSG00000244274	ENSG00000244274			15881	protein-coding gene	gene with protein product		611453	"""chromosome 20 open reading frame 35"""	C20orf35			Standard	NM_001048225		Approved	HSMNP1	uc002xof.3	Q9BQY9	OTTHUMG00000032576	ENST00000372720.3:c.433+1->T	20.37:g.44037248_44037248dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q331S6|Q5QPV4|Q5QPV6|Q9BQZ0|Q9BVL1|Q9H1F6|Q9NWZ0|Q9NY07|Q9NZ31	Splice_Site	INS	-	e2+1	ENST00000372720.3	37	c.433+1_433+1	CCDS56193.1	20																																																																																			DBNDD2	-	-	ENSG00000244274		0.545	DBNDD2-001	KNOWN	basic|CCDS	protein_coding	DBNDD2	HGNC	protein_coding	OTTHUMT00000079438.1	122	0.00	0	-	NM_018478	Intron	44037247	44037248	+1	no_errors	ENST00000372720	ensembl	human	known	69_37n	splice_site_ins	78	23.53	24	INS	1.000:1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155410719	155410719	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr4:155410719C>A	ENST00000339452.1	-	1	2149	c.1789G>T	c.(1789-1791)Gtc>Ttc	p.V597F	DCHS2_ENST00000456341.2_Missense_Mutation_p.V590F|DCHS2_ENST00000443500.1_Missense_Mutation_p.V597F	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1719	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GCGGTGTGGACCATCTTTGAT	0.587																																						dbGAP											0													28.0	29.0	29.0					4																	155410719		692	1591	2283	-	-	-	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1789G>T	4.37:g.155410719C>A	ENSP00000345062:p.Val597Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V597F	ENST00000339452.1	37	c.1789	CCDS47150.1	4	.	.	.	.	.	.	.	.	.	.	c	0.007	-2.015486	0.00422	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.59638	0.27;0.25;0.27	.	.	.	.	.	.	.	.	T	0.55114	0.1900	L	0.52126	1.63	0.09310	N	1	P;D	0.54601	0.91;0.967	P;B	0.53490	0.727;0.275	T	0.47749	-0.9093	7	0.16896	T	0.51	.	.	.	.	.	597;597	E9PG03;E9PC11	.;.	F	597;597;590;597	ENSP00000345062:V597F;ENSP00000408543:V590F;ENSP00000395539:V597F	ENSP00000345062:V597F	V	-	1	0	DCHS2	155630169	0.010000	0.17322	0.015000	0.15790	0.019000	0.09904	0.055000	0.14229	0.064000	0.16427	0.064000	0.15345	GTC	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.587	DCHS2-002	KNOWN	basic|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365282.1	46	0.00	0	C	NM_001142552		155410719	155410719	-1	no_errors	ENST00000339452	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.018	A
DNAH10	196385	genome.wustl.edu	37	12	124417966	124417966	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr12:124417966G>A	ENST00000409039.3	+	76	13056	c.13031G>A	c.(13030-13032)cGg>cAg	p.R4344Q	CCDC92_ENST00000544798.1_Intron|RP11-380L11.3_ENST00000602292.1_RNA|DNAH10_ENST00000538983.1_3'UTR|DNAH10OS_ENST00000514254.2_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4344					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCCACCTGCCGGAAGAACGGC	0.617																																						dbGAP											0													33.0	35.0	35.0					12																	124417966		1976	4146	6122	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.13031G>A	12.37:g.124417966G>A	ENSP00000386770:p.Arg4344Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.R4344Q	ENST00000409039.3	37	c.13031	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	36	5.867378	0.97043	.	.	ENSG00000197653	ENST00000409039	T	0.12361	2.69	5.18	5.18	0.71444	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.51278	0.1665	H	0.94423	3.535	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66866	-0.5815	10	0.87932	D	0	.	18.3051	0.90177	0.0:0.0:1.0:0.0	.	4344	Q8IVF4	DYH10_HUMAN	Q	4344	ENSP00000386770:R4344Q	ENSP00000386770:R4344Q	R	+	2	0	DNAH10	122983919	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.623000	0.98386	2.413000	0.81919	0.561000	0.74099	CGG	DNAH10	-	pfam_Dynein_heavy	ENSG00000197653		0.617	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	69	0.00	0	G			124417966	124417966	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	4	66.67	8	SNP	1.000	A
DOPEY1	23033	genome.wustl.edu	37	6	83847715	83847715	+	Silent	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr6:83847715C>T	ENST00000349129.2	+	21	4214	c.3954C>T	c.(3952-3954)ctC>ctT	p.L1318L	DOPEY1_ENST00000369739.3_Silent_p.L1309L|DOPEY1_ENST00000237163.5_Silent_p.L1299L|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1318					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		ATGAAAAACTCAAACAAACCA	0.378																																						dbGAP											0													72.0	72.0	72.0					6																	83847715		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3954C>T	6.37:g.83847715C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.L1318	ENST00000349129.2	37	c.3954	CCDS4996.1	6																																																																																			DOPEY1	-	superfamily_ARM-type_fold	ENSG00000083097		0.378	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	56	0.00	0	C	NM_015018		83847715	83847715	+1	no_errors	ENST00000349129	ensembl	human	known	69_37n	silent	37	32.73	18	SNP	0.991	T
EFCAB12	90288	genome.wustl.edu	37	3	129120504	129120504	+	Missense_Mutation	SNP	G	G	T	rs551533324		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:129120504G>T	ENST00000505956.1	-	9	1813	c.1651C>A	c.(1651-1653)Ccc>Acc	p.P551T	RPL32P3_ENST00000514355.1_RNA|EFCAB12_ENST00000326085.3_Missense_Mutation_p.P551T	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	551							calcium ion binding (GO:0005509)										TTCCTAAGGGGCCACCAGTGG	0.587																																						dbGAP											0													110.0	109.0	109.0					3																	129120504		2054	4192	6246	-	-	-	SO:0001583	missense	0			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.1651C>A	3.37:g.129120504G>T	ENSP00000420854:p.Pro551Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX4	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.P551T	ENST00000505956.1	37	c.1651	CCDS54638.1	3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162107	0.78226	.	.	ENSG00000172771	ENST00000505956;ENST00000326085	T;T	0.25912	1.77;1.77	5.81	5.81	0.92471	.	0.000000	0.45606	D	0.000345	T	0.42177	0.1191	L	0.34521	1.04	0.36037	D	0.839837	D	0.89917	1.0	D	0.97110	1.0	T	0.46020	-0.9221	10	0.62326	D	0.03	-34.0503	16.9993	0.86377	0.0:0.0:1.0:0.0	.	551	Q6NXP0	CC025_HUMAN	T	551	ENSP00000420854:P551T;ENSP00000324241:P551T	ENSP00000324241:P551T	P	-	1	0	C3orf25	130603194	1.000000	0.71417	0.999000	0.59377	0.836000	0.47400	4.127000	0.57944	2.746000	0.94184	0.655000	0.94253	CCC	EFCAB12	-	NULL	ENSG00000172771		0.587	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB12	HGNC	protein_coding	OTTHUMT00000355530.1	862	0.12	1	G	NM_207307		129120504	129120504	-1	no_errors	ENST00000326085	ensembl	human	known	69_37n	missense	298	23.79	93	SNP	1.000	T
EFTUD1	79631	genome.wustl.edu	37	15	82533624	82533624	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr15:82533624C>T	ENST00000268206.7	-	5	533	c.365G>A	c.(364-366)gGa>gAa	p.G122E	EFTUD1_ENST00000359445.3_Missense_Mutation_p.G71E	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	122	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						TGGACAGACTCCTTCCACAGC	0.438																																						dbGAP											0													79.0	74.0	75.0					15																	82533624		1910	4121	6031	-	-	-	SO:0001583	missense	0			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.365G>A	15.37:g.82533624C>T	ENSP00000268206:p.Gly122Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.G122E	ENST00000268206.7	37	c.365	CCDS42071.1	15	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416363	0.83449	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	T;T	0.80653	-1.4;-1.4	4.19	4.19	0.49359	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.52532	U	0.000075	D	0.93409	0.7898	H	0.98525	4.255	0.80722	D	1	D;D	0.67145	0.996;0.98	D;D	0.68943	0.961;0.955	D	0.96008	0.8999	10	0.87932	D	0	-10.4638	16.0434	0.80701	0.0:1.0:0.0:0.0	.	71;122	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	E	122;71	ENSP00000268206:G122E;ENSP00000352418:G71E	ENSP00000268206:G122E	G	-	2	0	EFTUD1	80320679	1.000000	0.71417	0.992000	0.48379	0.933000	0.57130	7.427000	0.80284	2.316000	0.78162	0.404000	0.27445	GGA	EFTUD1	-	pfam_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	ENSG00000140598		0.438	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	HGNC	protein_coding	OTTHUMT00000419252.1	248	0.00	0	C	NM_024580		82533624	82533624	-1	no_errors	ENST00000268206	ensembl	human	known	69_37n	missense	139	17.26	29	SNP	1.000	T
EGFLAM	133584	genome.wustl.edu	37	5	38407076	38407076	+	Silent	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr5:38407076C>A	ENST00000354891.3	+	8	1321	c.975C>A	c.(973-975)ccC>ccA	p.P325P	EGFLAM_ENST00000322350.5_Silent_p.P325P|EGFLAM_ENST00000336740.6_Silent_p.P91P|EGFLAM_ENST00000397202.2_Intron	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	325					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CTCCCCAGCCCATTCCCATAC	0.502																																					Colon(62;485 1295 3347 17454)	dbGAP											0													140.0	133.0	135.0					5																	38407076		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.975C>A	5.37:g.38407076C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.P325	ENST00000354891.3	37	c.975	CCDS56363.1	5																																																																																			EGFLAM	-	NULL	ENSG00000164318		0.502	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	552	0.18	1	C	NM_152403		38407076	38407076	+1	no_errors	ENST00000354891	ensembl	human	known	69_37n	silent	352	14.36	59	SNP	0.998	A
ENPP4	22875	genome.wustl.edu	37	6	46108029	46108029	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr6:46108029G>T	ENST00000321037.4	+	2	939	c.709G>T	c.(709-711)Gat>Tat	p.D237Y		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	237					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						CATTACAAGTGATCATGGGAT	0.408																																						dbGAP											0													114.0	108.0	110.0					6																	46108029		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.709G>T	6.37:g.46108029G>T	ENSP00000318066:p.Asp237Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5G1|Q7L2N1	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.D237Y	ENST00000321037.4	37	c.709	CCDS34468.1	6	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514054	0.85389	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	D	0.92199	-2.99	5.91	5.91	0.95273	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.97857	0.9296	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98505	1.0616	10	0.87932	D	0	-33.2932	20.2985	0.98592	0.0:0.0:1.0:0.0	.	237	Q9Y6X5	ENPP4_HUMAN	Y	237	ENSP00000318066:D237Y	ENSP00000318066:D237Y	D	+	1	0	ENPP4	46215988	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.294000	0.96088	2.793000	0.96121	0.655000	0.94253	GAT	ENPP4	-	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000001561		0.408	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP4	HGNC	protein_coding	OTTHUMT00000040777.2	195	0.00	0	G			46108029	46108029	+1	no_errors	ENST00000321037	ensembl	human	known	69_37n	missense	44	38.03	27	SNP	1.000	T
EPHA3	2042	genome.wustl.edu	37	3	89176423	89176423	+	Splice_Site	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:89176423G>T	ENST00000336596.2	+	2	378	c.153G>T	c.(151-153)ggG>ggT	p.G51G	EPHA3_ENST00000452448.2_Splice_Site_p.G51G|EPHA3_ENST00000494014.1_Splice_Site_p.G51G	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	51	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CATCACATGGGGTGAGTTCAA	0.343										TSP Lung(6;0.00050)																												dbGAP											0													99.0	104.0	102.0					3																	89176423		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.153+1G>T	3.37:g.89176423G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H2V3|Q9H2V4	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.G51	ENST00000336596.2	37	c.153	CCDS2922.1	3																																																																																			EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000044524		0.343	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	183	0.00	0	G	NM_005233	Silent	89176423	89176423	+1	no_errors	ENST00000336596	ensembl	human	known	69_37n	silent	153	21.13	41	SNP	1.000	T
FAM167B	84734	genome.wustl.edu	37	1	32713189	32713189	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr1:32713189G>A	ENST00000373582.3	+	1	356	c.167G>A	c.(166-168)cGc>cAc	p.R56H		NM_032648.2	NP_116037.2	Q9BTA0	F167B_HUMAN	family with sequence similarity 167, member B	56								p.R56H(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(2)	5						CAGGCCTGGCGCAGGGCCCAA	0.637																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											35.0	45.0	42.0					1																	32713189		1949	4132	6081	-	-	-	SO:0001583	missense	0			BC004269	CCDS358.2	1p35.1	2010-08-27	2008-06-11	2008-06-11	ENSG00000183615	ENSG00000183615			28133	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 90"""	C1orf90		12477932	Standard	NM_032648		Approved	MGC10820	uc001buw.3	Q9BTA0	OTTHUMG00000007462	ENST00000373582.3:c.167G>A	1.37:g.32713189G>A	ENSP00000362684:p.Arg56His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDH6	Missense_Mutation	SNP	pfam_FAM167	p.R56H	ENST00000373582.3	37	c.167	CCDS358.2	1	.	.	.	.	.	.	.	.	.	.	g	9.421	1.083135	0.20309	.	.	ENSG00000183615	ENST00000373582	T	0.62639	0.01	5.32	-5.07	0.02938	.	1.202870	0.06305	U	0.701525	T	0.38480	0.1042	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20505	-1.0273	10	0.26408	T	0.33	-3.3016	8.7233	0.34454	0.5466:0.0:0.3569:0.0965	.	56	Q9BTA0	F167B_HUMAN	H	56	ENSP00000362684:R56H	ENSP00000362684:R56H	R	+	2	0	FAM167B	32485776	0.000000	0.05858	0.005000	0.12908	0.713000	0.41058	-0.761000	0.04751	-0.931000	0.03746	-0.258000	0.10820	CGC	FAM167B	-	NULL	ENSG00000183615		0.637	FAM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM167B	HGNC	protein_coding	OTTHUMT00000019615.2	56	0.00	0	G	NM_032648		32713189	32713189	+1	no_errors	ENST00000373582	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	0.000	A
FCGBP	8857	genome.wustl.edu	37	19	40376946	40376946	+	Missense_Mutation	SNP	G	G	A	rs139112212		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:40376946G>A	ENST00000221347.6	-	24	11483	c.11476C>T	c.(11476-11478)Ccc>Tcc	p.P3826S	FCGBP_ENST00000595713.1_5'UTR	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3826	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGAGAGTCGGGCACCACCTCC	0.642																																						dbGAP											0													10.0	12.0	11.0					19																	40376946		2089	4140	6229	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11476C>T	19.37:g.40376946G>A	ENSP00000221347:p.Pro3826Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.P3826S	ENST00000221347.6	37	c.11476	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	g	14.59	2.581579	0.46006	.	.	ENSG00000090920	ENST00000221347	T	0.19532	2.14	3.23	2.14	0.27477	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.21468	0.0517	M	0.66939	2.045	0.09310	N	1	B	0.30281	0.275	B	0.32465	0.146	T	0.28933	-1.0028	9	0.08179	T	0.78	.	11.3006	0.49302	0.0:0.1873:0.8127:0.0	.	3826	Q9Y6R7	FCGBP_HUMAN	S	3826	ENSP00000221347:P3826S	ENSP00000221347:P3826S	P	-	1	0	FCGBP	45068786	0.268000	0.24133	0.014000	0.15608	0.004000	0.04260	0.502000	0.22594	0.653000	0.30826	0.313000	0.20887	CCC	FCGBP	-	NULL	ENSG00000090920		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	52	0.00	0	G	NM_003890		40376946	40376946	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.036	A
FIGN	55137	genome.wustl.edu	37	2	164467143	164467143	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:164467143G>A	ENST00000333129.3	-	3	1513	c.1199C>T	c.(1198-1200)aCc>aTc	p.T400I	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	400					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GGAAGGAGGGGTCAGAGCCCT	0.468																																						dbGAP											0													86.0	87.0	87.0					2																	164467143		1996	4173	6169	-	-	-	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1199C>T	2.37:g.164467143G>A	ENSP00000333836:p.Thr400Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.T400I	ENST00000333129.3	37	c.1199	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872801	0.33069	.	.	ENSG00000182263	ENST00000333129	D	0.92446	-3.04	6.04	5.16	0.70880	.	0.050334	0.85682	D	0.000000	D	0.87684	0.6239	L	0.41236	1.265	0.58432	D	0.999999	P	0.44578	0.838	B	0.35413	0.202	D	0.87318	0.2316	10	0.42905	T	0.14	-16.2275	17.3399	0.87292	0.0:0.1251:0.8749:0.0	.	400	Q5HY92	FIGN_HUMAN	I	400	ENSP00000333836:T400I	ENSP00000333836:T400I	T	-	2	0	FIGN	164175389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.561000	0.73955	1.545000	0.49373	0.563000	0.77884	ACC	FIGN	-	NULL	ENSG00000182263		0.468	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	190	0.00	0	G	NM_018086		164467143	164467143	-1	no_errors	ENST00000333129	ensembl	human	known	69_37n	missense	116	23.53	36	SNP	1.000	A
GAS6	2621	genome.wustl.edu	37	13	114530000	114530000	+	Silent	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr13:114530000C>T	ENST00000327773.6	-	12	1592	c.1446G>A	c.(1444-1446)ggG>ggA	p.G482G	GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000418959.3_Silent_p.G183G|GAS6_ENST00000357389.3_Silent_p.G525G|GAS6_ENST00000355761.4_Silent_p.G428G|GAS6_ENST00000450766.1_Silent_p.G209G	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	525	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)	p.S447N(1)		central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CGAAGCCGCTCCCGGGGTAGA	0.562																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											140.0	110.0	120.0					13																	114530000		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.1446G>A	13.37:g.114530000C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Silent	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd,pfam_GLA_domain,superfamily_ConA-like_lec_gl,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.G525	ENST00000327773.6	37	c.1575	CCDS45072.1	13																																																																																			GAS6	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000183087		0.562	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAS6	HGNC	protein_coding	OTTHUMT00000045946.2	205	0.00	0	C	NM_000820		114530000	114530000	-1	no_errors	ENST00000357389	ensembl	human	known	69_37n	silent	60	15.49	11	SNP	0.070	T
GCK	2645	genome.wustl.edu	37	7	44189394	44189394	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:44189394T>A	ENST00000403799.3	-	6	1113	c.644A>T	c.(643-645)tAc>tTc	p.Y215F	GCK_ENST00000437084.1_Missense_Mutation_p.Y198F|GCK_ENST00000345378.2_Missense_Mutation_p.Y216F|GCK_ENST00000395796.3_Missense_Mutation_p.Y214F	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	215	Hexokinase type-1.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						ATGGTCTTCGTAGTAGCAGGA	0.562																																						dbGAP											0													164.0	136.0	146.0					7																	44189394		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.644A>T	7.37:g.44189394T>A	ENSP00000384247:p.Tyr215Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.Y216F	ENST00000403799.3	37	c.647	CCDS5479.1	7	.	.	.	.	.	.	.	.	.	.	T	24.1	4.499338	0.85069	.	.	ENSG00000106633	ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93	6.17	6.17	0.99709	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	L	0.60012	1.86	0.80722	D	1	D;B;D	0.63880	0.993;0.058;0.991	D;B;D	0.75020	0.985;0.055;0.975	D	0.99845	1.1065	10	0.39692	T	0.17	-26.0896	16.4957	0.84242	0.0:0.0:0.0:1.0	.	215;216;214	P35557;P35557-2;P35557-3	HXK4_HUMAN;.;.	F	215;214;216;198	ENSP00000384247:Y215F;ENSP00000379142:Y214F;ENSP00000223366:Y216F;ENSP00000402840:Y198F	ENSP00000223366:Y216F	Y	-	2	0	GCK	44155919	1.000000	0.71417	0.967000	0.41034	0.955000	0.61496	6.285000	0.72658	2.371000	0.80710	0.533000	0.62120	TAC	GCK	-	pfam_Hexokinase_N,prints_Hexokinase	ENSG00000106633		0.562	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCK	HGNC	protein_coding	OTTHUMT00000251069.2	390	0.00	0	T			44189394	44189394	-1	no_errors	ENST00000345378	ensembl	human	known	69_37n	missense	154	21.03	41	SNP	1.000	A
GIMAP1	170575	genome.wustl.edu	37	7	150417441	150417441	+	Silent	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:150417441C>T	ENST00000307194.5	+	3	489	c.349C>T	c.(349-351)Ctg>Ttg	p.L117L		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	117	AIG1-type G.				B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCGCTGCTCCTGGTGACCCA	0.617																																						dbGAP											0													44.0	43.0	43.0					7																	150417441		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.349C>T	7.37:g.150417441C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCI3|Q8NAZ0	Silent	SNP	pfam_AIG1	p.L117	ENST00000307194.5	37	c.349	CCDS5906.1	7																																																																																			GIMAP1	-	pfam_AIG1	ENSG00000213203		0.617	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP1	HGNC	protein_coding	OTTHUMT00000348951.2	97	0.00	0	C	NM_130759		150417441	150417441	+1	no_errors	ENST00000307194	ensembl	human	known	69_37n	silent	36	20.00	9	SNP	0.998	T
GRID1	2894	genome.wustl.edu	37	10	87362343	87362343	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:87362343C>A	ENST00000327946.7	-	16	2802	c.2717G>T	c.(2716-2718)gGg>gTg	p.G906V	GRID1_ENST00000552278.2_5'UTR|RP11-93H12.2_ENST00000443311.1_RNA|GRID1_ENST00000536331.1_Missense_Mutation_p.G477V	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	906					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AGCCAGGCCCCCCATCTCCAG	0.612										Multiple Myeloma(13;0.14)																												dbGAP											0													39.0	36.0	37.0					10																	87362343		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2717G>T	10.37:g.87362343C>A	ENSP00000330148:p.Gly906Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G906V	ENST00000327946.7	37	c.2717	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440570	0.63067	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.15487	2.66;2.42	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.23210	0.0561	L	0.53249	1.67	0.80722	D	1	P	0.44877	0.845	B	0.41135	0.348	T	0.01039	-1.1472	10	0.72032	D	0.01	.	18.8961	0.92424	0.0:1.0:0.0:0.0	.	906	Q9ULK0	GRID1_HUMAN	V	906;477	ENSP00000330148:G906V;ENSP00000444455:G477V	ENSP00000330148:G906V	G	-	2	0	GRID1	87352323	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.925000	0.63425	2.703000	0.92315	0.591000	0.81541	GGG	GRID1	-	NULL	ENSG00000182771		0.612	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	131	0.00	0	C	XM_043613		87362343	87362343	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	missense	72	16.28	14	SNP	1.000	A
GYG1	2992	genome.wustl.edu	37	3	148744285	148744285	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:148744285G>C	ENST00000345003.4	+	7	1175	c.875G>C	c.(874-876)aGa>aCa	p.R292T	GYG1_ENST00000484197.1_Intron|GYG1_ENST00000296048.6_Intron|GYG1_ENST00000479119.1_Intron	NM_004130.3	NP_004121.2	P46976	GLYG_HUMAN	glycogenin 1	292					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogenin glucosyltransferase activity (GO:0008466)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GGCTTCTGTAGAAAGGTATGC	0.368																																						dbGAP											0													165.0	162.0	163.0					3																	148744285		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF087942	CCDS3139.1, CCDS54654.1, CCDS54655.1	3q24-q25.1	2013-02-22	2005-11-04	2005-11-04	ENSG00000163754	ENSG00000163754	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4699	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	603942	"""glycogenin"""	GYG		8602861	Standard	NM_004130		Approved		uc003ewn.3	P46976	OTTHUMG00000159533	ENST00000345003.4:c.875G>C	3.37:g.148744285G>C	ENSP00000340736:p.Arg292Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNH0|D3DNH1|D3DNH2|Q6FHZ1|Q9UNV0	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.R292T	ENST00000345003.4	37	c.875	CCDS3139.1	3	.	.	.	.	.	.	.	.	.	.	G	9.037	0.988819	0.18966	.	.	ENSG00000163754	ENST00000345003	T	0.62639	0.01	5.64	5.64	0.86602	.	0.753644	0.13555	N	0.379213	T	0.56834	0.2012	L	0.50333	1.59	0.80722	D	1	P	0.44734	0.842	B	0.36922	0.236	T	0.56541	-0.7962	10	0.13470	T	0.59	-27.8484	19.7052	0.96069	0.0:0.0:1.0:0.0	.	292	P46976	GLYG_HUMAN	T	292	ENSP00000340736:R292T	ENSP00000340736:R292T	R	+	2	0	GYG1	150226975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.852000	0.69488	2.655000	0.90218	0.563000	0.77884	AGA	GYG1	-	NULL	ENSG00000163754		0.368	GYG1-001	KNOWN	basic|CCDS	protein_coding	GYG1	HGNC	protein_coding	OTTHUMT00000356046.1	311	0.32	1	G	NM_004130		148744285	148744285	+1	no_errors	ENST00000345003	ensembl	human	known	69_37n	missense	288	11.11	36	SNP	1.000	C
HIST1H1E	3008	genome.wustl.edu	37	6	26156800	26156800	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr6:26156800C>T	ENST00000304218.3	+	1	242	c.182C>T	c.(181-183)gCt>gTt	p.A61V	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	61	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						TCTTTGGCCGCTCTCAAGAAA	0.622																																						dbGAP											0													31.0	34.0	33.0					6																	26156800		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.182C>T	6.37:g.26156800C>T	ENSP00000307705:p.Ala61Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VB25	Missense_Mutation	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.A61V	ENST00000304218.3	37	c.182	CCDS4586.1	6	.	.	.	.	.	.	.	.	.	.	.	26.2	4.713153	0.89112	.	.	ENSG00000168298	ENST00000304218	T	0.15718	2.4	5.11	5.11	0.69529	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.112474	0.64402	D	0.000014	T	0.51227	0.1662	H	0.97265	3.97	0.80722	D	1	P	0.45474	0.859	P	0.61397	0.888	T	0.67715	-0.5599	10	0.87932	D	0	-3.8218	17.8759	0.88825	0.0:1.0:0.0:0.0	.	61	P10412	H14_HUMAN	V	61	ENSP00000307705:A61V	ENSP00000307705:A61V	A	+	2	0	HIST1H1E	26264779	1.000000	0.71417	0.998000	0.56505	0.776000	0.43924	5.869000	0.69613	2.542000	0.85734	0.561000	0.74099	GCT	HIST1H1E	-	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	ENSG00000168298		0.622	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1	79	0.00	0	C	NM_005321		26156800	26156800	+1	no_errors	ENST00000304218	ensembl	human	known	69_37n	missense	64	31.91	30	SNP	1.000	T
HKR1	284459	genome.wustl.edu	37	19	37853010	37853010	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:37853010G>A	ENST00000324411.4	+	6	582		c.e6-1		HKR1_ENST00000586897.1_Splice_Site|HKR1_ENST00000544914.1_Splice_Site|HKR1_ENST00000392153.3_Splice_Site|HKR1_ENST00000591417.1_Splice_Site|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000541583.2_Splice_Site|HKR1_ENST00000592168.1_3'UTR|HKR1_ENST00000591471.1_Splice_Site|HKR1_ENST00000589392.1_Missense_Mutation_p.E87K	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member						multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCTTCAGCAGAATCGAAGCC	0.448																																						dbGAP											0													75.0	77.0	76.0					19																	37853010		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.314-1G>A	19.37:g.37853010G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Splice_Site	SNP	-	e4-1	ENST00000324411.4	37	c.314-1	CCDS12502.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|G	13.88|13.88	2.367788|2.367788	0.42003|0.42003	.|.	.|.	ENSG00000181666|ENSG00000181666	ENST00000414402;ENST00000392153;ENST00000324411;ENST00000541583|ENST00000542144	.|.	.|.	.|.	2.71|2.71	2.71|2.71	0.32032|0.32032	.|.	.|.	.|.	.|.	.|.	.|T	.|0.36331	.|0.0963	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B;B	.|0.16166	.|0.016;0.016	.|B;B	.|0.15870	.|0.014;0.014	.|T	.|0.11817	.|-1.0572	.|7	.|0.12766	.|T	.|0.61	.|.	9.1594|9.1594	0.37012|0.37012	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|44;87	.|Q7Z6E1;B4DSY3	.|.;.	.|K	-1|141	.|.	.|ENSP00000440633:E141K	.|E	+|+	.|1	.|0	HKR1|HKR1	42544850|42544850	0.982000|0.982000	0.34865|0.34865	0.932000|0.932000	0.37286|0.37286	0.759000|0.759000	0.43091|0.43091	3.397000|3.397000	0.52572|0.52572	1.821000|1.821000	0.53095|0.53095	0.650000|0.650000	0.86243|0.86243	.|GAA	HKR1	-	-	ENSG00000181666		0.448	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HKR1	HGNC	protein_coding	OTTHUMT00000458375.1	152	0.00	0	G	NM_181786	Intron	37853010	37853010	+1	no_errors	ENST00000324411	ensembl	human	known	69_37n	splice_site	82	23.36	25	SNP	0.981	A
HOXA3	3200	genome.wustl.edu	37	7	27148069	27148069	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:27148069C>T	ENST00000396352.4	-	3	996	c.797G>A	c.(796-798)cGc>cAc	p.R266H	HOXA3_ENST00000521401.1_5'Flank|HOXA3_ENST00000317201.2_Missense_Mutation_p.R266H|HOXA-AS2_ENST00000518088.1_RNA	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	266					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CACGGGGCTGCGACTTGGAGA	0.602																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	dbGAP											0													116.0	113.0	114.0					7																	27148069		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.797G>A	7.37:g.27148069C>T	ENSP00000379640:p.Arg266His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D181	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.R266H	ENST00000396352.4	37	c.797	CCDS5404.1	7	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964113	0.53507	.	.	ENSG00000105997	ENST00000396352;ENST00000317201;ENST00000396350	D;D	0.87256	-2.23;-2.23	5.56	5.56	0.83823	.	0.053164	0.64402	D	0.000001	D	0.84097	0.5397	L	0.52206	1.635	0.53688	D	0.999979	P	0.38300	0.626	B	0.32022	0.139	D	0.84641	0.0695	10	0.49607	T	0.09	.	19.5376	0.95260	0.0:1.0:0.0:0.0	.	266	O43365	HXA3_HUMAN	H	266;266;108	ENSP00000379640:R266H;ENSP00000324884:R266H	ENSP00000324884:R266H	R	-	2	0	HOXA3	27114594	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.592000	0.53993	2.620000	0.88729	0.655000	0.94253	CGC	HOXA3	-	NULL	ENSG00000105997		0.602	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA3	HGNC	protein_coding	OTTHUMT00000358708.2	252	0.00	0	C			27148069	27148069	-1	no_errors	ENST00000317201	ensembl	human	known	69_37n	missense	153	29.17	63	SNP	1.000	T
HPSE	10855	genome.wustl.edu	37	4	84216541	84216542	+	Frame_Shift_Del	DEL	TA	TA	-	rs145553296		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr4:84216541_84216542delTA	ENST00000405413.2	-	13	1723_1724	c.1587_1588delTA	c.(1585-1590)tatagtfs	p.YS529fs	HPSE_ENST00000513463.1_Frame_Shift_Del_p.YS471fs|HPSE_ENST00000311412.5_Frame_Shift_Del_p.YS529fs|HPSE_ENST00000512196.1_Frame_Shift_Del_p.YS455fs	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	529	Required for transferring proheparanase to the Golgi apparatus, secretion and subsequent enzyme activity and for enhancement of PKB/AKT1 phosphorylation.				carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	ACAAAAAAACTATATGAGAAAG	0.381																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.1587_1588delTA	4.37:g.84216543_84216544delTA	ENSP00000384262:p.Tyr529fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Frame_Shift_Del	DEL	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.Y529fs	ENST00000405413.2	37	c.1588_1587	CCDS3602.1	4																																																																																			HPSE	-	NULL	ENSG00000173083		0.381	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HPSE	HGNC	protein_coding	OTTHUMT00000252812.2	117	0.00	0	TA	NM_006665		84216541	84216542	-1	no_errors	ENST00000311412	ensembl	human	known	69_37n	frame_shift_del	105	62.54	192	DEL	0.412:0.338	-
IAPP	3375	genome.wustl.edu	37	12	21526336	21526336	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr12:21526336G>T	ENST00000240652.3	+	2	187	c.51G>T	c.(49-51)ttG>ttT	p.L17F	IAPP_ENST00000539393.1_Missense_Mutation_p.L17F|SLCO1A2_ENST00000537524.1_Intron|SLCO1A2_ENST00000473830.1_Intron|IAPP_ENST00000542023.1_Missense_Mutation_p.L17F|SLCO1A2_ENST00000307378.6_Intron	NM_000415.2	NP_000406.1	P10997	IAPP_HUMAN	islet amyloid polypeptide	17					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|endocrine pancreas development (GO:0031018)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell differentiation (GO:0045596)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)			lung(3)	3						CTGTTGCATTGAACCATCTGA	0.353																																						dbGAP											0													153.0	143.0	146.0					12																	21526336		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8688.1	12p12.1	2013-02-25			ENSG00000121351	ENSG00000121351		"""Endogenous ligands"""	5329	protein-coding gene	gene with protein product	"""amylin"""	147940					Standard	NM_000415		Approved	AMYLIN, DAP, IAP	uc001rev.3	P10997	OTTHUMG00000169128	ENST00000240652.3:c.51G>T	12.37:g.21526336G>T	ENSP00000240652:p.Leu17Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0ZD87|Q14598	Missense_Mutation	SNP	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Pro-islet_amyloid_polypep	p.L17F	ENST00000240652.3	37	c.51	CCDS8688.1	12	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833810	0.32421	.	.	ENSG00000121351	ENST00000539393;ENST00000240652;ENST00000542023;ENST00000537593	T;T;T	0.81247	-1.46;-1.46;-1.47	5.67	-8.37	0.00976	.	0.313564	0.25845	N	0.027922	T	0.59959	0.2232	.	.	.	0.09310	N	1	B	0.17038	0.02	B	0.17433	0.018	T	0.43621	-0.9380	9	0.72032	D	0.01	-0.0372	2.5867	0.04832	0.1447:0.3697:0.2931:0.1924	.	17	P10997	IAPP_HUMAN	F	17	ENSP00000437357:L17F;ENSP00000240652:L17F;ENSP00000445980:L17F	ENSP00000240652:L17F	L	+	3	2	IAPP	21417603	0.033000	0.19621	0.000000	0.03702	0.043000	0.13939	0.167000	0.16602	-1.306000	0.02324	-0.294000	0.09567	TTG	IAPP	-	prints_Pro-islet_amyloid_polypep	ENSG00000121351		0.353	IAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IAPP	HGNC	protein_coding	OTTHUMT00000402356.1	232	0.85	2	G	NM_000415		21526336	21526336	+1	no_errors	ENST00000240652	ensembl	human	known	69_37n	missense	121	12.32	17	SNP	0.000	T
IFNA4	3441	genome.wustl.edu	37	9	21187338	21187338	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr9:21187338C>T	ENST00000421715.1	-	1	260	c.193G>A	c.(193-195)Gag>Aag	p.E65K		NM_021068.2	NP_066546.1	P05014	IFNA4_HUMAN	interferon, alpha 4	65					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CCATCAAACTCCTCCTCGGGG	0.512																																					NSCLC(154;890 1986 23660 27800 51138)	dbGAP											0													109.0	108.0	108.0					9																	21187338		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6498.1	9p22	2010-08-24			ENSG00000236637	ENSG00000236637		"""Interferons"""	5425	protein-coding gene	gene with protein product		147564				1385305	Standard	NM_021068		Approved	MGC142200, IFN-alpha4a	uc003zon.2	P05014	OTTHUMG00000019660	ENST00000421715.1:c.193G>A	9.37:g.21187338C>T	ENSP00000412897:p.Glu65Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P13358|Q14CS4|Q5VV15	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.E65K	ENST00000421715.1	37	c.193	CCDS6498.1	9	.	.	.	.	.	.	.	.	.	.	-	0.071	-1.202248	0.01581	.	.	ENSG00000236637	ENST00000421715	T	0.03212	4.01	2.96	-0.293	0.12835	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.784428	0.11551	N	0.552813	T	0.02494	0.0076	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.46317	-0.9200	10	0.30078	T	0.28	.	3.34	0.07115	0.0:0.3862:0.209:0.4048	.	65	P05014	IFNA4_HUMAN	K	65	ENSP00000412897:E65K	ENSP00000412897:E65K	E	-	1	0	IFNA4	21177338	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.717000	0.04986	-0.199000	0.10317	0.485000	0.47835	GAG	IFNA4	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000236637		0.512	IFNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA4	HGNC	protein_coding	OTTHUMT00000051889.1	275	0.00	0	C	NM_021068		21187338	21187338	-1	no_errors	ENST00000421715	ensembl	human	known	69_37n	missense	195	13.33	30	SNP	0.000	T
KCNH7	90134	genome.wustl.edu	37	2	163302698	163302698	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:163302698A>T	ENST00000332142.5	-	7	1483	c.1384T>A	c.(1384-1386)Ttt>Att	p.F462I	KCNH7_ENST00000328032.4_Missense_Mutation_p.F455I	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	462					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TCTATGATAAACATAATATCC	0.363																																					GBM(196;1492 2208 17507 24132 45496)	dbGAP											0													89.0	83.0	85.0					2																	163302698		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1384T>A	2.37:g.163302698A>T	ENSP00000331727:p.Phe462Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.F462I	ENST00000332142.5	37	c.1384	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	A	29.7	5.026480	0.93518	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.99032	-5.35;-5.35	5.85	5.85	0.93711	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99600	0.9855	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.975;0.999	D	0.97660	1.0160	10	0.87932	D	0	.	16.2317	0.82347	1.0:0.0:0.0:0.0	.	455;462	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	I	462;455	ENSP00000331727:F462I;ENSP00000333781:F455I	ENSP00000333781:F455I	F	-	1	0	KCNH7	163010944	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.237000	0.73441	0.528000	0.53228	TTT	KCNH7	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000184611		0.363	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1	169	0.00	0	A	NM_033272		163302698	163302698	-1	no_errors	ENST00000332142	ensembl	human	known	69_37n	missense	124	18.83	29	SNP	1.000	T
KDM4B	23030	genome.wustl.edu	37	19	5131979	5131979	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:5131979C>A	ENST00000159111.4	+	13	2085	c.1867C>A	c.(1867-1869)Cca>Aca	p.P623T	KDM4B_ENST00000536461.1_Missense_Mutation_p.P657T	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	623					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CACCCGGTCCCCACTGTCGGT	0.642																																						dbGAP											0													21.0	26.0	24.0					19																	5131979		2194	4295	6489	-	-	-	SO:0001583	missense	0			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.1867C>A	19.37:g.5131979C>A	ENSP00000159111:p.Pro623Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.P623T	ENST00000159111.4	37	c.1867	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	C	24.2	4.509127	0.85282	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.48522	0.81;0.81	4.12	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.69468	0.3114	M	0.78637	2.42	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.75714	-0.3221	10	0.72032	D	0.01	-23.5565	16.3774	0.83410	0.0:1.0:0.0:0.0	.	657;623	F5GX28;O94953	.;KDM4B_HUMAN	T	623;657	ENSP00000159111:P623T;ENSP00000440495:P657T	ENSP00000159111:P623T	P	+	1	0	KDM4B	5082979	1.000000	0.71417	0.981000	0.43875	0.869000	0.49853	5.659000	0.68010	1.854000	0.53819	0.561000	0.74099	CCA	KDM4B	-	NULL	ENSG00000127663		0.642	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	HGNC	protein_coding	OTTHUMT00000450558.1	75	0.00	0	C	NM_015015		5131979	5131979	+1	no_errors	ENST00000159111	ensembl	human	known	69_37n	missense	54	15.62	10	SNP	1.000	A
KNG1	3827	genome.wustl.edu	37	3	186459855	186459855	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:186459855C>T	ENST00000265023.4	+	10	1882	c.1670C>T	c.(1669-1671)aCa>aTa	p.T557I	RP11-573D15.8_ENST00000609726.1_RNA|KNG1_ENST00000447445.1_Intron|RP11-573D15.8_ENST00000599314.1_RNA|RP11-573D15.8_ENST00000609652.1_RNA|RP11-573D15.8_ENST00000354642.2_RNA|KNG1_ENST00000287611.2_Intron|RP11-573D15.8_ENST00000596632.1_RNA|RP11-573D15.8_ENST00000596329.1_RNA	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	557					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		CCAGGTGTAACAGTTACCTTT	0.478																																						dbGAP											0													119.0	113.0	115.0					3																	186459855		1995	4157	6152	-	-	-	SO:0001583	missense	0				CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1670C>T	3.37:g.186459855C>T	ENSP00000265023:p.Thr557Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat,prints_Kininogen	p.T557I	ENST00000265023.4	37	c.1670	CCDS43183.1	3	.	.	.	.	.	.	.	.	.	.	C	1.015	-0.686581	0.03328	.	.	ENSG00000113889	ENST00000265023	T	0.14391	2.51	5.05	-0.239	0.13050	.	1.796340	0.02915	N	0.137223	T	0.07728	0.0194	N	0.12182	0.205	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.30416	-0.9979	9	.	.	.	-0.4004	4.7537	0.13073	0.4258:0.4105:0.0:0.1637	.	557	P01042	KNG1_HUMAN	I	557	ENSP00000265023:T557I	.	T	+	2	0	KNG1	187942549	0.000000	0.05858	0.002000	0.10522	0.047000	0.14425	-0.102000	0.10956	-0.279000	0.09167	-0.140000	0.14226	ACA	KNG1	-	NULL	ENSG00000113889		0.478	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KNG1	HGNC	protein_coding	OTTHUMT00000317738.1	257	0.00	0	C	NM_001102416		186459855	186459855	+1	no_errors	ENST00000265023	ensembl	human	known	69_37n	missense	114	21.62	32	SNP	0.001	T
LMAN1	3998	genome.wustl.edu	37	18	57016441	57016441	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr18:57016441C>T	ENST00000251047.5	-	6	1384	c.667G>A	c.(667-669)Gat>Aat	p.D223N	LMAN1_ENST00000587940.1_5'UTR	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	223	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TCATTTTTATCTGGTGTAAAG	0.333																																						dbGAP											0													90.0	89.0	89.0					18																	57016441		2203	4300	6503	-	-	-	SO:0001583	missense	0			X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.667G>A	18.37:g.57016441C>T	ENSP00000251047:p.Asp223Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Missense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl,superfamily_HMG_superfamily	p.D223N	ENST00000251047.5	37	c.667	CCDS11974.1	18	.	.	.	.	.	.	.	.	.	.	C	6.615	0.481858	0.12581	.	.	ENSG00000074695	ENST00000251047	T	0.62364	0.03	5.59	3.81	0.43845	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.142736	0.64402	N	0.000009	T	0.29524	0.0736	N	0.01800	-0.715	0.58432	D	0.999991	B	0.11235	0.004	B	0.12156	0.007	T	0.31194	-0.9952	10	0.02654	T	1	-18.9513	11.3304	0.49473	0.0:0.8519:0.0:0.1481	.	223	P49257	LMAN1_HUMAN	N	223	ENSP00000251047:D223N	ENSP00000251047:D223N	D	-	1	0	LMAN1	55167421	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.759000	0.55227	1.378000	0.46305	0.650000	0.86243	GAT	LMAN1	-	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	ENSG00000074695		0.333	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN1	HGNC	protein_coding	OTTHUMT00000256129.2	185	0.00	0	C	NM_005570		57016441	57016441	-1	no_errors	ENST00000251047	ensembl	human	known	69_37n	missense	115	17.27	24	SNP	1.000	T
LPCAT1	79888	genome.wustl.edu	37	5	1463771	1463771	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr5:1463771C>G	ENST00000283415.3	-	14	1732	c.1600G>C	c.(1600-1602)Gat>Cat	p.D534H	LPCAT1_ENST00000503252.1_5'UTR	NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	534					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		GGGTCCTAATCCAGCTTCTTG	0.622																																						dbGAP											0													50.0	53.0	52.0					5																	1463771		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.1600G>C	5.37:g.1463771C>G	ENSP00000283415:p.Asp534His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D534H	ENST00000283415.3	37	c.1600	CCDS3864.1	5	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544816	0.27563	.	.	ENSG00000153395	ENST00000283415	T	0.74315	-0.83	4.29	0.883	0.19177	.	0.195677	0.52532	D	0.000061	T	0.69459	0.3113	L	0.32530	0.975	0.25599	N	0.986617	D	0.71674	0.998	P	0.55667	0.781	T	0.61441	-0.7062	10	0.87932	D	0	.	6.417	0.21721	0.0:0.6348:0.1566:0.2086	.	534	Q8NF37	PCAT1_HUMAN	H	534	ENSP00000283415:D534H	ENSP00000283415:D534H	D	-	1	0	LPCAT1	1516771	1.000000	0.71417	0.019000	0.16419	0.014000	0.08584	1.121000	0.31283	0.273000	0.22049	0.561000	0.74099	GAT	LPCAT1	-	NULL	ENSG00000153395		0.622	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	HGNC	protein_coding	OTTHUMT00000304032.1	127	0.00	0	C	NM_024830		1463771	1463771	-1	no_errors	ENST00000283415	ensembl	human	known	69_37n	missense	156	16.49	31	SNP	0.788	G
LRP1B	53353	genome.wustl.edu	37	2	141253162	141253162	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:141253162A>T	ENST00000389484.3	-	56	9977	c.9006T>A	c.(9004-9006)gaT>gaA	p.D3002E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3002	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATTTGGGTTATCAGGTTGTA	0.428										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													210.0	188.0	195.0					2																	141253162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9006T>A	2.37:g.141253162A>T	ENSP00000374135:p.Asp3002Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.D3002E	ENST00000389484.3	37	c.9006	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	A	18.94	3.728746	0.69074	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.87887	-2.31	5.83	4.61	0.57282	Growth factor, receptor (1);EGF-like calcium-binding (1);	0.281147	0.33235	N	0.005125	T	0.81889	0.4918	L	0.47190	1.495	0.24037	N	0.996095	B	0.02656	0.0	B	0.04013	0.001	T	0.72268	-0.4343	10	0.49607	T	0.09	.	10.0798	0.42381	0.7412:0.0:0.0:0.2588	.	3002	Q9NZR2	LRP1B_HUMAN	E	3002;2940	ENSP00000374135:D3002E	ENSP00000374135:D3002E	D	-	3	2	LRP1B	140969632	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.034000	0.41145	2.240000	0.73641	0.477000	0.44152	GAT	LRP1B	-	superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000168702		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	422	0.00	0	A	NM_018557		141253162	141253162	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	missense	214	31.85	100	SNP	1.000	T
MAP3K4	4216	genome.wustl.edu	37	6	161470713	161470713	+	Frame_Shift_Del	DEL	G	G	-	rs375418351		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr6:161470713delG	ENST00000392142.4	+	3	1557	c.1409delG	c.(1408-1410)aggfs	p.R470fs	MAP3K4_ENST00000348824.7_Frame_Shift_Del_p.R470fs|MAP3K4_ENST00000366919.2_Frame_Shift_Del_p.R470fs|MAP3K4_ENST00000366920.2_Frame_Shift_Del_p.R470fs	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	470					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TCTGATCCTAGGGTACCGGAA	0.468																																						dbGAP											0													74.0	72.0	73.0					6																	161470713		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1409delG	6.37:g.161470713delG	ENSP00000375986:p.Arg470fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V471fs	ENST00000392142.4	37	c.1409	CCDS34565.1	6																																																																																			MAP3K4	-	NULL	ENSG00000085511		0.468	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	109	0.00	0	G			161470713	161470713	+1	no_errors	ENST00000392142	ensembl	human	known	69_37n	frame_shift_del	32	42.86	24	DEL	0.001	-
MAP4K4	9448	genome.wustl.edu	37	2	102476239	102476239	+	Silent	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:102476239G>A	ENST00000347699.4	+	15	1617	c.1617G>A	c.(1615-1617)ccG>ccA	p.P539P	MAP4K4_ENST00000324219.4_Silent_p.P539P|MAP4K4_ENST00000456652.1_Silent_p.P392P|MAP4K4_ENST00000413150.2_Silent_p.P508P|MAP4K4_ENST00000350198.4_Silent_p.P508P|MAP4K4_ENST00000350878.4_Silent_p.P488P|MAP4K4_ENST00000302217.5_Silent_p.P392P|MAP4K4_ENST00000425019.1_Silent_p.P508P	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	539					intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CGCAGCAGCCGCCACCACCGC	0.602																																						dbGAP											0													21.0	29.0	26.0					2																	102476239		2167	4273	6440	-	-	-	SO:0001819	synonymous_variant	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.1617G>A	2.37:g.102476239G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75172|Q9NST7	Missense_Mutation	SNP	pfam_Citron,superfamily_Kinase-like_dom,smart_Citron	p.A279T	ENST00000347699.4	37	c.835	CCDS56130.1	2	.	.	.	.	.	.	.	.	.	.	G	5.254	0.232253	0.09969	.	.	ENSG00000071054	ENST00000421882	.	.	.	5.09	2.14	0.27477	.	.	.	.	.	T	0.46367	0.1389	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.24154	-1.0168	4	.	.	.	.	3.9022	0.09166	0.1497:0.13:0.5863:0.134	.	.	.	.	T	279	.	.	A	+	1	0	MAP4K4	101842671	0.000000	0.05858	0.010000	0.14722	0.730000	0.41778	-1.861000	0.01654	0.112000	0.17975	0.585000	0.79938	GCC	MAP4K4	-	superfamily_Kinase-like_dom	ENSG00000071054		0.602	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	105	0.00	0	G	NM_004834		102476239	102476239	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000421882	ensembl	human	novel	69_37n	missense	57	18.57	13	SNP	0.047	A
MEFV	4210	genome.wustl.edu	37	16	3293384	3293384	+	Silent	SNP	C	C	T	rs104895095		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr16:3293384C>T	ENST00000219596.1	-	10	2142	c.2103G>A	c.(2101-2103)gcG>gcA	p.A701A	MEFV_ENST00000536379.1_Silent_p.A490A|MEFV_ENST00000339854.4_Silent_p.A521A|MEFV_ENST00000541159.1_3'UTR	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	701	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A701A(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GAACGCTGGACGCCTGGTACT	0.517																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											119.0	111.0	113.0					16																	3293384		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.2103G>A	16.37:g.3293384C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_DEATH-like,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.A701	ENST00000219596.1	37	c.2103	CCDS10498.1	16																																																																																			MEFV	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000103313		0.517	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	HGNC	protein_coding	OTTHUMT00000251464.1	183	0.00	0	C	NM_000243		3293384	3293384	-1	no_errors	ENST00000219596	ensembl	human	known	69_37n	silent	227	16.85	46	SNP	0.000	T
MGARP	84709	genome.wustl.edu	37	4	140196454	140196454	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr4:140196454C>T	ENST00000398955.1	-	2	354	c.175G>A	c.(175-177)Ggt>Agt	p.G59S		NM_032623.3	NP_116012.2	Q8TDB4	HUMMR_HUMAN	mitochondria-localized glutamic acid-rich protein	59					anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to hypoxia (GO:0071456)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of mitochondrion organization (GO:0010822)|protein targeting to mitochondrion (GO:0006626)|retrograde axon cargo transport (GO:0008090)	integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)											TAATATCCACCAGCACTGACT	0.398																																						dbGAP											0													111.0	101.0	104.0					4																	140196454		1930	4139	6069	-	-	-	SO:0001583	missense	0			AF484960	CCDS43269.1	4q31.1	2014-02-19	2014-02-19	2012-04-17	ENSG00000137463	ENSG00000137463			29969	protein-coding gene	gene with protein product	"""ovary-specific acidic protein"", ""corneal endothelium-specific protein 1"", ""hypoxia up-regulated mitochondrial movement regulator"""		"""chromosome 4 open reading frame 49"""	C4orf49			Standard	NM_032623		Approved	OSAP, CESP-1, HUMMR	uc003ihr.1	Q8TDB4	OTTHUMG00000161325	ENST00000398955.1:c.175G>A	4.37:g.140196454C>T	ENSP00000381928:p.Gly59Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZC3	Missense_Mutation	SNP	NULL	p.G59S	ENST00000398955.1	37	c.175	CCDS43269.1	4	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814844	0.90790	.	.	ENSG00000137463	ENST00000398955	T	0.55234	0.53	5.86	5.86	0.93980	.	0.114258	0.56097	D	0.000021	T	0.71230	0.3315	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.71882	-0.4458	10	0.72032	D	0.01	-11.7394	16.0536	0.80779	0.0:1.0:0.0:0.0	.	59	Q8TDB4	CD049_HUMAN	S	59	ENSP00000381928:G59S	ENSP00000381928:G59S	G	-	1	0	C4orf49	140415904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.978000	0.56881	2.937000	0.99478	0.650000	0.86243	GGT	MGARP	-	NULL	ENSG00000137463		0.398	MGARP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGARP	HGNC	protein_coding	OTTHUMT00000364536.1	220	0.00	0	C	NM_032623		140196454	140196454	-1	no_errors	ENST00000398955	ensembl	human	known	69_37n	missense	114	14.93	20	SNP	1.000	T
MRC2	9902	genome.wustl.edu	37	17	60758213	60758213	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr17:60758213delC	ENST00000303375.5	+	17	2928	c.2526delC	c.(2524-2526)cacfs	p.H843fs	MRC2_ENST00000446119.2_5'Flank	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	843	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TCTTTGAGCACCACTCCACGT	0.672																																						dbGAP											0													26.0	25.0	25.0					17																	60758213		2202	4298	6500	-	-	-	SO:0001589	frameshift_variant	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2526delC	17.37:g.60758213delC	ENSP00000307513:p.His843fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Frame_Shift_Del	DEL	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,prints_AntifreezeII,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.H843fs	ENST00000303375.5	37	c.2526	CCDS11634.1	17																																																																																			MRC2	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000011028		0.672	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1	49	0.00	0	C			60758213	60758213	+1	no_errors	ENST00000303375	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.994	-
MSMP	692094	genome.wustl.edu	37	9	35754070	35754070	+	Silent	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr9:35754070C>A	ENST00000436428.2	-	1	196	c.57G>T	c.(55-57)ggG>ggT	p.G19G	MSMP_ENST00000414286.1_Intron|RP11-112J3.15_ENST00000425499.2_RNA|RGP1_ENST00000378078.4_3'UTR	NM_001044264.2	NP_001037729.1	Q1L6U9	MSMP_HUMAN	microseminoprotein, prostate associated	19						cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(2)|kidney(1)|lung(3)|prostate(3)	9						AGCAGATGATCCCCCAGCCTC	0.567																																						dbGAP											0													132.0	142.0	139.0					9																	35754070		2073	4219	6292	-	-	-	SO:0001819	synonymous_variant	0			DQ012170	CCDS43797.1	9p13.3	2012-10-02			ENSG00000215183	ENSG00000215183			29663	protein-coding gene	gene with protein product		612191				17338636	Standard	NM_001044264		Approved	PC-3, PSMP	uc003zyb.2	Q1L6U9	OTTHUMG00000019882	ENST00000436428.2:c.57G>T	9.37:g.35754070C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_PSP94	p.G19	ENST00000436428.2	37	c.57	CCDS43797.1	9																																																																																			MSMP	-	NULL	ENSG00000215183		0.567	MSMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSMP	HGNC	protein_coding	OTTHUMT00000052384.2	206	0.00	0	C	NM_001044264		35754070	35754070	-1	no_errors	ENST00000436428	ensembl	human	known	69_37n	silent	63	12.50	9	SNP	0.024	A
MTIF2	4528	genome.wustl.edu	37	2	55463924	55463924	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:55463924C>T	ENST00000263629.4	-	16	2359	c.2044G>A	c.(2044-2046)Gac>Aac	p.D682N	MTIF2_ENST00000403721.1_Missense_Mutation_p.D682N|MTIF2_ENST00000394600.3_Missense_Mutation_p.D682N	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	682					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						ATTGAAATGTCATCTTTATGG	0.299																																						dbGAP											0													83.0	78.0	80.0					2																	55463924		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.2044G>A	2.37:g.55463924C>T	ENSP00000263629:p.Asp682Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5D0	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,pfam_GTP_binding_domain,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_TIF_IF2_dom3,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Small_GTP-bd_dom	p.D682N	ENST00000263629.4	37	c.2044	CCDS1853.1	2	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250133	0.80024	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600	T;T;T	0.61040	0.14;0.14;0.14	5.93	5.93	0.95920	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.047713	0.85682	D	0.000000	T	0.71417	0.3337	M	0.92649	3.33	0.80722	D	1	B	0.25007	0.116	B	0.25987	0.065	T	0.72966	-0.4131	10	0.87932	D	0	-18.4543	20.3284	0.98709	0.0:1.0:0.0:0.0	.	682	P46199	IF2M_HUMAN	N	682	ENSP00000384481:D682N;ENSP00000263629:D682N;ENSP00000378099:D682N	ENSP00000263629:D682N	D	-	1	0	MTIF2	55317428	1.000000	0.71417	0.997000	0.53966	0.848000	0.48234	7.176000	0.77643	2.808000	0.96608	0.563000	0.77884	GAC	MTIF2	-	superfamily_Transl_elong_init/rib_B-barrel	ENSG00000085760		0.299	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	314	0.32	1	C	NM_002453		55463924	55463924	-1	no_errors	ENST00000263629	ensembl	human	known	69_37n	missense	187	29.17	77	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9085910	9085910	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:9085910G>T	ENST00000397910.4	-	1	6108	c.5905C>A	c.(5905-5907)Cca>Aca	p.P1969T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1969	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P1969T(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATTGTTGGTGGGGTGATGGGA	0.448																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											205.0	202.0	203.0					19																	9085910		2071	4228	6299	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5905C>A	19.37:g.9085910G>T	ENSP00000381008:p.Pro1969Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.P1969T	ENST00000397910.4	37	c.5905	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	2.101	-0.405953	0.04832	.	.	ENSG00000181143	ENST00000397910	T	0.03181	4.02	0.235	0.235	0.15431	.	.	.	.	.	T	0.05364	0.0142	N	0.08118	0	.	.	.	D	0.69078	0.997	D	0.68483	0.958	T	0.41822	-0.9487	7	0.87932	D	0	.	.	.	.	.	1969	B5ME49	.	T	1969	ENSP00000381008:P1969T	ENSP00000381008:P1969T	P	-	1	0	MUC16	8946910	0.000000	0.05858	0.270000	0.24601	0.275000	0.26752	-0.552000	0.06020	0.308000	0.22923	0.313000	0.20887	CCA	MUC16	-	NULL	ENSG00000181143		0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	936	0.11	1	G	NM_024690		9085910	9085910	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	642	11.31	82	SNP	0.345	T
MUC16	94025	genome.wustl.edu	37	19	9090329	9090329	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:9090329T>A	ENST00000397910.4	-	1	1689	c.1486A>T	c.(1486-1488)Agc>Tgc	p.S496C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	496	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCAGCTGTGCTGGAACTCTGC	0.532																																						dbGAP											0													105.0	102.0	103.0					19																	9090329		2072	4213	6285	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1486A>T	19.37:g.9090329T>A	ENSP00000381008:p.Ser496Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S496C	ENST00000397910.4	37	c.1486	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	3.572	-0.087363	0.07097	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.36	0.124	0.14714	.	.	.	.	.	T	0.03348	0.0097	N	0.08118	0	.	.	.	D	0.65815	0.995	P	0.61132	0.884	T	0.44967	-0.9293	8	0.87932	D	0	.	3.9285	0.09275	0.0:0.0:0.3889:0.6111	.	496	B5ME49	.	C	496	ENSP00000381008:S496C	ENSP00000381008:S496C	S	-	1	0	MUC16	8951329	0.000000	0.05858	0.000000	0.03702	0.138000	0.21146	-0.113000	0.10774	-0.014000	0.14175	0.260000	0.18958	AGC	MUC16	-	NULL	ENSG00000181143		0.532	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	276	0.36	1	T	NM_024690		9090329	9090329	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	275	15.12	49	SNP	0.000	A
MUC6	4588	genome.wustl.edu	37	11	1016361	1016361	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr11:1016361G>T	ENST00000421673.2	-	31	6490	c.6440C>A	c.(6439-6441)tCc>tAc	p.S2147Y		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2147	Ser-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAGTGGGAGGAGGGCACATA	0.547																																						dbGAP											0													63.0	69.0	67.0					11																	1016361		2045	4181	6226	-	-	-	SO:0001583	missense	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6440C>A	11.37:g.1016361G>T	ENSP00000406861:p.Ser2147Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.S2147Y	ENST00000421673.2	37	c.6440	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	G	5.085	0.201330	0.09652	.	.	ENSG00000184956	ENST00000421673	T	0.22134	1.97	2.35	1.4	0.22301	.	.	.	.	.	T	0.07458	0.0188	N	0.14661	0.345	0.09310	N	1	P	0.46064	0.872	B	0.27262	0.078	T	0.25745	-1.0123	9	0.26408	T	0.33	.	5.4999	0.16823	0.1839:0.0:0.8161:0.0	.	2147	Q6W4X9	MUC6_HUMAN	Y	2147	ENSP00000406861:S2147Y	ENSP00000406861:S2147Y	S	-	2	0	MUC6	1006361	0.000000	0.05858	0.001000	0.08648	0.276000	0.26787	-0.902000	0.04088	0.285000	0.22329	0.297000	0.19635	TCC	MUC6	-	NULL	ENSG00000184956		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	373	0.00	0	G	XM_290540		1016361	1016361	-1	no_errors	ENST00000421673	ensembl	human	known	69_37n	missense	249	12.32	35	SNP	0.004	T
MYH1	4619	genome.wustl.edu	37	17	10408797	10408797	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr17:10408797C>T	ENST00000226207.5	-	20	2300	c.2206G>A	c.(2206-2208)Gaa>Aaa	p.E736K	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	736	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						AATTGTCCTTCAGGGATAGCA	0.418																																						dbGAP											0													92.0	84.0	87.0					17																	10408797		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2206G>A	17.37:g.10408797C>T	ENSP00000226207:p.Glu736Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E736K	ENST00000226207.5	37	c.2206	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.310785	0.95629	.	.	ENSG00000109061	ENST00000226207	D	0.92249	-3.0	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.000000	0.43747	U	0.000533	D	0.86197	0.5875	N	0.16037	0.36	0.80722	D	1	B	0.06786	0.001	B	0.22386	0.039	T	0.79904	-0.1606	10	0.21014	T	0.42	.	19.6961	0.96026	0.0:1.0:0.0:0.0	.	736	P12882	MYH1_HUMAN	K	736	ENSP00000226207:E736K	ENSP00000226207:E736K	E	-	1	0	MYH1	10349522	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.611000	0.82962	2.745000	0.94114	0.650000	0.86243	GAA	MYH1	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000109061		0.418	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	191	0.00	0	C	NM_005963		10408797	10408797	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	missense	53	43.01	40	SNP	1.000	T
MYO5C	55930	genome.wustl.edu	37	15	52497096	52497096	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr15:52497096C>T	ENST00000261839.7	-	38	4947	c.4786G>A	c.(4786-4788)Gac>Aac	p.D1596N	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1596	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GAGCACATGTCCTTGCGCAGG	0.592																																						dbGAP											0													40.0	45.0	44.0					15																	52497096		2028	4165	6193	-	-	-	SO:0001583	missense	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4786G>A	15.37:g.52497096C>T	ENSP00000261839:p.Asp1596Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1W8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1596N	ENST00000261839.7	37	c.4786	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414727	0.83449	.	.	ENSG00000128833	ENST00000261839	D	0.88277	-2.36	4.68	4.68	0.58851	Dilute (1);Dil domain (1);	0.000000	0.85682	D	0.000000	D	0.92384	0.7583	L	0.49256	1.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90293	0.4324	10	0.27082	T	0.32	.	18.1446	0.89651	0.0:1.0:0.0:0.0	.	1596	Q9NQX4	MYO5C_HUMAN	N	1596	ENSP00000261839:D1596N	ENSP00000261839:D1596N	D	-	1	0	MYO5C	50284388	1.000000	0.71417	1.000000	0.80357	0.292000	0.27327	7.609000	0.82925	2.605000	0.88082	0.655000	0.94253	GAC	MYO5C	-	pfam_Dil_domain,pfscan_Dilute	ENSG00000128833		0.592	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1	175	0.00	0	C	NM_018728		52497096	52497096	-1	no_errors	ENST00000261839	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	1.000	T
MYO9A	4649	genome.wustl.edu	37	15	72144513	72144513	+	Silent	SNP	G	G	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr15:72144513G>C	ENST00000356056.5	-	36	6907	c.6435C>G	c.(6433-6435)ctC>ctG	p.L2145L	MYO9A_ENST00000564571.1_Silent_p.L2145L|MYO9A_ENST00000424560.1_Silent_p.L2216L|MYO9A_ENST00000444904.1_Silent_p.L2126L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2145	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.|Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CAAAGGTCATGAGAGGATTGG	0.408																																						dbGAP											0													101.0	92.0	95.0					15																	72144513		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.6435C>G	15.37:g.72144513G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.S995*	ENST00000356056.5	37	c.2984	CCDS10239.1	15																																																																																			MYO9A	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000066933		0.408	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	150	0.00	0	G	NM_006901		72144513	72144513	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000561618	ensembl	human	putative	69_37n	nonsense	125	11.97	17	SNP	1.000	C
NEBL	10529	genome.wustl.edu	37	10	21157693	21157693	+	Splice_Site	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:21157693G>T	ENST00000377122.4	-	7	980	c.584C>A	c.(583-585)gCa>gAa	p.A195E	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron|NEBL_ENST00000377119.1_Splice_Site_p.A195E	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	195					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CTTGTATTCTGCCTAAAATGA	0.328																																						dbGAP											0													97.0	99.0	98.0					10																	21157693		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.583-1C>A	10.37:g.21157693G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.A195E	ENST00000377122.4	37	c.584	CCDS7134.1	10	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567652	0.86439	.	.	ENSG00000078114	ENST00000377122;ENST00000377119	T;T	0.18657	3.43;2.2	6.03	6.03	0.97812	.	0.056282	0.64402	D	0.000001	T	0.34919	0.0914	L	0.51422	1.61	0.80722	D	1	D	0.65815	0.995	P	0.56788	0.806	T	0.01283	-1.1396	10	0.62326	D	0.03	.	13.7163	0.62697	0.0699:0.0:0.9301:0.0	.	195	O76041	NEBL_HUMAN	E	195	ENSP00000366326:A195E;ENSP00000366323:A195E	ENSP00000366323:A195E	A	-	2	0	NEBL	21197699	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.561000	0.53770	2.868000	0.98415	0.555000	0.69702	GCA	NEBL	-	smart_Nebulin_35r-motif	ENSG00000078114		0.328	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	138	0.00	0	G	NM_006393	Missense_Mutation	21157693	21157693	-1	no_errors	ENST00000377122	ensembl	human	known	69_37n	missense	100	20.63	26	SNP	1.000	T
NELL2	4753	genome.wustl.edu	37	12	44926499	44926499	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr12:44926499C>T	ENST00000429094.2	-	16	2173	c.1669G>A	c.(1669-1671)Gat>Aat	p.D557N	NELL2_ENST00000395487.2_Missense_Mutation_p.D556N|NELL2_ENST00000452445.2_Missense_Mutation_p.D557N|NELL2_ENST00000437801.2_Missense_Mutation_p.D607N|NELL2_ENST00000333837.4_Missense_Mutation_p.D580N|NELL2_ENST00000549027.1_Missense_Mutation_p.D556N|NELL2_ENST00000551601.1_Intron	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	557	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GAGCATTCATCAATGTCTGGC	0.368																																						dbGAP											0													107.0	94.0	98.0					12																	44926499		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1669G>A	12.37:g.44926499C>T	ENSP00000390680:p.Asp557Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_VWF_C	p.D607N	ENST00000429094.2	37	c.1819	CCDS8746.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.236030	0.95240	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684	D;D;D;D;D;D	0.96011	-2.19;-2.19;-2.19;-2.19;-3.88;-2.19	5.71	5.71	0.89125	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96303	0.8794	L	0.33668	1.02	0.80722	D	1	D;D;D;D	0.89917	0.993;1.0;0.991;1.0	D;D;P;D	0.83275	0.984;0.983;0.837;0.996	D	0.95664	0.8718	10	0.38643	T	0.18	-22.857	19.8594	0.96778	0.0:1.0:0.0:0.0	.	580;607;557;556	B7Z2U7;B7Z9U3;Q99435;Q96JS2	.;.;NELL2_HUMAN;.	N	556;557;557;556;580;607;556	ENSP00000378866:D556N;ENSP00000390680:D557N;ENSP00000394612:D557N;ENSP00000447927:D556N;ENSP00000327988:D580N;ENSP00000416341:D607N	ENSP00000327988:D580N	D	-	1	0	NELL2	43212766	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	7.386000	0.79775	2.691000	0.91804	0.650000	0.86243	GAT	NELL2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000184613		0.368	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL2	HGNC	protein_coding	OTTHUMT00000404180.1	167	0.00	0	C	NM_006159		44926499	44926499	-1	no_errors	ENST00000437801	ensembl	human	known	69_37n	missense	85	30.89	38	SNP	1.000	T
NLRC4	58484	genome.wustl.edu	37	2	32476391	32476391	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:32476391C>T	ENST00000404025.2	-	5	1030	c.542G>A	c.(541-543)cGa>cAa	p.R181Q	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000402280.1_Missense_Mutation_p.R181Q|NLRC4_ENST00000360906.5_Missense_Mutation_p.R181Q			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	181	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.|Nucleotide-binding domain (NBD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CATGGCAATTCGCTGCAGCAG	0.567																																						dbGAP											0													70.0	69.0	70.0					2																	32476391		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.542G>A	2.37:g.32476391C>T	ENSP00000385090:p.Arg181Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_CARD	p.R181Q	ENST00000404025.2	37	c.542	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	C	12.27	1.889006	0.33348	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.79141	-1.24;-1.24;-1.24	3.27	0.301	0.15781	NACHT nucleoside triphosphatase (1);	0.323716	0.19190	N	0.120451	T	0.66366	0.2782	L	0.46157	1.445	0.27129	N	0.961946	B	0.24576	0.106	B	0.19148	0.024	T	0.62774	-0.6783	9	0.54805	T	0.06	-1.3178	7.5744	0.27926	0.0:0.5851:0.0:0.4149	.	181	Q9NPP4	NLRC4_HUMAN	Q	181	ENSP00000354159:R181Q;ENSP00000385428:R181Q;ENSP00000385090:R181Q	ENSP00000354159:R181Q	R	-	2	0	NLRC4	32329895	0.999000	0.42202	0.987000	0.45799	0.918000	0.54935	0.857000	0.27831	-0.065000	0.13021	-0.324000	0.08512	CGA	NLRC4	-	pfscan_NACHT_NTPase	ENSG00000091106		0.567	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	117	0.00	0	C	NM_021209		32476391	32476391	-1	no_errors	ENST00000360906	ensembl	human	known	69_37n	missense	104	13.33	16	SNP	0.989	T
NEUROD1	4760	genome.wustl.edu	37	2	182542944	182542944	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:182542944G>A	ENST00000295108.3	-	2	1101	c.644C>T	c.(643-645)cCt>cTt	p.P215L	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	215					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GGGGTGTACAGGGAAGGAAGC	0.632																																						dbGAP											0													56.0	66.0	63.0					2																	182542944		2203	4300	6503	-	-	-	SO:0001583	missense	0			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.644C>T	2.37:g.182542944G>A	ENSP00000295108:p.Pro215Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pirsf_TF_bHLH_NeuroD,pfscan_HLH_DNA-bd	p.P215L	ENST00000295108.3	37	c.644	CCDS2283.1	2	.	.	.	.	.	.	.	.	.	.	G	11.02	1.515349	0.27123	.	.	ENSG00000162992	ENST00000295108	T	0.63096	-0.02	6.02	6.02	0.97574	Neurogenic differentiation factor, domain of unknown function (1);	0.106127	0.64402	D	0.000003	T	0.62490	0.2432	L	0.54323	1.7	0.54753	D	0.999987	B	0.21821	0.061	B	0.22152	0.038	T	0.58999	-0.7536	10	0.72032	D	0.01	-25.9628	19.1109	0.93315	0.0:0.0:1.0:0.0	.	215	Q13562	NDF1_HUMAN	L	215	ENSP00000295108:P215L	ENSP00000295108:P215L	P	-	2	0	NEUROD1	182251189	1.000000	0.71417	0.688000	0.30117	0.890000	0.51754	7.990000	0.88215	2.850000	0.98022	0.650000	0.86243	CCT	NEUROD1	-	pfam_Neurogenic_DUF,pirsf_TF_bHLH_NeuroD	ENSG00000162992		0.632	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD1	HGNC	protein_coding	OTTHUMT00000255792.2	82	0.00	0	G	NM_002500		182542944	182542944	-1	no_errors	ENST00000295108	ensembl	human	known	69_37n	missense	40	47.37	36	SNP	0.910	A
NUP160	23279	genome.wustl.edu	37	11	47833723	47833723	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr11:47833723C>T	ENST00000378460.2	-	17	2180	c.2134G>A	c.(2134-2136)Gca>Aca	p.A712T	NUP160_ENST00000530326.1_Missense_Mutation_p.A598T|NUP160_ENST00000528501.1_3'UTR|NUP160_ENST00000528071.1_Missense_Mutation_p.A598T|NUP160_ENST00000531016.1_5'Flank	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	712					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						ATATACCCTGCTGTGTTACTA	0.403																																						dbGAP											0													117.0	112.0	114.0					11																	47833723		2201	4298	6499	-	-	-	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2134G>A	11.37:g.47833723C>T	ENSP00000367721:p.Ala712Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.A712T	ENST00000378460.2	37	c.2134	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532580	0.45073	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.47528	1.42;0.84;0.84	5.14	2.98	0.34508	.	0.266982	0.37178	N	0.002216	T	0.27967	0.0689	N	0.20986	0.625	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.05835	-1.0861	10	0.19590	T	0.45	.	6.9053	0.24305	0.1669:0.6811:0.0:0.152	.	712	Q12769	NU160_HUMAN	T	712;598;598	ENSP00000367721:A712T;ENSP00000433590:A598T;ENSP00000432367:A598T	ENSP00000367721:A712T	A	-	1	0	NUP160	47790299	0.989000	0.36119	0.203000	0.23512	0.963000	0.63663	2.802000	0.47916	1.141000	0.42275	0.591000	0.81541	GCA	NUP160	-	NULL	ENSG00000030066		0.403	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	327	0.00	0	C	NM_015231		47833723	47833723	-1	no_errors	ENST00000378460	ensembl	human	known	69_37n	missense	108	30.32	47	SNP	0.818	T
OBFC1	79991	genome.wustl.edu	37	10	105658674	105658674	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:105658674G>T	ENST00000224950.3	-	6	709	c.542C>A	c.(541-543)cCt>cAt	p.P181H	OBFC1_ENST00000369764.1_Missense_Mutation_p.P181H|OBFC1_ENST00000466828.1_5'UTR	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	181					positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		GCTGTGAAAAGGCTGGTCATA	0.478																																						dbGAP											0													132.0	120.0	124.0					10																	105658674		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.542C>A	10.37:g.105658674G>T	ENSP00000224950:p.Pro181His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR99|Q5TCZ0	Missense_Mutation	SNP	pfam_DUF1879_CST_STN1,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pirsf_CST_STN1	p.P181H	ENST00000224950.3	37	c.542	CCDS7552.1	10	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971531	0.74246	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.67523	-0.27;-0.27	5.79	5.79	0.91817	Domain of unknown function DUF1879, CTS complex STN1 subunit (1);	0.046298	0.85682	D	0.000000	D	0.82522	0.5055	M	0.80847	2.515	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.84356	0.0535	10	0.87932	D	0	-7.2609	15.531	0.75960	0.0:0.0:1.0:0.0	.	181	Q9H668	STN1_HUMAN	H	181	ENSP00000224950:P181H;ENSP00000358779:P181H	ENSP00000224950:P181H	P	-	2	0	OBFC1	105648664	1.000000	0.71417	0.993000	0.49108	0.809000	0.45718	4.595000	0.61048	2.734000	0.93682	0.555000	0.69702	CCT	OBFC1	-	pfam_DUF1879_CST_STN1,pirsf_CST_STN1	ENSG00000107960		0.478	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OBFC1	HGNC	protein_coding	OTTHUMT00000050174.1	348	0.29	1	G	NM_024928		105658674	105658674	-1	no_errors	ENST00000224950	ensembl	human	known	69_37n	missense	171	11.86	23	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228432172	228432172	+	Silent	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr1:228432172C>T	ENST00000422127.1	+	11	3425	c.3381C>T	c.(3379-3381)tgC>tgT	p.C1127C	OBSCN_ENST00000570156.2_Silent_p.C1219C|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.C1127C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1127	Ig-like 11.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCAAAGGGTGCACACGGAGGC	0.612																																						dbGAP											0													78.0	84.0	82.0					1																	228432172		2075	4206	6281	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3381C>T	1.37:g.228432172C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.C1127	ENST00000422127.1	37	c.3381	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000154358		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		390	0.00	0	C	NM_052843		228432172	228432172	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	silent	179	17.13	37	SNP	0.000	T
OLFML2A	169611	genome.wustl.edu	37	9	127570099	127570100	+	Frame_Shift_Ins	INS	-	-	C	rs368019954		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr9:127570099_127570100insC	ENST00000373580.3	+	7	1208_1209	c.1208_1209insC	c.(1207-1212)gaccccfs	p.DP403fs	OLFML2A_ENST00000288815.5_Frame_Shift_Ins_p.DP189fs	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	403	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						CGGGCTGTGGACCCCCCTGTGA	0.639																																						dbGAP											0										0,4264		0,0,2132						5.4	1.0			42	1,8253		0,1,4126	no	frameshift	OLFML2A	NM_182487.2		0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12517				-	-	-	SO:0001589	frameshift_variant	0			AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.1214dupC	9.37:g.127570105_127570105dupC	ENSP00000362682:p.Asp403fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Frame_Shift_Ins	INS	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.V406fs	ENST00000373580.3	37	c.1208_1209	CCDS6857.2	9																																																																																			OLFML2A	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000185585		0.639	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML2A	HGNC	protein_coding	OTTHUMT00000054046.2	96	0.00	0	-	NM_182487		127570099	127570100	+1	no_errors	ENST00000373580	ensembl	human	known	69_37n	frame_shift_ins	40	21.57	11	INS	1.000:0.871	C
OR4F5	79501	genome.wustl.edu	37	1	69523	69523	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr1:69523G>T	ENST00000335137.3	+	1	433	c.433G>T	c.(433-435)Ggc>Tgc	p.G145C		NM_001005484.1	NP_001005484.1	Q8NH21	OR4F5_HUMAN	olfactory receptor, family 4, subfamily F, member 5	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|ovary(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;3.48e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.21e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ATGGGGAATTGGCTTTCTCCA	0.468																																						dbGAP											0													134.0	63.0	89.0					1																	69523		1804	3116	4920	-	-	-	SO:0001583	missense	0			AB065592	CCDS30547.1	1p36.33	2012-08-09			ENSG00000186092	ENSG00000186092		"""GPCR / Class A : Olfactory receptors"""	14825	protein-coding gene	gene with protein product							Standard	NM_001005484		Approved		uc001aal.1	Q8NH21	OTTHUMG00000001094	ENST00000335137.3:c.433G>T	1.37:g.69523G>T	ENSP00000334393:p.Gly145Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VT22	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G145C	ENST00000335137.3	37	c.433	CCDS30547.1	1	.	.	.	.	.	.	.	.	.	.	.	10.98	1.503868	0.26949	.	.	ENSG00000186092	ENST00000534990;ENST00000335137	T	0.39997	1.05	2.31	2.31	0.28768	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000324	T	0.69415	0.3108	M	0.93328	3.405	0.39764	D	0.972077	D	0.89917	1.0	D	0.97110	1.0	T	0.77517	-0.2558	10	0.87932	D	0	.	10.7603	0.46261	0.0:0.0:1.0:0.0	.	145	Q8NH21	OR4F5_HUMAN	C	193;145	ENSP00000334393:G145C	ENSP00000334393:G145C	G	+	1	0	OR4F5	59386	0.995000	0.38212	0.993000	0.49108	0.561000	0.35649	2.699000	0.47077	1.232000	0.43678	0.398000	0.26397	GGC	OR4F5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186092		0.468	OR4F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F5	HGNC	protein_coding	OTTHUMT00000003223.1	581	0.34	2	G	NM_001005484		69523	69523	+1	no_errors	ENST00000335137	ensembl	human	known	69_37n	missense	527	13.32	81	SNP	1.000	T
OR51V1	283111	genome.wustl.edu	37	11	5221089	5221089	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr11:5221089G>A	ENST00000321255.1	-	1	841	c.842C>T	c.(841-843)gCc>gTc	p.A281V		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	281					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGAACGTGGGCCACGGGGGA	0.478																																						dbGAP											0													120.0	107.0	111.0					11																	5221089		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.842C>T	11.37:g.5221089G>A	ENSP00000321729:p.Ala281Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A281V	ENST00000321255.1	37	c.842	CCDS31375.1	11	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.516370	0.00151	.	.	ENSG00000176742	ENST00000321255	T	0.35789	1.29	5.15	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	0.141093	0.32120	N	0.006550	T	0.07503	0.0189	N	0.00317	-1.655	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36359	-0.9751	10	0.02654	T	1	.	6.1818	0.20476	0.7493:0.1618:0.0888:0.0	.	281	Q9H2C8	O51V1_HUMAN	V	281	ENSP00000321729:A281V	ENSP00000321729:A281V	A	-	2	0	OR51V1	5177665	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	1.459000	0.35234	0.989000	0.38761	-0.302000	0.09304	GCC	OR51V1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176742		0.478	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51V1	HGNC	protein_coding	OTTHUMT00000142965.1	315	0.00	0	G	NM_001004760		5221089	5221089	-1	no_errors	ENST00000321255	ensembl	human	known	69_37n	missense	96	23.20	29	SNP	0.001	A
OR6S1	341799	genome.wustl.edu	37	14	21109676	21109676	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr14:21109676T>A	ENST00000320704.3	-	1	174	c.175A>T	c.(175-177)Acc>Tcc	p.T59S		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		TACATAGGGGTCTGTAGTCGA	0.443																																						dbGAP											0													103.0	97.0	99.0					14																	21109676		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.175A>T	14.37:g.21109676T>A	ENSP00000313110:p.Thr59Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.T59S	ENST00000320704.3	37	c.175	CCDS32038.1	14	.	.	.	.	.	.	.	.	.	.	T	9.792	1.178061	0.21787	.	.	ENSG00000181803	ENST00000320704	T	0.00473	7.18	5.76	4.61	0.57282	GPCR, rhodopsin-like superfamily (1);	0.137684	0.33401	N	0.004948	T	0.00496	0.0016	L	0.53780	1.695	0.19945	N	0.999949	P	0.35745	0.518	B	0.37091	0.241	T	0.46034	-0.9220	10	0.66056	D	0.02	-10.5435	10.1686	0.42895	0.0:0.0787:0.0:0.9213	.	59	Q8NH40	OR6S1_HUMAN	S	59	ENSP00000313110:T59S	ENSP00000313110:T59S	T	-	1	0	OR6S1	20179516	0.001000	0.12720	0.934000	0.37439	0.388000	0.30384	0.820000	0.27323	1.007000	0.39238	-0.264000	0.10439	ACC	OR6S1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181803		0.443	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR6S1	HGNC	protein_coding	OTTHUMT00000411227.1	122	0.00	0	T			21109676	21109676	-1	no_errors	ENST00000320704	ensembl	human	known	69_37n	missense	67	14.10	11	SNP	0.575	A
OR8H2	390151	genome.wustl.edu	37	11	55872841	55872841	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr11:55872841G>T	ENST00000313503.1	+	1	323	c.323G>T	c.(322-324)gGt>gTt	p.G108V		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					GCCTTCTTGGGTACTGCTGAA	0.453										HNSCC(53;0.14)																												dbGAP											0													272.0	274.0	273.0					11																	55872841		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.323G>T	11.37:g.55872841G>T	ENSP00000323982:p.Gly108Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFC1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G108V	ENST00000313503.1	37	c.323	CCDS31518.1	11	.	.	.	.	.	.	.	.	.	.	g	0.012	-1.655938	0.00779	.	.	ENSG00000181767	ENST00000313503	T	0.01359	4.98	3.58	-2.51	0.06365	GPCR, rhodopsin-like superfamily (1);	0.385414	0.22434	N	0.060109	T	0.01222	0.0040	L	0.43701	1.375	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.50233	-0.8852	10	0.08381	T	0.77	.	9.3312	0.38023	0.0:0.3255:0.3483:0.3262	.	108	Q8N162	OR8H2_HUMAN	V	108	ENSP00000323982:G108V	ENSP00000323982:G108V	G	+	2	0	OR8H2	55629417	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.876000	0.00717	-0.333000	0.08476	0.440000	0.28878	GGT	OR8H2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000181767		0.453	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H2	HGNC	protein_coding	OTTHUMT00000391540.1	378	0.00	0	G	NM_001005200		55872841	55872841	+1	no_errors	ENST00000313503	ensembl	human	known	69_37n	missense	258	19.63	63	SNP	0.000	T
PARP10	84875	genome.wustl.edu	37	8	145057946	145057946	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr8:145057946C>G	ENST00000313028.7	-	8	1905	c.1811G>C	c.(1810-1812)gGc>gCc	p.G604A	PARP10_ENST00000533665.1_5'Flank|PARP10_ENST00000524918.1_Missense_Mutation_p.G595A|PARP10_ENST00000525773.1_Missense_Mutation_p.G616A	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	604	Glu-rich.				negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TAGGTCTAGGCCCTCCAGGGT	0.652																																						dbGAP											0													16.0	17.0	16.0					8																	145057946		2149	4186	6335	-	-	-	SO:0001583	missense	0			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1811G>C	8.37:g.145057946C>G	ENSP00000325618:p.Gly604Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.G604A	ENST00000313028.7	37	c.1811	CCDS34960.1	8	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899826	0.52227	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	T;T;T	0.10288	2.89;2.93;2.93	4.38	3.48	0.39840	.	0.708126	0.12129	U	0.496985	T	0.07098	0.0180	L	0.27053	0.805	0.19575	N	0.999969	B;B	0.28082	0.2;0.2	B;B	0.22880	0.042;0.042	T	0.31052	-0.9957	10	0.16896	T	0.51	.	8.7744	0.34753	0.0:0.8872:0.0:0.1128	.	616;604	E9PNI7;Q53GL7	.;PAR10_HUMAN	A	595;310;604;616	ENSP00000431620:G595A;ENSP00000325618:G604A;ENSP00000434776:G616A	ENSP00000325618:G604A	G	-	2	0	PARP10	145129934	0.004000	0.15560	0.957000	0.39632	0.573000	0.36030	0.099000	0.15210	2.006000	0.58801	0.479000	0.44913	GGC	PARP10	-	NULL	ENSG00000178685		0.652	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP10	HGNC	protein_coding	OTTHUMT00000383866.1	54	0.00	0	C	NM_032789		145057946	145057946	-1	no_errors	ENST00000313028	ensembl	human	known	69_37n	missense	21	40.00	14	SNP	0.750	G
PCDHGA3	56112	genome.wustl.edu	37	5	140725012	140725012	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr5:140725012T>A	ENST00000253812.6	+	1	1412	c.1412T>A	c.(1411-1413)aTc>aAc	p.I471N	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	471	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCCTCCATCTTCTCAGTG	0.542																																						dbGAP											0													116.0	131.0	126.0					5																	140725012		2136	4267	6403	-	-	-	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1412T>A	5.37:g.140725012T>A	ENSP00000253812:p.Ile471Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I471N	ENST00000253812.6	37	c.1412	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	18.88	3.718251	0.68844	.	.	ENSG00000254245	ENST00000253812	T	0.65549	-0.16	5.36	5.36	0.76844	Cadherin (3);Cadherin-like (1);	0.245298	0.20525	U	0.090622	D	0.86826	0.6026	H	0.98048	4.135	0.34458	D	0.701432	D;D	0.76494	0.999;0.999	D;D	0.76071	0.978;0.987	D	0.94194	0.7444	10	0.87932	D	0	.	15.3157	0.74074	0.0:0.0:0.0:1.0	.	471;471	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	N	471	ENSP00000253812:I471N	ENSP00000253812:I471N	I	+	2	0	PCDHGA3	140705196	0.934000	0.31675	1.000000	0.80357	0.917000	0.54804	6.163000	0.71880	2.152000	0.67230	0.460000	0.39030	ATC	PCDHGA3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000254245		0.542	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	200	0.00	0	T	NM_018916		140725012	140725012	+1	no_errors	ENST00000253812	ensembl	human	known	69_37n	missense	179	13.53	28	SNP	1.000	A
PCLO	27445	genome.wustl.edu	37	7	82764214	82764214	+	Silent	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:82764214G>A	ENST00000333891.9	-	3	2989	c.2652C>T	c.(2650-2652)acC>acT	p.T884T	PCLO_ENST00000423517.2_Silent_p.T884T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTGGCCAGCGGTAGGTCGTG	0.522																																						dbGAP											0													205.0	206.0	206.0					7																	82764214		1990	4164	6154	-	-	-	SO:0001819	synonymous_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2652C>T	7.37:g.82764214G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.T884	ENST00000333891.9	37	c.2652	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.522	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	202	0.00	0	G	NM_014510		82764214	82764214	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	silent	157	16.04	30	SNP	0.000	A
PDE4D	5144	genome.wustl.edu	37	5	58334711	58334711	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr5:58334711G>T	ENST00000340635.6	-	6	1071	c.896C>A	c.(895-897)tCc>tAc	p.S299Y	PDE4D_ENST00000405755.2_Missense_Mutation_p.S177Y|PDE4D_ENST00000502484.2_Missense_Mutation_p.S238Y|PDE4D_ENST00000358923.6_5'UTR|PDE4D_ENST00000360047.5_Missense_Mutation_p.S163Y|PDE4D_ENST00000503258.1_Missense_Mutation_p.S169Y|PDE4D_ENST00000546160.1_Missense_Mutation_p.S238Y|RP11-266N13.2_ENST00000500224.2_RNA|PDE4D_ENST00000507116.1_Missense_Mutation_p.S235Y	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	299					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CTCACTGACGGAGTGCCTGGT	0.612																																						dbGAP											0													52.0	57.0	55.0					5																	58334711		2039	4213	6252	-	-	-	SO:0001583	missense	0				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.896C>A	5.37:g.58334711G>T	ENSP00000345502:p.Ser299Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.S299Y	ENST00000340635.6	37	c.896	CCDS47213.1	5	.	.	.	.	.	.	.	.	.	.	G	29.3	4.991357	0.93106	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160	T;T;T;T;T;T;T	0.78816	-1.18;-1.14;-1.2;-1.12;-1.14;-1.21;-1.21	5.06	5.06	0.68205	.	0.586983	0.19892	N	0.103704	D	0.89670	0.6782	M	0.86028	2.79	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.994;0.99;0.994;0.996;0.996;0.994;1.0	D;D;D;D;D;D;D	0.85130	0.989;0.974;0.983;0.978;0.978;0.989;0.997	D	0.90917	0.4780	10	0.87932	D	0	.	18.6038	0.91259	0.0:0.0:1.0:0.0	.	238;299;235;162;177;169;74	Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10;Q08499-4	.;PDE4D_HUMAN;.;.;.;.;.	Y	299;168;163;235;169;177;238;238	ENSP00000345502:S299Y;ENSP00000353152:S163Y;ENSP00000424852:S235Y;ENSP00000425605:S169Y;ENSP00000384806:S177Y;ENSP00000423094:S238Y;ENSP00000442734:S238Y	ENSP00000345502:S299Y	S	-	2	0	PDE4D	58370468	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.553000	0.98118	2.636000	0.89361	0.561000	0.74099	TCC	PDE4D	-	NULL	ENSG00000113448		0.612	PDE4D-001	KNOWN	basic|CCDS	protein_coding	PDE4D	HGNC	protein_coding	OTTHUMT00000367940.3	230	0.43	1	G			58334711	58334711	-1	no_errors	ENST00000340635	ensembl	human	known	69_37n	missense	83	25.89	29	SNP	1.000	T
PEX1	5189	genome.wustl.edu	37	7	92143236	92143236	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:92143236C>T	ENST00000248633.4	-	6	1380	c.1285G>A	c.(1285-1287)Gta>Ata	p.V429I	PEX1_ENST00000438045.1_Missense_Mutation_p.V107I|PEX1_ENST00000541751.1_5'UTR|PEX1_ENST00000428214.1_Missense_Mutation_p.V429I	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	429					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			ATCCTGACTACGGCATGCATT	0.308																																						dbGAP											0													109.0	114.0	112.0					7																	92143236		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.1285G>A	7.37:g.92143236C>T	ENSP00000248633:p.Val429Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Peroxisome_synth_fac_1_a/b,pfam_PEX-1N,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.V429I	ENST00000248633.4	37	c.1285	CCDS5627.1	7	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466885	0.63625	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214;ENST00000545192	D;D;D	0.94457	-3.35;-3.38;-3.43	5.84	4.96	0.65561	.	0.317667	0.32563	N	0.005932	D	0.87962	0.6310	L	0.44542	1.39	0.80722	D	1	P;P;P	0.43633	0.659;0.813;0.659	B;B;B	0.27796	0.056;0.083;0.083	D	0.85983	0.1484	10	0.21014	T	0.42	-20.4333	11.5604	0.50774	0.0:0.8664:0.0:0.1336	.	107;221;429	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	I	107;429;429;429	ENSP00000410438:V107I;ENSP00000248633:V429I;ENSP00000394413:V429I	ENSP00000248633:V429I	V	-	1	0	PEX1	91981172	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.607000	0.36836	2.769000	0.95229	0.561000	0.74099	GTA	PEX1	-	NULL	ENSG00000127980		0.308	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX1	HGNC	protein_coding	OTTHUMT00000254066.3	76	0.00	0	C	NM_000466		92143236	92143236	-1	no_errors	ENST00000248633	ensembl	human	known	69_37n	missense	84	25.00	28	SNP	1.000	T
C10orf55	414236	genome.wustl.edu	37	10	75675049	75675049	+	Intron	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:75675049G>A	ENST00000409178.1	-	2	268				C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000372762.4_Silent_p.V301V|PLAU_ENST00000372764.3_Silent_p.V337V|PLAU_ENST00000446342.1_Silent_p.V320V	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					TGACTGTTGTGAAGCTGATTT	0.512																																						dbGAP											0													103.0	101.0	101.0					10																	75675049		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.72+1227C>T	10.37:g.75675049G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KRG4|Q8NAK4	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Kringle,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,pfscan_EG-like_dom,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V337	ENST00000409178.1	37	c.1011	CCDS53541.1	10																																																																																			PLAU	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000122861		0.512	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAU	HGNC	protein_coding	OTTHUMT00000048746.1	180	0.55	1	G	NM_001001791		75675049	75675049	+1	no_errors	ENST00000372764	ensembl	human	known	69_37n	silent	59	42.16	43	SNP	0.929	A
PLG	5340	genome.wustl.edu	37	6	161137755	161137755	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr6:161137755C>A	ENST00000308192.9	+	7	810	c.747C>A	c.(745-747)gaC>gaA	p.D249E		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	249	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TCACCACCGACCCCAACAAGC	0.483																																						dbGAP											0													70.0	66.0	67.0					6																	161137755		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.747C>A	6.37:g.161137755C>A	ENSP00000308938:p.Asp249Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.D249E	ENST00000308192.9	37	c.747	CCDS5279.1	6	.	.	.	.	.	.	.	.	.	.	C	13.48	2.250351	0.39797	.	.	ENSG00000122194	ENST00000308192	T	0.64618	-0.11	5.26	-5.4	0.02656	Kringle (4);Kringle-like fold (1);	0.172675	0.26832	U	0.022271	T	0.46964	0.1420	M	0.83692	2.655	0.26765	N	0.969928	B	0.33583	0.418	B	0.35655	0.207	T	0.57825	-0.7744	10	0.87932	D	0	.	15.585	0.76475	0.0:0.7719:0.0:0.2281	.	249	P00747	PLMN_HUMAN	E	249	ENSP00000308938:D249E	ENSP00000308938:D249E	D	+	3	2	PLG	161057745	0.000000	0.05858	0.790000	0.31976	0.722000	0.41435	-0.299000	0.08254	-1.015000	0.03375	-0.471000	0.05019	GAC	PLG	-	pirsf_Pept_S1A_plasmin,pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000122194		0.483	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	99	0.00	0	C	NM_000301		161137755	161137755	+1	no_errors	ENST00000308192	ensembl	human	known	69_37n	missense	48	27.27	18	SNP	0.966	A
PPP1R16B	26051	genome.wustl.edu	37	20	37529305	37529305	+	Silent	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr20:37529305C>T	ENST00000299824.1	+	5	738	c.549C>T	c.(547-549)atC>atT	p.I183I	PPP1R16B_ENST00000373331.2_Silent_p.I183I	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	183					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				TGGATGTCATCGAGACCTGCA	0.557																																						dbGAP											0													123.0	84.0	97.0					20																	37529305		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.549C>T	20.37:g.37529305C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S126L	ENST00000299824.1	37	c.377	CCDS13309.1	20	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472372	0.26423	.	.	ENSG00000101445	ENST00000438192	.	.	.	4.98	-1.21	0.09524	.	.	.	.	.	T	0.58047	0.2095	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55205	-0.8177	4	.	.	.	.	11.5783	0.50877	0.0:0.5437:0.0:0.4563	.	.	.	.	L	126	.	.	S	+	2	0	PPP1R16B	36962719	0.003000	0.15002	0.995000	0.50966	0.999000	0.98932	-1.292000	0.02772	-0.152000	0.11156	0.655000	0.94253	TCG	PPP1R16B	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000101445		0.557	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16B	HGNC	protein_coding	OTTHUMT00000079220.2	267	0.00	0	C	NM_015568		37529305	37529305	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000438192	ensembl	human	novel	69_37n	missense	75	34.78	40	SNP	0.978	T
PRRT2	112476	genome.wustl.edu	37	16	29824982	29824982	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr16:29824982C>T	ENST00000358758.7	+	2	890	c.607C>T	c.(607-609)Cca>Tca	p.P203S	PAGR1_ENST00000320330.6_5'Flank|PRRT2_ENST00000567551.1_Intron|PRRT2_ENST00000567659.1_Missense_Mutation_p.P203S|AC009133.14_ENST00000569981.1_RNA|AC009133.20_ENST00000569039.1_RNA|PRRT2_ENST00000300797.6_Missense_Mutation_p.P203S|PAGR1_ENST00000609618.1_5'Flank	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	203	Pro-rich.				neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						GCCTCACTCACCACCCTCAAA	0.612																																						dbGAP											0													14.0	15.0	15.0					16																	29824982		2184	4284	6468	-	-	-	SO:0001583	missense	0			BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.607C>T	16.37:g.29824982C>T	ENSP00000351608:p.Pro203Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Missense_Mutation	SNP	pfam_Interferon-induced_TM_protein	p.P203S	ENST00000358758.7	37	c.607	CCDS10654.1	16	.	.	.	.	.	.	.	.	.	.	C	6.245	0.413288	0.11812	.	.	ENSG00000167371	ENST00000358758;ENST00000300797	T;T	0.76448	-1.02;0.16	3.9	1.94	0.25998	.	0.128677	0.52532	N	0.000078	T	0.56717	0.2004	N	0.24115	0.695	0.27290	N	0.957863	B;B;B	0.23891	0.011;0.02;0.093	B;B;B	0.25140	0.013;0.008;0.058	T	0.33904	-0.9850	10	0.17369	T	0.5	-0.3414	3.44	0.07460	0.2008:0.5814:0.0:0.2178	.	203;203;203	Q7Z6L0-3;Q7Z6L0;Q7Z6L0-2	.;PRRT2_HUMAN;.	S	203	ENSP00000351608:P203S;ENSP00000300797:P203S	ENSP00000300797:P203S	P	+	1	0	PRRT2	29732483	0.000000	0.05858	0.631000	0.29282	0.495000	0.33615	-0.488000	0.06497	0.446000	0.26666	0.563000	0.77884	CCA	PRRT2	-	NULL	ENSG00000167371		0.612	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT2	HGNC	protein_coding	OTTHUMT00000255161.3	12	0.00	0	C	NM_145239		29824982	29824982	+1	no_errors	ENST00000567659	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.339	T
PTPLAD2	401494	genome.wustl.edu	37	9	21011668	21011668	+	Missense_Mutation	SNP	A	A	G	rs189125285		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr9:21011668A>G	ENST00000495827.2	-	5	455	c.410T>C	c.(409-411)aTa>aCa	p.I137T	PTPLAD2_ENST00000513293.2_Missense_Mutation_p.I137T	NM_001010915.3	NP_001010915.2	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain containing 2	137					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		GGATATTCCTATGACTGATAA	0.378													A|||	1	0.000199681	0.0	0.0014	5008	,	,		19955	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													75.0	67.0	70.0					9																	21011668		1876	4111	5987	-	-	-	SO:0001583	missense	0				CCDS43791.1	9p21.3	2008-02-05			ENSG00000188921	ENSG00000188921			20920	protein-coding gene	gene with protein product		615941					Standard	NM_001010915		Approved	Em:AL662879.1, OTTHUMG00000021016	uc010mir.1	Q5VWC8	OTTHUMG00000021016	ENST00000495827.2:c.410T>C	9.37:g.21011668A>G	ENSP00000419503:p.Ile137Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z385	Missense_Mutation	SNP	pfam_Tyr_Pase-like_PTPLA	p.I137T	ENST00000495827.2	37	c.410	CCDS43791.1	9	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	13.49	2.253652	0.39797	.	.	ENSG00000188921	ENST00000513293;ENST00000495827	T;T	0.31769	1.48;1.48	5.7	5.7	0.88788	.	0.241503	0.44483	D	0.000448	T	0.30634	0.0771	L	0.60455	1.87	0.32265	N	0.569656	B	0.02656	0.0	B	0.10450	0.005	T	0.34030	-0.9845	10	0.44086	T	0.13	-9.1659	10.7846	0.46398	0.9253:0.0:0.0747:0.0	.	137	Q5VWC8	HACD4_HUMAN	T	137	ENSP00000426475:I137T;ENSP00000419503:I137T	ENSP00000419503:I137T	I	-	2	0	PTPLAD2	21001668	0.724000	0.28038	1.000000	0.80357	0.823000	0.46562	1.576000	0.36504	2.174000	0.68829	0.402000	0.26972	ATA	PTPLAD2	-	pfam_Tyr_Pase-like_PTPLA	ENSG00000188921		0.378	PTPLAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLAD2	HGNC	protein_coding	OTTHUMT00000055434.3	201	0.00	0	A	NM_001010915		21011668	21011668	-1	no_errors	ENST00000495827	ensembl	human	known	69_37n	missense	51	29.17	21	SNP	0.958	G
RAD51D	5892	genome.wustl.edu	37	17	33430502	33430502	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr17:33430502G>A	ENST00000345365.6	-	7	893	c.638C>T	c.(637-639)tCc>tTc	p.S213F	RAD51D_ENST00000335858.7_Missense_Mutation_p.S101F|RAD51D_ENST00000590380.1_5'UTR|RAD51D_ENST00000394589.4_Missense_Mutation_p.S213F|RAD51D_ENST00000460118.2_Missense_Mutation_p.S94F|RAD51D_ENST00000590016.1_Missense_Mutation_p.S233F|RAD51L3-RFFL_ENST00000593039.1_Missense_Mutation_p.S54F|RAD51D_ENST00000360276.3_Missense_Mutation_p.S168F	NM_002878.3	NP_002869.3	O75771	RA51D_HUMAN	RAD51 paralog D	213					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|reciprocal meiotic recombination (GO:0007131)|strand invasion (GO:0042148)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|gamma-tubulin binding (GO:0043015)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CAGAAGTGGGGAAACCACCGC	0.582								Direct reversal of damage																														dbGAP											0													109.0	92.0	98.0					17																	33430502		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034956	CCDS11287.1, CCDS11288.1, CCDS45646.1	17q11	2014-09-17	2013-07-02	2011-07-01	ENSG00000185379	ENSG00000185379			9823	protein-coding gene	gene with protein product	"""recombination repair protein"", ""DNA repair protein RAD51 homolog 4"""	602954	"""RAD51 (S. cerevisiae)-like 3"", ""RAD51-like 3 (S. cerevisiae)"", ""RAD51 homolog D (S. cerevisiae)"""	RAD51L3		9570954	Standard	NM_001142571		Approved	R51H3, Trad, HsTRAD	uc010ctj.2	O75771	OTTHUMG00000132930	ENST00000345365.6:c.638C>T	17.37:g.33430502G>A	ENSP00000338790:p.Ser213Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJU7|E1P637|O43537|O60355|O75196|O75847|O75848|O76073|O76085|O94908|Q9UFU5	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_Circ_KaiC/RadA,smart_AAA+_ATPase,pfscan_DNA_recomb_RecA/RadB_ATP-bd	p.S233F	ENST00000345365.6	37	c.698	CCDS11287.1	17	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302804	0.40795	.	.	ENSG00000185379	ENST00000345365;ENST00000394589;ENST00000335858;ENST00000360276;ENST00000345766;ENST00000418935	T;T	0.67523	1.08;-0.27	5.05	5.05	0.67936	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.283582	0.40818	N	0.001006	T	0.74045	0.3665	L	0.52905	1.665	0.80722	D	1	P;P;P;P	0.52316	0.952;0.822;0.77;0.91	P;B;P;P	0.56216	0.791;0.339;0.794;0.691	T	0.76788	-0.2830	10	0.87932	D	0	-4.2101	15.2515	0.73549	0.0:0.0:1.0:0.0	.	233;101;213;213	B4DJU7;O75771-3;O75771;F8W8E6	.;.;RA51D_HUMAN;.	F	213;233;213;168;101;213	ENSP00000338790:S213F;ENSP00000353417:S168F	ENSP00000338408:S213F	S	-	2	0	RAD51D	30454615	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.654000	0.54453	2.632000	0.89209	0.591000	0.81541	TCC	RAD51D	-	pfam_DNA_recomb/repair_Rad51_C,pfam_Circ_KaiC/RadA,smart_AAA+_ATPase,pfscan_DNA_recomb_RecA/RadB_ATP-bd	ENSG00000185379		0.582	RAD51D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51D	HGNC	protein_coding	OTTHUMT00000256446.1	224	0.00	0	G	NM_002878		33430502	33430502	-1	no_errors	ENST00000590016	ensembl	human	known	69_37n	missense	51	32.89	25	SNP	1.000	A
RASAL2	9462	genome.wustl.edu	37	1	178435229	178435229	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr1:178435229G>T	ENST00000462775.1	+	14	3264	c.3139G>T	c.(3139-3141)Gat>Tat	p.D1047Y	RASAL2_ENST00000367649.3_Missense_Mutation_p.D1188Y|RASAL2_ENST00000448150.3_Missense_Mutation_p.D1177Y	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	1047					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						GGAAGAAAAAGATAGCCAGAT	0.522																																						dbGAP											0													60.0	52.0	55.0					1																	178435229		2194	4291	6485	-	-	-	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.3139G>T	1.37:g.178435229G>T	ENSP00000420558:p.Asp1047Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.D1188Y	ENST00000462775.1	37	c.3562	CCDS1322.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.557105|4.557105	0.86231|0.86231	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	T;T;T|.	0.28255|.	1.62;1.62;1.62|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.81422|0.81422	0.4819|0.4819	M|M	0.79123|0.79123	2.44|2.44	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.992;1.0|.	D;D;D|.	0.97110|.	0.999;0.949;1.0|.	T|T	0.80596|0.80596	-0.1312|-0.1312	10|5	0.87932|.	D|.	0|.	.|.	20.0139|20.0139	0.97470|0.97470	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1177;1047;1188|.	B1AKC7;Q9UJF2;F8W755|.	.;NGAP_HUMAN;.|.	Y|I	1177;1188;1047|597	ENSP00000407768:D1177Y;ENSP00000356621:D1188Y;ENSP00000420558:D1047Y|.	ENSP00000356621:D1188Y|.	D|R	+|+	1|2	0|0	RASAL2|RASAL2	176701852|176701852	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.746000|0.746000	0.42486|0.42486	9.731000|9.731000	0.98807|0.98807	2.724000|2.724000	0.93272|0.93272	0.563000|0.563000	0.77884|0.77884	GAT|AGA	RASAL2	-	pfam_DUF3498	ENSG00000075391		0.522	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	83	0.00	0	G	NM_170692		178435229	178435229	+1	no_errors	ENST00000367649	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	1.000	T
RTKN2	219790	genome.wustl.edu	37	10	64000922	64000922	+	Missense_Mutation	SNP	C	C	G	rs377435237		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:64000922C>G	ENST00000373789.3	-	4	445	c.349G>C	c.(349-351)Gat>Cat	p.D117H	RTKN2_ENST00000395260.3_Missense_Mutation_p.D117H|RTKN2_ENST00000395265.1_Missense_Mutation_p.D117H	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	117					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					CTGAAGTGATCAGAGTCTTTC	0.284																																						dbGAP											0													52.0	54.0	53.0					10																	64000922		2202	4285	6487	-	-	-	SO:0001583	missense	0			BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.349G>C	10.37:g.64000922C>G	ENSP00000362894:p.Asp117His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D117H	ENST00000373789.3	37	c.349	CCDS7263.1	10	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588519	0.86851	.	.	ENSG00000182010	ENST00000395265;ENST00000373789;ENST00000395260	T;T;T	0.45668	0.89;0.89;0.89	5.95	5.95	0.96441	.	0.134220	0.64402	D	0.000003	T	0.68476	0.3005	M	0.78801	2.425	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.67894	-0.5552	10	0.54805	T	0.06	0.5827	20.3932	0.98965	0.0:1.0:0.0:0.0	.	117;117	Q8IZC4-3;Q8IZC4	.;RTKN2_HUMAN	H	117	ENSP00000378682:D117H;ENSP00000362894:D117H;ENSP00000378678:D117H	ENSP00000362894:D117H	D	-	1	0	RTKN2	63670928	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.270000	0.72563	2.824000	0.97209	0.655000	0.94253	GAT	RTKN2	-	NULL	ENSG00000182010		0.284	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RTKN2	HGNC	protein_coding	OTTHUMT00000091618.1	95	0.00	0	C	NM_145307		64000922	64000922	-1	no_errors	ENST00000373789	ensembl	human	known	69_37n	missense	74	23.71	23	SNP	1.000	G
SCN1B	6324	genome.wustl.edu	37	19	35530584	35530584	+	Silent	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:35530584G>A	ENST00000262631.5	+	5	773	c.636G>A	c.(634-636)acG>acA	p.T212T	HPN_ENST00000597419.1_5'Flank|CTD-2527I21.9_ENST00000601692.1_RNA|HPN_ENST00000262626.2_5'Flank|SCN1B_ENST00000595652.1_Silent_p.T141T|HPN_ENST00000392226.1_5'Flank	NM_001037.4	NP_001028.1	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta subunit	212					axon guidance (GO:0007411)|cardiac conduction (GO:0061337)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|corticospinal neuron axon guidance (GO:0021966)|locomotion (GO:0040011)|membrane depolarization (GO:0051899)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during Purkinje myocyte cell action potential (GO:0086047)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|intercalated disc (GO:0014704)|node of Ranvier (GO:0033268)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)|voltage-gated sodium channel activity involved in Purkinje myocyte action potential (GO:0086062)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	11	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Valproic Acid(DB00313)|Zonisamide(DB00909)	AGAACTGCACGGGCGTCCAGG	0.617																																						dbGAP											0													81.0	70.0	74.0					19																	35530584		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12441.1, CCDS46047.1	19q13.12	2014-09-17	2012-02-28		ENSG00000105711	ENSG00000105711		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10586	protein-coding gene	gene with protein product		600235	"""sodium channel, voltage-gated, type I, beta polypeptide"", ""sodium channel, voltage-gated, type I, beta"""			8394762	Standard	NM_001037		Approved		uc002nxo.2	Q07699	OTTHUMG00000182472	ENST00000262631.5:c.636G>A	19.37:g.35530584G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZZ4|Q6TN97	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_V-set	p.T212	ENST00000262631.5	37	c.636	CCDS12441.1	19																																																																																			SCN1B	-	NULL	ENSG00000105711		0.617	SCN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN1B	HGNC	protein_coding	OTTHUMT00000461567.1	170	0.00	0	G			35530584	35530584	+1	no_errors	ENST00000262631	ensembl	human	known	69_37n	silent	61	16.44	12	SNP	0.879	A
SEC24C	9632	genome.wustl.edu	37	10	75520490	75520490	+	Silent	SNP	G	G	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:75520490G>C	ENST00000339365.2	+	7	1032	c.870G>C	c.(868-870)cgG>cgC	p.R290R	SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Silent_p.R148R|SEC24C_ENST00000345254.4_Silent_p.R290R|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000546025.1_Silent_p.R148R	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	290					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GACCAGCCCGGGGCCCTCAGT	0.567																																						dbGAP											0													55.0	63.0	61.0					10																	75520490		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.870G>C	10.37:g.75520490G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZT4|Q8WV25	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.R290	ENST00000339365.2	37	c.870	CCDS7332.1	10																																																																																			SEC24C	-	NULL	ENSG00000176986		0.567	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	69	0.00	0	G			75520490	75520490	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	silent	44	25.42	15	SNP	0.958	C
SFI1	9814	genome.wustl.edu	37	22	32009792	32009792	+	Silent	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr22:32009792C>T	ENST00000400288.2	+	27	3052	c.2947C>T	c.(2947-2949)Ctg>Ttg	p.L983L	SFI1_ENST00000432498.1_Silent_p.L952L|SFI1_ENST00000414585.1_Silent_p.L830L|SFI1_ENST00000400289.1_Silent_p.L901L|SFI1_ENST00000443011.1_Silent_p.L830L|SFI1_ENST00000443326.1_Silent_p.L901L|SFI1_ENST00000540643.1_Silent_p.L928L	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	983					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						TTCTCGGCCTCTGGGAGCTCT	0.632											OREG0003527	type=REGULATORY REGION|Gene=SFI1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													16.0	20.0	18.0					22																	32009792		2015	4174	6189	-	-	-	SO:0001819	synonymous_variant	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2947C>T	22.37:g.32009792C>T		Somatic	829	WXS	Illumina GAIIx	Phase_IV	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Silent	SNP	superfamily_Cyclin-like	p.L983	ENST00000400288.2	37	c.2947	CCDS43004.1	22																																																																																			SFI1	-	NULL	ENSG00000198089		0.632	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	41	0.00	0	C	NM_014775		32009792	32009792	+1	no_errors	ENST00000400288	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	0.000	T
SHC2	25759	genome.wustl.edu	37	19	438818	438818	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:438818G>T	ENST00000264554.6	-	4	619	c.620C>A	c.(619-621)gCg>gAg	p.A207E		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	207	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGACGGACGCCAGGGCCTT	0.687																																						dbGAP											0													32.0	37.0	35.0					19																	438818		2061	4156	6217	-	-	-	SO:0001583	missense	0			AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.620C>A	19.37:g.438818G>T	ENSP00000264554:p.Ala207Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60230|Q9NPL5|Q9UCX4	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_SH2,smart_PTyr_interaction_dom,smart_SH2,prints_PID_domain,prints_SH2,pfscan_PTyr_interaction_dom,pfscan_SH2	p.A207E	ENST00000264554.6	37	c.620	CCDS45891.1	19	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422622	0.43020	.	.	ENSG00000129946	ENST00000264554	T	0.20463	2.07	3.67	2.63	0.31362	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.437810	0.25063	N	0.033423	T	0.17534	0.0421	L	0.27053	0.805	0.26831	N	0.968575	P	0.36282	0.546	P	0.45232	0.474	T	0.06058	-1.0848	10	0.40728	T	0.16	-23.3961	6.691	0.23171	0.2092:0.0:0.7908:0.0	.	207	P98077	SHC2_HUMAN	E	207	ENSP00000264554:A207E	ENSP00000264554:A207E	A	-	2	0	SHC2	389818	0.955000	0.32602	0.998000	0.56505	0.740000	0.42216	2.387000	0.44389	2.006000	0.58801	0.491000	0.48974	GCG	SHC2	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000129946		0.687	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC2	HGNC	protein_coding	OTTHUMT00000451840.3	222	0.00	0	G			438818	438818	-1	no_errors	ENST00000264554	ensembl	human	known	69_37n	missense	80	13.98	13	SNP	1.000	T
SHD	56961	genome.wustl.edu	37	19	4290544	4290544	+	Missense_Mutation	SNP	G	G	A	rs555300757		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:4290544G>A	ENST00000543264.2	+	6	2400	c.937G>A	c.(937-939)Gtc>Atc	p.V313I	SHD_ENST00000599689.1_Missense_Mutation_p.V273I	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	313	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGAGCTCGTCCTCCACTA	0.672																																						dbGAP											0													69.0	64.0	66.0					19																	4290544		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.937G>A	19.37:g.4290544G>A	ENSP00000446058:p.Val313Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96NC2	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.V313I	ENST00000543264.2	37	c.937	CCDS12125.1	19	.	.	.	.	.	.	.	.	.	.	G	9.633	1.137009	0.21123	.	.	ENSG00000105251	ENST00000543264;ENST00000221852	T	0.66099	-0.19	4.41	3.33	0.38152	SH2 motif (5);	0.133282	0.50627	D	0.000110	T	0.37376	0.1001	N	0.04018	-0.295	0.32971	D	0.52229	B;B	0.30741	0.293;0.261	B;B	0.32583	0.085;0.148	T	0.45906	-0.9229	10	0.17369	T	0.5	-16.8074	11.9007	0.52682	0.0:0.1778:0.8222:0.0	.	220;313	Q9NPN8;Q96IW2	.;SHD_HUMAN	I	313;228	ENSP00000446058:V313I	ENSP00000221852:V228I	V	+	1	0	SHD	4241544	1.000000	0.71417	1.000000	0.80357	0.346000	0.29079	2.817000	0.48034	1.042000	0.40150	0.485000	0.47835	GTC	SHD	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000105251		0.672	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SHD	HGNC	protein_coding	OTTHUMT00000458082.1	72	0.00	0	G	NM_020209		4290544	4290544	+1	no_errors	ENST00000543264	ensembl	human	known	69_37n	missense	32	31.91	15	SNP	1.000	A
SLC15A1	6564	genome.wustl.edu	37	13	99364112	99364112	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr13:99364112T>A	ENST00000376503.5	-	11	951	c.896A>T	c.(895-897)cAg>cTg	p.Q299L		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	299					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CATTACCTGCTGGTCAAACAA	0.478																																						dbGAP											0													172.0	130.0	144.0					13																	99364112		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.896A>T	13.37:g.99364112T>A	ENSP00000365686:p.Gln299Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW82	Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	p.Q299L	ENST00000376503.5	37	c.896	CCDS9489.1	13	.	.	.	.	.	.	.	.	.	.	T	25.5	4.648230	0.87958	.	.	ENSG00000088386	ENST00000376503	T	0.06371	3.31	4.82	4.82	0.62117	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.33469	0.0864	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.45011	-0.9290	10	0.87932	D	0	-44.2389	14.6833	0.69033	0.0:0.0:0.0:1.0	.	299	P46059	S15A1_HUMAN	L	299	ENSP00000365686:Q299L	ENSP00000365686:Q299L	Q	-	2	0	SLC15A1	98162113	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	7.787000	0.85759	1.937000	0.56155	0.460000	0.39030	CAG	SLC15A1	-	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	ENSG00000088386		0.478	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A1	HGNC	protein_coding	OTTHUMT00000045560.3	340	0.00	0	T	NM_005073		99364112	99364112	-1	no_errors	ENST00000376503	ensembl	human	known	69_37n	missense	80	45.21	66	SNP	1.000	A
SLITRK4	139065	genome.wustl.edu	37	X	142718314	142718314	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chrX:142718314C>A	ENST00000381779.4	-	2	836	c.611G>T	c.(610-612)cGt>cTt	p.R204L	SLITRK4_ENST00000338017.4_Missense_Mutation_p.R204L|SLITRK4_ENST00000356928.1_Missense_Mutation_p.R204L	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	204						integral component of membrane (GO:0016021)		p.R204H(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TTCAACGACACGGCCAATGTG	0.428																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											86.0	82.0	84.0					X																	142718314		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.611G>T	X.37:g.142718314C>A	ENSP00000371198:p.Arg204Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R204L	ENST00000381779.4	37	c.611	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779322	0.49891	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.52754	0.65;0.65;0.65	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.54806	0.1881	L	0.33792	1.035	0.80722	D	1	P	0.52463	0.953	P	0.57324	0.818	T	0.53493	-0.8431	10	0.46703	T	0.11	-6.3467	17.313	0.87214	0.0:1.0:0.0:0.0	.	204	Q8IW52	SLIK4_HUMAN	L	204	ENSP00000371198:R204L;ENSP00000349400:R204L;ENSP00000336627:R204L	ENSP00000336627:R204L	R	-	2	0	SLITRK4	142545980	1.000000	0.71417	0.840000	0.33206	0.462000	0.32619	7.818000	0.86416	2.412000	0.81896	0.597000	0.82753	CGT	SLITRK4	-	NULL	ENSG00000179542		0.428	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	160	0.00	0	C	NM_173078		142718314	142718314	-1	no_errors	ENST00000338017	ensembl	human	known	69_37n	missense	52	24.29	17	SNP	1.000	A
SPTA1	6708	genome.wustl.edu	37	1	158648298	158648298	+	Silent	SNP	A	A	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr1:158648298A>T	ENST00000368147.4	-	6	885	c.705T>A	c.(703-705)atT>atA	p.I235I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	235					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCTTAGACTGAATTAAGGGTA	0.403																																						dbGAP											0													72.0	68.0	69.0					1																	158648298		1871	4105	5976	-	-	-	SO:0001819	synonymous_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.705T>A	1.37:g.158648298A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.I235	ENST00000368147.4	37	c.705	CCDS41423.1	1																																																																																			SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.403	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	103	0.00	0	A	NM_003126		158648298	158648298	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	silent	95	18.10	21	SNP	0.023	T
SSPO	23145	genome.wustl.edu	37	7	149475874	149475874	+	RNA	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:149475874G>A	ENST00000378016.2	+	0	840							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCAGGGCTGAGCCTGCAAT	0.627																																						dbGAP											0													28.0	34.0	32.0					7																	149475874		2084	4212	6296	-	-	-			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149475874G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.627	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		179	0.00	0	G			149475874	149475874	+1	no_errors	ENST00000262089	ensembl	human	known	69_37n	rna	101	24.63	33	SNP	0.999	A
STRN	6801	genome.wustl.edu	37	2	37111155	37111155	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:37111155G>A	ENST00000263918.4	-	9	1114	c.1106C>T	c.(1105-1107)tCa>tTa	p.S369L	STRN_ENST00000379213.2_Missense_Mutation_p.S320L	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	369					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				TGGCTGCAATGAAGGAAGTTC	0.433																																						dbGAP											0													92.0	83.0	86.0					2																	37111155		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.1106C>T	2.37:g.37111155G>A	ENSP00000263918:p.Ser369Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S369L	ENST00000263918.4	37	c.1106	CCDS1784.1	2	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596947	0.46318	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	T;T	0.66099	-0.19;-0.06	5.83	5.83	0.93111	.	0.310608	0.33534	N	0.004805	T	0.59224	0.2178	L	0.50333	1.59	0.53688	D	0.999973	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.003	T	0.53194	-0.8473	10	0.19147	T	0.46	-8.2915	20.111	0.97911	0.0:0.0:1.0:0.0	.	320;369	O43815-2;O43815	.;STRN_HUMAN	L	369;344;320	ENSP00000263918:S369L;ENSP00000368513:S320L	ENSP00000263918:S369L	S	-	2	0	STRN	36964659	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.827000	0.69300	2.747000	0.94245	0.650000	0.86243	TCA	STRN	-	NULL	ENSG00000115808		0.433	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRN	HGNC	protein_coding	OTTHUMT00000218568.1	232	0.00	0	G			37111155	37111155	-1	no_errors	ENST00000263918	ensembl	human	known	69_37n	missense	193	15.35	35	SNP	1.000	A
STRN3	29966	genome.wustl.edu	37	14	31381308	31381308	+	Silent	SNP	T	T	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr14:31381308T>C	ENST00000357479.5	-	11	1651	c.1455A>G	c.(1453-1455)gcA>gcG	p.A485A	STRN3_ENST00000355683.5_Silent_p.A401A|STRN3_ENST00000366206.2_5'UTR	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	485					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		GAAAAGCTAATGCCCGTACTC	0.428																																						dbGAP											0													134.0	129.0	131.0					14																	31381308		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1455A>G	14.37:g.31381308T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX7|A6NHZ7|Q9NRA5	Silent	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A485	ENST00000357479.5	37	c.1455	CCDS41938.1	14																																																																																			STRN3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196792		0.428	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	STRN3	HGNC	protein_coding	OTTHUMT00000409713.1	194	0.00	0	T	NM_014574		31381308	31381308	-1	no_errors	ENST00000357479	ensembl	human	known	69_37n	silent	93	25.60	32	SNP	1.000	C
SVIL	6840	genome.wustl.edu	37	10	29839670	29839670	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr10:29839670G>A	ENST00000355867.4	-	6	1435	c.683C>T	c.(682-684)tCg>tTg	p.S228L	SVIL_ENST00000375400.3_Missense_Mutation_p.S228L|SVIL_ENST00000375398.2_Missense_Mutation_p.S228L	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	228					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				AGAGAAGGTCGAGGAACTCTC	0.627																																						dbGAP											0													76.0	77.0	77.0					10																	29839670		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.683C>T	10.37:g.29839670G>A	ENSP00000348128:p.Ser228Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.S228L	ENST00000355867.4	37	c.683	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	G	7.751	0.703355	0.15172	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.43294	0.95;0.95;0.95	5.51	4.61	0.57282	.	0.364495	0.31872	N	0.006925	T	0.28167	0.0695	L	0.41824	1.3	0.18873	N	0.999982	P;B	0.38280	0.625;0.001	B;B	0.24701	0.055;0.001	T	0.13629	-1.0502	9	.	.	.	-7.1858	11.2935	0.49265	0.1584:0.0:0.8416:0.0	.	228;228	O95425-2;O95425	.;SVIL_HUMAN	L	228	ENSP00000364549:S228L;ENSP00000364547:S228L;ENSP00000348128:S228L	.	S	-	2	0	SVIL	29879676	0.046000	0.20272	0.192000	0.23308	0.050000	0.14768	2.449000	0.44935	1.327000	0.45338	-0.137000	0.14449	TCG	SVIL	-	NULL	ENSG00000197321		0.627	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	137	0.00	0	G			29839670	29839670	-1	no_errors	ENST00000355867	ensembl	human	known	69_37n	missense	73	28.43	29	SNP	0.112	A
SYNE3	161176	genome.wustl.edu	37	14	95921720	95921720	+	Silent	SNP	G	G	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr14:95921720G>T	ENST00000334258.5	-	5	1145	c.1131C>A	c.(1129-1131)cgC>cgA	p.R377R	SYNE3_ENST00000557275.1_Silent_p.R377R|SYNE3_ENST00000554873.1_Silent_p.R134R|SYNE3_ENST00000553340.1_Silent_p.R377R	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	377					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						TTACCGAGTAGCGTCTCCAGT	0.642																																						dbGAP											0													28.0	31.0	30.0					14																	95921720		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1131C>A	14.37:g.95921720G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8H3|Q86SX5|Q8N7G8	Silent	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.R377	ENST00000334258.5	37	c.1131	CCDS9935.1	14																																																																																			SYNE3	-	NULL	ENSG00000176438		0.642	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	61	0.00	0	G	NM_152592		95921720	95921720	-1	no_errors	ENST00000334258	ensembl	human	known	69_37n	silent	15	31.82	7	SNP	0.041	T
TAX1BP1	8887	genome.wustl.edu	37	7	27856569	27856569	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:27856569C>G	ENST00000396319.2	+	15	2085	c.1997C>G	c.(1996-1998)tCt>tGt	p.S666C	TAX1BP1_ENST00000409980.1_Missense_Mutation_p.S690C|TAX1BP1_ENST00000265393.6_Missense_Mutation_p.S624C|TAX1BP1_ENST00000433216.2_Missense_Mutation_p.S467C|TAX1BP1_ENST00000543117.1_Missense_Mutation_p.S624C	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	666					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)			breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			AGAGTCCCCTCTTGGGGACTG	0.443																																						dbGAP											0													65.0	68.0	67.0					7																	27856569		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1997C>G	7.37:g.27856569C>G	ENSP00000379612:p.Ser666Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Missense_Mutation	SNP	pfam_CoCoA	p.S666C	ENST00000396319.2	37	c.1997	CCDS5415.1	7	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120301	0.37436	.	.	ENSG00000106052	ENST00000543117;ENST00000265393;ENST00000409980;ENST00000433216;ENST00000396319;ENST00000457186	T;T;T;T;T	0.34667	2.76;2.76;2.75;1.35;2.7	5.67	4.6	0.57074	.	0.765113	0.11633	N	0.544611	T	0.55721	0.1938	M	0.65498	2.005	0.09310	N	1	D;P;D	0.65815	0.995;0.584;0.992	P;B;P	0.61940	0.784;0.443;0.896	T	0.45041	-0.9288	10	0.56958	D	0.05	-7.4613	13.2574	0.60087	0.0:0.8802:0.0:0.1198	.	467;666;624	E7ENV2;Q86VP1;Q86VP1-2	.;TAXB1_HUMAN;.	C	624;624;690;467;666;203	ENSP00000444811:S624C;ENSP00000265393:S624C;ENSP00000386515:S690C;ENSP00000391907:S467C;ENSP00000379612:S666C	ENSP00000265393:S624C	S	+	2	0	TAX1BP1	27823094	0.969000	0.33509	0.257000	0.24404	0.326000	0.28443	2.609000	0.46317	2.697000	0.92050	0.655000	0.94253	TCT	TAX1BP1	-	NULL	ENSG00000106052		0.443	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAX1BP1	HGNC	protein_coding	OTTHUMT00000214142.1	63	0.00	0	C	NM_006024		27856569	27856569	+1	no_errors	ENST00000396319	ensembl	human	known	69_37n	missense	78	29.09	32	SNP	0.004	G
TCTN2	79867	genome.wustl.edu	37	12	124191321	124191321	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr12:124191321C>G	ENST00000303372.5	+	16	1946	c.1818C>G	c.(1816-1818)caC>caG	p.H606Q	RP11-338K17.8_ENST00000538837.1_lincRNA|TCTN2_ENST00000426174.2_Missense_Mutation_p.H605Q	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	606					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CCTGTGAGCACAAGGCCGACC	0.502																																						dbGAP											0													160.0	132.0	142.0					12																	124191321		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.1818C>G	12.37:g.124191321C>G	ENSP00000304941:p.His606Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Y8|B3KPW5|Q9H966	Missense_Mutation	SNP	pfam_DUF1619	p.H606Q	ENST00000303372.5	37	c.1818	CCDS9253.1	12	.	.	.	.	.	.	.	.	.	.	C	9.571	1.120928	0.20877	.	.	ENSG00000168778	ENST00000426174;ENST00000303372	D;D	0.81659	-1.52;-1.52	5.21	-9.96	0.00443	.	0.562827	0.17892	N	0.158496	T	0.48040	0.1478	N	0.03608	-0.345	0.09310	N	1	B;B	0.21452	0.056;0.056	B;B	0.18871	0.023;0.023	T	0.48885	-0.8995	10	0.09338	T	0.73	-15.3917	12.5511	0.56227	0.0:0.6185:0.2021:0.1794	.	605;606	A8K7Y8;Q96GX1	.;TECT2_HUMAN	Q	605;606	ENSP00000395171:H605Q;ENSP00000304941:H606Q	ENSP00000304941:H606Q	H	+	3	2	TCTN2	122757274	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-1.299000	0.02754	-2.123000	0.00823	-0.482000	0.04802	CAC	TCTN2	-	NULL	ENSG00000168778		0.502	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCTN2	HGNC	protein_coding	OTTHUMT00000400652.1	347	0.00	0	C	NM_024809		124191321	124191321	+1	no_errors	ENST00000303372	ensembl	human	known	69_37n	missense	108	31.21	49	SNP	0.001	G
TGM6	343641	genome.wustl.edu	37	20	2380303	2380303	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr20:2380303A>T	ENST00000202625.2	+	6	830	c.769A>T	c.(769-771)Att>Ttt	p.I257F	TGM6_ENST00000477505.1_3'UTR|TGM6_ENST00000381423.1_Missense_Mutation_p.I257F	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	257					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	CAGCGTGGCCATTCTGCAGAA	0.642																																						dbGAP											0													50.0	50.0	50.0					20																	2380303		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.769A>T	20.37:g.2380303A>T	ENSP00000202625:p.Ile257Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.I257F	ENST00000202625.2	37	c.769	CCDS13025.1	20	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487548	0.84854	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.91237	-2.81;-2.81	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.96626	0.8899	H	0.95884	3.735	0.49389	D	0.999786	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97507	1.0064	10	0.87932	D	0	-21.2594	12.6867	0.56952	1.0:0.0:0.0:0.0	.	257;257	O95932-2;O95932	.;TGM3L_HUMAN	F	257	ENSP00000202625:I257F;ENSP00000370831:I257F	ENSP00000202625:I257F	I	+	1	0	TGM6	2328303	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.208000	0.77907	2.088000	0.63022	0.459000	0.35465	ATT	TGM6	-	NULL	ENSG00000166948		0.642	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	HGNC	protein_coding	OTTHUMT00000077581.2	77	0.00	0	A	NM_198994		2380303	2380303	+1	no_errors	ENST00000202625	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578534	7578534	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr17:7578534C>G	ENST00000269305.4	-	5	585	c.396G>C	c.(394-396)aaG>aaC	p.K132N	TP53_ENST00000413465.2_Missense_Mutation_p.K132N|TP53_ENST00000420246.2_Missense_Mutation_p.K132N|TP53_ENST00000445888.2_Missense_Mutation_p.K132N|TP53_ENST00000359597.4_Missense_Mutation_p.K132N|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.K132N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132N(49)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.K39N(2)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132K(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.M133fs*37(1)|p.M133fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAAAACATCTTGTTGAGGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	77	Substitution - Missense(51)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(1)|Substitution - coding silent(1)	urinary_tract(13)|breast(10)|ovary(10)|lung(9)|large_intestine(8)|haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(4)|bone(4)|adrenal_gland(3)|upper_aerodigestive_tract(2)|skin(2)|liver(2)|stomach(1)|penis(1)|oesophagus(1)|pancreas(1)											47.0	48.0	48.0					17																	7578534		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.396G>C	17.37:g.7578534C>G	ENSP00000269305:p.Lys132Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K132N	ENST00000269305.4	37	c.396	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123172	0.77436	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.48	3.5	0.40072	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.91768	3.24	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.998;0.993;0.996;0.999;0.998;1.0	D	0.97328	0.9948	10	0.87932	D	0	-14.0777	10.5581	0.45129	0.0:0.841:0.0:0.159	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132N;ENSP00000352610:K132N;ENSP00000269305:K132N;ENSP00000398846:K132N;ENSP00000391127:K132N;ENSP00000391478:K132N;ENSP00000423862:K39N;ENSP00000424104:K132N	ENSP00000269305:K132N	K	-	3	2	TP53	7519259	1.000000	0.71417	0.994000	0.49952	0.784000	0.44337	1.646000	0.37249	0.804000	0.34136	0.655000	0.94253	AAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	222	0.00	0	C	NM_000546		7578534	7578534	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	43	27.12	16	SNP	1.000	G
TRBV10-2	28584	genome.wustl.edu	37	7	142206735	142206735	+	RNA	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:142206735C>G	ENST00000426318.2	-	0	170									T cell receptor beta variable 10-2																		GGTGACACATCAAGGTCACCT	0.488																																						dbGAP											0													108.0	105.0	106.0					7																	142206735		1961	4169	6130	-	-	-			0			U17049		7q34	2012-02-07			ENSG00000229769	ENSG00000229769		"""T cell receptors / TRB locus"""	12178	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV102, TCRBV10S2, TCRBV12S3			OTTHUMG00000158535		7.37:g.142206735C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L40F	ENST00000426318.2	37	c.120		7																																																																																			TRBV10-2	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000229769		0.488	TRBV10-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV10-2	HGNC	TR_V_gene	OTTHUMT00000351241.1	157	0.00	0	C	NG_001333		142206735	142206735	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000426318	ensembl	human	known	69_37n	missense	87	38.30	54	SNP	0.003	G
TRIM58	25893	genome.wustl.edu	37	1	248039226	248039226	+	Missense_Mutation	SNP	C	C	T	rs565939415	byFrequency	TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr1:248039226C>T	ENST00000366481.3	+	6	944	c.896C>T	c.(895-897)aCg>aTg	p.T299M	OR2W3_ENST00000537741.1_5'UTR	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	299	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GATCCCGCCACGGCGCACCCG	0.537													C|||	2	0.000399361	0.0	0.0	5008	,	,		15673	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													59.0	58.0	58.0					1																	248039226		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.896C>T	1.37:g.248039226C>T	ENSP00000355437:p.Thr299Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B0H9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.T299M	ENST00000366481.3	37	c.896	CCDS1636.1	1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985526	0.53934	.	.	ENSG00000162722	ENST00000366481	T	0.55052	0.54	3.95	3.95	0.45737	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000016	T	0.77698	0.4169	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83554	0.0103	10	0.87932	D	0	.	14.3286	0.66537	0.0:1.0:0.0:0.0	.	299	Q8NG06	TRI58_HUMAN	M	299	ENSP00000355437:T299M	ENSP00000355437:T299M	T	+	2	0	TRIM58	246105849	1.000000	0.71417	0.245000	0.24217	0.140000	0.21249	5.349000	0.66010	2.512000	0.84698	0.650000	0.86243	ACG	TRIM58	-	superfamily_ConA-like_lec_gl,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000162722		0.537	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	121	0.00	0	C	NM_015431		248039226	248039226	+1	no_errors	ENST00000366481	ensembl	human	known	69_37n	missense	107	20.15	27	SNP	0.999	T
TRIM6	117854	genome.wustl.edu	37	11	5632304	5632304	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr11:5632304G>A	ENST00000278302.5	+	8	1339	c.1199G>A	c.(1198-1200)gGa>gAa	p.G400E	HBG2_ENST00000380259.2_Intron|TRIM6_ENST00000445329.1_Missense_Mutation_p.G225E|TRIM6_ENST00000506134.1_Missense_Mutation_p.G225E|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000380107.1_Missense_Mutation_p.G374E|TRIM6_ENST00000380097.3_Missense_Mutation_p.G428E|TRIM6_ENST00000515022.1_Missense_Mutation_p.G225E|TRIM6_ENST00000507320.1_Missense_Mutation_p.G225E|TRIM6_ENST00000481603.1_3'UTR|TRIM6-TRIM34_ENST00000354852.5_Intron	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	400	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCTCAGAGTGGATACTGGGTG	0.493																																						dbGAP											0													131.0	121.0	124.0					11																	5632304		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.1199G>A	11.37:g.5632304G>A	ENSP00000278302:p.Gly400Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.G428E	ENST00000278302.5	37	c.1283	CCDS31390.1	11	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978460	0.74360	.	.	ENSG00000121236	ENST00000278302;ENST00000507320;ENST00000380107;ENST00000380097;ENST00000445329;ENST00000396867;ENST00000515022;ENST00000506134	T;T;T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51;-0.51;-0.51	4.2	4.2	0.49525	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.87026	0.6075	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89905	0.4047	9	0.87932	D	0	.	14.8442	0.70249	0.0:0.0:1.0:0.0	.	374;428;400	E9PFM0;Q9C030-2;Q9C030	.;.;TRIM6_HUMAN	E	400;225;374;428;225;307;225;225	ENSP00000278302:G400E;ENSP00000427704:G225E;ENSP00000369450:G374E;ENSP00000369440:G428E;ENSP00000399215:G225E;ENSP00000421802:G225E;ENSP00000421079:G225E	ENSP00000278302:G400E	G	+	2	0	TRIM6	5588880	1.000000	0.71417	0.774000	0.31636	0.781000	0.44180	8.883000	0.92426	2.633000	0.89246	0.467000	0.42956	GGA	TRIM6	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000121236		0.493	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6	HGNC	protein_coding	OTTHUMT00000143376.2	224	0.00	0	G	NM_001003818		5632304	5632304	+1	no_errors	ENST00000380097	ensembl	human	known	69_37n	missense	126	21.25	34	SNP	0.997	A
TTN	7273	genome.wustl.edu	37	2	179479066	179479066	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr2:179479066C>A	ENST00000591111.1	-	212	44359	c.44135G>T	c.(44134-44136)gGa>gTa	p.G14712V	TTN_ENST00000359218.5_Missense_Mutation_p.G7413V|TTN_ENST00000460472.2_Missense_Mutation_p.G7288V|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G13785V|TTN_ENST00000342175.6_Missense_Mutation_p.G7480V|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G16353V|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14712					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTGGTGGTCCGGGTTTATC	0.378																																						dbGAP											0													78.0	72.0	74.0					2																	179479066		1928	4135	6063	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.44135G>T	2.37:g.179479066C>A	ENSP00000465570:p.Gly14712Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.G13785V	ENST00000591111.1	37	c.41354		2	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350370	0.41599	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.55	5.55	0.83447	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80560	0.4646	M	0.92555	3.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.84616	0.0681	9	0.87932	D	0	.	19.8764	0.96873	0.0:1.0:0.0:0.0	.	7288;7413;7480;14712	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	13785;7288;7480;7413;7288	ENSP00000343764:G13785V;ENSP00000434586:G7288V;ENSP00000340554:G7480V;ENSP00000352154:G7413V	ENSP00000340554:G7480V	G	-	2	0	TTN	179187311	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.729000	0.84864	2.768000	0.95171	0.655000	0.94253	GGA	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	91	0.00	0	C	NM_133378		179479066	179479066	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	75	19.35	18	SNP	1.000	A
TULP1	7287	genome.wustl.edu	37	6	35477415	35477415	+	Missense_Mutation	SNP	C	C	A	rs9688653	byFrequency	TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr6:35477415C>A	ENST00000229771.6	-	7	793	c.714G>T	c.(712-714)aaG>aaT	p.K238N	TULP1_ENST00000322263.4_Missense_Mutation_p.K185N	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	238					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						ATCCACCTTTCTTCTTCAGGG	0.582																																					GBM(55;1027 1091 11115 23439)	dbGAP											0													127.0	124.0	125.0					6																	35477415		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.714G>T	6.37:g.35477415C>A	ENSP00000229771:p.Lys238Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C	p.K238N	ENST00000229771.6	37	c.714	CCDS4807.1	6	.	.	.	.	.	.	.	.	.	.	C	18.76	3.693683	0.68386	.	.	ENSG00000112041	ENST00000229771;ENST00000322263;ENST00000545327	D;D	0.82893	-1.66;-1.61	4.4	2.61	0.31194	.	0.494058	0.21643	N	0.071319	T	0.79753	0.4500	L	0.59436	1.845	0.48185	D	0.999605	B;D	0.71674	0.041;0.998	B;P	0.61477	0.019;0.889	T	0.76342	-0.2994	10	0.33940	T	0.23	.	7.299	0.26409	0.0:0.7951:0.0:0.2049	.	185;238	O00294-2;O00294	.;TULP1_HUMAN	N	238;185;185	ENSP00000229771:K238N;ENSP00000319414:K185N	ENSP00000229771:K238N	K	-	3	2	TULP1	35585393	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	0.510000	0.22723	0.489000	0.27749	0.462000	0.41574	AAG	TULP1	-	NULL	ENSG00000112041		0.582	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP1	HGNC	protein_coding	OTTHUMT00000040307.2	375	0.00	0	C			35477415	35477415	-1	no_errors	ENST00000229771	ensembl	human	known	69_37n	missense	156	23.53	48	SNP	1.000	A
UBAP1L	390595	genome.wustl.edu	37	15	65386863	65386863	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr15:65386863C>G	ENST00000559089.1	-	5	1181	c.961G>C	c.(961-963)Gaa>Caa	p.E321Q	UBAP1L_ENST00000502113.2_Missense_Mutation_p.E321Q			F5GYI3	UBA1L_HUMAN	ubiquitin associated protein 1-like	321										breast(1)|endometrium(1)|kidney(1)	3						ACCAGGCCTTCCTCATATCCC	0.632																																						dbGAP											0													83.0	76.0	78.0					15																	65386863		691	1590	2281	-	-	-	SO:0001583	missense	0				CCDS53948.1	15q22.31	2011-08-15			ENSG00000246922	ENSG00000246922			40028	protein-coding gene	gene with protein product							Standard	NM_001163692		Approved		uc010uit.2	F5GYI3		ENST00000559089.1:c.961G>C	15.37:g.65386863C>G	ENSP00000454012:p.Glu321Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_UBA-like	p.E321Q	ENST00000559089.1	37	c.961	CCDS53948.1	15	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023086	0.54683	.	.	ENSG00000246922	ENST00000502113	.	.	.	4.49	3.53	0.40419	.	.	.	.	.	T	0.62502	0.2433	N	0.24115	0.695	0.38631	D	0.951381	D	0.89917	1.0	D	0.76575	0.988	T	0.67098	-0.5756	8	0.51188	T	0.08	.	14.3449	0.66654	0.0:0.8503:0.1497:0.0	.	321	F5GYI3	UBA1L_HUMAN	Q	321	.	ENSP00000440243:E321Q	E	-	1	0	AC013553.1	63173916	0.993000	0.37304	0.998000	0.56505	0.837000	0.47467	2.813000	0.48002	0.938000	0.37419	0.555000	0.69702	GAA	UBAP1L	-	NULL	ENSG00000246922		0.632	UBAP1L-002	NOVEL	basic|appris_principal|CCDS	protein_coding	UBAP1L	HGNC	protein_coding	OTTHUMT00000418469.1	254	0.00	0	C	NM_001163692		65386863	65386863	-1	no_errors	ENST00000502113	ensembl	human	known	69_37n	missense	127	13.01	19	SNP	1.000	G
UNC13B	10497	genome.wustl.edu	37	9	35399191	35399191	+	Silent	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr9:35399191G>A	ENST00000378495.3	+	33	4083	c.3861G>A	c.(3859-3861)acG>acA	p.T1287T	UNC13B_ENST00000378496.4_Silent_p.T1287T|UNC13B_ENST00000396787.1_Silent_p.T1299T	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1287	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GTGAGAAGACGGTTCTGAAGC	0.567																																						dbGAP											0													197.0	174.0	182.0					9																	35399191		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.3861G>A	9.37:g.35399191G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYM8	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T1299	ENST00000378495.3	37	c.3897	CCDS6579.1	9																																																																																			UNC13B	-	pfam_Munc13_subgr_dom-2	ENSG00000198722		0.567	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	485	0.00	0	G	NM_006377		35399191	35399191	+1	no_errors	ENST00000396787	ensembl	human	known	69_37n	silent	137	23.46	42	SNP	0.126	A
UNC5D	137970	genome.wustl.edu	37	8	35583857	35583857	+	Silent	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr8:35583857G>A	ENST00000404895.2	+	10	1819	c.1491G>A	c.(1489-1491)gaG>gaA	p.E497E	UNC5D_ENST00000449677.1_Silent_p.E73E|UNC5D_ENST00000416672.1_Silent_p.E502E|UNC5D_ENST00000453357.2_Silent_p.E492E|UNC5D_ENST00000287272.2_Silent_p.E428E|UNC5D_ENST00000420357.1_Silent_p.E430E	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	497					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAGTGTCTGAGAGAGCTGAGT	0.473																																						dbGAP											0													77.0	78.0	78.0					8																	35583857		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1491G>A	8.37:g.35583857G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYP7	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death,pfam_Immunoglobulin,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.E497	ENST00000404895.2	37	c.1491	CCDS6093.2	8																																																																																			UNC5D	-	NULL	ENSG00000156687		0.473	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	154	0.00	0	G			35583857	35583857	+1	no_errors	ENST00000404895	ensembl	human	known	69_37n	silent	122	16.44	24	SNP	0.572	A
VSIG10	54621	genome.wustl.edu	37	12	118511558	118511558	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr12:118511558G>A	ENST00000359236.5	-	5	1441	c.1165C>T	c.(1165-1167)Cga>Tga	p.R389*		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	389	Ig-like C2-type 4.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						CTGTCAGCTCGGCAGATGTAG	0.577																																						dbGAP											0													92.0	92.0	92.0					12																	118511558		2033	4196	6229	-	-	-	SO:0001587	stop_gained	0				CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1165C>T	12.37:g.118511558G>A	ENSP00000352172:p.Arg389*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NWQ7	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R389*	ENST00000359236.5	37	c.1165	CCDS44992.1	12	.	.	.	.	.	.	.	.	.	.	G	40	8.305184	0.98752	.	.	ENSG00000176834	ENST00000359236	.	.	.	5.65	2.58	0.30949	.	0.359414	0.20568	N	0.089791	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-26.0873	8.5138	0.33233	0.0:0.1115:0.3691:0.5193	.	.	.	.	X	389	.	ENSP00000352172:R389X	R	-	1	2	VSIG10	116995941	1.000000	0.71417	1.000000	0.80357	0.619000	0.37552	1.837000	0.39201	1.379000	0.46325	0.650000	0.86243	CGA	VSIG10	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000176834		0.577	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG10	HGNC	protein_coding	OTTHUMT00000401273.2	567	0.00	0	G	NM_019086		118511558	118511558	-1	no_errors	ENST00000359236	ensembl	human	known	69_37n	nonsense	159	19.70	39	SNP	1.000	A
WAS	7454	genome.wustl.edu	37	X	48546700	48546700	+	Silent	SNP	C	C	T	rs376093906		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chrX:48546700C>T	ENST00000376701.4	+	9	864	c.789C>T	c.(787-789)ctC>ctT	p.L263L		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	263					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				TGAACAACCTCGACCCAGATC	0.567			"""Mis, N, F, S"""			lymphoma																																dbGAP		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	0													29.0	26.0	27.0					X																	48546700		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.789C>T	X.37:g.48546700C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BU11|Q9UNJ9	Silent	SNP	pfam_EVH1,pfam_PAK_box_Rho-bd,pfam_WH2_dom,superfamily_WASP_C,smart_EVH1,smart_PAK_box_Rho-bd,smart_WH2_dom,pfscan_PAK_box_Rho-bd,pfscan_EVH1,pfscan_WH2_dom	p.L263	ENST00000376701.4	37	c.789	CCDS14303.1	X																																																																																			WAS	-	pfam_PAK_box_Rho-bd,superfamily_WASP_C,smart_PAK_box_Rho-bd	ENSG00000015285		0.567	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	WAS	HGNC	protein_coding	OTTHUMT00000083379.1	113	0.00	0	C	NM_000377		48546700	48546700	+1	no_errors	ENST00000376701	ensembl	human	known	69_37n	silent	45	25.00	15	SNP	0.832	T
WDR83OS	51398	genome.wustl.edu	37	19	12779204	12779204	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:12779204T>G	ENST00000596731.1	-	4	2242	c.290A>C	c.(289-291)cAg>cCg	p.Q97P	MAN2B1_ENST00000221363.4_5'Flank|CTD-2192J16.24_ENST00000597961.1_Intron|MAN2B1_ENST00000456935.2_5'Flank|WDR83_ENST00000418543.3_Intron|WDR83OS_ENST00000600694.1_5'Flank|WDR83_ENST00000242796.4_5'Flank|WDR83OS_ENST00000222190.5_Missense_Mutation_p.Q95P	NM_016145.3	NP_057229.1	Q9Y284	ASTER_HUMAN	WD repeat domain 83 opposite strand	97						integral component of membrane (GO:0016021)											CTGAGGATTCTGCAGATAGGA	0.572																																						dbGAP											0													81.0	64.0	70.0					19																	12779204		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151898	CCDS12274.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000105583	ENSG00000105583			30203	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 56"""	C19orf56		10810093	Standard	NM_016145		Approved	PTD008	uc002mud.2	Q9Y284		ENST00000596731.1:c.290A>C	19.37:g.12779204T>G	ENSP00000468969:p.Gln97Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4T8|Q9BVI3	Missense_Mutation	SNP	pfam_UPF0139	p.Q97P	ENST00000596731.1	37	c.290	CCDS12274.1	19	.	.	.	.	.	.	.	.	.	.	T	25.5	4.641808	0.87859	.	.	ENSG00000105583	ENST00000222190	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.78984	0.4370	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79249	-0.1881	9	0.38643	T	0.18	-13.0975	13.7827	0.63091	0.0:0.0:0.0:1.0	.	97	Q9Y284	CS056_HUMAN	P	97	.	ENSP00000222190:Q97P	Q	-	2	0	C19orf56	12640204	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.391000	0.66266	2.148000	0.66965	0.459000	0.35465	CAG	WDR83OS	-	pfam_UPF0139	ENSG00000105583		0.572	WDR83OS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR83OS	HGNC	protein_coding	OTTHUMT00000462702.1	207	0.00	0	T	NM_016145		12779204	12779204	-1	no_errors	ENST00000222190	ensembl	human	known	69_37n	missense	145	20.65	38	SNP	1.000	G
NELFA	7469	genome.wustl.edu	37	4	1986593	1986593	+	Silent	SNP	G	G	C	rs144419708		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr4:1986593G>C	ENST00000411638.2	-	8	993	c.978C>G	c.(976-978)ccC>ccG	p.P326P	NELFA_ENST00000542778.1_Silent_p.P191P|MIR943_ENST00000401286.1_RNA|NELFA_ENST00000382882.3_Silent_p.P337P	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	326					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										TGGGCGTGGAGGGAAGGTAGC	0.622																																						dbGAP											0													92.0	85.0	88.0					4																	1986593		2189	4297	6486	-	-	-	SO:0001819	synonymous_variant	0			AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.978C>G	4.37:g.1986593G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2T1|O95392	Missense_Mutation	SNP	NULL	p.P227R	ENST00000411638.2	37	c.680		4	.	.	.	.	.	.	.	.	.	.	G	9.843	1.191445	0.21954	.	.	ENSG00000185049	ENST00000453740	T	0.62788	0.0	4.96	-5.96	0.02234	.	0.000000	0.85682	D	0.000000	T	0.53610	0.1807	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54091	-0.8345	7	0.72032	D	0.01	-20.9127	1.1342	0.01752	0.3448:0.0924:0.1929:0.3699	.	.	.	.	R	227	ENSP00000405119:P227R	ENSP00000405119:P227R	P	-	2	0	WHSC2	1956391	0.000000	0.05858	0.372000	0.25991	0.991000	0.79684	-2.009000	0.01455	-1.285000	0.02387	0.655000	0.94253	CCT	WHSC2	-	NULL	ENSG00000185049		0.622	NELFA-015	NOVEL	basic|appris_principal	protein_coding	WHSC2	HGNC	protein_coding	OTTHUMT00000473007.1	391	0.00	0	G	NM_005663		1986593	1986593	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000453740	ensembl	human	novel	69_37n	missense	518	13.21	79	SNP	0.067	C
XRRA1	143570	genome.wustl.edu	37	11	74632307	74632307	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr11:74632307G>A	ENST00000340360.6	-	8	915	c.584C>T	c.(583-585)aCa>aTa	p.T195I	XRRA1_ENST00000321448.8_5'UTR|XRRA1_ENST00000527087.1_Missense_Mutation_p.T195I|XRRA1_ENST00000533598.1_5'UTR	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						GCCATTGCCTGTGAGGAGCAG	0.512																																						dbGAP											0													79.0	84.0	82.0					11																	74632307		2002	4173	6175	-	-	-	SO:0001583	missense	0			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.584C>T	11.37:g.74632307G>A	ENSP00000339918:p.Thr195Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T195I	ENST00000340360.6	37	c.584	CCDS44680.1	11	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146536	0.77888	.	.	ENSG00000166435	ENST00000340360;ENST00000344880;ENST00000398418;ENST00000527087;ENST00000525407	T;T;T	0.54071	1.82;0.59;0.64	5.02	5.02	0.67125	.	0.163809	0.45867	D	0.000333	T	0.63943	0.2554	L	0.39898	1.24	0.45046	D	0.998068	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	T	0.65590	-0.6131	10	0.62326	D	0.03	-10.877	14.2005	0.65699	0.0:0.0:1.0:0.0	.	195;195	Q6P2D8;Q6P2D8-2	XRRA1_HUMAN;.	I	195;195;195;195;203	ENSP00000339918:T195I;ENSP00000435838:T195I;ENSP00000437334:T203I	ENSP00000339918:T195I	T	-	2	0	XRRA1	74309955	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.116000	0.64661	2.494000	0.84150	0.655000	0.94253	ACA	XRRA1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000166435		0.512	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	213	0.47	1	G	NM_182969		74632307	74632307	-1	no_errors	ENST00000340360	ensembl	human	known	69_37n	missense	63	29.21	26	SNP	0.999	A
ZFHX4	79776	genome.wustl.edu	37	8	77766362	77766362	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr8:77766362C>T	ENST00000521891.2	+	10	7653	c.7205C>T	c.(7204-7206)aCt>aTt	p.T2402I	ZFHX4_ENST00000518282.1_Missense_Mutation_p.T2376I|ZFHX4_ENST00000455469.2_Missense_Mutation_p.T2357I|ZFHX4_ENST00000050961.6_Missense_Mutation_p.T2357I	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2357	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCTGAGAAGACTTCTCCAAAA	0.547										HNSCC(33;0.089)																												dbGAP											0													37.0	47.0	44.0					8																	77766362		1940	4139	6079	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7205C>T	8.37:g.77766362C>T	ENSP00000430497:p.Thr2402Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.T2402I	ENST00000521891.2	37	c.7205	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	9.606	1.130008	0.21041	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50277	0.75;0.8;0.77;0.77	5.23	4.33	0.51752	.	0.656368	0.13236	U	0.403253	T	0.31389	0.0795	N	0.21448	0.665	0.22435	N	0.999108	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.003	T	0.16276	-1.0408	10	0.22109	T	0.4	.	8.4705	0.32982	0.1598:0.7635:0.0:0.0767	.	2357;2357;2402	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	I	2402;2386;2357;2357;2376	ENSP00000430497:T2402I;ENSP00000399605:T2357I;ENSP00000050961:T2357I;ENSP00000430848:T2376I	ENSP00000050961:T2357I	T	+	2	0	ZFHX4	77928917	0.667000	0.27484	0.316000	0.25252	0.723000	0.41478	1.652000	0.37313	1.375000	0.46248	0.650000	0.86243	ACT	ZFHX4	-	NULL	ENSG00000091656		0.547	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	119	0.00	0	C	NM_024721		77766362	77766362	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	148	12.35	21	SNP	0.856	T
ZFX	7543	genome.wustl.edu	37	X	24228434	24228434	+	Silent	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chrX:24228434G>A	ENST00000379177.1	+	11	1786	c.1359G>A	c.(1357-1359)aaG>aaA	p.K453K	ZFX_ENST00000540034.1_Silent_p.K492K|ZFX_ENST00000338565.3_Silent_p.K403K|ZFX_ENST00000379188.3_Silent_p.K453K|ZFX_ENST00000304543.5_Silent_p.K453K|ZFX_ENST00000539115.1_Silent_p.K224K	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	453					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						ACCTTGCCAAGAAGAAATACC	0.438																																					Esophageal Squamous(20;306 562 7346 32868 37983)	dbGAP											0													154.0	129.0	137.0					X																	24228434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1359G>A	X.37:g.24228434G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG97|O43668|Q8WYJ8	Silent	SNP	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K492	ENST00000379177.1	37	c.1476	CCDS14211.1	X																																																																																			ZFX	-	pfscan_Znf_C2H2	ENSG00000005889		0.438	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	HGNC	protein_coding	OTTHUMT00000056084.1	334	0.00	0	G	NM_003410		24228434	24228434	+1	no_errors	ENST00000540034	ensembl	human	known	69_37n	silent	238	12.50	34	SNP	1.000	A
ZNF182	7569	genome.wustl.edu	37	X	47836619	47836619	+	Silent	SNP	G	G	A	rs567380126		TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chrX:47836619G>A	ENST00000396965.1	-	7	1217	c.867C>T	c.(865-867)ccC>ccT	p.P289P	ZNF182_ENST00000376943.3_Silent_p.P270P|ZNF182_ENST00000305127.6_Silent_p.P289P	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						GACACTCAAAGGGTCTCTCTC	0.398																																						dbGAP											0													83.0	73.0	76.0					X																	47836619		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.867C>T	X.37:g.47836619G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2IDD7|Q3KP67|Q96QH7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P289	ENST00000396965.1	37	c.867	CCDS35236.1	X																																																																																			ZNF182	-	pfscan_Znf_C2H2	ENSG00000147118		0.398	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	HGNC	protein_coding	OTTHUMT00000277055.1	160	0.00	0	G	NM_006962		47836619	47836619	-1	no_errors	ENST00000305127	ensembl	human	known	69_37n	silent	93	27.91	36	SNP	0.368	A
ZNF418	147686	genome.wustl.edu	37	19	58439287	58439287	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:58439287C>G	ENST00000396147.1	-	4	553	c.262G>C	c.(262-264)Ggc>Cgc	p.G88R	ZNF418_ENST00000599852.1_Missense_Mutation_p.G3R|ZNF418_ENST00000425570.3_Missense_Mutation_p.G109R|ZNF418_ENST00000595830.1_Missense_Mutation_p.G88R|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000599086.1_5'Flank	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	88	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		AAGATCGCGCCACACATTTCA	0.498																																						dbGAP											0													73.0	76.0	75.0					19																	58439287		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.262G>C	19.37:g.58439287C>G	ENSP00000379451:p.Gly88Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G109R	ENST00000396147.1	37	c.325	CCDS42642.1	19	.	.	.	.	.	.	.	.	.	.	.	12.79	2.043653	0.36085	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	T;T	0.66460	-0.21;-0.21	2.16	-3.25	0.05079	Zinc finger, C2H2-like (1);Krueppel-associated box (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.71753	0.3377	L	0.61218	1.895	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.60682	-0.7215	9	0.48119	T	0.1	.	3.1949	0.06630	0.1871:0.4255:0.0:0.3875	.	88	Q8TF45	ZN418_HUMAN	R	88;109;54	ENSP00000379451:G88R;ENSP00000407039:G109R	ENSP00000379451:G88R	G	-	1	0	ZNF418	63131099	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.410000	0.07151	-0.705000	0.05035	0.298000	0.19748	GGC	ZNF418	-	smart_Znf_C2H2-like,pfscan_Krueppel-associated_box	ENSG00000196724		0.498	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZNF418	HGNC	protein_coding	OTTHUMT00000466693.1	171	0.00	0	C	NM_133460		58439287	58439287	-1	no_errors	ENST00000425570	ensembl	human	known	69_37n	missense	188	12.56	27	SNP	0.001	G
ZNF467	168544	genome.wustl.edu	37	7	149463318	149463318	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr7:149463318C>G	ENST00000302017.3	-	5	686	c.273G>C	c.(271-273)tgG>tgC	p.W91C	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCCGAATCATCCACTCCTCTC	0.547																																						dbGAP											0													92.0	78.0	83.0					7																	149463318		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.273G>C	7.37:g.149463318C>G	ENSP00000304769:p.Trp91Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.W91C	ENST00000302017.3	37	c.273	CCDS5899.1	7	.	.	.	.	.	.	.	.	.	.	c	14.40	2.524641	0.44969	.	.	ENSG00000181444	ENST00000302017	T	0.06768	3.26	4.57	4.57	0.56435	.	0.000000	0.31246	U	0.007981	T	0.17662	0.0424	L	0.29908	0.895	0.51767	D	0.999937	D	0.76494	0.999	D	0.69142	0.962	T	0.01776	-1.1276	10	0.56958	D	0.05	-20.4578	15.1343	0.72552	0.0:1.0:0.0:0.0	.	91	Q7Z7K2	ZN467_HUMAN	C	91	ENSP00000304769:W91C	ENSP00000304769:W91C	W	-	3	0	ZNF467	149094251	0.995000	0.38212	1.000000	0.80357	0.938000	0.57974	2.093000	0.41710	2.074000	0.62210	0.552000	0.68991	TGG	ZNF467	-	NULL	ENSG00000181444		0.547	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	HGNC	protein_coding	OTTHUMT00000349833.1	123	0.81	1	C	NM_207336		149463318	149463318	-1	no_errors	ENST00000302017	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	1.000	G
ZNF614	80110	genome.wustl.edu	37	19	52521663	52521663	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:52521663G>A	ENST00000270649.6	-	3	644	c.100C>T	c.(100-102)Cgg>Tgg	p.R34W	ZNF614_ENST00000356322.6_Missense_Mutation_p.R34W	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	34	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ATCACATCCCGGTACAGGTTC	0.507																																						dbGAP											0													119.0	111.0	114.0					19																	52521663		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.100C>T	19.37:g.52521663G>A	ENSP00000270649:p.Arg34Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R34W	ENST00000270649.6	37	c.100	CCDS12847.1	19	.	.	.	.	.	.	.	.	.	.	G	8.632	0.893870	0.17613	.	.	ENSG00000142556	ENST00000356322;ENST00000270649	T;T	0.02631	4.22;4.22	3.23	-1.97	0.07503	Krueppel-associated box (4);	.	.	.	.	T	0.03477	0.0100	M	0.66506	2.035	0.09310	N	1	B;P	0.38048	0.141;0.616	B;B	0.36719	0.057;0.231	T	0.34079	-0.9843	9	0.56958	D	0.05	.	2.7494	0.05275	0.3699:0.0:0.3341:0.2959	.	34;34	Q8N883;Q9BSN8	ZN614_HUMAN;.	W	34	ENSP00000348674:R34W;ENSP00000270649:R34W	ENSP00000270649:R34W	R	-	1	2	ZNF614	57213475	0.001000	0.12720	0.023000	0.16930	0.525000	0.34531	-0.773000	0.04689	-0.060000	0.13132	0.591000	0.81541	CGG	ZNF614	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000142556		0.507	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF614	HGNC	protein_coding	OTTHUMT00000462407.1	199	0.00	0	G	NM_025040		52521663	52521663	-1	no_errors	ENST00000270649	ensembl	human	known	69_37n	missense	161	10.56	19	SNP	0.053	A
ZNF717	100131827	genome.wustl.edu	37	3	75788181	75788184	+	Frame_Shift_Del	DEL	TGAG	TGAG	-			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	TGAG	TGAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr3:75788181_75788184delTGAG	ENST00000478296.1	-	4	716_719	c.440_443delCTCA	c.(439-444)actcagfs	p.TQ147fs	ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000477374.1_Intron|MIR4273_ENST00000582824.1_RNA|ZNF717_ENST00000422325.1_Frame_Shift_Del_p.TQ197fs|ZNF717_ENST00000400845.3_Frame_Shift_Del_p.TQ190fs			Q9BY31	ZN717_HUMAN	zinc finger protein 717	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						CTTGTGATGCTGAGTAAGATGTTC	0.417																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.440_443delCTCA	3.37:g.75788181_75788184delTGAG	ENSP00000419377:p.Thr147fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T197fs	ENST00000478296.1	37	c.593_590		3																																																																																			ZNF717	-	NULL	ENSG00000227124		0.417	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	ZNF717	HGNC	protein_coding	OTTHUMT00000352764.2	191	0.00	0	TGAG	NM_001128223		75788181	75788184	-1	no_errors	ENST00000422325	ensembl	human	known	69_37n	frame_shift_del	112	14.50	19	DEL	0.000:0.000:0.000:0.000	-
ZNF729	100287226	genome.wustl.edu	37	19	22499779	22499779	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:22499779C>T	ENST00000601693.1	+	4	3678	c.3560C>T	c.(3559-3561)cCc>cTc	p.P1187L	ZNF729_ENST00000357491.6_Missense_Mutation_p.P1159L			A6NN14	ZN729_HUMAN	zinc finger protein 729	1187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						GGAGAGAAACCCTACAAATGT	0.368																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3560C>T	19.37:g.22499779C>T	ENSP00000469582:p.Pro1187Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P1159L	ENST00000601693.1	37	c.3476	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	7.927	0.739743	0.15642	.	.	ENSG00000196350	ENST00000357491	T	0.01159	5.25	1.25	-1.65	0.08291	.	.	.	.	.	T	0.03477	0.0100	M	0.82433	2.59	.	.	.	.	.	.	.	.	.	T	0.07790	-1.0754	6	0.87932	D	0	.	6.5615	0.22489	0.0:0.732:0.0:0.268	.	.	.	.	L	1159	ENSP00000350085:P1159L	ENSP00000350085:P1159L	P	+	2	0	ZNF729	22291619	0.000000	0.05858	0.005000	0.12908	0.022000	0.10575	-0.084000	0.11268	-0.452000	0.07087	-0.373000	0.07131	CCC	ZNF729	-	pfscan_Znf_C2H2	ENSG00000196350		0.368	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	42	0.00	0	C	XM_496301		22499779	22499779	+1	no_stop_codon	ENST00000357491	ensembl	human	known	69_37n	missense	77	18.09	17	SNP	0.048	T
ZNF841	284371	genome.wustl.edu	37	19	52569672	52569672	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:52569672T>C	ENST00000426391.2	-	5	1666	c.1115A>G	c.(1114-1116)aAt>aGt	p.N372S	CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000594295.1_Missense_Mutation_p.N488S|ZNF841_ENST00000359973.2_Intron|ZNF841_ENST00000389534.4_Missense_Mutation_p.N488S|ZNF432_ENST00000598446.1_Intron			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	372					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						GCCACATTCATTACATTTGTA	0.423																																						dbGAP											0													42.0	38.0	39.0					19																	52569672		692	1591	2283	-	-	-	SO:0001583	missense	0			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.1115A>G	19.37:g.52569672T>C	ENSP00000415453:p.Asn372Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N488S	ENST00000426391.2	37	c.1463		19	.	.	.	.	.	.	.	.	.	.	T	7.176	0.588640	0.13812	.	.	ENSG00000197608	ENST00000389534;ENST00000426391	T;T	0.07216	3.21;3.21	2.41	-1.88	0.07713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03220	0.0094	N	0.04162	-0.26	0.09310	N	1	B;B	0.16396	0.002;0.017	B;B	0.20184	0.004;0.028	T	0.46303	-0.9201	9	0.22109	T	0.4	.	5.1952	0.15233	0.3057:0.0:0.4634:0.2309	.	488;372	Q6ZN19-3;Q6ZN19	.;ZN841_HUMAN	S	488;372	ENSP00000374185:N488S;ENSP00000415453:N372S	ENSP00000374185:N488S	N	-	2	0	ZNF841	57261484	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	-2.844000	0.00736	-0.765000	0.04645	0.260000	0.18958	AAT	ZNF841	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197608		0.423	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	HGNC	protein_coding	OTTHUMT00000462435.1	122	0.00	0	T	XM_209155		52569672	52569672	-1	no_errors	ENST00000389534	ensembl	human	known	69_37n	missense	212	10.17	24	SNP	0.000	C
ZNF835	90485	genome.wustl.edu	37	19	57175732	57175732	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BP-01A-11D-A10Y-09	TCGA-BH-A0BP-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	51405cf1-e844-4316-be17-85e8ad1de4a3	f1b6fe69-8f67-4fc8-8650-664ab02d7cfb	g.chr19:57175732G>C	ENST00000537055.2	-	2	1066	c.835C>G	c.(835-837)Cgc>Ggc	p.R279G		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						TGGCCGCAGCGGTAGGGCTTC	0.692																																						dbGAP											0													17.0	20.0	19.0					19																	57175732		2201	4293	6494	-	-	-	SO:0001583	missense	0			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.835C>G	19.37:g.57175732G>C	ENSP00000444747:p.Arg279Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R279G	ENST00000537055.2	37	c.835	CCDS56105.1	19	.	.	.	.	.	.	.	.	.	.	G	9.981	1.228112	0.22542	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.37235	1.21	2.12	-4.23	0.03789	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20981	0.0505	L	0.37561	1.115	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.29458	-1.0011	9	0.66056	D	0.02	.	0.2395	0.00190	0.2572:0.266:0.2334:0.2434	.	301	Q9Y2P0	ZN835_HUMAN	G	301;279	ENSP00000444747:R279G	ENSP00000341756:R301G	R	-	1	0	ZNF835	61867544	0.000000	0.05858	0.000000	0.03702	0.481000	0.33189	-6.379000	0.00068	-1.360000	0.02172	-0.258000	0.10820	CGC	ZNF835	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000127903		0.692	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	140	0.00	0	G	NM_001005850		57175732	57175732	-1	no_errors	ENST00000537055	ensembl	human	known	69_37n	missense	94	11.32	12	SNP	0.001	C
