#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC3	8714	genome.wustl.edu	37	17	48746861	48746861	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:48746861G>T	ENST00000285238.8	+	17	2293	c.2213G>T	c.(2212-2214)gGt>gTt	p.G738V		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	738	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	ATGCTGCCTGGTGGGGATCAG	0.567																																						dbGAP											0													93.0	88.0	90.0					17																	48746861		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.2213G>T	17.37:g.48746861G>T	ENSP00000285238:p.Gly738Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.G738V	ENST00000285238.8	37	c.2213	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960514	0.53400	.	.	ENSG00000108846	ENST00000285238	D	0.90788	-2.73	4.12	2.08	0.27032	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.068044	0.64402	D	0.000019	D	0.90669	0.7073	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89314	0.3635	10	0.87932	D	0	-2.07	9.4901	0.38953	0.08:0.1434:0.7766:0.0	.	738	O15438	MRP3_HUMAN	V	738	ENSP00000285238:G738V	ENSP00000285238:G738V	G	+	2	0	ABCC3	46101860	0.998000	0.40836	0.978000	0.43139	0.753000	0.42808	2.686000	0.46968	0.502000	0.28037	0.313000	0.20887	GGT	ABCC3	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc	ENSG00000108846		0.567	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	132	0.00	0	G	NM_020038		48746861	48746861	+1	no_errors	ENST00000285238	ensembl	human	known	69_37n	missense	102	18.11	23	SNP	0.993	T
AHDC1	27245	genome.wustl.edu	37	1	27874450	27874451	+	Frame_Shift_Ins	INS	-	-	G	rs371911768		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:27874450_27874451insG	ENST00000247087.5	-	5	4772_4773	c.4176_4177insC	c.(4174-4179)gccggcfs	p.G1393fs	AHDC1_ENST00000374011.2_Frame_Shift_Ins_p.G1393fs			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1393							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		TTCTGCAGGCCGGCGTCAAACA	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.4177dupC	1.37:g.27874452_27874452dupG	ENSP00000247087:p.Gly1393fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Frame_Shift_Ins	INS	NULL	p.G1392fs	ENST00000247087.5	37	c.4177_4176	CCDS30652.1	1																																																																																			AHDC1	-	NULL	ENSG00000126705		0.653	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3	59	0.00	0	-			27874450	27874451	-1	no_errors	ENST00000247087	ensembl	human	known	69_37n	frame_shift_ins	19	24.00	6	INS	1.000:0.017	G
ALDH1L2	160428	genome.wustl.edu	37	12	105456710	105456710	+	Missense_Mutation	SNP	C	C	A	rs150374711		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:105456710C>A	ENST00000258494.9	-	7	1017	c.877G>T	c.(877-879)Gtt>Ttt	p.V293F	ALDH1L2_ENST00000424857.2_Missense_Mutation_p.V293F	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	293					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						TTTTTGGTAACGAGACCAGGC	0.403																																						dbGAP											0													75.0	70.0	72.0					12																	105456710		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.877G>T	12.37:g.105456710C>A	ENSP00000258494:p.Val293Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.V293F	ENST00000258494.9	37	c.877	CCDS31891.1	12	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648134	0.67358	.	.	ENSG00000136010	ENST00000258494;ENST00000424857	T;T	0.53857	0.6;0.6	5.49	3.67	0.42095	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.165132	0.53938	D	0.000044	T	0.72518	0.3470	M	0.85859	2.78	0.80722	D	1	D	0.63046	0.992	D	0.69142	0.962	T	0.75855	-0.3170	10	0.87932	D	0	.	12.033	0.53408	0.0:0.8596:0.0:0.1404	.	293	Q3SY69	AL1L2_HUMAN	F	293	ENSP00000258494:V293F;ENSP00000389608:V293F	ENSP00000258494:V293F	V	-	1	0	ALDH1L2	103980840	0.927000	0.31430	0.998000	0.56505	0.970000	0.65996	1.749000	0.38319	0.687000	0.31509	-0.252000	0.11476	GTT	ALDH1L2	-	pfam_Formyl_trans_C,superfamily_Formyl_transferase_C-like,pirsf_10_FTHF_DH	ENSG00000136010		0.403	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	232	0.43	1	C	XM_090294		105456710	105456710	-1	no_errors	ENST00000258494	ensembl	human	known	69_37n	missense	187	11.32	24	SNP	0.989	A
ALDOA	226	genome.wustl.edu	37	16	30079970	30079970	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:30079970G>C	ENST00000566897.1	+	7	1480	c.328G>C	c.(328-330)Gac>Cac	p.D110H	ALDOA_ENST00000395240.3_Missense_Mutation_p.D110H|ALDOA_ENST00000412304.2_Missense_Mutation_p.D110H|ALDOA_ENST00000564546.1_Missense_Mutation_p.D110H|ALDOA_ENST00000564595.2_Missense_Mutation_p.D164H|ALDOA_ENST00000569798.1_Missense_Mutation_p.D110H|ALDOA_ENST00000338110.5_Missense_Mutation_p.D110H|ALDOA_ENST00000569545.1_Missense_Mutation_p.D110H|ALDOA_ENST00000395248.1_Missense_Mutation_p.D164H|ALDOA_ENST00000563060.2_Missense_Mutation_p.D110H			P04075	ALDOA_HUMAN	aldolase A, fructose-bisphosphate	110					actin filament organization (GO:0007015)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homotetramerization (GO:0051289)|regulation of cell shape (GO:0008360)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|membrane (GO:0016020)|nucleus (GO:0005634)|platelet alpha granule lumen (GO:0031093)	actin binding (GO:0003779)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|tubulin binding (GO:0015631)			breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	17						CCAACAGGTAGACAAGGGCGT	0.547																																						dbGAP											0													132.0	115.0	121.0					16																	30079970		2197	4300	6497	-	-	-	SO:0001583	missense	0			X05236	CCDS10668.1, CCDS58450.1	16p11.2	2008-03-06			ENSG00000149925	ENSG00000149925	4.1.2.13		414	protein-coding gene	gene with protein product		103850				3570299	Standard	NM_000034		Approved		uc010veg.2	P04075	OTTHUMG00000132107	ENST00000566897.1:c.328G>C	16.37:g.30079970G>C	ENSP00000455724:p.Asp110His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXI7|Q6FH76|Q6FI10|Q96B15|Q9BWD9|Q9UCN2	Missense_Mutation	SNP	pfam_Aldolase_I	p.D110H	ENST00000566897.1	37	c.328	CCDS10668.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.184196	0.94885	.	.	ENSG00000149925	ENST00000395248;ENST00000338110;ENST00000412304;ENST00000395240	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.79	5.79	0.91817	Aldolase-type TIM barrel (1);	0.088422	0.85682	D	0.000000	D	0.96947	0.9003	M	0.93550	3.43	0.80722	D	1	P	0.44478	0.836	P	0.58780	0.845	D	0.97383	0.9984	10	0.87932	D	0	.	18.7978	0.92003	0.0:0.0:1.0:0.0	.	110	P04075	ALDOA_HUMAN	H	164;110;110;110	ENSP00000378669:D164H;ENSP00000336927:D110H;ENSP00000400452:D110H;ENSP00000378661:D110H	ENSP00000336927:D110H	D	+	1	0	ALDOA	29987471	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.531000	0.98054	2.735000	0.93741	0.655000	0.94253	GAC	ALDOA	-	pfam_Aldolase_I	ENSG00000149925		0.547	ALDOA-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ALDOA	HGNC	protein_coding	OTTHUMT00000435360.1	348	0.00	0	G	NM_000034		30079970	30079970	+1	no_errors	ENST00000338110	ensembl	human	known	69_37n	missense	303	13.43	47	SNP	1.000	C
ALYREF	10189	genome.wustl.edu	37	17	79847099	79847100	+	In_Frame_Ins	INS	-	-	CAT			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:79847099_79847100insCAT	ENST00000331204.4	-	3	501_502	c.475_476insATG	c.(475-477)gcc>gATGcc	p.158_159insD	ALYREF_ENST00000505490.2_In_Frame_Ins_p.165_166insD|ANAPC11_ENST00000571874.2_5'Flank|ANAPC11_ENST00000583839.1_5'Flank|ANAPC11_ENST00000574924.2_5'Flank|ANAPC11_ENST00000572851.2_5'Flank|ANAPC11_ENST00000577747.1_5'Flank|ANAPC11_ENST00000579133.1_5'Flank|ANAPC11_ENST00000572639.1_5'Flank|ANAPC11_ENST00000571024.2_5'Flank|ANAPC11_ENST00000357385.3_5'Flank|ANAPC11_ENST00000578550.1_5'Flank|ALYREF_ENST00000512673.1_De_novo_Start_OutOfFrame|ANAPC11_ENST00000344877.5_5'Flank|ANAPC11_ENST00000571570.1_5'Flank|ANAPC11_ENST00000577425.1_5'Flank|ANAPC11_ENST00000584314.1_5'Flank|ANAPC11_ENST00000392376.3_5'Flank|ANAPC11_ENST00000579978.1_5'Flank|ANAPC11_ENST00000582222.1_5'Flank	NM_005782.3	NP_005773.3	Q86V81	THOC4_HUMAN	Aly/REF export factor	158	Ala/Arg/Gly-rich.|Interaction with HHV-8 ORF57 protein and with ICP27 from HHV-1. {ECO:0000250}.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|replication fork processing (GO:0031297)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral mRNA export from host cell nucleus (GO:0046784)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|transcription export complex (GO:0000346)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)										GGCCTTCAGGGCATCTGCCTTC	0.584																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AF047002	CCDS32768.1, CCDS32768.2	17q25.3	2013-02-12	2011-12-12	2011-12-12	ENSG00000183684	ENSG00000183684		"""THO complex subunits"", ""RNA binding motif (RRM) containing"""	19071	protein-coding gene	gene with protein product		604171	"""THO complex 4"""	THOC4		11032328	Standard	NM_005782		Approved	ALY, BEF, ALY/REF, REF	uc002kbu.2	Q86V81	OTTHUMG00000160470	ENST00000331204.4:c.473_475dupATG	17.37:g.79847100_79847102dupCAT	ENSP00000331817:p.Asp158_Asp158dup	Somatic		WXS	Illumina GAIIx	Phase_IV	O43672	In_Frame_Ins	INS	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.166in_frame_insD	ENST00000331204.4	37	c.497_496		17																																																																																			ALYREF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000183684		0.584	ALYREF-201	KNOWN	basic|appris_principal	protein_coding	ALYREF	HGNC	protein_coding		256	0.39	1	-	NM_005782		79847099	79847100	-1	no_errors	ENST00000505490	ensembl	human	known	69_37n	in_frame_ins	141	54.07	166	INS	1.000:1.000	CAT
ANKMY1	51281	genome.wustl.edu	37	2	241463462	241463462	+	Nonsense_Mutation	SNP	C	C	A	rs372329121		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:241463462C>A	ENST00000272972.3	-	7	1619	c.1405G>T	c.(1405-1407)Gag>Tag	p.E469*	ANKMY1_ENST00000405002.1_Nonsense_Mutation_p.E239*|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000403283.1_Nonsense_Mutation_p.E407*|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000405523.3_Nonsense_Mutation_p.E328*|ANKMY1_ENST00000401804.1_Nonsense_Mutation_p.E558*|ANKMY1_ENST00000391987.1_Nonsense_Mutation_p.E469*|ANKMY1_ENST00000373320.4_Nonsense_Mutation_p.E239*|ANKMY1_ENST00000536462.1_Nonsense_Mutation_p.E281*|ANKMY1_ENST00000361678.4_Nonsense_Mutation_p.E328*|ANKMY1_ENST00000373318.2_Nonsense_Mutation_p.E328*	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	469							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		ACGTTGGACTCAAATTTCGTC	0.597																																						dbGAP											0													141.0	123.0	129.0					2																	241463462		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1405G>T	2.37:g.241463462C>A	ENSP00000272972:p.Glu469*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_MORN,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_MORN,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.E469*	ENST00000272972.3	37	c.1405	CCDS2536.1	2	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660361	0.67586	.	.	ENSG00000144504	ENST00000373318;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	.	.	.	4.06	4.06	0.47325	.	0.951572	0.08664	N	0.912008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-29.5423	12.4117	0.55471	0.0:1.0:0.0:0.0	.	.	.	.	X	328;469;328;469;239;407;558;281;328;239	.	ENSP00000272972:E469X	E	-	1	0	ANKMY1	241112135	0.659000	0.27411	0.738000	0.30950	0.017000	0.09413	1.267000	0.33050	2.197000	0.70478	0.491000	0.48974	GAG	ANKMY1	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000144504		0.597	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKMY1	HGNC	protein_coding	OTTHUMT00000257187.2	143	0.00	0	C	NM_017844		241463462	241463462	-1	no_errors	ENST00000272972	ensembl	human	known	69_37n	nonsense	72	21.74	20	SNP	0.906	A
ANKRD13B	124930	genome.wustl.edu	37	17	27934851	27934851	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:27934851C>T	ENST00000394859.3	+	2	360	c.206C>T	c.(205-207)gCg>gTg	p.A69V	RP11-68I3.2_ENST00000581474.1_RNA	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	69						endosome (GO:0005768)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						GTGCTCCTGGCGCACGGCGCA	0.706																																						dbGAP											0													23.0	27.0	26.0					17																	27934851		2197	4289	6486	-	-	-	SO:0001583	missense	0			AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.206C>T	17.37:g.27934851C>T	ENSP00000378328:p.Ala69Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7S9	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.A69V	ENST00000394859.3	37	c.206	CCDS11251.1	17	.	.	.	.	.	.	.	.	.	.	c	16.59	3.164381	0.57476	.	.	ENSG00000198720	ENST00000394859	T	0.65732	-0.17	5.8	2.61	0.31194	Ankyrin repeat-containing domain (4);	0.243146	0.45126	N	0.000391	T	0.51550	0.1681	M	0.69463	2.115	0.30585	N	0.762156	P	0.48016	0.904	B	0.41666	0.363	T	0.54289	-0.8316	10	0.31617	T	0.26	-9.0064	2.0771	0.03627	0.2749:0.4542:0.1157:0.1552	.	69	Q86YJ7	AN13B_HUMAN	V	69	ENSP00000378328:A69V	ENSP00000378328:A69V	A	+	2	0	ANKRD13B	24958977	0.934000	0.31675	0.756000	0.31282	0.716000	0.41182	2.077000	0.41557	0.819000	0.34492	-0.215000	0.12644	GCG	ANKRD13B	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000198720		0.706	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13B	HGNC	protein_coding	OTTHUMT00000256077.1	24	0.00	0	C	NM_152345		27934851	27934851	+1	no_errors	ENST00000394859	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.915	T
ANXA5	308	genome.wustl.edu	37	4	122590856	122590856	+	Silent	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr4:122590856G>C	ENST00000296511.5	-	12	1089	c.804C>G	c.(802-804)acC>acG	p.T268T	ANXA5_ENST00000515017.1_Silent_p.T168T|ANXA5_ENST00000501272.2_Silent_p.T208T	NM_001154.3	NP_001145.1	P08758	ANXA5_HUMAN	annexin A5	268					blood coagulation (GO:0007596)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of coagulation (GO:0050819)|response to organic substance (GO:0010033)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipase inhibitor activity (GO:0004859)|phospholipid binding (GO:0005543)			NS(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)	15						CTCTGATGAGGGTATGATCAT	0.398																																					Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)	dbGAP											0													95.0	94.0	94.0					4																	122590856		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U05770	CCDS3720.1	4q27	2008-02-05			ENSG00000164111	ENSG00000164111		"""Annexins"""	543	protein-coding gene	gene with protein product		131230		ENX2, ANX5		2960376	Standard	NM_001154		Approved		uc003idv.4	P08758	OTTHUMG00000133034	ENST00000296511.5:c.804C>G	4.37:g.122590856G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNW7|Q6FHB3|Q6FI16|Q8WV69|Q9UDH9	Silent	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinV,prints_AnnexinIV	p.T268	ENST00000296511.5	37	c.804	CCDS3720.1	4																																																																																			ANXA5	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin	ENSG00000164111		0.398	ANXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA5	HGNC	protein_coding	OTTHUMT00000256636.2	137	0.00	0	G	NM_001154		122590856	122590856	-1	no_errors	ENST00000296511	ensembl	human	known	69_37n	silent	146	14.12	24	SNP	1.000	C
APBA2	321	genome.wustl.edu	37	15	29397678	29397678	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr15:29397678A>G	ENST00000558402.1	+	12	2220	c.1621A>G	c.(1621-1623)Aag>Gag	p.K541E	APBA2_ENST00000558259.1_Missense_Mutation_p.K541E|APBA2_ENST00000558330.1_Missense_Mutation_p.K529E|APBA2_ENST00000561069.1_Missense_Mutation_p.K541E|APBA2_ENST00000411764.1_Missense_Mutation_p.K529E			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	541	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CTTGAGCCAGAAGGAATACAG	0.562																																						dbGAP											0													167.0	118.0	134.0					15																	29397678		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.1621A>G	15.37:g.29397678A>G	ENSP00000453293:p.Lys541Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.K541E	ENST00000558402.1	37	c.1621	CCDS10022.1	15	.	.	.	.	.	.	.	.	.	.	A	12.75	2.032122	0.35893	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.05649	3.41	4.07	2.89	0.33648	Phosphotyrosine interaction domain (1);PDZ/DHR/GLGF (1);	0.056427	0.64402	N	0.000002	T	0.10680	0.0261	L	0.27053	0.805	0.58432	D	0.999993	B;D;P	0.71674	0.092;0.998;0.76	B;D;B	0.77557	0.014;0.99;0.343	T	0.32981	-0.9886	10	0.15952	T	0.53	.	9.174	0.37100	0.837:0.0:0.0:0.163	.	529;529;541	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	E	529;541	ENSP00000409312:K529E	ENSP00000219865:K541E	K	+	1	0	APBA2	27184970	1.000000	0.71417	0.998000	0.56505	0.300000	0.27592	5.812000	0.69194	0.660000	0.30964	0.260000	0.18958	AAG	APBA2	-	superfamily_PDZ,pfscan_PTyr_interaction_dom	ENSG00000034053		0.562	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	318	0.00	0	A	NM_005503		29397678	29397678	+1	no_errors	ENST00000558259	ensembl	human	known	69_37n	missense	137	29.74	58	SNP	1.000	G
APOB	338	genome.wustl.edu	37	2	21230517	21230517	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:21230517C>T	ENST00000233242.1	-	26	9350	c.9223G>A	c.(9223-9225)Gca>Aca	p.A3075T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3075					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAAACAGTGCATAGTTATTC	0.418																																						dbGAP											0													91.0	91.0	91.0					2																	21230517		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9223G>A	2.37:g.21230517C>T	ENSP00000233242:p.Ala3075Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.A3075T	ENST00000233242.1	37	c.9223	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058349	0.36277	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.34472	1.36	5.87	4.09	0.47781	.	0.466841	0.21324	N	0.076410	T	0.31796	0.0808	L	0.57536	1.79	0.20975	N	0.999818	B	0.29627	0.252	B	0.26770	0.073	T	0.15350	-1.0440	10	0.26408	T	0.33	.	9.9141	0.41423	0.0:0.7932:0.0:0.2068	.	3075	P04114	APOB_HUMAN	T	3075	ENSP00000233242:A3075T	ENSP00000233242:A3075T	A	-	1	0	APOB	21084022	0.851000	0.29673	0.990000	0.47175	0.937000	0.57800	2.131000	0.42074	0.833000	0.34828	0.655000	0.94253	GCA	APOB	-	NULL	ENSG00000084674		0.418	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	186	0.00	0	C			21230517	21230517	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	137	18.45	31	SNP	0.083	T
APOB	338	genome.wustl.edu	37	2	21239435	21239435	+	Missense_Mutation	SNP	C	C	G	rs368268089		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:21239435C>G	ENST00000233242.1	-	21	3335	c.3208G>C	c.(3208-3210)Gat>Cat	p.D1070H		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1070					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGTCAACATCAAAATCCGGA	0.433																																						dbGAP											0													142.0	126.0	132.0					2																	21239435		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3208G>C	2.37:g.21239435C>G	ENSP00000233242:p.Asp1070His	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.D1070H	ENST00000233242.1	37	c.3208	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104713	0.37145	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01203	5.18	5.03	2.2	0.27929	Lipid transport, open beta-sheet (1);	0.414529	0.22628	N	0.057620	T	0.05090	0.0136	M	0.76002	2.32	0.80722	D	1	D	0.76494	0.999	D	0.66847	0.947	T	0.11567	-1.0582	10	0.72032	D	0.01	.	10.35	0.43929	0.0:0.783:0.0:0.217	.	1070	P04114	APOB_HUMAN	H	1070	ENSP00000233242:D1070H	ENSP00000233242:D1070H	D	-	1	0	APOB	21092940	1.000000	0.71417	0.009000	0.14445	0.479000	0.33129	2.452000	0.44961	0.243000	0.21327	0.561000	0.74099	GAT	APOB	-	pfam_Lipid_transpt_open_b-sht	ENSG00000084674		0.433	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	339	0.00	0	C			21239435	21239435	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	249	19.61	61	SNP	0.977	G
APP	351	genome.wustl.edu	37	21	27347382	27347382	+	Splice_Site	DEL	C	C	-			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr21:27347382delC	ENST00000346798.3	-	11	1492		c.e11+1		APP_ENST00000348990.5_Splice_Site|APP_ENST00000358918.3_Splice_Site|APP_ENST00000354192.3_Splice_Site|APP_ENST00000359726.3_Splice_Site|APP_ENST00000357903.3_Splice_Site|APP_ENST00000448388.2_Splice_Site|APP_ENST00000440126.3_Splice_Site|APP_ENST00000439274.2_Splice_Site	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein						adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				GCGAGACCTACCCGAGGAGGA	0.572																																						dbGAP											0													64.0	50.0	55.0					21																	27347382		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1458+1G>-	21.37:g.27347382delC		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Splice_Site	DEL	-	e11+1	ENST00000346798.3	37	c.1458+1	CCDS13576.1	21																																																																																			APP	-	-	ENSG00000142192		0.572	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APP	HGNC	protein_coding	OTTHUMT00000171340.1	210	0.00	0	C	NM_000484	Intron	27347382	27347382	-1	no_errors	ENST00000346798	ensembl	human	known	69_37n	splice_site_del	120	20.13	31	DEL	1.000	-
ARRB1	408	genome.wustl.edu	37	11	74995294	74995294	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:74995294G>A	ENST00000420843.2	-	4	239	c.142C>T	c.(142-144)Ctc>Ttc	p.L48F	ARRB1_ENST00000393505.4_Missense_Mutation_p.L48F|ARRB1_ENST00000360025.3_Missense_Mutation_p.L48F	NM_004041.4	NP_004032.2	P49407	ARRB1_HUMAN	arrestin, beta 1	48	Interaction with CHRM2. {ECO:0000250}.|Interaction with SRC. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|Notch signaling pathway (GO:0007219)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of GTPase activity (GO:0043547)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-Golgi vesicle-mediated transport (GO:0006892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)|transcription from RNA polymerase II promoter (GO:0006366)	basolateral plasma membrane (GO:0016323)|chromatin (GO:0000785)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|pseudopodium (GO:0031143)	angiotensin receptor binding (GO:0031701)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme inhibitor activity (GO:0004857)|GTPase activator activity (GO:0005096)|insulin-like growth factor receptor binding (GO:0005159)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|large_intestine(2)|lung(4)|prostate(1)	11						CGCTCTTTGAGATACTCAGGA	0.612																																						dbGAP											0													63.0	58.0	60.0					11																	74995294		2200	4293	6493	-	-	-	SO:0001583	missense	0			BC003636	CCDS31640.1, CCDS44684.1	11q13	2008-12-11			ENSG00000137486	ENSG00000137486			711	protein-coding gene	gene with protein product	"""arrestin 2"""	107940		ARR1		8486659	Standard	NM_004041		Approved		uc001owe.2	P49407	OTTHUMG00000165444	ENST00000420843.2:c.142C>T	11.37:g.74995294G>A	ENSP00000409581:p.Leu48Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B6V9G8|O75625|O75630|Q2PP20|Q9BTK8	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.L48F	ENST00000420843.2	37	c.142	CCDS44684.1	11	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833832	0.50951	.	.	ENSG00000137486	ENST00000420843;ENST00000393505;ENST00000360025;ENST00000532525	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.2	4.28	0.50868	Arrestin, N-terminal (1);Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.000000	0.64402	D	0.000004	T	0.48241	0.1489	M	0.83483	2.645	0.51482	D	0.999923	P;P	0.49635	0.926;0.886	P;P	0.59012	0.601;0.85	T	0.51260	-0.8728	10	0.52906	T	0.07	-22.8346	11.6361	0.51204	0.0874:0.0:0.9126:0.0	.	48;48	P49407-2;P49407	.;ARRB1_HUMAN	F	48;48;48;43	ENSP00000409581:L48F;ENSP00000377141:L48F;ENSP00000353124:L48F;ENSP00000433171:L43F	ENSP00000353124:L48F	L	-	1	0	ARRB1	74672942	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.678000	0.61641	1.174000	0.42811	0.462000	0.41574	CTC	ARRB1	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000137486		0.612	ARRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARRB1	HGNC	protein_coding	OTTHUMT00000384092.3	69	0.00	0	G	NM_004041		74995294	74995294	-1	no_errors	ENST00000393505	ensembl	human	known	69_37n	missense	119	15.00	21	SNP	1.000	A
ATP5B	506	genome.wustl.edu	37	12	57036286	57036286	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:57036286C>G	ENST00000262030.3	-	7	1080	c.1030G>C	c.(1030-1032)Gaa>Caa	p.E344Q	ATP5B_ENST00000550162.1_5'UTR|ATP5B_ENST00000552919.1_Missense_Mutation_p.E333Q|SNORD59A_ENST00000384304.1_RNA	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	344					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTAATTCTTTCCTGCATAGTA	0.438																																						dbGAP											0													90.0	92.0	91.0					12																	57036286		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1030G>C	12.37:g.57036286C>G	ENSP00000262030:p.Glu344Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X0|Q14283	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/A1-cplx_a/bsu_N,smart_AAA+_ATPase,tigrfam_ATPase_F1-cplx_bsu	p.E344Q	ENST00000262030.3	37	c.1030	CCDS8924.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.7|21.7	4.191207|4.191207	0.78902|0.78902	.|.	.|.	ENSG00000110955|ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020;ENST00000551570;ENST00000553007|ENST00000552959	D;D;D;D;D|.	0.86297|.	-2.1;-2.1;-2.09;-2.1;-2.1|.	6.17|6.17	6.17|6.17	0.99709|0.99709	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.92792|0.92792	0.7708|0.7708	H|H	0.99884|0.99884	4.89|4.89	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	D|.	0.74023|.	0.982|.	D|D	0.95546|0.95546	0.8616|0.8616	10|5	0.72032|.	D|.	0.01|.	-20.7081|-20.7081	19.6509|19.6509	0.95805|0.95805	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	344|.	P06576|.	ATPB_HUMAN|.	Q|A	344;333;230;88;245|280	ENSP00000262030:E344Q;ENSP00000450297:E333Q;ENSP00000446677:E230Q;ENSP00000448428:E88Q;ENSP00000447571:E245Q|.	ENSP00000262030:E344Q|.	E|G	-|-	1|2	0|0	ATP5B|ATP5B	55322553|55322553	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.660000|7.660000	0.83776|0.83776	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAA|GGA	ATP5B	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,smart_AAA+_ATPase,tigrfam_ATPase_F1-cplx_bsu	ENSG00000110955		0.438	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5B	HGNC	protein_coding	OTTHUMT00000408380.1	393	0.00	0	C	NM_001686		57036286	57036286	-1	no_errors	ENST00000262030	ensembl	human	known	69_37n	missense	373	12.24	52	SNP	1.000	G
ATP8B3	148229	genome.wustl.edu	37	19	1799950	1799950	+	Silent	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:1799950G>T	ENST00000310127.6	-	14	1786	c.1548C>A	c.(1546-1548)gtC>gtA	p.V516V	ATP8B3_ENST00000525591.1_Silent_p.V469V|ATP8B3_ENST00000526092.2_Silent_p.V463V|ATP8B3_ENST00000539485.1_Silent_p.V516V	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	516					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCACCATAGACGCGGCCGC	0.622																																						dbGAP											0													31.0	35.0	34.0					19																	1799950		2143	4255	6398	-	-	-	SO:0001819	synonymous_variant	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1548C>A	19.37:g.1799950G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.V516	ENST00000310127.6	37	c.1548	CCDS45901.1	19																																																																																			ATP8B3	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000130270		0.622	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	126	0.00	0	G	NM_138813		1799950	1799950	-1	no_errors	ENST00000539485	ensembl	human	known	69_37n	silent	98	15.52	18	SNP	0.639	T
BDNF	627	genome.wustl.edu	37	11	27695705	27695705	+	5'UTR	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:27695705C>G	ENST00000420794.1	-	0	267				BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000532997.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000584049.1_Intron|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000418212.1_Intron|BDNF_ENST00000533131.1_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000438929.1_Missense_Mutation_p.V43L|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000356660.4_Intron|BDNF-AS_ENST00000501663.2_RNA|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395980.2_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000499008.3_RNA	NM_001143811.1	NP_001137283.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						TCATGCCATACAGAAGCGTGT	0.453																																						dbGAP											0													77.0	71.0	73.0					11																	27695705		1567	3581	5148	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000420794.1:c.-237G>C	11.37:g.27695705C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel,prints_Brain-der_neurotrophic_factor,prints_Nerve_growth_factor-rel	p.V43L	ENST00000420794.1	37	c.127	CCDS7866.1	11	.	.	.	.	.	.	.	.	.	.	C	8.730	0.916508	0.17907	.	.	ENSG00000176697	ENST00000438929	T	0.57273	0.41	6.07	2.08	0.27032	.	.	.	.	.	T	0.38957	0.1060	.	.	.	0.19300	N	0.999972	B	0.09022	0.002	B	0.06405	0.002	T	0.35748	-0.9776	8	0.87932	D	0	.	4.6443	0.12565	0.1544:0.6017:0.0:0.2439	.	43	P23560-4	.	L	43	ENSP00000414303:V43L	ENSP00000414303:V43L	V	-	1	0	BDNF	27652281	0.002000	0.14202	0.006000	0.13384	0.595000	0.36748	-0.353000	0.07691	0.416000	0.25844	0.655000	0.94253	GTA	BDNF	-	NULL	ENSG00000176697		0.453	BDNF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding		208	0.00	0	C	NM_170735		27695705	27695705	-1	no_errors	ENST00000438929	ensembl	human	known	69_37n	missense	162	18.59	37	SNP	0.045	G
BRDT	676	genome.wustl.edu	37	1	92446610	92446610	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:92446610C>G	ENST00000362005.3	+	11	2043	c.1625C>G	c.(1624-1626)cCt>cGt	p.P542R	BRDT_ENST00000402388.1_Missense_Mutation_p.P542R|BRDT_ENST00000399546.2_Missense_Mutation_p.P542R|BRDT_ENST00000394530.3_Missense_Mutation_p.P496R|BRDT_ENST00000370389.2_Missense_Mutation_p.P469R	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	542	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.		P -> A (in dbSNP:rs55912588). {ECO:0000269|PubMed:17344846}.		cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		TCAAGAGAGCCTTCTCTGAGC	0.368																																						dbGAP											0													76.0	77.0	77.0					1																	92446610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.1625C>G	1.37:g.92446610C>G	ENSP00000354568:p.Pro542Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.P542R	ENST00000362005.3	37	c.1625	CCDS735.1	1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545797	0.86022	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000394530;ENST00000402388	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.97	5.97	0.96955	.	0.107991	0.41500	D	0.000864	T	0.63200	0.2491	M	0.88640	2.97	0.80722	D	1	D;D;P;P	0.71674	0.998;0.998;0.776;0.956	D;D;P;P	0.66716	0.946;0.946;0.452;0.71	T	0.68769	-0.5321	10	0.87932	D	0	-7.6888	20.4324	0.99085	0.0:1.0:0.0:0.0	.	496;496;546;542	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	R	542;469;542;496;542	ENSP00000354568:P542R;ENSP00000359416:P469R;ENSP00000387822:P542R;ENSP00000378038:P496R;ENSP00000384051:P542R	ENSP00000354568:P542R	P	+	2	0	BRDT	92219198	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	4.841000	0.62824	2.833000	0.97629	0.585000	0.79938	CCT	BRDT	-	NULL	ENSG00000137948		0.368	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRDT	HGNC	protein_coding	OTTHUMT00000027980.2	160	0.00	0	C	NM_207189		92446610	92446610	+1	no_errors	ENST00000362005	ensembl	human	known	69_37n	missense	202	29.12	83	SNP	1.000	G
BLZF1	8548	genome.wustl.edu	37	1	169351347	169351347	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:169351347C>G	ENST00000367808.3	+	6	1268	c.845C>G	c.(844-846)aCt>aGt	p.T282S	BLZF1_ENST00000329281.2_Missense_Mutation_p.T282S			Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	282					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|mitotic cell cycle (GO:0000278)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	14	all_hematologic(923;0.208)					AGAGAGCAAACTTACTCCCCT	0.423																																						dbGAP											0													147.0	140.0	142.0					1																	169351347		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79751	CCDS1278.1	1q24	2008-08-01	2008-08-01		ENSG00000117475	ENSG00000117475			1065	protein-coding gene	gene with protein product		608692				9129147	Standard	NM_003666		Approved	JEM-1	uc001gfy.3	Q9H2G9	OTTHUMG00000035453	ENST00000367808.3:c.845C>G	1.37:g.169351347C>G	ENSP00000356782:p.Thr282Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O15298|Q5T531|Q5T533|Q9GZX4	Missense_Mutation	SNP	pfam_DUF1721_fun	p.T282S	ENST00000367808.3	37	c.845	CCDS1278.1	1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.213062	0.58452	.	.	ENSG00000117475	ENST00000367808;ENST00000329281	T;T	0.34275	1.37;1.37	5.63	5.63	0.86233	.	0.049911	0.85682	D	0.000000	T	0.30166	0.0756	M	0.66939	2.045	0.37949	D	0.932578	D	0.52996	0.957	P	0.48571	0.582	T	0.12400	-1.0549	9	0.21540	T	0.41	-0.7156	12.9533	0.58413	0.0:0.926:0.0:0.074	.	282	Q9H2G9	GO45_HUMAN	S	282	ENSP00000356782:T282S;ENSP00000327541:T282S	ENSP00000327541:T282S	T	+	2	0	BLZF1	167617971	1.000000	0.71417	0.977000	0.42913	0.962000	0.63368	4.598000	0.61069	2.651000	0.90000	0.555000	0.69702	ACT	BLZF1	-	NULL	ENSG00000117475		0.423	BLZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLZF1	HGNC	protein_coding	OTTHUMT00000086109.1	293	0.00	0	C	NM_003666		169351347	169351347	+1	no_errors	ENST00000329281	ensembl	human	known	69_37n	missense	421	21.46	115	SNP	0.998	G
BRE	9577	genome.wustl.edu	37	2	28521317	28521317	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:28521317C>G	ENST00000342045.2	+	12	1188	c.1047C>G	c.(1045-1047)taC>taG	p.Y349*	BRE_ENST00000344773.2_Nonsense_Mutation_p.Y349*|BRE_ENST00000379624.1_Nonsense_Mutation_p.Y349*|BRE_ENST00000361704.2_Nonsense_Mutation_p.Y349*|BRE_ENST00000379632.2_Nonsense_Mutation_p.Y349*	NM_199194.2	NP_954664.1			brain and reproductive organ-expressed (TNFRSF1A modulator)											NS(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(2)	23	Acute lymphoblastic leukemia(172;0.155)					ATTATCCGTACAGCCCCAGAT	0.433																																						dbGAP											0													119.0	121.0	120.0					2																	28521317		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF015767	CCDS1763.1, CCDS1764.1, CCDS1765.1	2p23	2008-02-05			ENSG00000158019	ENSG00000158019			1106	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 4"""	610497				9737713, 7826398	Standard	NM_004899		Approved	BRCC45, BRCC4	uc002rls.3	Q9NXR7	OTTHUMG00000097831	ENST00000342045.2:c.1047C>G	2.37:g.28521317C>G	ENSP00000339371:p.Tyr349*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Brain/reproduct-express_prot	p.Y349*	ENST00000342045.2	37	c.1047	CCDS1763.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.268940	0.95429	.	.	ENSG00000158019	ENST00000344773;ENST00000379624;ENST00000342045;ENST00000379632;ENST00000361704;ENST00000379623	.	.	.	5.75	4.87	0.63330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.8749	12.0856	0.53695	0.0:0.8356:0.0:0.1644	.	.	.	.	X	349;349;349;349;349;251	.	ENSP00000339371:Y349X	Y	+	3	2	BRE	28374821	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	1.758000	0.38410	2.732000	0.93576	0.655000	0.94253	TAC	BRE	-	NULL	ENSG00000158019		0.433	BRE-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BRE	HGNC	protein_coding	OTTHUMT00000215114.1	341	0.00	0	C			28521317	28521317	+1	no_errors	ENST00000344773	ensembl	human	known	69_37n	nonsense	283	18.16	63	SNP	1.000	G
BZRAP1	9256	genome.wustl.edu	37	17	56389025	56389025	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:56389025C>G	ENST00000343736.4	-	18	3151	c.2988G>C	c.(2986-2988)ttG>ttC	p.L996F	BZRAP1_ENST00000268893.6_Missense_Mutation_p.L936F|BZRAP1_ENST00000355701.3_Missense_Mutation_p.L996F			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	996	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AACTGATGATCAAGATCCCAG	0.617																																						dbGAP											0													65.0	57.0	60.0					17																	56389025		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2988G>C	17.37:g.56389025C>G	ENSP00000345824:p.Leu996Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75111|Q8N5W3	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.L996F	ENST00000343736.4	37	c.2988	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197627	0.58126	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.47869	0.83;0.83;0.83	5.38	4.39	0.52855	Fibronectin, type III (3);	0.217217	0.38663	N	0.001603	T	0.63628	0.2527	M	0.84683	2.71	0.39893	D	0.973798	P;D;P	0.55800	0.931;0.973;0.923	P;P;P	0.54629	0.621;0.742;0.757	T	0.71404	-0.4603	10	0.72032	D	0.01	.	10.9936	0.47563	0.0:0.7981:0.1291:0.0728	.	996;936;996	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	F	996;996;936	ENSP00000347929:L996F;ENSP00000345824:L996F;ENSP00000268893:L936F	ENSP00000268893:L936F	L	-	3	2	BZRAP1	53744024	0.238000	0.23825	0.998000	0.56505	0.743000	0.42351	-0.141000	0.10327	1.387000	0.46486	0.557000	0.71058	TTG	BZRAP1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000005379		0.617	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	71	0.00	0	C	NM_004758		56389025	56389025	-1	no_errors	ENST00000355701	ensembl	human	known	69_37n	missense	84	11.58	11	SNP	0.996	G
C17orf80	55028	genome.wustl.edu	37	17	71232219	71232219	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:71232219A>G	ENST00000535032.2	+	2	711	c.598A>G	c.(598-600)Acc>Gcc	p.T200A	C17orf80_ENST00000577615.1_Missense_Mutation_p.T200A|FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000268942.8_Missense_Mutation_p.T200A|C17orf80_ENST00000359042.2_Missense_Mutation_p.T200A|C17orf80_ENST00000426147.2_Missense_Mutation_p.T200A|C17orf80_ENST00000255557.4_Missense_Mutation_p.T200A			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	200						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			TGTACAAACTACCTCTGGTGA	0.373																																						dbGAP											0													76.0	80.0	79.0					17																	71232219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.598A>G	17.37:g.71232219A>G	ENSP00000440551:p.Thr200Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Missense_Mutation	SNP	NULL	p.T200A	ENST00000535032.2	37	c.598	CCDS11694.1	17	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763939	0.49574	.	.	ENSG00000141219	ENST00000255557;ENST00000359042;ENST00000268942;ENST00000426147;ENST00000535032	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	4.41	-0.823	0.10815	.	0.344667	0.25402	N	0.030936	T	0.43166	0.1235	M	0.67953	2.075	0.09310	N	1	D;D;D;D	0.63046	0.972;0.972;0.986;0.992	P;P;P;P	0.57502	0.574;0.737;0.775;0.822	T	0.27839	-1.0062	10	0.72032	D	0.01	-2.7871	4.5653	0.12184	0.3969:0.3895:0.2136:0.0	.	200;200;200;200	B7Z7E5;Q9BSJ5;Q9BSJ5-2;Q9BSJ5-3	.;CQ080_HUMAN;.;.	A	200	ENSP00000255557:T200A;ENSP00000351937:T200A;ENSP00000268942:T200A;ENSP00000396970:T200A;ENSP00000440551:T200A	ENSP00000255557:T200A	T	+	1	0	C17orf80	68743814	0.000000	0.05858	0.023000	0.16930	0.072000	0.16883	-0.025000	0.12413	0.007000	0.14760	0.459000	0.35465	ACC	C17orf80	-	NULL	ENSG00000141219		0.373	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf80	HGNC	protein_coding	OTTHUMT00000441893.1	129	0.00	0	A	NM_017941		71232219	71232219	+1	no_errors	ENST00000359042	ensembl	human	known	69_37n	missense	221	23.00	66	SNP	0.034	G
CNBD2	140894	genome.wustl.edu	37	20	34618474	34618474	+	Nonsense_Mutation	SNP	T	T	G	rs530240069		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr20:34618474T>G	ENST00000373973.3	+	12	1808	c.1635T>G	c.(1633-1635)taT>taG	p.Y545*	CNBD2_ENST00000538900.1_3'UTR|CNBD2_ENST00000349339.1_Nonsense_Mutation_p.Y541*			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	545																	AACCTCGTTATCCTATTTTTA	0.468																																						dbGAP											0													233.0	221.0	225.0					20																	34618474		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.1635T>G	20.37:g.34618474T>G	ENSP00000363084:p.Tyr545*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Nonsense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.Y545*	ENST00000373973.3	37	c.1635		20	.	.	.	.	.	.	.	.	.	.	T	15.89	2.965510	0.53507	.	.	ENSG00000149646	ENST00000373973;ENST00000349339	.	.	.	5.26	1.49	0.22878	.	0.826650	0.10629	N	0.652378	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5325	6.9728	0.24658	0.0:0.5387:0.0:0.4613	.	.	.	.	X	545;541	.	ENSP00000340954:Y541X	Y	+	3	2	C20orf152	34081888	0.001000	0.12720	0.740000	0.30986	0.020000	0.10135	-0.011000	0.12721	0.090000	0.17273	0.459000	0.35465	TAT	C20orf152	-	NULL	ENSG00000149646		0.468	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	C20orf152	HGNC	protein_coding	OTTHUMT00000078960.2	304	0.00	0	T	NM_080834		34618474	34618474	+1	no_errors	ENST00000373973	ensembl	human	known	69_37n	nonsense	456	10.39	53	SNP	0.791	G
C2orf73	129852	genome.wustl.edu	37	2	54562103	54562103	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:54562103C>A	ENST00000398634.2	+	2	218	c.176C>A	c.(175-177)gCa>gAa	p.A59E	C2orf73_ENST00000491538.1_Intron|C2orf73_ENST00000405749.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	59										breast(2)	2						AACACAAATGCAAGAACATAC	0.328																																						dbGAP											0													84.0	72.0	76.0					2																	54562103		1856	4085	5941	-	-	-	SO:0001583	missense	0			BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.176C>A	2.37:g.54562103C>A	ENSP00000381631:p.Ala59Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV79|A0AV81|Q8N7V4	Missense_Mutation	SNP	NULL	p.A59E	ENST00000398634.2	37	c.176	CCDS46285.1	2	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590227	0.46214	.	.	ENSG00000177994	ENST00000486488;ENST00000398634	T;T	0.37235	1.21;1.21	4.39	0.381	0.16228	.	0.449885	0.20322	N	0.094615	T	0.35248	0.0925	L	0.60455	1.87	0.26974	N	0.965521	P	0.48016	0.904	P	0.48227	0.571	T	0.20405	-1.0276	10	0.56958	D	0.05	-9.9622	4.4689	0.11703	0.0:0.543:0.1637:0.2933	.	59	Q8N5S3	CB073_HUMAN	E	65;59	ENSP00000417971:A65E;ENSP00000381631:A59E	ENSP00000381631:A59E	A	+	2	0	C2orf73	54415607	1.000000	0.71417	0.991000	0.47740	0.507000	0.33981	0.479000	0.22228	-0.046000	0.13446	-0.302000	0.09304	GCA	C2orf73	-	NULL	ENSG00000177994		0.328	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf73	HGNC	protein_coding	OTTHUMT00000324075.2	217	0.00	0	C	NM_001100396		54562103	54562103	+1	no_errors	ENST00000398634	ensembl	human	known	69_37n	missense	301	12.21	42	SNP	0.994	A
CACNA2D1	781	genome.wustl.edu	37	7	81598259	81598259	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr7:81598259A>G	ENST00000356253.5	-	29	2630	c.2375T>C	c.(2374-2376)aTt>aCt	p.I792T	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.I780T|CACNA2D1_ENST00000535308.1_Intron			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	792					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GCTTACCATAATGCCCGATTC	0.274																																						dbGAP											0													97.0	103.0	101.0					7																	81598259		2203	4294	6497	-	-	-	SO:0001583	missense	0			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2375T>C	7.37:g.81598259A>G	ENSP00000348589:p.Ile792Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	pfam_VDCC_a2/dsu,pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.I792T	ENST00000356253.5	37	c.2375		7	.	.	.	.	.	.	.	.	.	.	A	20.2	3.942167	0.73672	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.77229	-1.08;-1.08	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.86594	0.5970	M	0.76328	2.33	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	D	0.87180	0.2227	10	0.49607	T	0.09	-23.1449	13.6819	0.62491	1.0:0.0:0.0:0.0	.	780	P54289-2	.	T	780;799;792	ENSP00000349320:I780T;ENSP00000348589:I792T	ENSP00000284088:I799T	I	-	2	0	CACNA2D1	81436195	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.309000	0.89969	2.036000	0.60181	0.397000	0.26171	ATT	CACNA2D1	-	NULL	ENSG00000153956		0.274	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	HGNC	protein_coding		134	0.00	0	A			81598259	81598259	-1	no_errors	ENST00000356253	ensembl	human	known	69_37n	missense	114	38.38	71	SNP	1.000	G
CCDC121	79635	genome.wustl.edu	37	2	27851347	27851347	+	Intron	DEL	G	G	-			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:27851347delG	ENST00000324364.3	-	1	63				CCDC121_ENST00000394775.3_Frame_Shift_Del_p.P95fs|GPN1_ENST00000264718.3_5'Flank|GPN1_ENST00000424214.1_5'Flank|GPN1_ENST00000610189.1_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000458167.2_5'Flank|GPN1_ENST00000407583.3_5'Flank|GPN1_ENST00000503738.1_5'Flank|ZNF512_ENST00000556601.1_Intron|GPN1_ENST00000515877.1_5'UTR	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121											breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					GCTAGCATCAGGAACCTGCGT	0.537																																						dbGAP											0													30.0	28.0	29.0					2																	27851347		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.117+469C>-	2.37:g.27851347delG		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW66|J3KQZ8|Q9H8G6	Frame_Shift_Del	DEL	NULL	p.P95fs	ENST00000324364.3	37	c.284	CCDS1759.1	2																																																																																			CCDC121	-	NULL	ENSG00000176714		0.537	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC121	HGNC	protein_coding	OTTHUMT00000250215.1	105	0.00	0	G	NM_024584		27851347	27851347	-1	no_errors	ENST00000394775	ensembl	human	known	69_37n	frame_shift_del	83	13.00	13	DEL	0.002	-
CD5	921	genome.wustl.edu	37	11	60890420	60890423	+	Frame_Shift_Del	DEL	GCAA	GCAA	-			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	GCAA	GCAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:60890420_60890423delGCAA	ENST00000347785.3	+	7	1307_1310	c.1141_1144delGCAA	c.(1141-1146)gcaagcfs	p.AS381fs		NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule	381					apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		AGGCACGGTGGCAAGCATCATCCT	0.618																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.1141_1144delGCAA	11.37:g.60890420_60890423delGCAA	ENSP00000342681:p.Ala381fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0P4|A8K9I3	Frame_Shift_Del	DEL	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Tcell_CD5,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.I383fs	ENST00000347785.3	37	c.1141_1144	CCDS8000.1	11																																																																																			CD5	-	prints_Tcell_CD5	ENSG00000110448		0.618	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5	HGNC	protein_coding	OTTHUMT00000396465.2	281	0.00	0	GCAA	NM_014207		60890420	60890423	+1	no_errors	ENST00000347785	ensembl	human	known	69_37n	frame_shift_del	182	26.02	64	DEL	0.043:0.005:0.003:0.959	-
CDH8	1006	genome.wustl.edu	37	16	61854993	61854993	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:61854993T>G	ENST00000577390.1	-	6	1814	c.860A>C	c.(859-861)gAa>gCa	p.E287A	CDH8_ENST00000299345.6_Missense_Mutation_p.E287A|CDH8_ENST00000584337.1_Missense_Mutation_p.E287A|CDH8_ENST00000577730.1_Missense_Mutation_p.E287A	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	287	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AACCACATCTTCCGGTACTGA	0.403																																						dbGAP											0													101.0	79.0	86.0					16																	61854993		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.860A>C	16.37:g.61854993T>G	ENSP00000462701:p.Glu287Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E287A	ENST00000577390.1	37	c.860	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	T	25.6	4.655077	0.88056	.	.	ENSG00000150394	ENST00000299345	T	0.76316	-1.01	5.96	5.96	0.96718	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.92044	0.7479	H	0.95982	3.75	0.80722	D	1	D;P	0.89917	1.0;0.912	D;D	0.91635	0.999;0.918	D	0.94354	0.7582	10	0.87932	D	0	.	16.4447	0.83919	0.0:0.0:0.0:1.0	.	103;287	Q3LID3;P55286	.;CADH8_HUMAN	A	287	ENSP00000299345:E287A	ENSP00000299345:E287A	E	-	2	0	CDH8	60412494	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.876000	0.56115	2.284000	0.76573	0.528000	0.53228	GAA	CDH8	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000150394		0.403	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	221	0.45	1	T	NM_001796		61854993	61854993	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	missense	143	19.66	35	SNP	1.000	G
CDK11B	984	genome.wustl.edu	37	1	1573246	1573246	+	Splice_Site	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:1573246C>A	ENST00000407249.3	-	14	1351		c.e14-1		CDK11B_ENST00000341832.6_Splice_Site|CDK11B_ENST00000340677.5_Splice_Site|CDK11B_ENST00000317673.7_Splice_Site			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						ACAATTTCATCTGTGAAGAAA	0.542																																						dbGAP											0													107.0	99.0	102.0					1																	1573246		1869	4092	5961	-	-	-	SO:0001630	splice_region_variant	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.1352-1G>T	1.37:g.1573246C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Splice_Site	SNP	-	e14-1	ENST00000407249.3	37	c.1352-1		1																																																																																			CDK11B	-	-	ENSG00000248333		0.542	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		578	0.00	0	C	NM_001787	Intron	1573246	1573246	-1	no_errors	ENST00000407249	ensembl	human	known	69_37n	splice_site	339	18.71	78	SNP	1.000	A
CDV3	55573	genome.wustl.edu	37	3	133306840	133306840	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr3:133306840C>T	ENST00000264993.3	+	5	1042	c.727C>T	c.(727-729)Caa>Taa	p.Q243*	CDV3_ENST00000515421.1_Intron|CDV3_ENST00000508481.1_Nonsense_Mutation_p.Q141*|CDV3_ENST00000420115.2_3'UTR	NM_001134422.1|NM_001282763.1|NM_017548.4	NP_001127894.1|NP_001269692.1|NP_060018.1	Q9UKY7	CDV3_HUMAN	CDV3 homolog (mouse)	243					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)				kidney(3)|lung(1)|prostate(1)	5						GCTAGACAACCAATATGCTGT	0.408																																						dbGAP											0													86.0	90.0	88.0					3																	133306840		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK096865	CCDS3079.1, CCDS46917.1, CCDS46918.1, CCDS75013.1, CCDS75014.1, CCDS75015.1	3q22.1	2008-02-05			ENSG00000091527	ENSG00000091527			26928	protein-coding gene	gene with protein product						10497265	Standard	NM_017548		Approved	H41	uc003epq.3	Q9UKY7	OTTHUMG00000159764	ENST00000264993.3:c.727C>T	3.37:g.133306840C>T	ENSP00000264993:p.Gln243*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUC2|Q96IP9	Nonsense_Mutation	SNP	NULL	p.Q243*	ENST00000264993.3	37	c.727	CCDS3079.1	3	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962101	0.92791	.	.	ENSG00000091527	ENST00000264993;ENST00000508481	.	.	.	5.51	5.51	0.81932	.	0.109619	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	19.4155	0.94694	0.0:1.0:0.0:0.0	.	.	.	.	X	243;141	.	ENSP00000264993:Q243X	Q	+	1	0	CDV3	134789530	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.155000	0.77445	2.605000	0.88082	0.650000	0.86243	CAA	CDV3	-	NULL	ENSG00000091527		0.408	CDV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDV3	HGNC	protein_coding	OTTHUMT00000357203.1	157	0.00	0	C	NM_017548		133306840	133306840	+1	no_errors	ENST00000264993	ensembl	human	known	69_37n	nonsense	133	13.55	21	SNP	1.000	T
CEP192	55125	genome.wustl.edu	37	18	13087076	13087076	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr18:13087076T>C	ENST00000325971.8	+	29	5482	c.3889T>C	c.(3889-3891)Tct>Cct	p.S1297P	CEP192_ENST00000506447.1_Missense_Mutation_p.S1893P|CEP192_ENST00000430049.2_Missense_Mutation_p.S1418P|CEP192_ENST00000540847.2_3'UTR			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1297					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TAAAAAATTATCTGACAGTTA	0.338																																						dbGAP											0													81.0	83.0	82.0					18																	13087076		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.3889T>C	18.37:g.13087076T>C	ENSP00000317156:p.Ser1297Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.S1893P	ENST00000325971.8	37	c.5677		18	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846328	0.71603	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.45276	0.9;0.9;0.9	5.2	2.58	0.30949	.	0.222920	0.39407	N	0.001376	T	0.57007	0.2024	M	0.72894	2.215	0.44409	D	0.997324	D;D;D	0.89917	0.998;1.0;0.958	P;D;P	0.79108	0.9;0.992;0.731	T	0.56263	-0.8008	10	0.56958	D	0.05	-12.8448	6.9486	0.24532	0.257:0.0:0.1335:0.6094	.	1418;1893;495	C9JT09;E9PF99;Q9HCK3	.;.;.	P	1893;1297;1297;1418	ENSP00000427550:S1893P;ENSP00000317156:S1297P;ENSP00000389190:S1418P	ENSP00000317156:S1297P	S	+	1	0	CEP192	13077076	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.454000	0.44979	0.895000	0.36342	0.528000	0.53228	TCT	CEP192	-	NULL	ENSG00000101639		0.338	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		142	0.00	0	T	NM_032142		13087076	13087076	+1	no_errors	ENST00000506447	ensembl	human	known	69_37n	missense	181	31.32	83	SNP	1.000	C
CEP350	9857	genome.wustl.edu	37	1	180000592	180000592	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:180000592G>C	ENST00000367607.3	+	15	4106	c.3688G>C	c.(3688-3690)Gat>Cat	p.D1230H		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1230	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TCTTGATACAGATAGCACTTT	0.328																																						dbGAP											0													38.0	37.0	37.0					1																	180000592		2199	4299	6498	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3688G>C	1.37:g.180000592G>C	ENSP00000356579:p.Asp1230His	Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.D1230H	ENST00000367607.3	37	c.3688	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506759	0.64410	.	.	ENSG00000135837	ENST00000367607	T	0.62232	0.04	6.02	6.02	0.97574	.	0.000000	0.48767	D	0.000175	T	0.62527	0.2435	L	0.29908	0.895	0.46981	D	0.999273	D;D	0.58620	0.97;0.983	P;P	0.50791	0.498;0.65	T	0.57608	-0.7782	9	.	.	.	.	20.1421	0.98061	0.0:0.0:1.0:0.0	.	1230;1230	E7EU22;Q5VT06	.;CE350_HUMAN	H	1230	ENSP00000356579:D1230H	.	D	+	1	0	CEP350	178267215	1.000000	0.71417	0.162000	0.22713	0.455000	0.32408	6.715000	0.74697	2.850000	0.98022	0.650000	0.86243	GAT	CEP350	-	NULL	ENSG00000135837		0.328	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	60	0.00	0	G	NM_014810		180000592	180000592	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	87	13.00	13	SNP	0.945	C
CLTC	1213	genome.wustl.edu	37	17	57738819	57738819	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:57738819C>A	ENST00000269122.3	+	8	1457	c.1183C>A	c.(1183-1185)Cca>Aca	p.P395T	CLTC_ENST00000393043.1_Missense_Mutation_p.P395T|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	395	Globular terminal domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCTTCGTACTCCAGACACTAT	0.448			T	"""ALK, TFE3"""	"""ALCL, renal """																																	dbGAP		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													124.0	115.0	118.0					17																	57738819		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1183C>A	17.37:g.57738819C>A	ENSP00000269122:p.Pro395Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.P395T	ENST00000269122.3	37	c.1183	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043255	0.55003	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.45276	0.9;0.9	5.78	5.78	0.91487	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56529	0.1991	M	0.80183	2.485	0.80722	D	1	B;B	0.17667	0.004;0.023	B;B	0.34038	0.031;0.174	T	0.56792	-0.7920	10	0.66056	D	0.02	-16.0628	20.0216	0.97506	0.0:1.0:0.0:0.0	.	395;395	Q00610;Q00610-2	CLH1_HUMAN;.	T	395	ENSP00000269122:P395T;ENSP00000376763:P395T	ENSP00000269122:P395T	P	+	1	0	CLTC	55093601	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.072000	0.71238	2.735000	0.93741	0.650000	0.86243	CCA	CLTC	-	superfamily_ARM-type_fold,pirsf_Clathrin_heavy_chain	ENSG00000141367		0.448	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	222	0.45	1	C	NM_004859		57738819	57738819	+1	no_errors	ENST00000269122	ensembl	human	known	69_37n	missense	225	12.45	32	SNP	1.000	A
CNGA3	1261	genome.wustl.edu	37	2	98994171	98994171	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:98994171G>C	ENST00000272602.2	+	2	162	c.123G>C	c.(121-123)gaG>gaC	p.E41D	CNGA3_ENST00000409937.1_5'UTR|CNGA3_ENST00000436404.2_Missense_Mutation_p.E41D|CNGA3_ENST00000393504.1_Missense_Mutation_p.E41D			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	41					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CAAGTGAGGAGACATCGTCAG	0.577																																						dbGAP											0													37.0	32.0	34.0					2																	98994171		2203	4300	6503	-	-	-	SO:0001583	missense	0			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.123G>C	2.37:g.98994171G>C	ENSP00000272602:p.Glu41Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.E41D	ENST00000272602.2	37	c.123	CCDS2034.1	2	.	.	.	.	.	.	.	.	.	.	G	1.892	-0.455122	0.04540	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602	T;T;T	0.46819	0.86;0.86;0.86	5.01	1.91	0.25777	.	.	.	.	.	T	0.22820	0.0551	N	0.10916	0.065	0.09310	N	0.999992	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.20605	-1.0270	9	0.02654	T	1	.	9.4659	0.38813	0.0:0.288:0.564:0.1479	.	41;41	Q4VAP7;Q16281	.;CNGA3_HUMAN	D	41	ENSP00000377140:E41D;ENSP00000410070:E41D;ENSP00000272602:E41D	ENSP00000272602:E41D	E	+	3	2	CNGA3	98360603	0.977000	0.34250	0.608000	0.28969	0.024000	0.10985	1.552000	0.36244	0.754000	0.32968	0.655000	0.94253	GAG	CNGA3	-	NULL	ENSG00000144191		0.577	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	HGNC	protein_coding	OTTHUMT00000252986.1	66	0.00	0	G	NM_001298		98994171	98994171	+1	no_errors	ENST00000272602	ensembl	human	known	69_37n	missense	45	29.69	19	SNP	0.738	C
COASY	80347	genome.wustl.edu	37	17	40715169	40715169	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:40715169G>C	ENST00000393818.2	+	1	985	c.529G>C	c.(529-531)Gct>Cct	p.A177P	COASY_ENST00000420359.1_Missense_Mutation_p.A177P|COASY_ENST00000449624.1_5'UTR|COASY_ENST00000590958.1_Missense_Mutation_p.A206P|COASY_ENST00000421097.2_Missense_Mutation_p.A177P|RP11-400F19.8_ENST00000585572.1_RNA	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	177					cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GATCAGGCCAGCTTCCCCCGT	0.632																																						dbGAP											0													59.0	63.0	62.0					17																	40715169		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.529G>C	17.37:g.40715169G>C	ENSP00000377406:p.Ala177Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	pfam_Depp_CoAkinase,pfam_Cytidylyltransf,tigrfam_Depp_CoAkinase	p.A206P	ENST00000393818.2	37	c.616	CCDS11429.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.30|15.30	2.791344|2.791344	0.50102|0.50102	.|.	.|.	ENSG00000068120|ENSG00000068120	ENST00000421097;ENST00000420359;ENST00000393818|ENST00000426807	D;T;T|.	0.97089|.	-4.24;1.41;1.41|.	5.04|5.04	-2.48|-2.48	0.06423|0.06423	.|.	0.543883|.	0.17764|.	N|.	0.162806|.	T|T	0.32793|0.32793	0.0841|0.0841	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	B;B|.	0.29805|.	0.001;0.257|.	B;B|.	0.28638|.	0.005;0.092|.	T|T	0.19160|0.19160	-1.0314|-1.0314	10|6	0.29301|0.87932	T|D	0.29|0	-1.7283|-1.7283	4.5335|4.5335	0.12017|0.12017	0.2271:0.0:0.3791:0.3938|0.2271:0.0:0.3791:0.3938	.|.	206;177|.	Q13057-2;Q13057|.	.;COASY_HUMAN|.	P|T	206;177;177|152	ENSP00000393564:A206P;ENSP00000413338:A177P;ENSP00000377406:A177P|.	ENSP00000377406:A177P|ENSP00000390306:S152T	A|S	+|+	1|2	0|0	COASY|COASY	37968695|37968695	0.084000|0.084000	0.21492|0.21492	0.046000|0.046000	0.18839|0.18839	0.875000|0.875000	0.50365|0.50365	0.720000|0.720000	0.25896|0.25896	-0.261000|-0.261000	0.09405|0.09405	0.561000|0.561000	0.74099|0.74099	GCT|AGC	COASY	-	NULL	ENSG00000068120		0.632	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COASY	HGNC	protein_coding	OTTHUMT00000450409.1	126	0.00	0	G	NM_025233		40715169	40715169	+1	no_errors	ENST00000590958	ensembl	human	known	69_37n	missense	96	11.82	13	SNP	0.845	C
COL1A2	1278	genome.wustl.edu	37	7	94043009	94043009	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr7:94043009C>T	ENST00000297268.6	+	27	2036	c.1565C>T	c.(1564-1566)cCa>cTa	p.P522L		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	522					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TAGGGTGCTCCAGGTCCTGAT	0.443										HNSCC(75;0.22)																												dbGAP											0													101.0	96.0	97.0					7																	94043009		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1565C>T	7.37:g.94043009C>T	ENSP00000297268:p.Pro522Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C,smart_Fib_collagen_C	p.P522L	ENST00000297268.6	37	c.1565	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321646	0.81580	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.98684	-5.07	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.99239	0.9735	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99301	1.0901	10	0.48119	T	0.1	.	19.5643	0.95386	0.0:1.0:0.0:0.0	.	522	P08123	CO1A2_HUMAN	L	522;523	ENSP00000297268:P522L	ENSP00000297268:P522L	P	+	2	0	COL1A2	93880945	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.094000	0.71431	2.700000	0.92200	0.655000	0.94253	CCA	COL1A2	-	pfam_Collagen	ENSG00000164692		0.443	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	271	0.00	0	C	NM_000089		94043009	94043009	+1	no_errors	ENST00000297268	ensembl	human	known	69_37n	missense	248	15.36	45	SNP	1.000	T
COQ10B	80219	genome.wustl.edu	37	2	198334804	198334804	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:198334804C>G	ENST00000263960.2	+	4	596	c.458C>G	c.(457-459)aCt>aGt	p.T153S	COQ10B_ENST00000409010.1_Missense_Mutation_p.T125S|COQ10B_ENST00000409398.1_Missense_Mutation_p.T103S|COQ10B_ENST00000545340.1_Missense_Mutation_p.T110S	NM_025147.3	NP_079423.1	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B (S. cerevisiae)	153						mitochondrial inner membrane (GO:0005743)				endometrium(1)|large_intestine(2)|lung(3)	6			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCATCTTGTACTGATGGGAGA	0.378																																						dbGAP											0													163.0	143.0	150.0					2																	198334804		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023510	CCDS2319.1	2q33.1	2008-02-05	2006-04-04		ENSG00000115520	ENSG00000115520			25819	protein-coding gene	gene with protein product			"""coenzyme Q10 homolog B (yeast)"""				Standard	NM_025147		Approved	FLJ13448	uc002uuh.1	Q9H8M1	OTTHUMG00000132745	ENST00000263960.2:c.458C>G	2.37:g.198334804C>G	ENSP00000263960:p.Thr153Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1Y4	Missense_Mutation	SNP	pfam_Polyket_cyc	p.T153S	ENST00000263960.2	37	c.458	CCDS2319.1	2	.	.	.	.	.	.	.	.	.	.	C	14.16	2.451222	0.43531	.	.	ENSG00000115520	ENST00000263960;ENST00000409398;ENST00000545340;ENST00000409010	T;T;T;T	0.41400	1.97;1.0;2.02;1.98	5.25	5.25	0.73442	START-like domain (1);	0.058045	0.64402	D	0.000001	T	0.28863	0.0716	N	0.10760	0.04	0.50813	D	0.999892	B;B	0.23128	0.08;0.022	B;B	0.29353	0.05;0.101	T	0.08513	-1.0718	10	0.25751	T	0.34	0.7043	18.8462	0.92208	0.0:1.0:0.0:0.0	.	125;153	B8ZZV9;Q9H8M1	.;CQ10B_HUMAN	S	153;103;110;125	ENSP00000263960:T153S;ENSP00000386785:T103S;ENSP00000442520:T110S;ENSP00000387223:T125S	ENSP00000263960:T153S	T	+	2	0	COQ10B	198043049	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	7.776000	0.85560	2.451000	0.82905	0.650000	0.86243	ACT	COQ10B	-	pfam_Polyket_cyc	ENSG00000115520		0.378	COQ10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ10B	HGNC	protein_coding	OTTHUMT00000256105.2	424	0.00	0	C	NM_025147		198334804	198334804	+1	no_errors	ENST00000263960	ensembl	human	known	69_37n	missense	465	20.24	118	SNP	1.000	G
COX10	1352	genome.wustl.edu	37	17	13980191	13980191	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:13980191G>A	ENST00000261643.3	+	3	394	c.317G>A	c.(316-318)aGc>aAc	p.S106N	COX10_ENST00000429152.2_Missense_Mutation_p.S106N|COX10_ENST00000537334.1_Intron|COX10_ENST00000536205.1_5'UTR	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	106					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TCACCGCCCAGCCTATCTTTG	0.423																																						dbGAP											0													86.0	81.0	83.0					17																	13980191		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.317G>A	17.37:g.13980191G>A	ENSP00000261643:p.Ser106Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	p.S106N	ENST00000261643.3	37	c.317	CCDS11166.1	17	.	.	.	.	.	.	.	.	.	.	G	7.921	0.738554	0.15574	.	.	ENSG00000006695	ENST00000261643	T	0.37235	1.21	5.35	2.13	0.27403	.	1.067150	0.07090	N	0.838569	T	0.28433	0.0703	L	0.53249	1.67	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.31668	-0.9935	10	0.15952	T	0.53	.	2.1207	0.03725	0.205:0.2536:0.4113:0.13	.	106	Q12887	COX10_HUMAN	N	106	ENSP00000261643:S106N	ENSP00000261643:S106N	S	+	2	0	COX10	13920916	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	0.299000	0.19138	0.698000	0.31739	0.655000	0.94253	AGC	COX10	-	pirsf_Protohaem_IX_farnesylTrfase_mt	ENSG00000006695		0.423	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX10	HGNC	protein_coding	OTTHUMT00000130003.1	287	0.00	0	G	NM_001303		13980191	13980191	+1	no_errors	ENST00000261643	ensembl	human	known	69_37n	missense	152	23.50	47	SNP	0.000	A
CPB2	1361	genome.wustl.edu	37	13	46627925	46627925	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr13:46627925G>C	ENST00000181383.4	-	11	1112	c.1096C>G	c.(1096-1098)Cct>Gct	p.P366A	CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000606351.1_RNA|ZC3H13_ENST00000282007.3_5'Flank|CPB2-AS1_ENST00000606243.1_RNA|CPB2_ENST00000439329.3_Missense_Mutation_p.P329A|ZC3H13_ENST00000242848.4_5'Flank|CPB2-AS1_ENST00000415033.2_RNA	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	366					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		CCACCTCCAGGAGCTAGGTCT	0.373																																						dbGAP											0													73.0	73.0	73.0					13																	46627925		2203	4300	6503	-	-	-	SO:0001583	missense	0			M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.1096C>G	13.37:g.46627925G>C	ENSP00000181383:p.Pro366Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.P366A	ENST00000181383.4	37	c.1096	CCDS9401.1	13	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999211	0.35226	.	.	ENSG00000080618	ENST00000181383;ENST00000439329	T;T	0.09538	2.97;2.97	5.62	5.62	0.85841	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.09992	0.0245	N	0.01081	-1.03	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70227	0.968;0.915	T	0.55321	-0.8159	10	0.09843	T	0.71	.	18.6405	0.91393	0.0:0.0:1.0:0.0	.	329;366	Q96IY4-2;Q96IY4	.;CBPB2_HUMAN	A	366;329	ENSP00000181383:P366A;ENSP00000400714:P329A	ENSP00000181383:P366A	P	-	1	0	CPB2	45525926	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.322000	0.65852	2.650000	0.89964	0.561000	0.74099	CCT	CPB2	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000080618		0.373	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPB2	HGNC	protein_coding	OTTHUMT00000044803.2	165	0.60	1	G	NM_001872		46627925	46627925	-1	no_errors	ENST00000181383	ensembl	human	known	69_37n	missense	129	21.34	35	SNP	1.000	C
CPEB2	132864	genome.wustl.edu	37	4	15054069	15054069	+	Silent	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr4:15054069C>G	ENST00000507071.1	+	6	984	c.897C>G	c.(895-897)ggC>ggG	p.G299G	CPEB2_ENST00000382401.3_Silent_p.G272G|CPEB2_ENST00000345451.3_Silent_p.G269G|CPEB2_ENST00000541112.1_Silent_p.G736G|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000442003.2_Silent_p.G717G|CPEB2_ENST00000259997.5_Silent_p.G307G|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000538197.1_Silent_p.G744G|CPEB2_ENST00000382395.3_Silent_p.G277G			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	299					cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						TAGATGATGGCTTGCTTGATG	0.368																																						dbGAP											0													225.0	214.0	218.0					4																	15054069		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.897C>G	4.37:g.15054069C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G744	ENST00000507071.1	37	c.2232		4																																																																																			CPEB2	-	NULL	ENSG00000137449		0.368	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	701	0.00	0	C	XM_059607		15054069	15054069	+1	no_errors	ENST00000538197	ensembl	human	known	69_37n	silent	681	12.23	95	SNP	1.000	G
CPNE2	221184	genome.wustl.edu	37	16	57153125	57153125	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:57153125G>C	ENST00000535318.2	+	7	887	c.526G>C	c.(526-528)Gac>Cac	p.D176H	CPNE2_ENST00000290776.8_Missense_Mutation_p.D176H|CPNE2_ENST00000565874.1_Missense_Mutation_p.D176H|CPNE2_ENST00000537605.1_Missense_Mutation_p.D74H			Q96FN4	CPNE2_HUMAN	copine II	176	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				TGGGAAGTCAGACCCCTTTCT	0.592																																						dbGAP											0													106.0	97.0	100.0					16																	57153125		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.526G>C	16.37:g.57153125G>C	ENSP00000439018:p.Asp176His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68D19|Q719H8|Q86XP9	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting	p.D176H	ENST00000535318.2	37	c.526	CCDS10774.1	16	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690213	0.88735	.	.	ENSG00000140848	ENST00000290776;ENST00000537605;ENST00000535318	T;T;T	0.60040	0.22;0.22;0.22	5.38	5.38	0.77491	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.054165	0.64402	D	0.000001	D	0.86707	0.5997	H	0.98701	4.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.92182	0.5752	10	0.87932	D	0	-28.1111	19.1243	0.93376	0.0:0.0:1.0:0.0	.	176;176	A8K8A4;Q96FN4	.;CPNE2_HUMAN	H	176;74;176	ENSP00000290776:D176H;ENSP00000445468:D74H;ENSP00000439018:D176H	ENSP00000290776:D176H	D	+	1	0	CPNE2	55710626	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.819000	0.99357	2.531000	0.85337	0.555000	0.69702	GAC	CPNE2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000140848		0.592	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPNE2	HGNC	protein_coding	OTTHUMT00000432986.2	245	0.00	0	G	NM_152727		57153125	57153125	+1	no_errors	ENST00000290776	ensembl	human	known	69_37n	missense	163	18.09	36	SNP	1.000	C
CREM	1390	genome.wustl.edu	37	10	35500663	35500663	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:35500663C>G	ENST00000395895.2	+	10	1180	c.1018C>G	c.(1018-1020)Cag>Gag	p.Q340E	CREM_ENST00000395887.3_Missense_Mutation_p.Q261E|CREM_ENST00000474362.1_Missense_Mutation_p.Q75E|CREM_ENST00000348787.2_Missense_Mutation_p.Q200E|CREM_ENST00000479070.1_Missense_Mutation_p.Q291E|CREM_ENST00000463960.1_Missense_Mutation_p.Q173E|CREM_ENST00000361599.4_Missense_Mutation_p.Q249E|CREM_ENST00000356917.5_3'UTR|CREM_ENST00000429130.3_Missense_Mutation_p.Q324E|CREM_ENST00000374721.3_3'UTR|CREM_ENST00000374728.3_Missense_Mutation_p.Q200E|CREM_ENST00000487763.1_Missense_Mutation_p.Q100E|CREM_ENST00000345491.3_Missense_Mutation_p.Q279E|CREM_ENST00000490511.1_Missense_Mutation_p.Q92E|CREM_ENST00000333809.8_3'UTR|CREM_ENST00000473940.1_3'UTR|CREM_ENST00000460270.1_3'UTR|CREM_ENST00000344351.5_3'UTR|CREM_ENST00000342105.3_Missense_Mutation_p.Q224E|CREM_ENST00000488328.1_Missense_Mutation_p.Q88E|CREM_ENST00000468236.1_Missense_Mutation_p.Q104E|CREM_ENST00000463314.1_Missense_Mutation_p.Q117E|CREM_ENST00000484283.1_Missense_Mutation_p.Q198E|CREM_ENST00000439705.1_3'UTR|RP11-324I22.3_ENST00000602435.1_RNA|CREM_ENST00000354759.3_3'UTR			Q03060	CREM_HUMAN	cAMP responsive element modulator	340	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cell differentiation (GO:0030154)|glycosphingolipid metabolic process (GO:0006687)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding protein binding (GO:0008140)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14						GCTGGAAGTCCAGAACAAGAA	0.393																																						dbGAP											0													86.0	94.0	91.0					10																	35500663		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7180.1, CCDS7181.1, CCDS7182.1, CCDS7183.1, CCDS7184.1, CCDS7185.1, CCDS7186.1, CCDS7187.1, CCDS7188.1, CCDS31181.1, CCDS53519.1, CCDS53520.1, CCDS53517.1, CCDS53518.1, CCDS53521.1, CCDS58074.1, CCDS58075.1, CCDS58076.1	10p12.1-p11.1	2013-01-10			ENSG00000095794	ENSG00000095794		"""basic leucine zipper proteins"""	2352	protein-coding gene	gene with protein product		123812				1461747, 7916662	Standard	NM_182717		Approved	hCREM-2	uc001iyb.3	Q03060	OTTHUMG00000017953	ENST00000395895.2:c.1018C>G	10.37:g.35500663C>G	ENSP00000379232:p.Gln340Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K014|A8K3J7|A8K6A1|A8MPQ2|B4DXC1|C9J785|C9JZ10|E9PAR4|E9PHM1|O75519|Q14501|Q14503|Q14504|Q14505|Q14506|Q15731|Q16114|Q16116|Q5T9H7|Q5W1A6|Q5W1A7|Q5W1A8|Q5W1A9|Q5W1B0|Q5W1B2|Q7Z2Q6|Q8IVD4|Q96AG7|Q9NZ98|Q9NZ99|Q9NZB9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_Coactivator_CBP_pKID,pfam_bZIP_2,smart_bZIP,pfscan_Coactivator_CBP_pKID,pfscan_bZIP,prints_Leuzip_CREB	p.Q340E	ENST00000395895.2	37	c.1018		10	.	.	.	.	.	.	.	.	.	.	C	17.04	3.288355	0.59976	.	.	ENSG00000095794	ENST00000474362;ENST00000345491;ENST00000395895;ENST00000374728;ENST00000479070;ENST00000429130;ENST00000489627;ENST00000493508;ENST00000490263;ENST00000348787;ENST00000374722;ENST00000361599;ENST00000484283;ENST00000395887;ENST00000463314;ENST00000342105;ENST00000463960;ENST00000487763;ENST00000488328;ENST00000468236;ENST00000490511	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.95	5.05	0.67936	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	.	.	.	.	T	0.56187	0.1968	L	0.41492	1.28	0.80722	D	1	D;D;D;D;D;P;D;D;D;D	0.76494	0.985;0.998;0.998;0.999;0.998;0.946;0.995;0.994;0.991;0.989	D;D;D;D;D;D;D;D;D;D	0.87578	0.94;0.995;0.971;0.998;0.997;0.953;0.995;0.992;0.993;0.989	T	0.58306	-0.7659	9	0.56958	D	0.05	-9.5398	15.2773	0.73750	0.0:0.933:0.0:0.067	.	92;88;100;328;340;224;198;249;200;279	E9PAR4;Q03060-11;Q03060-10;Q03060-1;Q03060;Q03060-7;Q03060-13;Q03060-12;Q5W1A7;Q03060-16	.;.;.;.;CREM_HUMAN;.;.;.;.;.	E	75;279;340;200;291;324;184;133;249;200;312;249;198;261;117;224;173;100;88;104;92	ENSP00000419018:Q75E;ENSP00000265372:Q279E;ENSP00000379232:Q340E;ENSP00000363860:Q200E;ENSP00000420511:Q291E;ENSP00000393538:Q324E;ENSP00000345384:Q200E;ENSP00000354593:Q249E;ENSP00000417165:Q198E;ENSP00000379225:Q261E;ENSP00000418336:Q117E;ENSP00000341875:Q224E;ENSP00000419684:Q173E;ENSP00000417807:Q100E;ENSP00000417460:Q88E;ENSP00000419810:Q104E;ENSP00000417327:Q92E	ENSP00000341875:Q224E	Q	+	1	0	CREM	35540669	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.789000	0.62446	1.532000	0.49169	0.650000	0.86243	CAG	CREM	-	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	ENSG00000095794		0.393	CREM-203	KNOWN	basic|appris_principal	protein_coding	CREM	HGNC	protein_coding		160	0.00	0	C	NM_001881		35500663	35500663	+1	no_errors	ENST00000395895	ensembl	human	known	69_37n	missense	136	20.47	35	SNP	1.000	G
CSMD2	114784	genome.wustl.edu	37	1	33990553	33990553	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:33990553C>T	ENST00000373381.4	-	66	10501	c.10325G>A	c.(10324-10326)gGc>gAc	p.G3442D		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AACTTGGAAGCCAGTCACTCT	0.542																																						dbGAP											0													203.0	168.0	180.0					1																	33990553		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10325G>A	1.37:g.33990553C>T	ENSP00000362479:p.Gly3442Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.G3442D	ENST00000373381.4	37	c.10325		1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.400624	0.42613	.	.	ENSG00000121904	ENST00000373381	T	0.23552	1.9	5.54	3.69	0.42338	.	0.318671	0.34386	N	0.004004	T	0.18173	0.0436	L	0.29908	0.895	0.80722	D	1	B;P	0.45044	0.136;0.849	B;B	0.39027	0.13;0.288	T	0.01839	-1.1263	10	0.44086	T	0.13	.	11.4121	0.49931	0.0:0.8549:0.0:0.1451	.	3298;3442	Q7Z408;E7EUA6	CSMD2_HUMAN;.	D	3442	ENSP00000362479:G3442D	ENSP00000241312:G3298D	G	-	2	0	CSMD2	33763140	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	4.070000	0.57548	0.826000	0.34661	-0.229000	0.12294	GGC	CSMD2	-	NULL	ENSG00000121904		0.542	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		479	0.00	0	C	NM_052896		33990553	33990553	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	301	21.00	80	SNP	0.996	T
CXADRP3	440224	genome.wustl.edu	37	18	14478290	14478290	+	lincRNA	SNP	G	G	T	rs558072722		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr18:14478290G>T	ENST00000581457.1	-	0	1618					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		TGCGTTCAAAGTCTTCACTCG	0.483																																						dbGAP											0																																										-	-	-			0					18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14478290G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			CXADRP3	-	-	ENSG00000265766		0.483	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	HGNC	lincRNA	OTTHUMT00000443008.1	152	0.00	0	G	NR_024076		14478290	14478290	-1	no_errors	ENST00000581457	ensembl	human	known	69_37n	rna	94	12.96	14	SNP	1.000	T
CYP21A2	1589	genome.wustl.edu	37	6	32006896	32006896	+	Silent	SNP	G	G	C	rs577302226	byFrequency	TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:32006896G>C	ENST00000418967.2	+	3	476	c.318G>C	c.(316-318)ccG>ccC	p.P106P	C4B-AS1_ENST00000415626.1_RNA|CYP21A2_ENST00000435122.2_Silent_p.P76P	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	105					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	GGAACTACCCGGACCTGTCCT	0.627													G|||	61	0.0121805	0.0008	0.0115	5008	,	,		14213	0.001		0.0447	False		,,,				2504	0.0061				Melanoma(174;1669 1998 3915 34700 46447)	dbGAP											0													34.0	32.0	33.0					6																	32006896		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.318G>C	6.37:g.32006896G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.P106	ENST00000418967.2	37	c.318	CCDS4735.1	6																																																																																			CYP21A2	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000231852		0.627	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP21A2	HGNC	protein_coding	OTTHUMT00000268768.2	144	0.00	0	G	NM_000500		32006896	32006896	+1	no_errors	ENST00000418967	ensembl	human	known	69_37n	silent	117	20.95	31	SNP	0.000	C
CYP2A7	1549	genome.wustl.edu	37	19	41383175	41383175	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:41383175T>C	ENST00000301146.4	-	7	1622	c.1081A>G	c.(1081-1083)Aga>Gga	p.R361G	CYP2A7_ENST00000291764.3_Missense_Mutation_p.R310G|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	361						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TCTCCAAATCTTTGGATCTCG	0.537																																						dbGAP											0													106.0	92.0	97.0					19																	41383175		2203	4299	6502	-	-	-	SO:0001583	missense	0			NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.1081A>G	19.37:g.41383175T>C	ENSP00000301146:p.Arg361Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13121	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2B-like	p.R361G	ENST00000301146.4	37	c.1081	CCDS12569.1	19	.	.	.	.	.	.	.	.	.	.	T	11.85	1.762476	0.31228	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	D;D	0.97480	-4.4;-4.4	2.18	2.18	0.27775	.	0.000000	0.85682	U	0.000000	D	0.98757	0.9582	H	0.97758	4.07	0.32162	N	0.582741	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96987	0.9719	10	0.87932	D	0	.	9.0853	0.36577	0.0:0.0:0.0:1.0	.	361;310;361	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	G	361;310	ENSP00000301146:R361G;ENSP00000291764:R310G	ENSP00000291764:R310G	R	-	1	2	CYP2A7	46075015	0.504000	0.26123	0.701000	0.30321	0.324000	0.28378	0.785000	0.26830	1.001000	0.39076	0.155000	0.16302	AGA	CYP2A7	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	ENSG00000198077		0.537	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A7	HGNC	protein_coding	OTTHUMT00000463269.2	389	0.00	0	T	NM_030589		41383175	41383175	-1	no_errors	ENST00000301146	ensembl	human	known	69_37n	missense	299	15.06	53	SNP	0.997	C
CYP2C9	1559	genome.wustl.edu	37	10	96748684	96748684	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:96748684C>G	ENST00000260682.6	+	9	1384	c.1372C>G	c.(1372-1374)Ctg>Gtg	p.L458V		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	458					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)	p.L458L(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	GAACTTTAACCTGAAATCTCT	0.473																																					Ovarian(54;1266 1406 16072 35076)	dbGAP											1	Substitution - coding silent(1)	lung(1)											154.0	147.0	149.0					10																	96748684		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.1372C>G	10.37:g.96748684C>G	ENSP00000260682:p.Leu458Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.L458V	ENST00000260682.6	37	c.1372	CCDS7437.1	10	.	.	.	.	.	.	.	.	.	.	C	12.66	2.003438	0.35320	.	.	ENSG00000138109	ENST00000260682	T	0.13538	2.58	3.42	-3.27	0.05048	.	0.190856	0.34025	U	0.004335	T	0.22126	0.0533	L	0.53617	1.68	0.09310	N	1	D;D	0.62365	0.991;0.991	P;P	0.62089	0.898;0.898	T	0.04840	-1.0923	10	0.59425	D	0.04	.	9.6406	0.39837	0.0:0.2857:0.0:0.7143	.	458;458	Q5VX92;P11712	.;CP2C9_HUMAN	V	458	ENSP00000260682:L458V	ENSP00000260682:L458V	L	+	1	2	CYP2C9	96738674	0.037000	0.19845	0.000000	0.03702	0.016000	0.09150	0.085000	0.14912	-0.618000	0.05656	0.453000	0.30009	CTG	CYP2C9	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000138109		0.473	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C9	HGNC	protein_coding	OTTHUMT00000049501.1	539	0.00	0	C	NM_000771		96748684	96748684	+1	no_errors	ENST00000260682	ensembl	human	known	69_37n	missense	302	17.26	63	SNP	0.003	G
BRINP1	1620	genome.wustl.edu	37	9	122000956	122000956	+	Missense_Mutation	SNP	G	G	A	rs1473785	byFrequency	TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:122000956G>A	ENST00000265922.3	-	5	1123	c.662C>T	c.(661-663)aCg>aTg	p.T221M	BRINP1_ENST00000373964.2_Missense_Mutation_p.T221M	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	221	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.T221M(1)									TTTGCTCTCCGTGCTTTGCAG	0.512																																						dbGAP											1	Substitution - Missense(1)	lung(1)											118.0	81.0	94.0					9																	122000956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.662C>T	9.37:g.122000956G>A	ENSP00000265922:p.Thr221Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.T221M	ENST00000265922.3	37	c.662	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333801	0.60853	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.45668	2.47;0.89	5.91	5.91	0.95273	Membrane attack complex component/perforin (MACPF) domain (1);	0.088405	0.85682	D	0.000000	T	0.20292	0.0488	N	0.03608	-0.345	0.47214	D	0.999355	B;B	0.29716	0.255;0.037	B;B	0.14578	0.011;0.005	T	0.10200	-1.0640	10	0.54805	T	0.06	-16.8736	12.5712	0.56339	0.0752:0.0:0.9248:0.0	rs1473785;rs1473785	221;221	O60477-2;O60477	.;DBC1_HUMAN	M	221	ENSP00000265922:T221M;ENSP00000363075:T221M	ENSP00000265922:T221M	T	-	2	0	DBC1	121040777	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.830000	0.86741	2.794000	0.96219	0.655000	0.94253	ACG	DBC1	-	smart_MACPF	ENSG00000078725		0.512	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBC1	HGNC	protein_coding	OTTHUMT00000055440.2	214	0.00	0	G	NM_014618		122000956	122000956	-1	no_errors	ENST00000265922	ensembl	human	known	69_37n	missense	173	16.43	34	SNP	1.000	A
DMD	1756	genome.wustl.edu	37	X	32503137	32503137	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chrX:32503137C>A	ENST00000357033.4	-	21	2908	c.2702G>T	c.(2701-2703)gGa>gTa	p.G901V	DMD_ENST00000378677.2_Missense_Mutation_p.G897V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	901					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGGTCCTTGTCCTTTCTCTTT	0.418																																						dbGAP											0													176.0	151.0	159.0					X																	32503137		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2702G>T	X.37:g.32503137C>A	ENSP00000354923:p.Gly901Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.G901V	ENST00000357033.4	37	c.2702	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	14.02	2.409859	0.42715	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.51574	0.7;0.7	4.84	3.71	0.42584	.	0.205916	0.23439	U	0.048163	T	0.30103	0.0754	N	0.14661	0.345	0.80722	D	1	P;P;P	0.43938	0.571;0.822;0.624	B;B;P	0.46253	0.375;0.392;0.509	T	0.05225	-1.0898	10	0.32370	T	0.25	.	3.2873	0.06936	0.0:0.5303:0.0:0.4697	.	893;901;897	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	V	893;897;901;901;778	ENSP00000367948:G897V;ENSP00000354923:G901V	ENSP00000354923:G901V	G	-	2	0	DMD	32413058	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.135000	0.50546	2.118000	0.64928	0.538000	0.68166	GGA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.418	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	715	0.00	0	C	NM_004006		32503137	32503137	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	346	34.22	180	SNP	1.000	A
DMGDH	29958	genome.wustl.edu	37	5	78338282	78338282	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:78338282C>A	ENST00000255189.3	-	7	1045	c.1017G>T	c.(1015-1017)gaG>gaT	p.E339D	DMGDH_ENST00000380311.4_Missense_Mutation_p.E138D|DMGDH_ENST00000540686.1_Intron	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	339					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		CTAGATCAGACTCAAAGAGTT	0.423																																						dbGAP											0													105.0	100.0	102.0					5																	78338282		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.1017G>T	5.37:g.78338282C>A	ENSP00000255189:p.Glu339Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBN0|B4E1J9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_SoxG	p.E339D	ENST00000255189.3	37	c.1017	CCDS4044.1	5	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417212	0.62622	.	.	ENSG00000132837	ENST00000255189;ENST00000523732;ENST00000380311;ENST00000539598	T;T;T	0.79845	-1.31;-1.31;-1.31	5.25	4.38	0.52667	FAD dependent oxidoreductase (1);	0.053561	0.64402	D	0.000001	T	0.70211	0.3198	L	0.31926	0.97	0.80722	D	1	B;B;B	0.27068	0.167;0.009;0.099	B;B;B	0.29077	0.086;0.037;0.098	T	0.64193	-0.6465	10	0.26408	T	0.33	.	10.6093	0.45412	0.0:0.8428:0.0:0.1572	.	138;189;339	F8W6P8;F5H1C7;Q9UI17	.;.;M2GD_HUMAN	D	339;178;138;189	ENSP00000255189:E339D;ENSP00000430972:E178D;ENSP00000369667:E138D	ENSP00000255189:E339D	E	-	3	2	DMGDH	78374038	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.104000	0.50306	1.223000	0.43536	0.650000	0.86243	GAG	DMGDH	-	pfam_FAD-dep_OxRdtase	ENSG00000132837		0.423	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMGDH	HGNC	protein_coding	OTTHUMT00000226963.3	229	0.00	0	C	NM_013391		78338282	78338282	-1	no_errors	ENST00000255189	ensembl	human	known	69_37n	missense	157	16.49	31	SNP	1.000	A
ECD	11319	genome.wustl.edu	37	10	74923668	74923668	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:74923668T>G	ENST00000372979.4	-	2	234	c.28A>C	c.(28-30)Atg>Ctg	p.M10L	ECD_ENST00000610256.1_5'UTR|ECD_ENST00000430082.2_Missense_Mutation_p.M10L|ECD_ENST00000454759.2_Missense_Mutation_p.M10L	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	10					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					GTGTCTTCCATCGTAGCAAGC	0.363																																						dbGAP											0													173.0	155.0	161.0					10																	74923668		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.28A>C	10.37:g.74923668T>G	ENSP00000362070:p.Met10Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JX46|E9PAW8	Missense_Mutation	SNP	pfam_SGT1	p.M10L	ENST00000372979.4	37	c.28	CCDS7321.1	10	.	.	.	.	.	.	.	.	.	.	T	7.625	0.677669	0.14841	.	.	ENSG00000122882	ENST00000372979;ENST00000430082;ENST00000454759;ENST00000413026	T;T;T;T	0.39787	2.65;2.66;2.4;1.06	5.49	-1.11	0.09840	.	0.825397	0.11288	N	0.579598	T	0.21227	0.0511	N	0.14661	0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.19451	-1.0305	10	0.27082	T	0.32	-3.651	6.3311	0.21270	0.0:0.5209:0.1186:0.3605	.	10;10;10	E9PAW8;C9JX46;O95905	.;.;SGT1_HUMAN	L	10	ENSP00000362070:M10L;ENSP00000401566:M10L;ENSP00000395786:M10L;ENSP00000416288:M10L	ENSP00000362070:M10L	M	-	1	0	ECD	74593674	0.347000	0.24853	0.020000	0.16555	0.281000	0.26958	0.828000	0.27435	-0.201000	0.10284	-0.904000	0.02843	ATG	ECD	-	NULL	ENSG00000122882		0.363	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECD	HGNC	protein_coding	OTTHUMT00000048606.1	296	0.00	0	T	NM_007265		74923668	74923668	-1	no_errors	ENST00000430082	ensembl	human	known	69_37n	missense	243	15.62	45	SNP	0.017	G
EEF2K	29904	genome.wustl.edu	37	16	22260122	22260122	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:22260122A>C	ENST00000263026.5	+	4	868	c.394A>C	c.(394-396)Aag>Cag	p.K132Q		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	132	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		AGTTCTGATCAAGATGGCATC	0.567																																					NSCLC(195;1411 2157 20319 27471 51856)	dbGAP											0													136.0	106.0	116.0					16																	22260122		2197	4300	6497	-	-	-	SO:0001583	missense	0			U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.394A>C	16.37:g.22260122A>C	ENSP00000263026:p.Lys132Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N588	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Sel1-like,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	p.K132Q	ENST00000263026.5	37	c.394	CCDS10604.1	16	.	.	.	.	.	.	.	.	.	.	A	19.60	3.858204	0.71834	.	.	ENSG00000103319	ENST00000263026	T	0.06371	3.31	4.97	4.97	0.65823	MHCK/EF2 kinase (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.20210	0.0486	M	0.66560	2.04	0.80722	D	1	D	0.55800	0.973	P	0.60068	0.868	T	0.00329	-1.1813	10	0.59425	D	0.04	-9.9136	14.9504	0.71067	1.0:0.0:0.0:0.0	.	132	O00418	EF2K_HUMAN	Q	132	ENSP00000263026:K132Q	ENSP00000263026:K132Q	K	+	1	0	EEF2K	22167623	1.000000	0.71417	1.000000	0.80357	0.295000	0.27426	8.864000	0.92294	1.993000	0.58246	0.379000	0.24179	AAG	EEF2K	-	superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	ENSG00000103319		0.567	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2K	HGNC	protein_coding	OTTHUMT00000211580.2	181	0.00	0	A	NM_013302		22260122	22260122	+1	no_errors	ENST00000263026	ensembl	human	known	69_37n	missense	188	15.32	34	SNP	1.000	C
EMID1	129080	genome.wustl.edu	37	22	29611547	29611547	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr22:29611547G>T	ENST00000404820.3	+	3	374	c.247G>T	c.(247-249)Gtg>Ttg	p.V83L	EMID1_ENST00000334018.6_Missense_Mutation_p.V83L|EMID1_ENST00000404755.3_Missense_Mutation_p.V83L			Q96A84	EMID1_HUMAN	EMI domain containing 1	83	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						CACATACAAGGTGATGTACAA	0.622																																						dbGAP											0													109.0	97.0	101.0					22																	29611547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.247G>T	22.37:g.29611547G>T	ENSP00000384452:p.Val83Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYK6|Q6ICG1|Q86SS7	Missense_Mutation	SNP	pfam_Collagen,pfam_EMI_domain,pfscan_EMI_domain	p.V83L	ENST00000404820.3	37	c.247		22	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338687	0.81911	.	.	ENSG00000186998	ENST00000334018;ENST00000429226;ENST00000404755;ENST00000404820;ENST00000430127	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.43	5.43	0.79202	EMI domain (2);	0.000000	0.46145	D	0.000313	T	0.66577	0.2803	M	0.71581	2.175	0.47065	D	0.999309	D;D;P;D	0.69078	0.997;0.996;0.623;0.996	D;D;P;D	0.79108	0.992;0.973;0.77;0.987	T	0.65278	-0.6207	10	0.39692	T	0.17	-16.5526	14.7274	0.69354	0.0:0.0:1.0:0.0	.	83;83;83;83	B0QYK4;B0QYK5;Q96A84;Q96A84-3	.;.;EMID1_HUMAN;.	L	83	ENSP00000335481:V83L;ENSP00000403816:V83L;ENSP00000385414:V83L;ENSP00000384452:V83L;ENSP00000399760:V83L	ENSP00000335481:V83L	V	+	1	0	EMID1	27941547	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.830000	0.55768	2.547000	0.85894	0.462000	0.41574	GTG	EMID1	-	pfam_EMI_domain,pfscan_EMI_domain	ENSG00000186998		0.622	EMID1-002	NOVEL	basic|appris_principal	protein_coding	EMID1	HGNC	protein_coding	OTTHUMT00000321075.1	145	0.00	0	G	NM_133455		29611547	29611547	+1	no_errors	ENST00000334018	ensembl	human	known	69_37n	missense	113	16.30	22	SNP	1.000	T
EML5	161436	genome.wustl.edu	37	14	89091378	89091378	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:89091378G>A	ENST00000380664.5	-	34	4809	c.4810C>T	c.(4810-4812)Cct>Tct	p.P1604S	EML5_ENST00000553320.1_5'UTR|EML5_ENST00000352093.5_Missense_Mutation_p.P1566S|EML5_ENST00000554922.1_Missense_Mutation_p.P1612S			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1604						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GCAAACACAGGCCCGTTGTGA	0.458																																						dbGAP											0													75.0	76.0	76.0					14																	89091378		2010	4187	6197	-	-	-	SO:0001583	missense	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4810C>T	14.37:g.89091378G>A	ENSP00000370039:p.Pro1604Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P1612S	ENST00000380664.5	37	c.4834	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856180	0.91355	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664;ENST00000555823	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.055005	0.85682	D	0.000000	T	0.42017	0.1184	L	0.49256	1.55	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.989	T	0.13098	-1.0522	10	0.05721	T	0.95	-15.0643	18.5013	0.90882	0.0:0.0:1.0:0.0	.	1612;1604	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	S	1612;1566;1604;53	ENSP00000451998:P1612S;ENSP00000298315:P1566S;ENSP00000370039:P1604S;ENSP00000452030:P53S	ENSP00000298315:P1566S	P	-	1	0	EML5	88161131	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.070000	0.93974	2.612000	0.88384	0.561000	0.74099	CCT	EML5	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000165521		0.458	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	140	0.00	0	G			89091378	89091378	-1	no_errors	ENST00000554922	ensembl	human	known	69_37n	missense	66	37.74	40	SNP	1.000	A
ERCC6	2074	genome.wustl.edu	37	10	50681546	50681546	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:50681546G>A	ENST00000355832.5	-	14	2764	c.2686C>T	c.(2686-2688)Cca>Tca	p.P896S	RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000542458.1_Missense_Mutation_p.P266S	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	896	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GTAATCAGTGGCTGTCTTGAA	0.448								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													387.0	267.0	308.0					10																	50681546		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2686C>T	10.37:g.50681546G>A	ENSP00000348089:p.Pro896Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P896S	ENST00000355832.5	37	c.2686	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041446	0.75732	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	T;T	0.74209	-0.82;-0.82	5.69	5.69	0.88448	Helicase, C-terminal (3);	.	.	.	.	T	0.66538	0.2799	N	0.01576	-0.805	0.80722	D	1	P;B	0.51057	0.941;0.071	P;B	0.60068	0.868;0.127	T	0.72629	-0.4235	9	0.23891	T	0.37	-12.9463	19.8149	0.96562	0.0:0.0:1.0:0.0	.	896;273	Q03468;Q59FF6	ERCC6_HUMAN;.	S	896;273;266	ENSP00000348089:P896S;ENSP00000445134:P266S	ENSP00000348089:P896S	P	-	1	0	ERCC6	50351552	1.000000	0.71417	0.440000	0.26846	0.990000	0.78478	9.869000	0.99810	2.679000	0.91253	0.591000	0.81541	CCA	ERCC6	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000225830		0.448	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	768	0.00	0	G	NM_000124		50681546	50681546	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	missense	490	14.41	83	SNP	1.000	A
FASTKD1	79675	genome.wustl.edu	37	2	170394566	170394566	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:170394566C>G	ENST00000453153.2	-	11	2377	c.2031G>C	c.(2029-2031)caG>caC	p.Q677H	FASTKD1_ENST00000453929.2_Intron|FASTKD1_ENST00000495505.1_5'UTR	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	677					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						ACCATGGAATCTGAAACTCAG	0.333																																						dbGAP											0													166.0	181.0	176.0					2																	170394566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.2031G>C	2.37:g.170394566C>G	ENSP00000400513:p.Gln677His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.Q677H	ENST00000453153.2	37	c.2031	CCDS33318.1	2	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774069	0.49786	.	.	ENSG00000138399	ENST00000453153	T	0.47177	0.85	5.02	2.04	0.26737	FAST kinase-like protein, subdomain 2 (1);	0.164661	0.56097	D	0.000033	T	0.34745	0.0908	L	0.38175	1.15	0.80722	D	1	P	0.42827	0.791	B	0.43155	0.41	T	0.04281	-1.0963	10	0.28530	T	0.3	-24.6238	6.0247	0.19648	0.0:0.5906:0.1569:0.2525	.	677	Q53R41	FAKD1_HUMAN	H	677	ENSP00000400513:Q677H	ENSP00000400513:Q677H	Q	-	3	2	FASTKD1	170102812	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.114000	0.31196	0.712000	0.32039	0.563000	0.77884	CAG	FASTKD1	-	pfam_FAST_2	ENSG00000138399		0.333	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FASTKD1	HGNC	protein_coding	OTTHUMT00000337788.2	155	0.00	0	C	NM_024622		170394566	170394566	-1	no_errors	ENST00000453153	ensembl	human	known	69_37n	missense	226	10.98	28	SNP	0.998	G
FCGR1A	2209	genome.wustl.edu	37	1	149755809	149755809	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:149755809C>G	ENST00000369168.4	+	3	357	c.303C>G	c.(301-303)caC>caG	p.H101Q	HIST2H2BF_ENST00000545683.1_Intron|RP11-196G18.3_ENST00000428289.1_RNA|RP11-196G18.21_ENST00000420462.1_RNA	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	101	Ig-like C2-type 1.|Ig-like C2-type 2.				antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGGAAATCCACAGAGGTAATT	0.512																																						dbGAP											0													31.0	42.0	38.0					1																	149755809		2126	4296	6422	-	-	-	SO:0001583	missense	0			BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.303C>G	1.37:g.149755809C>G	ENSP00000358165:p.His101Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P12315|Q5QNW7|Q92495|Q92663	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.H101Q	ENST00000369168.4	37	c.303	CCDS933.1	1	.	.	.	.	.	.	.	.	.	.	C	6.411	0.443963	0.12164	.	.	ENSG00000150337	ENST00000369168	T	0.02369	4.32	2.47	0.555	0.17247	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.709268	0.12727	N	0.444222	T	0.02119	0.0066	M	0.80982	2.52	0.39324	D	0.9653	P	0.42456	0.78	B	0.41860	0.368	T	0.50524	-0.8818	10	0.51188	T	0.08	.	4.6844	0.12750	0.0:0.6794:0.0:0.3206	.	101	P12314	FCGR1_HUMAN	Q	101	ENSP00000358165:H101Q	ENSP00000358165:H101Q	H	+	3	2	FCGR1A	148022433	0.002000	0.14202	0.227000	0.23927	0.734000	0.41952	0.025000	0.13577	0.150000	0.19136	0.411000	0.27672	CAC	FCGR1A	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000150337		0.512	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGR1A	HGNC	protein_coding	OTTHUMT00000033446.1	272	0.00	0	C	NM_000566		149755809	149755809	+1	no_errors	ENST00000369168	ensembl	human	known	69_37n	missense	214	21.03	57	SNP	0.652	G
FLG2	388698	genome.wustl.edu	37	1	152328814	152328814	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:152328814C>A	ENST00000388718.5	-	3	1520	c.1448G>T	c.(1447-1449)gGg>gTg	p.G483V	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	483	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G483V(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGCCAGACCCATGTTGTCC	0.527																																						dbGAP											1	Substitution - Missense(1)	lung(1)											213.0	211.0	212.0					1																	152328814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1448G>T	1.37:g.152328814C>A	ENSP00000373370:p.Gly483Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.G483V	ENST00000388718.5	37	c.1448	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869009	0.32977	.	.	ENSG00000143520	ENST00000388718	T	0.19938	2.11	4.42	3.5	0.40072	.	.	.	.	.	T	0.22936	0.0554	L	0.54323	1.7	0.09310	N	0.999999	D	0.64830	0.994	D	0.65773	0.938	T	0.03795	-1.1003	9	0.51188	T	0.08	-0.4816	10.1347	0.42699	0.0:0.9009:0.0:0.0991	.	483	Q5D862	FILA2_HUMAN	V	483	ENSP00000373370:G483V	ENSP00000373370:G483V	G	-	2	0	FLG2	150595438	0.000000	0.05858	0.002000	0.10522	0.106000	0.19336	0.154000	0.16343	1.070000	0.40811	0.655000	0.94253	GGG	FLG2	-	NULL	ENSG00000143520		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	678	0.15	1	C	NM_001014342		152328814	152328814	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	387	24.71	127	SNP	0.009	A
FCRL6	343413	genome.wustl.edu	37	1	159785371	159785371	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:159785371G>A	ENST00000368106.3	+	10	1226	c.1225G>A	c.(1225-1227)Gag>Aag	p.E409K	FCRL6_ENST00000392235.3_Silent_p.*312*|FCRL6_ENST00000339348.5_Silent_p.*398*|FCRL6_ENST00000321935.6_Silent_p.*414*	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	409						external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					GCAGCCCAGTGAGGTTTCATC	0.502																																						dbGAP											0													126.0	124.0	125.0					1																	159785371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.1225G>A	1.37:g.159785371G>A	ENSP00000357086:p.Glu409Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E409K	ENST00000368106.3	37	c.1225	CCDS30912.1	1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806318	0.31961	.	.	ENSG00000181036	ENST00000368106	T	0.01152	5.26	3.87	-2.3	0.06785	.	.	.	.	.	T	0.00271	0.0008	N	0.14661	0.345	0.09310	N	1	B	0.24043	0.096	B	0.18263	0.021	T	0.25641	-1.0126	9	0.24483	T	0.36	.	8.5458	0.33421	0.6274:0.0:0.3726:0.0	.	409	Q6DN72	FCRL6_HUMAN	K	409	ENSP00000357086:E409K	ENSP00000357086:E409K	E	+	1	0	FCRL6	158051995	0.000000	0.05858	0.000000	0.03702	0.117000	0.20001	0.100000	0.15231	-0.500000	0.06614	-0.339000	0.08088	GAG	FCRL6	-	NULL	ENSG00000181036		0.502	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL6	HGNC	protein_coding	OTTHUMT00000276853.1	415	0.00	0	G	NM_001004310		159785371	159785371	+1	no_errors	ENST00000368106	ensembl	human	known	69_37n	missense	500	10.85	61	SNP	0.000	A
FSTL4	23105	genome.wustl.edu	37	5	132535018	132535018	+	Silent	SNP	C	C	T	rs112958932		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:132535018C>T	ENST00000265342.7	-	16	2547	c.2298G>A	c.(2296-2298)ctG>ctA	p.L766L	CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	766						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCCCCGTGGACAGCTCCAGGA	0.597																																						dbGAP											0													57.0	55.0	55.0					5																	132535018		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.2298G>A	5.37:g.132535018C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBU0|Q9UPU1	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_HAND_2,pfscan_Ig-like	p.L766	ENST00000265342.7	37	c.2298	CCDS34238.1	5																																																																																			FSTL4	-	NULL	ENSG00000053108		0.597	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	HGNC	protein_coding	OTTHUMT00000370212.1	244	0.81	2	C	XM_048786		132535018	132535018	-1	no_errors	ENST00000265342	ensembl	human	known	69_37n	silent	138	19.77	34	SNP	0.996	T
FUT2	2524	genome.wustl.edu	37	19	49206873	49206873	+	Silent	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:49206873G>A	ENST00000425340.2	+	2	777	c.660G>A	c.(658-660)cgG>cgA	p.R220R	FUT2_ENST00000391876.4_Silent_p.R220R	NM_000511.5|NM_001097638.2	NP_000502.4|NP_001091107.1	Q10981	FUT2_HUMAN	fucosyltransferase 2 (secretor status included)	220					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)	7		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.00011)|all cancers(93;0.000238)|GBM - Glioblastoma multiforme(486;0.0164)|Epithelial(262;0.017)		TGGCCGACCGGCGATACCTAC	0.607																																						dbGAP											0													73.0	75.0	74.0					19																	49206873		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33069.1	19q13.33	2014-07-19			ENSG00000176920	ENSG00000176920		"""Fucosyltransferases"""	4013	protein-coding gene	gene with protein product	"""alpha (1,2) fucosyltransferase"", ""galactoside 2-alpha-L-fucosyltransferase 2"", ""GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 2"", ""alpha(1,2)FT2"", ""secretor factor"", ""secretor blood group alpha-2-fucosyltransferase"""	182100		SE		1763885	Standard	NM_000511		Approved	sej, Se2, SEC2	uc010emc.3	Q10981	OTTHUMG00000164427	ENST00000425340.2:c.660G>A	19.37:g.49206873G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAG5|Q14338|Q5D0G2	Silent	SNP	pfam_Glyco_trans_11	p.R220	ENST00000425340.2	37	c.660	CCDS33069.1	19																																																																																			FUT2	-	pfam_Glyco_trans_11	ENSG00000176920		0.607	FUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT2	HGNC	protein_coding	OTTHUMT00000378731.2	146	0.00	0	G	NM_000511		49206873	49206873	+1	no_errors	ENST00000391876	ensembl	human	known	69_37n	silent	73	15.12	13	SNP	0.000	A
FYCO1	79443	genome.wustl.edu	37	3	46008278	46008278	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr3:46008278C>G	ENST00000296137.2	-	8	2753	c.2548G>C	c.(2548-2550)Gag>Cag	p.E850Q	FYCO1_ENST00000535325.1_Missense_Mutation_p.E850Q	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	850					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CCTTCACGCTCCGAGCATTGC	0.627																																						dbGAP											0													46.0	45.0	45.0					3																	46008278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2548G>C	3.37:g.46008278C>G	ENSP00000296137:p.Glu850Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.E850Q	ENST00000296137.2	37	c.2548	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644157	0.67244	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.29397	1.57;1.59	5.73	5.73	0.89815	.	0.170465	0.52532	D	0.000066	T	0.54351	0.1853	M	0.74258	2.255	0.39241	D	0.963858	D;D	0.69078	0.994;0.997	P;P	0.61275	0.833;0.886	T	0.55927	-0.8063	10	0.48119	T	0.1	-21.8433	18.0789	0.89436	0.0:1.0:0.0:0.0	.	850;850	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	Q	850	ENSP00000296137:E850Q;ENSP00000441178:E850Q	ENSP00000296137:E850Q	E	-	1	0	FYCO1	45983282	0.975000	0.34042	0.085000	0.20634	0.915000	0.54546	2.519000	0.45546	2.713000	0.92767	0.655000	0.94253	GAG	FYCO1	-	NULL	ENSG00000163820		0.627	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	177	0.00	0	C	NM_024513		46008278	46008278	-1	no_errors	ENST00000535325	ensembl	human	known	69_37n	missense	117	13.33	18	SNP	0.949	G
GABBR2	9568	genome.wustl.edu	37	9	101470750	101470750	+	Silent	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:101470750G>A	ENST00000259455.2	-	1	729	c.270C>T	c.(268-270)aaC>aaT	p.N90N		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	90					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GGAGTGACTCGTTGCGGATCT	0.677																																						dbGAP											0													46.0	43.0	44.0					9																	101470750		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.270C>T	9.37:g.101470750G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.N90	ENST00000259455.2	37	c.270	CCDS6736.1	9																																																																																			GABBR2	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B	ENSG00000136928		0.677	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	49	0.00	0	G			101470750	101470750	-1	no_errors	ENST00000259455	ensembl	human	known	69_37n	silent	32	15.79	6	SNP	0.999	A
GALC	2581	genome.wustl.edu	37	14	88406275	88406276	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:88406275_88406276insT	ENST00000261304.2	-	16	1990_1991	c.1884_1885insA	c.(1882-1887)aaatggfs	p.W629fs	GALC_ENST00000393569.2_Frame_Shift_Ins_p.W603fs|GALC_ENST00000393568.4_Frame_Shift_Ins_p.W606fs|GALC_ENST00000544807.2_Frame_Shift_Ins_p.W573fs	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	629					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AGTGTATACCATTTTTTTGCTG	0.307																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.1885dupA	14.37:g.88406282_88406282dupT	ENSP00000261304:p.Trp629fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Frame_Shift_Ins	INS	pfam_Glyco_hydro_59,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_59	p.W628fs	ENST00000261304.2	37	c.1885_1884	CCDS9878.2	14																																																																																			GALC	-	pfam_Glyco_hydro_59	ENSG00000054983		0.307	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALC	HGNC	protein_coding	OTTHUMT00000071559.2	318	0.00	0	-			88406275	88406276	-1	no_errors	ENST00000261304	ensembl	human	known	69_37n	frame_shift_ins	191	18.03	42	INS	0.998:0.261	T
GALNT3	2591	genome.wustl.edu	37	2	166611534	166611534	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:166611534G>A	ENST00000392701.3	-	8	2207	c.1432C>T	c.(1432-1434)Cac>Tac	p.H478Y	GALNT3_ENST00000409882.1_Missense_Mutation_p.H216Y	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	478					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TGAAGGCGGTGTTTTATTTCA	0.328																																						dbGAP											0													64.0	65.0	65.0					2																	166611534		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1432C>T	2.37:g.166611534G>A	ENSP00000376465:p.His478Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TG9|Q7Z476	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.H478Y	ENST00000392701.3	37	c.1432	CCDS2226.1	2	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881198	0.51801	.	.	ENSG00000115339	ENST00000392701;ENST00000409882	T;T	0.29142	1.58;1.58	5.71	3.67	0.42095	.	0.619490	0.18713	N	0.133241	T	0.29783	0.0744	L	0.49778	1.585	0.28489	N	0.914584	B	0.20887	0.049	B	0.25987	0.065	T	0.29549	-1.0008	10	0.87932	D	0	.	10.4049	0.44252	0.0:0.1173:0.6896:0.1931	.	478	Q14435	GALT3_HUMAN	Y	478;216	ENSP00000376465:H478Y;ENSP00000386955:H216Y	ENSP00000376465:H478Y	H	-	1	0	GALNT3	166319780	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	3.038000	0.49783	1.265000	0.44215	0.655000	0.94253	CAC	GALNT3	-	NULL	ENSG00000115339		0.328	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT3	HGNC	protein_coding	OTTHUMT00000255205.2	146	0.68	1	G	NM_004482		166611534	166611534	-1	no_errors	ENST00000392701	ensembl	human	known	69_37n	missense	87	29.27	36	SNP	0.993	A
GIPC1	10755	genome.wustl.edu	37	19	14589304	14589304	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:14589304C>T	ENST00000393033.4	-	9	1195	c.926G>A	c.(925-927)gGt>gAt	p.G309D	GIPC1_ENST00000393029.3_Missense_Mutation_p.G212D|GIPC1_ENST00000345425.2_Missense_Mutation_p.G309D|GIPC1_ENST00000393028.1_Missense_Mutation_p.G212D|GIPC1_ENST00000591349.1_Missense_Mutation_p.G212D|GIPC1_ENST00000586027.1_Missense_Mutation_p.G309D	NM_005716.3	NP_005707.1	O14908	GIPC1_HUMAN	GIPC PDZ domain containing family, member 1	309					endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|glutamate secretion (GO:0014047)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cytokinesis (GO:0032467)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein targeting (GO:0006605)|regulation of protein stability (GO:0031647)|regulation of synaptic plasticity (GO:0048167)|synaptic transmission (GO:0007268)	brush border (GO:0005903)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|myosin binding (GO:0017022)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						GGCAAAGTCACCCAGCCGTTC	0.637																																					Pancreas(33;78 923 2910 41023 52850)	dbGAP											0													36.0	35.0	35.0					19																	14589304		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF089816	CCDS12310.1, CCDS12311.1	19p13.1	2009-09-22	2005-06-28	2005-06-28					1226	protein-coding gene	gene with protein product		605072	"""chromosome 19 open reading frame 3"", ""regulator of G-protein signalling 19 interacting protein 1"""	C19orf3, RGS19IP1		9770488, 9482110	Standard	NM_005716		Approved	TIP-2, Hs.6454, GIPC, SEMCAP, GLUT1CBP, SYNECTIN, NIP	uc002myx.4	O14908		ENST00000393033.4:c.926G>A	19.37:g.14589304C>T	ENSP00000376753:p.Gly309Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4I3|A8MZG3|Q9BTC9	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	p.G309D	ENST00000393033.4	37	c.926	CCDS12310.1	19	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346622	0.61073	.	.	ENSG00000123159	ENST00000393033;ENST00000345425;ENST00000393029;ENST00000393028;ENST00000351277	D;D;D;D	0.86030	-1.52;-1.52;-2.06;-2.06	4.53	4.53	0.55603	.	0.057916	0.64402	D	0.000002	D	0.85890	0.5802	M	0.75264	2.295	0.80722	D	1	P	0.46142	0.873	P	0.44897	0.463	D	0.85460	0.1166	10	0.31617	T	0.26	-3.1991	14.7708	0.69675	0.0:1.0:0.0:0.0	.	309	O14908	GIPC1_HUMAN	D	309;309;212;212;309	ENSP00000376753:G309D;ENSP00000340698:G309D;ENSP00000376749:G212D;ENSP00000376748:G212D	ENSP00000340698:G309D	G	-	2	0	GIPC1	14450304	1.000000	0.71417	0.989000	0.46669	0.429000	0.31625	5.517000	0.67061	2.072000	0.62099	0.561000	0.74099	GGT	GIPC1	-	pirsf_UCP038083_PDZ	ENSG00000123159		0.637	GIPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIPC1	HGNC	protein_coding	OTTHUMT00000460239.2	96	0.00	0	C			14589304	14589304	-1	no_errors	ENST00000345425	ensembl	human	known	69_37n	missense	52	20.90	14	SNP	0.998	T
GNL2	29889	genome.wustl.edu	37	1	38040001	38040001	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:38040001C>A	ENST00000373062.3	-	12	1457	c.1359G>T	c.(1357-1359)agG>agT	p.R453S		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	453					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				GAATCCGGCCCCTCTGCCAGT	0.552																																						dbGAP											0													52.0	49.0	50.0					1																	38040001		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1359G>T	1.37:g.38040001C>A	ENSP00000362153:p.Arg453Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWN7	Missense_Mutation	SNP	pfam_NOG2_N_dom,pfam_GTP_binding_domain,prints_GTP_binding_domain	p.R453S	ENST00000373062.3	37	c.1359	CCDS421.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235461	0.79800	.	.	ENSG00000134697	ENST00000373062	T	0.54279	0.58	5.97	2.77	0.32553	GTP-binding protein, orthogonal bundle domain (1);	0.000000	0.85682	D	0.000000	T	0.59335	0.2186	L	0.41961	1.31	0.80722	D	1	D	0.71674	0.998	D	0.67900	0.954	T	0.54944	-0.8217	10	0.48119	T	0.1	-28.1557	9.373	0.38266	0.0:0.7433:0.0:0.2567	.	453	Q13823	NOG2_HUMAN	S	453	ENSP00000362153:R453S	ENSP00000362153:R453S	R	-	3	2	GNL2	37812588	0.991000	0.36638	1.000000	0.80357	0.999000	0.98932	0.361000	0.20267	0.274000	0.22072	0.655000	0.94253	AGG	GNL2	-	NULL	ENSG00000134697		0.552	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL2	HGNC	protein_coding	OTTHUMT00000012478.1	144	0.69	1	C	NM_013285		38040001	38040001	-1	no_errors	ENST00000373062	ensembl	human	known	69_37n	missense	103	26.95	38	SNP	1.000	A
GPR179	440435	genome.wustl.edu	37	17	36487341	36487341	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:36487341A>T	ENST00000342292.4	-	11	2131	c.2111T>A	c.(2110-2112)cTg>cAg	p.L704Q	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	704					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTTCTTGGGCAGGTGGGGGTT	0.627																																						dbGAP											0													51.0	57.0	55.0					17																	36487341		1986	4169	6155	-	-	-	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.2111T>A	17.37:g.36487341A>T	ENSP00000345060:p.Leu704Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.L704Q	ENST00000342292.4	37	c.2111	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	A	20.2	3.945315	0.73672	.	.	ENSG00000188888	ENST00000342292	T	0.70282	-0.47	5.26	5.26	0.73747	.	0.000000	0.49305	D	0.000153	D	0.83243	0.5212	M	0.76574	2.34	0.45995	D	0.998808	D	0.89917	1.0	D	0.91635	0.999	D	0.85458	0.1165	10	0.87932	D	0	-11.0902	14.2902	0.66273	1.0:0.0:0.0:0.0	.	704	Q6PRD1	GP179_HUMAN	Q	704	ENSP00000345060:L704Q	ENSP00000345060:L704Q	L	-	2	0	GPR179	33740867	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	8.568000	0.90741	2.201000	0.70794	0.533000	0.62120	CTG	GPR179	-	NULL	ENSG00000188888		0.627	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	208	0.00	0	A			36487341	36487341	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	missense	147	13.02	22	SNP	1.000	T
GRAMD1B	57476	genome.wustl.edu	37	11	123476187	123476187	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:123476187G>A	ENST00000529750.1	+	9	1221		c.e9+1		GRAMD1B_ENST00000322282.7_Splice_Site|GRAMD1B_ENST00000456860.2_Splice_Site|GRAMD1B_ENST00000450171.2_5'Flank	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B							integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CCCCGTCTCGGTATGGGCAGT	0.562																																						dbGAP											0													128.0	133.0	131.0					11																	123476187		2064	4190	6254	-	-	-	SO:0001630	splice_region_variant	0			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.894+1G>A	11.37:g.123476187G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW85|Q9ULL9	Splice_Site	SNP	-	e9+1	ENST00000529750.1	37	c.894+1	CCDS53720.1	11	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045765	0.75846	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5435	0.84408	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRAMD1B	122981397	1.000000	0.71417	0.997000	0.53966	0.844000	0.47949	8.100000	0.89544	2.340000	0.79590	0.305000	0.20034	.	GRAMD1B	-	-	ENSG00000023171		0.562	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	404	0.00	0	G	XM_370660	Intron	123476187	123476187	+1	no_errors	ENST00000322282	ensembl	human	known	69_37n	splice_site	290	23.16	88	SNP	1.000	A
GRIN2A	2903	genome.wustl.edu	37	16	9862753	9862753	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:9862753C>T	ENST00000396573.2	-	13	2859	c.2550G>A	c.(2548-2550)acG>acA	p.T850T	GRIN2A_ENST00000396575.2_Silent_p.T850T|GRIN2A_ENST00000562109.1_Silent_p.T850T|GRIN2A_ENST00000330684.3_Silent_p.T850T|GRIN2A_ENST00000404927.2_Silent_p.T850T|GRIN2A_ENST00000535259.1_Silent_p.T693T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	850					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T850T(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGCACACGCCCGTGAAACAGA	0.577																																						dbGAP											1	Substitution - coding silent(1)	prostate(1)											86.0	85.0	86.0					16																	9862753		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2550G>A	16.37:g.9862753C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00669|Q17RZ6	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T850	ENST00000396573.2	37	c.2550	CCDS10539.1	16																																																																																			GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.577	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	187	0.00	0	C			9862753	9862753	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	silent	82	33.60	42	SNP	0.082	T
GSTA2	2939	genome.wustl.edu	37	6	52616434	52616434	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:52616434G>A	ENST00000493422.1	-	6	642	c.487C>T	c.(487-489)Ctt>Ttt	p.L163F		NM_000846.4	NP_000837.3	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	163	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Chloroquine(DB00608)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Vitamin E(DB00163)	TAGTAGAGAAGTTCCACCAGG	0.507																																						dbGAP											0													166.0	144.0	151.0					6																	52616434		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL109918	CCDS4944.1	6p12.2	2012-06-21	2008-11-26		ENSG00000244067	ENSG00000244067	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4627	protein-coding gene	gene with protein product		138360	"""glutathione S-transferase A2"""	GST2			Standard	NM_000846		Approved		uc003pay.3	P09210	OTTHUMG00000016263	ENST00000493422.1:c.487C>T	6.37:g.52616434G>A	ENSP00000420168:p.Leu163Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q12759|Q16491|Q9NTY6	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_alpha	p.L163F	ENST00000493422.1	37	c.487	CCDS4944.1	6	.	.	.	.	.	.	.	.	.	.	g	7.913	0.736845	0.15574	.	.	ENSG00000244067	ENST00000493422	T	0.02085	4.46	2.88	0.66	0.17868	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.465309	0.23554	N	0.046929	T	0.02342	0.0072	M	0.66939	2.045	0.23776	N	0.99687	P	0.43314	0.803	P	0.58620	0.842	T	0.41627	-0.9498	10	0.12766	T	0.61	.	9.6791	0.40059	0.0:0.5932:0.4068:0.0	.	163	P09210	GSTA2_HUMAN	F	163	ENSP00000420168:L163F	ENSP00000420168:L163F	L	-	1	0	GSTA2	52724393	0.501000	0.26099	0.982000	0.44146	0.442000	0.32017	-0.202000	0.09451	0.509000	0.28195	0.485000	0.47835	CTT	GSTA2	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000244067		0.507	GSTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTA2	HGNC	protein_coding	OTTHUMT00000043589.1	492	0.00	0	G	NM_000846		52616434	52616434	-1	no_errors	ENST00000493422	ensembl	human	known	69_37n	missense	455	14.42	77	SNP	0.906	A
HAP1	9001	genome.wustl.edu	37	17	39889034	39889034	+	Silent	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:39889034T>C	ENST00000310778.5	-	2	495	c.486A>G	c.(484-486)ctA>ctG	p.L162L	HAP1_ENST00000393939.2_Silent_p.L162L|HAP1_ENST00000347901.4_Silent_p.L162L|RN7SL399P_ENST00000471648.2_RNA|JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Silent_p.L162L			P54257	HAP1_HUMAN	huntingtin-associated protein 1	162	HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CTGGCGGAGGTAGGTTAGGAC	0.532																																						dbGAP											0													119.0	102.0	108.0					17																	39889034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.486A>G	17.37:g.39889034T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Silent	SNP	pfam_HAP1_N	p.L162	ENST00000310778.5	37	c.486		17																																																																																			HAP1	-	pfam_HAP1_N	ENSG00000173805		0.532	HAP1-006	KNOWN	basic|appris_principal	protein_coding	HAP1	HGNC	protein_coding	OTTHUMT00000389619.1	248	0.00	0	T	NM_003949		39889034	39889034	-1	no_errors	ENST00000310778	ensembl	human	known	69_37n	silent	238	16.51	53	SNP	0.019	C
HDAC6	10013	genome.wustl.edu	37	X	48661392	48661392	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chrX:48661392G>A	ENST00000334136.5	+	3	386	c.208G>A	c.(208-210)Gga>Aga	p.G70R	HDAC6_ENST00000469223.1_3'UTR|HDAC6_ENST00000376619.2_Missense_Mutation_p.G70R|HDAC6_ENST00000413163.2_Missense_Mutation_p.G15R|HDAC6_ENST00000444343.2_Missense_Mutation_p.G84R			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	70					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	CCTAATCGTGGGACTGCAAGG	0.532																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													66.0	53.0	58.0					X																	48661392		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.208G>A	X.37:g.48661392G>A	ENSP00000334061:p.Gly70Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.G84R	ENST00000334136.5	37	c.250	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331628	0.24167	.	.	ENSG00000094631	ENST00000423941;ENST00000376643;ENST00000444343;ENST00000376610;ENST00000334136;ENST00000376619;ENST00000436813;ENST00000413163;ENST00000441703;ENST00000426196;ENST00000443563;ENST00000440653	T;T;T;T	0.63580	0.26;0.27;0.27;-0.05	4.42	4.42	0.53409	.	0.511418	0.20088	N	0.099502	T	0.64249	0.2581	L	0.29908	0.895	0.09310	N	0.999999	P;P;P;D	0.62365	0.915;0.65;0.915;0.991	B;B;B;D	0.63877	0.294;0.186;0.294;0.919	T	0.54569	-0.8274	10	0.16896	T	0.51	-16.85	13.6369	0.62227	0.0:0.0:1.0:0.0	.	60;15;70;70	B4DZN1;E7EUZ1;Q9UBN7;Q9BRX7	.;.;HDAC6_HUMAN;.	R	70;70;84;70;70;70;70;15;70;70;70;70	ENSP00000398566:G84R;ENSP00000334061:G70R;ENSP00000365804:G70R;ENSP00000398801:G15R	ENSP00000334061:G70R	G	+	1	0	HDAC6	48546336	0.275000	0.24201	0.401000	0.26359	0.057000	0.15508	2.183000	0.42565	2.176000	0.68965	0.600000	0.82982	GGA	HDAC6	-	NULL	ENSG00000094631		0.532	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	203	0.49	1	G	NM_006044		48661392	48661392	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	missense	221	12.94	33	SNP	0.196	A
HEG1	57493	genome.wustl.edu	37	3	124731512	124731512	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr3:124731512G>A	ENST00000311127.4	-	6	2978	c.2911C>T	c.(2911-2913)Cag>Tag	p.Q971*	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	971					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GTGCTGCTCTGAACAGCAAAG	0.527																																						dbGAP											0													93.0	105.0	101.0					3																	124731512		2098	4250	6348	-	-	-	SO:0001587	stop_gained	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2911C>T	3.37:g.124731512G>A	ENSP00000311502:p.Gln971*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX66|Q8NC40|Q9BSV0	Nonsense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.Q971*	ENST00000311127.4	37	c.2911	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.701389	0.98441	.	.	ENSG00000173706	ENST00000311127	.	.	.	4.22	3.33	0.38152	.	0.999564	0.08090	U	0.999530	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	5.2487	0.15510	0.1168:0.2459:0.6373:0.0	.	.	.	.	X	971	.	ENSP00000311502:Q971X	Q	-	1	0	HEG1	126214202	0.007000	0.16637	0.009000	0.14445	0.692000	0.40212	1.222000	0.32515	1.338000	0.45544	0.655000	0.94253	CAG	HEG1	-	NULL	ENSG00000173706		0.527	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	446	0.22	1	G	XM_087386		124731512	124731512	-1	no_errors	ENST00000311127	ensembl	human	known	69_37n	nonsense	250	19.35	60	SNP	0.007	A
HIST1H2BC	8347	genome.wustl.edu	37	6	26123825	26123825	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:26123825A>G	ENST00000314332.5	-	1	313	c.308T>C	c.(307-309)cTt>cCt	p.L103P	HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.L103P|HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	103					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						CTCTCCGGGAAGCAGCAGGCG	0.602																																						dbGAP											0													77.0	80.0	79.0					6																	26123825		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.308T>C	6.37:g.26123825A>G	ENSP00000321744:p.Leu103Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.L103P	ENST00000314332.5	37	c.308	CCDS4584.1	6	.	.	.	.	.	.	.	.	.	.	.	19.29	3.798980	0.70567	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.52983	0.64;0.64	5.61	5.61	0.85477	Histone-fold (2);	0.000000	0.32852	U	0.005578	T	0.42108	0.1188	.	.	.	0.58432	D	0.999999	P	0.44195	0.828	P	0.45856	0.495	T	0.49570	-0.8926	9	0.87932	D	0	.	15.2833	0.73806	1.0:0.0:0.0:0.0	.	103	P62807	H2B1C_HUMAN	P	103	ENSP00000321744:L103P;ENSP00000380180:L103P	ENSP00000321744:L103P	L	-	2	0	HIST1H2BC	26231804	1.000000	0.71417	1.000000	0.80357	0.240000	0.25518	9.208000	0.95075	2.259000	0.74868	0.528000	0.53228	CTT	HIST1H2BC	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000180596		0.602	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	380	0.00	0	A	NM_003526		26123825	26123825	-1	no_errors	ENST00000314332	ensembl	human	known	69_37n	missense	289	12.87	43	SNP	1.000	G
HLA-A	3105	genome.wustl.edu	37	6	29910336	29910336	+	Silent	SNP	C	C	T	rs113772324	byFrequency	TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:29910336C>T	ENST00000396634.1	+	3	347	c.6C>T	c.(4-6)gcC>gcT	p.A2A	HLA-A_ENST00000376802.2_Silent_p.A2A|HLA-A_ENST00000376809.5_Silent_p.A2A|HLA-A_ENST00000376806.5_Silent_p.A2A			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	2					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CGAGGATGGCCGTCATGGCGC	0.672									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												dbGAP											0													36.0	38.0	37.0					6																	29910336		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.6C>T	6.37:g.29910336C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.A2	ENST00000396634.1	37	c.6	CCDS34373.1	6																																																																																			HLA-A	-	NULL	ENSG00000206503		0.672	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	40	0.00	0	C	NM_002116		29910336	29910336	+1	no_errors	ENST00000376806	ensembl	human	known	69_37n	silent	29	18.92	7	SNP	0.000	T
HMCN1	83872	genome.wustl.edu	37	1	186014823	186014823	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:186014823C>T	ENST00000271588.4	+	41	6537	c.6308C>T	c.(6307-6309)cCg>cTg	p.P2103L	HMCN1_ENST00000367492.2_Missense_Mutation_p.P2103L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2103					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.P2103L(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CATGTAGTTCCGCCAAATATT	0.388																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											112.0	100.0	104.0					1																	186014823		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6308C>T	1.37:g.186014823C>T	ENSP00000271588:p.Pro2103Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.P2103L	ENST00000271588.4	37	c.6308	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278725	0.80692	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.51574	0.7;0.7	5.35	4.44	0.53790	Immunoglobulin-like fold (1);	0.099034	0.64402	D	0.000001	T	0.51007	0.1649	M	0.88775	2.98	0.80722	D	1	P	0.42692	0.787	B	0.30782	0.12	T	0.63989	-0.6512	10	0.54805	T	0.06	.	15.4358	0.75146	0.1401:0.8599:0.0:0.0	.	2103	Q96RW7	HMCN1_HUMAN	L	2103	ENSP00000271588:P2103L;ENSP00000356462:P2103L	ENSP00000271588:P2103L	P	+	2	0	HMCN1	184281446	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	7.294000	0.78760	1.239000	0.43787	0.650000	0.86243	CCG	HMCN1	-	smart_Ig_V-set_subgr	ENSG00000143341		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	298	0.67	2	C	NM_031935		186014823	186014823	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	325	18.14	72	SNP	1.000	T
HRH2	3274	genome.wustl.edu	37	5	175110861	175110861	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:175110861G>A	ENST00000231683.2	+	1	2398	c.625G>A	c.(625-627)Gcc>Acc	p.A209T	HRH2_ENST00000377291.2_Missense_Mutation_p.A209T	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	209					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	CTTCAAGGTCGCCCGGGATCA	0.577																																						dbGAP											0													75.0	69.0	71.0					5																	175110861		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.625G>A	5.37:g.175110861G>A	ENSP00000231683:p.Ala209Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Histamine_H2_recept,prints_7TM_GPCR_Rhodpsn,prints_5HT6_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.A209T	ENST00000231683.2	37	c.625	CCDS4395.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.135249	0.94517	.	.	ENSG00000113749	ENST00000377291;ENST00000231683	T;T	0.38240	1.15;1.15	5.19	5.19	0.71726	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.64068	0.2565	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.69367	-0.5164	10	0.87932	D	0	.	17.7162	0.88337	0.0:0.0:1.0:0.0	.	209;209	P25021;Q7Z5R9	HRH2_HUMAN;.	T	209	ENSP00000366506:A209T;ENSP00000231683:A209T	ENSP00000231683:A209T	A	+	1	0	HRH2	175043467	1.000000	0.71417	0.993000	0.49108	0.898000	0.52572	9.869000	0.99810	2.428000	0.82296	0.455000	0.32223	GCC	HRH2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_5HT6_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000113749		0.577	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH2	HGNC	protein_coding	OTTHUMT00000253151.1	158	0.62	1	G			175110861	175110861	+1	no_errors	ENST00000377291	ensembl	human	known	69_37n	missense	181	14.22	30	SNP	1.000	A
HRH4	59340	genome.wustl.edu	37	18	22056805	22056805	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr18:22056805T>C	ENST00000256906.4	+	3	552	c.452T>C	c.(451-453)aTt>aCt	p.I151T	HRH4_ENST00000426880.2_Intron	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	151					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	GGGCCAATGATTCTAGTTTCA	0.433																																						dbGAP											0													227.0	209.0	215.0					18																	22056805		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.452T>C	18.37:g.22056805T>C	ENSP00000256906:p.Ile151Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Histamine_H4_recept,prints_7TM_GPCR_Rhodpsn	p.I151T	ENST00000256906.4	37	c.452	CCDS11887.1	18	.	.	.	.	.	.	.	.	.	.	T	21.4	4.146039	0.77888	.	.	ENSG00000134489	ENST00000256906	T	0.37235	1.21	5.67	5.67	0.87782	GPCR, rhodopsin-like superfamily (1);	0.056815	0.64402	D	0.000002	T	0.62696	0.2449	M	0.81682	2.555	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.68062	-0.5508	10	0.87932	D	0	-25.532	15.0965	0.72238	0.0:0.0:0.0:1.0	.	151	Q9H3N8	HRH4_HUMAN	T	151	ENSP00000256906:I151T	ENSP00000256906:I151T	I	+	2	0	HRH4	20310803	1.000000	0.71417	0.871000	0.34182	0.679000	0.39708	7.463000	0.80869	2.163000	0.67991	0.533000	0.62120	ATT	HRH4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000134489		0.433	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH4	HGNC	protein_coding	OTTHUMT00000254904.1	679	0.00	0	T			22056805	22056805	+1	no_errors	ENST00000256906	ensembl	human	known	69_37n	missense	520	27.34	196	SNP	1.000	C
HUWE1	10075	genome.wustl.edu	37	X	53617397	53617397	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chrX:53617397A>T	ENST00000342160.3	-	34	4615	c.4158T>A	c.(4156-4158)gaT>gaA	p.D1386E	HUWE1_ENST00000262854.6_Missense_Mutation_p.D1386E|HUWE1_ENST00000218328.8_Missense_Mutation_p.D1386E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1386					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CCATTGGAATATCCTGTCCCA	0.438																																						dbGAP											0													199.0	163.0	175.0					X																	53617397		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.4158T>A	X.37:g.53617397A>T	ENSP00000340648:p.Asp1386Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.D1386E	ENST00000342160.3	37	c.4158	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.98|13.98	2.397755|2.397755	0.42512|0.42512	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328|ENST00000427052	T;T;T|.	0.42513|.	1.28;1.28;0.97|.	5.93|5.93	3.53|3.53	0.40419|0.40419	Armadillo-like helical (1);|.	0.113891|.	0.64402|.	D|.	0.000017|.	T|T	0.30541|0.30541	0.0768|0.0768	N|N	0.12182|0.12182	0.205|0.205	0.33385|0.33385	D|D	0.575304|0.575304	B;B|.	0.16603|.	0.01;0.018|.	B;B|.	0.22880|.	0.012;0.042|.	T|T	0.39292|0.39292	-0.9621|-0.9621	10|5	0.52906|.	T|.	0.07|.	.|.	9.2052|9.2052	0.37285|0.37285	0.8443:0.0:0.1557:0.0|0.8443:0.0:0.1557:0.0	.|.	1386;1386|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	E|N	1386|420	ENSP00000340648:D1386E;ENSP00000262854:D1386E;ENSP00000218328:D1386E|.	ENSP00000218328:D1386E|.	D|Y	-|-	3|1	2|0	HUWE1|HUWE1	53634122|53634122	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.965000|0.965000	0.29319|0.29319	0.863000|0.863000	0.35553|0.35553	0.486000|0.486000	0.48141|0.48141	GAT|TAT	HUWE1	-	NULL	ENSG00000086758		0.438	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	483	0.00	0	A	XM_497119		53617397	53617397	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	363	18.39	82	SNP	1.000	T
IFNB1	3456	genome.wustl.edu	37	9	21077514	21077514	+	Silent	SNP	G	G	A	rs545301798		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:21077514G>A	ENST00000380232.2	-	1	429	c.355C>T	c.(355-357)Ctg>Ttg	p.L119L		NM_002176.2	NP_002167.1	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast	119					adaptive immune response (GO:0002250)|B cell activation involved in immune response (GO:0002312)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of viral genome replication (GO:0045071)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	12				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)		ACTGTCTTCAGATGGTTTATC	0.413																																						dbGAP											0													178.0	181.0	180.0					9																	21077514		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6495.1	9p22	2008-07-21			ENSG00000171855	ENSG00000171855		"""Interferons"""	5434	protein-coding gene	gene with protein product		147640		IFNB			Standard	NM_002176		Approved	IFB, IFF	uc003zok.3	P01574	OTTHUMG00000019652	ENST00000380232.2:c.355C>T	9.37:g.21077514G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWC9	Silent	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.L119	ENST00000380232.2	37	c.355	CCDS6495.1	9																																																																																			IFNB1	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000171855		0.413	IFNB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNB1	HGNC	protein_coding	OTTHUMT00000051881.1	410	0.00	0	G	NM_002176		21077514	21077514	-1	no_errors	ENST00000380232	ensembl	human	known	69_37n	silent	242	12.95	36	SNP	0.966	A
IGHV3-48	28424	genome.wustl.edu	37	14	106994221	106994221	+	RNA	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:106994221C>A	ENST00000390624.2	-	0	125									immunoglobulin heavy variable 3-48																		CCATGAATCACCTTCTAAAAT	0.448																																						dbGAP											0													208.0	195.0	199.0					14																	106994221		1913	4135	6048	-	-	-			0			M99675		14q32.33	2012-02-08			ENSG00000211964	ENSG00000211964		"""Immunoglobulins / IGH locus"""	5606	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151959		14.37:g.106994221C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e1+1	ENST00000390624.2	37	c.46+1		14																																																																																			IGHV3-48	-	-	ENSG00000211964		0.448	IGHV3-48-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-48	HGNC	IG_V_gene	OTTHUMT00000324605.1	840	0.12	1	C	NG_001019		106994221	106994221	-1	no_stop_codon	ENST00000390624	ensembl	human	known	69_37n	splice_site	440	20.29	112	SNP	0.033	A
IKBKB	3551	genome.wustl.edu	37	8	42171889	42171889	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr8:42171889G>T	ENST00000520810.1	+	9	928	c.742G>T	c.(742-744)Gac>Tac	p.D248Y	IKBKB_ENST00000520835.1_Missense_Mutation_p.D246Y|IKBKB_ENST00000416505.2_Missense_Mutation_p.D189Y|IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000379708.3_Missense_Mutation_p.D25Y	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	248	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TGTTAGCGAAGACTTGAATGG	0.443																																						dbGAP											0													298.0	258.0	272.0					8																	42171889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.742G>T	8.37:g.42171889G>T	ENSP00000430684:p.Asp248Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ubiquitin_supergroup,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D248Y	ENST00000520810.1	37	c.742	CCDS6128.1	8	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518544	0.85495	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.66099	-0.19;-0.19;-0.19;2.79	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043608	0.85682	D	0.000000	T	0.80297	0.4597	M	0.70108	2.13	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.992;1.0;1.0	D;D;D;D;D;D	0.91635	0.993;0.987;0.999;0.962;0.989;0.987	T	0.80535	-0.1339	10	0.87932	D	0	.	20.3854	0.98941	0.0:0.0:1.0:0.0	.	189;246;25;199;248;248	B4E0U4;O14920-2;B3KRB7;Q59GL9;O14920;Q32ND9	.;.;.;.;IKKB_HUMAN;.	Y	248;189;246;25	ENSP00000430684:D248Y;ENSP00000404920:D189Y;ENSP00000430868:D246Y;ENSP00000369030:D25Y	ENSP00000369030:D25Y	D	+	1	0	IKBKB	42291046	1.000000	0.71417	0.995000	0.50966	0.893000	0.52053	6.250000	0.72435	2.825000	0.97269	0.655000	0.94253	GAC	IKBKB	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000104365		0.443	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKB	HGNC	protein_coding	OTTHUMT00000377214.1	673	0.00	0	G			42171889	42171889	+1	no_errors	ENST00000520810	ensembl	human	known	69_37n	missense	661	13.01	99	SNP	1.000	T
INTS1	26173	genome.wustl.edu	37	7	1527563	1527563	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr7:1527563C>T	ENST00000404767.3	-	19	2434	c.2349G>A	c.(2347-2349)acG>acA	p.T783T	INTS1_ENST00000389470.4_Silent_p.T911T	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	783					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TCTCCTCATCCGTCAGGGTGC	0.677																																						dbGAP											0													113.0	126.0	122.0					7																	1527563		2111	4224	6335	-	-	-	SO:0001819	synonymous_variant	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.2349G>A	7.37:g.1527563C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Silent	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.T911	ENST00000404767.3	37	c.2733	CCDS47526.1	7																																																																																			INTS1	-	NULL	ENSG00000164880		0.677	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	198	0.00	0	C			1527563	1527563	-1	no_errors	ENST00000389470	ensembl	human	known	69_37n	silent	146	11.45	19	SNP	1.000	T
ITGA9	3680	genome.wustl.edu	37	3	37778446	37778446	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr3:37778446G>A	ENST00000264741.5	+	20	2462	c.2206G>A	c.(2206-2208)Gtt>Att	p.V736I		NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	736					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GGAAGAGGAAGTTCTCAGCTT	0.433																																						dbGAP											0													114.0	111.0	112.0					3																	37778446		2203	4300	6503	-	-	-	SO:0001583	missense	0			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.2206G>A	3.37:g.37778446G>A	ENSP00000264741:p.Val736Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14638	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.V736I	ENST00000264741.5	37	c.2206	CCDS2669.1	3	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788725	0.31685	.	.	ENSG00000144668	ENST00000264741	T	0.44083	0.93	5.51	-1.12	0.09808	Integrin alpha-2 (1);	0.505405	0.21231	N	0.077971	T	0.11281	0.0275	N	0.01352	-0.895	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.14282	-1.0478	10	0.35671	T	0.21	.	1.0998	0.01681	0.3819:0.28:0.1961:0.142	.	736	Q13797	ITA9_HUMAN	I	736	ENSP00000264741:V736I	ENSP00000264741:V736I	V	+	1	0	ITGA9	37753450	0.001000	0.12720	0.059000	0.19551	0.989000	0.77384	0.065000	0.14466	-0.044000	0.13491	0.561000	0.74099	GTT	ITGA9	-	pfam_Integrin_alpha-2	ENSG00000144668		0.433	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA9	HGNC	protein_coding	OTTHUMT00000253361.1	434	0.00	0	G	NM_002207		37778446	37778446	+1	no_errors	ENST00000264741	ensembl	human	known	69_37n	missense	329	16.50	65	SNP	0.003	A
ITM2A	9452	genome.wustl.edu	37	X	78616643	78616643	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chrX:78616643C>T	ENST00000373298.2	-	6	878	c.735G>A	c.(733-735)tgG>tgA	p.W245*	ITM2A_ENST00000434584.2_Nonsense_Mutation_p.W201*|ITM2A_ENST00000469541.1_5'UTR	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A	245						integral component of membrane (GO:0016021)		p.W245C(1)		breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						GTCTAATCTTCCAGCATTTAT	0.363																																						dbGAP											1	Substitution - Missense(1)	lung(1)											65.0	52.0	56.0					X																	78616643		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.735G>A	X.37:g.78616643C>T	ENSP00000362395:p.Trp245*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7X5|B4E062|Q6IBC9	Nonsense_Mutation	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.W245*	ENST00000373298.2	37	c.735	CCDS14444.1	X	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276479	0.80580	.	.	ENSG00000078596	ENST00000373298;ENST00000434584	.	.	.	4.5	1.45	0.22620	.	0.501648	0.19042	N	0.124259	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-19.6862	7.0566	0.25104	0.0:0.3992:0.4928:0.108	.	.	.	.	X	245;201	.	ENSP00000362395:W245X	W	-	3	0	ITM2A	78503299	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	0.443000	0.21644	0.670000	0.31165	0.513000	0.50165	TGG	ITM2A	-	NULL	ENSG00000078596		0.363	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITM2A	HGNC	protein_coding	OTTHUMT00000057329.1	142	0.00	0	C	NM_004867		78616643	78616643	-1	no_errors	ENST00000373298	ensembl	human	known	69_37n	nonsense	120	11.76	16	SNP	0.995	T
KCNK3	3777	genome.wustl.edu	37	2	26950777	26950777	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:26950777G>A	ENST00000302909.3	+	2	651	c.526G>A	c.(526-528)Gcc>Acc	p.A176T		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	176					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	CATCGGCGCCGCCGCCTTCTC	0.632																																					GBM(80;1457 1631 27100 45946)	dbGAP											0													60.0	54.0	56.0					2																	26950777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.526G>A	2.37:g.26950777G>A	ENSP00000306275:p.Ala176Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SU2	Missense_Mutation	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TASK1,prints_2pore_dom_K_chnl	p.A176T	ENST00000302909.3	37	c.526	CCDS1727.1	2	.	.	.	.	.	.	.	.	.	.	g	21.4	4.138259	0.77775	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.24723	1.84	5.26	5.26	0.73747	Ion transport 2 (1);	0.240513	0.40818	N	0.001008	T	0.39655	0.1086	M	0.69248	2.105	0.48762	D	0.999706	P	0.46784	0.884	P	0.49226	0.603	T	0.19844	-1.0293	10	0.54805	T	0.06	.	16.7244	0.85417	0.0:0.0:1.0:0.0	.	176	O14649	KCNK3_HUMAN	T	53;176	ENSP00000306275:A176T	ENSP00000306275:A176T	A	+	1	0	KCNK3	26804281	1.000000	0.71417	0.990000	0.47175	0.899000	0.52679	5.161000	0.64935	2.616000	0.88540	0.556000	0.70494	GCC	KCNK3	-	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK	ENSG00000171303		0.632	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK3	HGNC	protein_coding	OTTHUMT00000246861.2	109	0.00	0	G	NM_002246		26950777	26950777	+1	no_errors	ENST00000302909	ensembl	human	known	69_37n	missense	63	14.67	11	SNP	0.991	A
KCNQ2	3785	genome.wustl.edu	37	20	62070997	62070997	+	Missense_Mutation	SNP	G	G	T	rs118192211		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr20:62070997G>T	ENST00000359125.2	-	6	1055	c.881C>A	c.(880-882)gCg>gAg	p.A294E	KCNQ2_ENST00000360480.3_Missense_Mutation_p.A294E|KCNQ2_ENST00000354587.3_Missense_Mutation_p.A294E|KCNQ2_ENST00000357249.2_Missense_Mutation_p.A294E|KCNQ2_ENST00000344425.5_Missense_Mutation_p.A294E|KCNQ2_ENST00000344462.4_Missense_Mutation_p.A294E|KCNQ2_ENST00000370224.1_Missense_Mutation_p.A294E|KCNQ2_ENST00000359689.1_Missense_Mutation_p.A294E	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	294					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.A294V(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GAAGGTTGCCGCAAGGAGCCT	0.627																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)	GRCh37	CM073161	KCNQ2	M	rs118192211						216.0	159.0	178.0					20																	62070997		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.881C>A	20.37:g.62070997G>T	ENSP00000352035:p.Ala294Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.A294E	ENST00000359125.2	37	c.881	CCDS13520.1	20	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757979	0.49468	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.98617	-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03	4.01	4.01	0.46588	Ion transport (1);	0.142257	0.46145	D	0.000306	D	0.99321	0.9762	M	0.93420	3.415	0.58432	D	0.999999	D;D;D;D;D;D	0.76494	0.999;0.965;0.998;0.997;0.997;0.998	D;P;D;D;D;D	0.80764	0.994;0.898;0.953;0.953;0.953;0.972	D	0.98693	1.0697	10	0.87932	D	0	-13.0776	16.4798	0.84155	0.0:0.0:1.0:0.0	.	294;294;294;294;294;294	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	E	294	ENSP00000349789:A294E;ENSP00000352035:A294E;ENSP00000359246:A294E;ENSP00000346601:A294E;ENSP00000352718:A294E;ENSP00000399612:A294E;ENSP00000353668:A294E;ENSP00000339611:A294E;ENSP00000359244:A294E;ENSP00000359242:A294E;ENSP00000359241:A294E;ENSP00000345523:A294E	ENSP00000345523:A294E	A	-	2	0	KCNQ2	61541441	1.000000	0.71417	0.569000	0.28460	0.117000	0.20001	5.273000	0.65564	1.908000	0.55244	0.561000	0.74099	GCG	KCNQ2	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl	ENSG00000075043		0.627	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	KCNQ2	HGNC	protein_coding	OTTHUMT00000080353.1	132	0.75	1	G	NM_172109		62070997	62070997	-1	no_errors	ENST00000354587	ensembl	human	known	69_37n	missense	124	40.48	85	SNP	0.989	T
KCTD21	283219	genome.wustl.edu	37	11	77885303	77885303	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:77885303C>A	ENST00000340067.3	-	2	576	c.298G>T	c.(298-300)Gaa>Taa	p.E100*	KCTD21-AS1_ENST00000530261.1_RNA|KCTD21-AS1_ENST00000528468.1_RNA|KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000600795.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	100					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			AGCTCCACTTCCTTCTCCTGC	0.607																																						dbGAP											0													99.0	79.0	86.0					11																	77885303		2200	4292	6492	-	-	-	SO:0001587	stop_gained	0			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.298G>T	11.37:g.77885303C>A	ENSP00000339340:p.Glu100*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTR0	Nonsense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.E100*	ENST00000340067.3	37	c.298	CCDS31645.1	11	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361862	0.82353	.	.	ENSG00000188997	ENST00000340067;ENST00000526208;ENST00000525447;ENST00000529350	.	.	.	6.03	6.03	0.97812	.	0.000000	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	X	100	.	ENSP00000339340:E100X	E	-	1	0	KCTD21	77562951	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	2.255000	0.43222	2.861000	0.98227	0.655000	0.94253	GAA	KCTD21	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000188997		0.607	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD21	HGNC	protein_coding	OTTHUMT00000390057.1	287	0.35	1	C	NM_001029859		77885303	77885303	-1	no_errors	ENST00000340067	ensembl	human	known	69_37n	nonsense	252	13.40	39	SNP	1.000	A
ZSWIM8	23053	genome.wustl.edu	37	10	75561184	75561184	+	Silent	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:75561184G>A	ENST00000605216.1	+	26	5638	c.5421G>A	c.(5419-5421)caG>caA	p.Q1807Q	ZSWIM8_ENST00000398706.2_Silent_p.Q1812Q|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000603114.1_Silent_p.Q1766Q|ZSWIM8_ENST00000604524.1_Silent_p.Q1625Q|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604729.1_Silent_p.Q1804Q	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1807							zinc ion binding (GO:0008270)										GCATGATGCAGTTCAACGACA	0.582																																						dbGAP											0													79.0	85.0	83.0					10																	75561184		2163	4263	6426	-	-	-	SO:0001819	synonymous_variant	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.5421G>A	10.37:g.75561184G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	NULL	p.S1082N	ENST00000605216.1	37	c.3245		10	.	.	.	.	.	.	.	.	.	.	G	4.353	0.065021	0.08388	.	.	ENSG00000214655	ENST00000412198	.	.	.	5.99	5.08	0.68730	.	.	.	.	.	T	0.70561	0.3238	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68002	-0.5524	4	.	.	.	-0.1124	14.6556	0.68831	0.0689:0.0:0.9311:0.0	.	.	.	.	N	1082	.	.	S	+	2	0	KIAA0913	75231190	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.978000	0.88095	2.840000	0.97914	0.655000	0.94253	AGT	KIAA0913	-	NULL	ENSG00000214655		0.582	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	201	0.00	0	G	NM_001242487		75561184	75561184	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000412198	ensembl	human	known	69_37n	missense	142	20.99	38	SNP	1.000	A
KIAA1614	57710	genome.wustl.edu	37	1	180885366	180885366	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:180885366C>G	ENST00000367588.4	+	2	182	c.127C>G	c.(127-129)Cag>Gag	p.Q43E		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	43										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						TCCTGAGCCACAGCTGGATAA	0.612																																						dbGAP											0													26.0	31.0	29.0					1																	180885366		1940	4123	6063	-	-	-	SO:0001583	missense	0			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.127C>G	1.37:g.180885366C>G	ENSP00000356560:p.Gln43Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	NULL	p.Q43E	ENST00000367588.4	37	c.127	CCDS41442.1	1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120292	0.37436	.	.	ENSG00000135835	ENST00000367588	T	0.06849	3.25	4.67	4.67	0.58626	.	0.251962	0.20860	N	0.084366	T	0.12433	0.0302	N	0.24115	0.695	0.80722	D	1	D	0.58268	0.982	P	0.55615	0.78	T	0.12941	-1.0528	10	0.34782	T	0.22	-3.9989	14.6205	0.68582	0.0:1.0:0.0:0.0	.	43	Q5VZ46	K1614_HUMAN	E	43	ENSP00000356560:Q43E	ENSP00000356560:Q43E	Q	+	1	0	KIAA1614	179151989	0.003000	0.15002	0.349000	0.25694	0.087000	0.18053	1.470000	0.35354	2.419000	0.82065	0.563000	0.77884	CAG	KIAA1614	-	NULL	ENSG00000135835		0.612	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	HGNC	protein_coding	OTTHUMT00000085151.1	68	0.00	0	C	XM_046531		180885366	180885366	+1	no_errors	ENST00000367588	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	0.182	G
KIF20B	9585	genome.wustl.edu	37	10	91498778	91498779	+	Frame_Shift_Ins	INS	-	-	A	rs372651065		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:91498778_91498779insA	ENST00000371728.3	+	21	3905_3906	c.3840_3841insA	c.(3841-3843)aagfs	p.K1281fs	KIF20B_ENST00000394289.2_Frame_Shift_Ins_p.K1281fs|KIF20B_ENST00000260753.4_Frame_Shift_Ins_p.K1241fs|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000416354.1_Frame_Shift_Ins_p.K1311fs	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1281					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						ATCTTCAGAGGAAGGAAGAAGA	0.391																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3842dupA	10.37:g.91498780_91498780dupA	ENSP00000360793:p.Lys1281fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Frame_Shift_Ins	INS	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1311fs	ENST00000371728.3	37	c.3930_3931		10																																																																																			KIF20B	-	NULL	ENSG00000138182		0.391	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	215	0.00	0	-	NM_016195		91498778	91498779	+1	no_errors	ENST00000416354	ensembl	human	known	69_37n	frame_shift_ins	323	17.81	70	INS	1.000:1.000	A
KIF3A	11127	genome.wustl.edu	37	5	132038596	132038596	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:132038596C>A	ENST00000378746.4	-	11	1765	c.1547G>T	c.(1546-1548)aGa>aTa	p.R516I	KIF3A_ENST00000378735.1_Missense_Mutation_p.R519I|KIF3A_ENST00000403231.1_Missense_Mutation_p.R543I|AC004237.1_ENST00000431165.1_RNA|KIF3A_ENST00000487055.1_5'UTR	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	516					anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)			endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTCAAGTTCTCTGCGAAGTTG	0.383																																						dbGAP											0													224.0	222.0	223.0					5																	132038596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1547G>T	5.37:g.132038596C>A	ENSP00000368020:p.Arg516Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R519I	ENST00000378746.4	37	c.1556	CCDS34235.1	5	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249910	0.39797	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000450441;ENST00000403231	T;T;T;T	0.09911	2.94;2.94;2.93;2.94	6.17	1.23	0.21249	.	0.311136	0.41001	D	0.000963	T	0.12135	0.0295	L	0.60455	1.87	0.50313	D	0.999868	B;B;B;B	0.26258	0.145;0.145;0.145;0.145	B;B;B;B	0.28709	0.093;0.093;0.093;0.093	T	0.06661	-1.0814	10	0.56958	D	0.05	.	10.1665	0.42884	0.0:0.4905:0.0:0.5094	.	543;543;516;542	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	I	516;519;543;44;543	ENSP00000368020:R516I;ENSP00000368009:R519I;ENSP00000405619:R44I;ENSP00000385808:R543I	ENSP00000368009:R519I	R	-	2	0	KIF3A	132066495	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	0.724000	0.25954	-0.060000	0.13132	-0.150000	0.13652	AGA	KIF3A	-	NULL	ENSG00000131437		0.383	KIF3A-001	KNOWN	basic|CCDS	protein_coding	KIF3A	HGNC	protein_coding	OTTHUMT00000132788.3	564	0.00	0	C	NM_007054		132038596	132038596	-1	no_errors	ENST00000378735	ensembl	human	known	69_37n	missense	431	16.31	84	SNP	0.997	A
KIFC1	3833	genome.wustl.edu	37	6	33371093	33371093	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:33371093C>G	ENST00000428849.2	+	4	703	c.253C>G	c.(253-255)Caa>Gaa	p.Q85E	KIFC1_ENST00000486695.1_3'UTR	NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	85					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						CTGGGCAGCTCAAAAAGTTTC	0.483																																						dbGAP											0													95.0	100.0	98.0					6																	33371093		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.253C>G	6.37:g.33371093C>G	ENSP00000393963:p.Gln85Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q85E	ENST00000428849.2	37	c.253	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922032	0.52653	.	.	ENSG00000237649	ENST00000428849;ENST00000450504	T	0.73469	-0.75	5.11	5.11	0.69529	.	0.496995	0.20357	N	0.093924	T	0.42200	0.1192	L	0.29908	0.895	0.34858	D	0.742301	B;B	0.19817	0.039;0.039	B;B	0.16722	0.016;0.016	T	0.12578	-1.0542	10	0.06099	T	0.92	-12.9043	13.8991	0.63792	0.0:1.0:0.0:0.0	.	85;85	B4E063;Q9BW19	.;KIFC1_HUMAN	E	85;126	ENSP00000393963:Q85E	ENSP00000393963:Q85E	Q	+	1	0	KIFC1	33479071	0.947000	0.32204	0.998000	0.56505	0.924000	0.55760	3.311000	0.51919	2.660000	0.90430	0.563000	0.77884	CAA	KIFC1	-	NULL	ENSG00000237649		0.483	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	199	0.00	0	C	NM_002263		33371093	33371093	+1	no_errors	ENST00000428849	ensembl	human	known	69_37n	missense	243	12.27	34	SNP	0.998	G
KRT82	3888	genome.wustl.edu	37	12	52800015	52800016	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:52800015_52800016delCT	ENST00000257974.2	-	1	123_124	c.46_47delAG	c.(46-48)agtfs	p.S16fs	RP11-1020M18.10_ENST00000548135.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	16	Head.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		TGAGCTGAAACTCTGACTGCCA	0.624																																						dbGAP											0										0,4262		0,0,2131						-2.7	0.9		dbSNP_131	34	1,8253		0,1,4126	no	frameshift	KRT82	NM_033033.3		0,1,6257	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12515				-	-	-	SO:0001589	frameshift_variant	0			Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.46_47delAG	12.37:g.52800017_52800018delCT	ENSP00000257974:p.Ser16fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_F,prints_Keratin_II,prints_Keratin_I	p.S16fs	ENST00000257974.2	37	c.47_46	CCDS8826.1	12																																																																																			KRT82	-	NULL	ENSG00000161850		0.624	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT82	HGNC	protein_coding	OTTHUMT00000405189.1	74	0.00	0	CT	NM_033033		52800015	52800016	-1	no_errors	ENST00000257974	ensembl	human	known	69_37n	frame_shift_del	74	28.57	30	DEL	0.355:0.086	-
KRTAP10-4	386672	genome.wustl.edu	37	21	45993856	45993856	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr21:45993856C>T	ENST00000400374.3	+	1	251	c.221C>T	c.(220-222)cCc>cTc	p.P74L	TSPEAR_ENST00000397916.1_5'Flank|TSPEAR_ENST00000323084.4_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	74	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						ACCTGCGAGCCCAGCCCCTGC	0.711																																						dbGAP											0													19.0	36.0	30.0					21																	45993856		1989	4189	6178	-	-	-	SO:0001583	missense	0			AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.221C>T	21.37:g.45993856C>T	ENSP00000383225:p.Pro74Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AS0	Missense_Mutation	SNP	NULL	p.P74L	ENST00000400374.3	37	c.221	CCDS42957.1	21	.	.	.	.	.	.	.	.	.	.	N	3.103	-0.184252	0.06340	.	.	ENSG00000215454	ENST00000400374;ENST00000334871	T	0.01025	5.43	1.33	1.33	0.21861	.	.	.	.	.	T	0.01730	0.0055	M	0.83118	2.625	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.38023	-0.9680	9	0.66056	D	0.02	.	4.2322	0.10608	0.0:0.747:0.0:0.253	.	74	P60372	KR104_HUMAN	L	74;63	ENSP00000383225:P74L	ENSP00000333987:P63L	P	+	2	0	KRTAP10-4	44818284	0.010000	0.17322	0.219000	0.23793	0.200000	0.23975	0.001000	0.13038	0.646000	0.30693	0.298000	0.19748	CCC	KRTAP10-4	-	NULL	ENSG00000215454		0.711	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-4	HGNC	protein_coding	OTTHUMT00000128045.1	187	0.00	0	C	NM_198687		45993856	45993856	+1	no_errors	ENST00000400374	ensembl	human	known	69_37n	missense	77	17.20	16	SNP	0.124	T
KRTAP17-1	83902	genome.wustl.edu	37	17	39471833	39471833	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:39471833A>G	ENST00000334202.3	-	1	114	c.70T>C	c.(70-72)Tgt>Cgt	p.C24R		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	24						intermediate filament (GO:0005882)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CCCGGCTGACAGCAGCACTCT	0.687																																						dbGAP											0													17.0	20.0	19.0					17																	39471833		2195	4290	6485	-	-	-	SO:0001583	missense	0			AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.70T>C	17.37:g.39471833A>G	ENSP00000333993:p.Cys24Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C24R	ENST00000334202.3	37	c.70	CCDS11387.1	17	.	.	.	.	.	.	.	.	.	.	A	10.37	1.330218	0.24167	.	.	ENSG00000186860	ENST00000334202	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.55033	0.1895	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.59364	-0.7468	8	0.87932	D	0	-17.9362	9.6839	0.40087	1.0:0.0:0.0:0.0	.	24	Q9BYP8	KR171_HUMAN	R	24	.	ENSP00000333993:C24R	C	-	1	0	KRTAP17-1	36725359	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.830000	0.55768	1.782000	0.52362	0.379000	0.24179	TGT	KRTAP17-1	-	NULL	ENSG00000186860		0.687	KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP17-1	HGNC	protein_coding	OTTHUMT00000257296.1	58	0.00	0	A			39471833	39471833	-1	no_errors	ENST00000334202	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	1.000	G
LAMB2	3913	genome.wustl.edu	37	3	49166019	49166019	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr3:49166019C>T	ENST00000418109.1	-	16	2055		c.e16-1		LAMB2_ENST00000305544.4_Splice_Site|LAMB2_ENST00000464891.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)						astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCTCAGGGACCTGGGAAAACG	0.582																																						dbGAP											0													85.0	79.0	81.0					3																	49166019		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1891-1G>A	3.37:g.49166019C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16321	Splice_Site	SNP	-	e15-1	ENST00000418109.1	37	c.1891-1	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222665	0.58668	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6854	0.77405	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMB2	49141023	1.000000	0.71417	0.985000	0.45067	0.755000	0.42902	6.794000	0.75135	2.275000	0.75901	0.655000	0.94253	.	LAMB2	-	-	ENSG00000172037		0.582	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	134	0.00	0	C	NM_002292	Intron	49166019	49166019	-1	no_errors	ENST00000305544	ensembl	human	known	69_37n	splice_site	38	32.14	18	SNP	1.000	T
LEKR1	389170	genome.wustl.edu	37	3	156547155	156547155	+	5'UTR	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr3:156547155G>C	ENST00000470811.1	+	0	151				LEKR1_ENST00000498839.1_Missense_Mutation_p.E13Q|LEKR1_ENST00000489350.1_3'UTR|LEKR1_ENST00000356539.4_Missense_Mutation_p.E13Q|LEKR1_ENST00000477399.1_Missense_Mutation_p.E13Q|LEKR1_ENST00000491763.1_Missense_Mutation_p.E13Q|LEKR1_ENST00000483177.1_Missense_Mutation_p.E13Q			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1											breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GTTGCCTGAAGAAATCCAAAA	0.378																																						dbGAP											0													114.0	96.0	102.0					3																	156547155		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.-1185G>C	3.37:g.156547155G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Ribosomal_L29	p.E13Q	ENST00000470811.1	37	c.37		3	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841437	0.71488	.	.	ENSG00000197980;ENSG00000197980;ENSG00000197980;ENSG00000178110	ENST00000498839;ENST00000483177;ENST00000477399;ENST00000356539	T	0.58652	0.32	4.86	4.86	0.63082	.	.	.	.	.	T	0.65196	0.2668	L	0.50333	1.59	0.21579	N	0.999637	D	0.61080	0.989	P	0.55455	0.776	T	0.58418	-0.7640	9	0.62326	D	0.03	-4.0694	13.3772	0.60745	0.0:0.0:1.0:0.0	.	13	D3DNK7	.	Q	13	ENSP00000348936:E13Q	ENSP00000348936:E13Q	E	+	1	0	RP11-6F2.7;LEKR1	158029849	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.471000	0.60182	2.528000	0.85240	0.591000	0.81541	GAA	LEKR1	-	NULL	ENSG00000178110		0.378	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	HGNC	protein_coding	OTTHUMT00000351625.3	336	0.00	0	G	NM_001004316		156547155	156547155	+1	no_errors	ENST00000356539	ensembl	human	known	69_37n	missense	258	16.18	50	SNP	1.000	C
LGALS13	29124	genome.wustl.edu	37	19	40095264	40095264	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:40095264C>G	ENST00000221797.4	+	2	83	c.38C>G	c.(37-39)tCt>tGt	p.S13C		NM_013268.2	NP_037400.1	Q9UHV8	PP13_HUMAN	lectin, galactoside-binding, soluble, 13	13	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)			lung(5)|ovary(1)|urinary_tract(1)	7	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			CTGCCTGTGTCTTTGTCTGTT	0.488																																						dbGAP											0													178.0	149.0	159.0					19																	40095264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117383	CCDS33024.1	19q13.2	2014-03-19	2008-07-25		ENSG00000105198	ENSG00000105198		"""Lectins, galactoside-binding"""	15449	protein-coding gene	gene with protein product	"""galectin 13"""	608717				6856484, 10527825	Standard	NM_013268		Approved	PP13, PLAC8	uc002omb.3	Q9UHV8	OTTHUMG00000183073	ENST00000221797.4:c.38C>G	19.37:g.40095264C>G	ENSP00000221797:p.Ser13Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	C5HZ15	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.S13C	ENST00000221797.4	37	c.38	CCDS33024.1	19	.	.	.	.	.	.	.	.	.	.	.	10.70	1.423409	0.25639	.	.	ENSG00000105198	ENST00000221797	T	0.18502	2.21	0.817	0.817	0.18773	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.36963	0.0986	M	0.82132	2.575	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.07947	-1.0746	9	0.62326	D	0.03	.	4.9365	0.13943	0.0:1.0:0.0:0.0	.	13	Q9UHV8	PP13_HUMAN	C	13	ENSP00000221797:S13C	ENSP00000221797:S13C	S	+	2	0	LGALS13	44787104	0.001000	0.12720	0.044000	0.18714	0.106000	0.19336	0.194000	0.17135	0.710000	0.31997	0.313000	0.20887	TCT	LGALS13	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	ENSG00000105198		0.488	LGALS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS13	HGNC	protein_coding	OTTHUMT00000464968.1	506	0.00	0	C	NM_013268		40095264	40095264	+1	no_errors	ENST00000221797	ensembl	human	known	69_37n	missense	391	16.45	77	SNP	0.065	G
LHX2	9355	genome.wustl.edu	37	9	126776287	126776288	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:126776287_126776288insA	ENST00000373615.4	+	2	907_908	c.168_169insA	c.(169-171)gggfs	p.G57fs	RP11-85O21.4_ENST00000421041.1_RNA	NM_004789.3	NP_004780.3	P50458	LHX2_HUMAN	LIM homeobox 2	57	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|cerebral cortex development (GO:0021987)|dorsal/ventral pattern formation (GO:0009953)|mesoderm development (GO:0007498)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural tube closure (GO:0001843)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|retina development in camera-type eye (GO:0060041)|telencephalon regionalization (GO:0021978)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)	10						GCGCCGGCTGCGGGGGCAAGAT	0.678																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U11701	CCDS6853.1	9q33.3	2011-06-20			ENSG00000106689	ENSG00000106689		"""Homeoboxes / LIM class"""	6594	protein-coding gene	gene with protein product		603759				8649822, 10051612	Standard	NM_004789		Approved	LH-2, hLhx2	uc004boe.1	P50458	OTTHUMG00000020647	Exception_encountered	9.37:g.126776287_126776288insA	ENSP00000362717:p.Gly57fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O95860|Q52M57|Q8N1Z3	Frame_Shift_Ins	INS	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.G56fs	ENST00000373615.4	37	c.168_169	CCDS6853.1	9																																																																																			LHX2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000106689		0.678	LHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX2	HGNC	protein_coding	OTTHUMT00000054010.2	42	0.00	0	-			126776287	126776288	+1	no_errors	ENST00000373615	ensembl	human	known	69_37n	frame_shift_ins	25	21.88	7	INS	0.995:1.000	A
LIPA	3988	genome.wustl.edu	37	10	90986702	90986702	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:90986702G>A	ENST00000336233.5	-	5	810	c.488C>T	c.(487-489)aCt>aTt	p.T163I	LIPA_ENST00000456827.1_Missense_Mutation_p.T163I|LIPA_ENST00000371837.1_Missense_Mutation_p.T107I			P38571	LICH_HUMAN	lipase A, lysosomal acid, cholesterol esterase	163					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cytokine production (GO:0001816)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|lung development (GO:0030324)|tissue remodeling (GO:0048771)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	lipase activity (GO:0016298)|sterol esterase activity (GO:0004771)			endometrium(1)|large_intestine(2)|lung(3)	6		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		TTCTTGGCCAGTTTTATTCAG	0.338																																						dbGAP											0													171.0	159.0	163.0					10																	90986702		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74775	CCDS7401.1, CCDS73160.1	10q23.2-q23.3	2012-07-13	2008-08-01		ENSG00000107798	ENSG00000107798	3.1.1.13		6617	protein-coding gene	gene with protein product	"""Wolman disease"""	613497				8432549	Standard	NM_000235		Approved	LAL, CESD	uc009xtq.3	P38571	OTTHUMG00000018716	ENST00000336233.5:c.488C>T	10.37:g.90986702G>A	ENSP00000337354:p.Thr163Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBH5|D3DR29|Q16529|Q53H21|Q5T074|Q5T771|Q96EJ0	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_AB_hydrolase_lipase	p.T165I	ENST00000336233.5	37	c.494	CCDS7401.1	10	.	.	.	.	.	.	.	.	.	.	G	24.7	4.563268	0.86335	.	.	ENSG00000107798	ENST00000336233;ENST00000371837;ENST00000371829;ENST00000541980;ENST00000354621;ENST00000456827;ENST00000425287;ENST00000428800;ENST00000282673	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	4.72	4.72	0.59763	Alpha/beta hydrolase fold-1 (1);	0.135888	0.64402	D	0.000003	D	0.86740	0.6005	H	0.97758	4.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.90963	0.4814	10	0.87932	D	0	-28.4857	17.9549	0.89065	0.0:0.0:1.0:0.0	.	165;107;163	E7EUT7;P38571-2;P38571	.;.;LICH_HUMAN	I	163;107;163;163;121;163;165;163;163	ENSP00000337354:T163I;ENSP00000360903:T107I;ENSP00000413019:T163I;ENSP00000388415:T163I;ENSP00000282673:T163I	ENSP00000282673:T163I	T	-	2	0	LIPA	90976682	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.155000	0.77445	2.906000	0.99361	0.655000	0.94253	ACT	LIPA	-	pfam_AB_hydrolase_1	ENSG00000107798		0.338	LIPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPA	HGNC	protein_coding	OTTHUMT00000049308.1	404	0.00	0	G	NM_000235		90986702	90986702	-1	no_errors	ENST00000425287	ensembl	human	known	69_37n	missense	335	15.62	62	SNP	1.000	A
LPAR5	57121	genome.wustl.edu	37	12	6730247	6730247	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:6730247C>T	ENST00000329858.4	-	2	924	c.168G>A	c.(166-168)gtG>gtA	p.V56V	LPAR5_ENST00000431922.1_Silent_p.V56V|LPAR5_ENST00000540335.1_5'UTR	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						ACACGCTCACCACCGAGTGCA	0.657																																					NSCLC(74;891 2312 37538)	dbGAP											0													55.0	46.0	49.0					12																	6730247		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.168G>A	12.37:g.6730247C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.V56	ENST00000329858.4	37	c.168	CCDS8553.1	12																																																																																			LPAR5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184574		0.657	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR5	HGNC	protein_coding	OTTHUMT00000400699.1	260	0.00	0	C	NM_020400		6730247	6730247	-1	no_errors	ENST00000329858	ensembl	human	known	69_37n	silent	190	13.64	30	SNP	0.985	T
LPIN1	23175	genome.wustl.edu	37	2	11911547	11911547	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:11911547C>T	ENST00000256720.2	+	4	431	c.338C>T	c.(337-339)gCt>gTt	p.A113V	LPIN1_ENST00000396099.1_Missense_Mutation_p.A119V|LPIN1_ENST00000425416.2_Missense_Mutation_p.A119V|LPIN1_ENST00000449576.2_Missense_Mutation_p.A162V|LPIN1_ENST00000396098.1_Missense_Mutation_p.A119V	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	113					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TCAGAAGGAGCTTCGAGAATG	0.532																																						dbGAP											0													60.0	64.0	63.0					2																	11911547		2203	4300	6503	-	-	-	SO:0001583	missense	0			D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.338C>T	2.37:g.11911547C>T	ENSP00000256720:p.Ala113Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,superfamily_WD40_repeat_dom,smart_LNS2	p.A162V	ENST00000256720.2	37	c.485	CCDS1682.1	2	.	.	.	.	.	.	.	.	.	.	C	8.704	0.910490	0.17833	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720	T;D;T;T;T	0.88896	-1.42;-2.44;-1.41;-1.42;-1.41	5.8	4.02	0.46733	.	0.382752	0.32106	N	0.006574	T	0.80341	0.4605	N	0.14661	0.345	0.22601	N	0.998943	B;B;B	0.17852	0.004;0.003;0.024	B;B;B	0.27608	0.008;0.009;0.081	T	0.66160	-0.5993	10	0.28530	T	0.3	-14.4612	12.5267	0.56089	0.0:0.8766:0.0:0.1234	.	162;113;119	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	V	162;119;119;119;113	ENSP00000397908:A162V;ENSP00000379405:A119V;ENSP00000379406:A119V;ENSP00000401522:A119V;ENSP00000256720:A113V	ENSP00000256720:A113V	A	+	2	0	LPIN1	11828998	0.755000	0.28372	0.105000	0.21289	0.364000	0.29643	1.876000	0.39588	0.813000	0.34350	0.655000	0.94253	GCT	LPIN1	-	NULL	ENSG00000134324		0.532	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN1	HGNC	protein_coding	OTTHUMT00000239296.3	166	0.00	0	C	NM_145693		11911547	11911547	+1	no_errors	ENST00000449576	ensembl	human	known	69_37n	missense	128	20.99	34	SNP	0.041	T
LRIT2	340745	genome.wustl.edu	37	10	85982013	85982013	+	Missense_Mutation	SNP	G	G	T	rs182815603	byFrequency	TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:85982013G>T	ENST00000372113.4	-	3	1321	c.1316C>A	c.(1315-1317)cCt>cAt	p.P439H	LRIT2_ENST00000538192.1_Missense_Mutation_p.P449H	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	439	Fibronectin type-III.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						CTGGTGTGGAGGCTGGCCCTC	0.557																																						dbGAP											0													103.0	101.0	101.0					10																	85982013		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1316C>A	10.37:g.85982013G>T	ENSP00000361185:p.Pro439His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZME6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P449H	ENST00000372113.4	37	c.1346	CCDS31234.1	10	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001424	0.35320	.	.	ENSG00000204033	ENST00000372113;ENST00000538192	T;T	0.18502	2.21;2.21	4.75	3.82	0.43975	Fibronectin, type III (1);	0.238513	0.42964	D	0.000624	T	0.28896	0.0717	M	0.69823	2.125	0.37670	D	0.923104	D;D	0.76494	0.999;0.999	P;P	0.59703	0.862;0.862	T	0.20174	-1.0283	10	0.30854	T	0.27	.	4.5364	0.12037	0.1744:0.0:0.6386:0.187	.	449;439	B7ZME6;A6NDA9	.;LRIT2_HUMAN	H	439;449	ENSP00000361185:P439H;ENSP00000438264:P449H	ENSP00000361185:P439H	P	-	2	0	LRIT2	85971993	0.997000	0.39634	0.187000	0.23214	0.160000	0.22226	2.491000	0.45303	1.086000	0.41228	0.563000	0.77884	CCT	LRIT2	-	NULL	ENSG00000204033		0.557	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT2	HGNC	protein_coding	OTTHUMT00000049110.4	134	0.74	1	G	XM_291697		85982013	85982013	-1	no_errors	ENST00000538192	ensembl	human	known	69_37n	missense	91	15.74	17	SNP	0.904	T
LSM5	23658	genome.wustl.edu	37	7	32528913	32528913	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr7:32528913C>T	ENST00000450169.2	-	2	142	c.90G>A	c.(88-90)atG>atA	p.M30I	LSM5_ENST00000409987.1_Missense_Mutation_p.M30I|LSM5_ENST00000409952.3_Start_Codon_SNP_p.M1I|LSM5_ENST00000410044.1_Start_Codon_SNP_p.M1I|LSM5_ENST00000409909.3_Start_Codon_SNP_p.M1I|LSM5_ENST00000409292.1_Start_Codon_SNP_p.M1I|LSM5_ENST00000409782.1_Start_Codon_SNP_p.M1I	NM_001130710.1|NM_012322.2	NP_001124182.1|NP_036454.1	Q9Y4Y9	LSM5_HUMAN	LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)	30					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			breast(1)|cervix(1)|large_intestine(1)|lung(1)|stomach(1)	5			GBM - Glioblastoma multiforme(11;0.152)			TATCACTCTTCATCACGATGT	0.328																																						dbGAP											0													111.0	101.0	104.0					7																	32528913		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF182291	CCDS5438.1, CCDS47571.1	7p14.3	2003-02-17			ENSG00000106355	ENSG00000106355			17162	protein-coding gene	gene with protein product		607285				10369684, 12515382	Standard	NM_001130710		Approved	YER146W	uc003tct.2	Q9Y4Y9	OTTHUMG00000022913	ENST00000450169.2:c.90G>A	7.37:g.32528913C>T	ENSP00000410758:p.Met30Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.M30I	ENST00000450169.2	37	c.90	CCDS5438.1	7	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102732	0.76983	.	.	ENSG00000106355	ENST00000450169;ENST00000409909;ENST00000409292;ENST00000410044;ENST00000409987;ENST00000409782;ENST00000409952	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.79	4.9	0.64082	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.45054	0.1323	.	.	.	0.80722	D	1	P	0.42584	0.784	B	0.43701	0.428	T	0.49244	-0.8960	9	0.87932	D	0	-9.4299	14.9204	0.70832	0.0:0.9294:0.0:0.0706	.	30	Q9Y4Y9	LSM5_HUMAN	I	30;1;1;1;30;1;1	ENSP00000410758:M30I;ENSP00000386363:M1I;ENSP00000386814:M1I;ENSP00000386707:M1I;ENSP00000386275:M30I;ENSP00000387109:M1I;ENSP00000387126:M1I	ENSP00000386814:M1I	M	-	3	0	LSM5	32495438	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.752000	0.68728	2.718000	0.92993	0.655000	0.94253	ATG	LSM5	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000106355		0.328	LSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM5	HGNC	protein_coding	OTTHUMT00000215102.2	183	0.00	0	C			32528913	32528913	-1	no_errors	ENST00000450169	ensembl	human	known	69_37n	missense	252	14.81	44	SNP	1.000	T
LSM6	11157	genome.wustl.edu	37	4	147104112	147104112	+	Silent	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr4:147104112G>A	ENST00000502781.1	+	2	758	c.39G>A	c.(37-39)aaG>aaA	p.K13K	LSM6_ENST00000296581.5_Silent_p.K13K|LSM6_ENST00000503982.1_3'UTR			P62312	LSM6_HUMAN	LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)	13					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)|tRNA processing (GO:0008033)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)					all_hematologic(180;0.151)					ACTTCTTAAAGCAAATCATCG	0.333																																					Ovarian(181;1591 2748 12147 31551)	dbGAP											0													105.0	112.0	110.0					4																	147104112		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF182292	CCDS3767.1	4q31.21	2008-02-05				ENSG00000164167			17017	protein-coding gene	gene with protein product		607286				10369684, 10523320	Standard	NM_007080		Approved	YDR378C	uc003ikq.4	P62312		ENST00000502781.1:c.39G>A	4.37:g.147104112G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5J5|Q9Y4Y8	Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.K13	ENST00000502781.1	37	c.39	CCDS3767.1	4																																																																																			LSM6	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000164167		0.333	LSM6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LSM6	HGNC	protein_coding	OTTHUMT00000364929.1	248	0.00	0	G			147104112	147104112	+1	no_errors	ENST00000296581	ensembl	human	known	69_37n	silent	221	14.67	38	SNP	1.000	A
MAN1A2	10905	genome.wustl.edu	37	1	118003225	118003225	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:118003225C>G	ENST00000356554.3	+	7	1800	c.1065C>G	c.(1063-1065)taC>taG	p.Y355*		NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	355					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		ACCTGACTTACTACAAAAAGG	0.413																																					Ovarian(33;199 881 8228 13687 31538)	dbGAP											0													168.0	156.0	160.0					1																	118003225		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.1065C>G	1.37:g.118003225C>G	ENSP00000348959:p.Tyr355*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H510	Nonsense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.Y355*	ENST00000356554.3	37	c.1065	CCDS895.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	44|44	11.040408|11.040408	0.99507|0.99507	.|.	.|.	ENSG00000198162|ENSG00000198162	ENST00000449370|ENST00000356554;ENST00000369450	.|.	.|.	.|.	5.09|5.09	4.16|4.16	0.48862|0.48862	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.09202|.	0.0227|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.13548|.	-1.0505|.	3|.	.|0.02654	.|T	.|1	-7.2079|-7.2079	8.2405|8.2405	0.31658|0.31658	0.0:0.8173:0.0:0.1827|0.0:0.8173:0.0:0.1827	.|.	.|.	.|.	.|.	S|X	88|355;119	.|.	.|ENSP00000348959:Y355X	T|Y	+|+	2|3	0|2	MAN1A2|MAN1A2	117804748|117804748	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	1.617000|1.617000	0.36943|0.36943	2.354000|2.354000	0.79902|0.79902	0.655000|0.655000	0.94253|0.94253	ACT|TAC	MAN1A2	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47	ENSG00000198162		0.413	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A2	HGNC	protein_coding	OTTHUMT00000033593.1	432	0.00	0	C	NM_006699		118003225	118003225	+1	no_errors	ENST00000356554	ensembl	human	known	69_37n	nonsense	365	11.62	48	SNP	1.000	G
MBL2	4153	genome.wustl.edu	37	10	54528028	54528028	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:54528028T>G	ENST00000373968.3	-	4	680	c.616A>C	c.(616-618)Aca>Cca	p.T206P		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	206	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						TTCCAGTTTGTGTAGGTCAGT	0.483																																						dbGAP											0													377.0	337.0	351.0					10																	54528028		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.616A>C	10.37:g.54528028T>G	ENSP00000363079:p.Thr206Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.T206P	ENST00000373968.3	37	c.616	CCDS7247.1	10	.	.	.	.	.	.	.	.	.	.	T	16.37	3.103846	0.56291	.	.	ENSG00000165471	ENST00000373968	T	0.20200	2.09	4.73	-7.3	0.01446	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	2.059270	0.02141	N	0.057214	T	0.41351	0.1155	M	0.90650	3.135	0.09310	N	1	P	0.46987	0.888	P	0.55112	0.769	T	0.59752	-0.7395	10	0.72032	D	0.01	0.3292	4.7592	0.13099	0.098:0.1463:0.5193:0.2364	.	206	P11226	MBL2_HUMAN	P	206	ENSP00000363079:T206P	ENSP00000363079:T206P	T	-	1	0	MBL2	54198034	0.001000	0.12720	0.000000	0.03702	0.019000	0.09904	-0.587000	0.05780	-1.314000	0.02300	-0.438000	0.05819	ACA	MBL2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000165471		0.483	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBL2	HGNC	protein_coding	OTTHUMT00000048115.1	498	0.20	1	T	NM_000242		54528028	54528028	-1	no_errors	ENST00000373968	ensembl	human	known	69_37n	missense	308	18.73	71	SNP	0.000	G
MBTPS2	51360	genome.wustl.edu	37	X	21886678	21886678	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chrX:21886678G>C	ENST00000379484.5	+	6	863	c.764G>C	c.(763-765)gGg>gCg	p.G255A	MBTPS2_ENST00000365779.2_Missense_Mutation_p.G255A	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	255					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						ACTGGAGTTGGGGTGCTCATC	0.398																																						dbGAP											0													242.0	220.0	227.0					X																	21886678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.764G>C	X.37:g.21886678G>C	ENSP00000368798:p.Gly255Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UM70|Q9UMD3	Missense_Mutation	SNP	pfam_Peptidase_M50,superfamily_PDZ,prints_Pept_M50_SREBP	p.G255A	ENST00000379484.5	37	c.764	CCDS14201.1	X	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333002	0.81801	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.95724	-3.79;-2.57	5.64	5.64	0.86602	Peptidase M50 (1);	0.000000	0.85682	D	0.000000	D	0.97467	0.9171	M	0.73430	2.235	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.68483	0.873;0.958	D	0.97649	1.0153	10	0.54805	T	0.06	-14.1895	18.7278	0.91720	0.0:0.0:1.0:0.0	.	255;255	O43462;B9ZVQ3	MBTP2_HUMAN;.	A	255	ENSP00000368798:G255A;ENSP00000368796:G255A	ENSP00000368796:G255A	G	+	2	0	MBTPS2	21796599	1.000000	0.71417	0.349000	0.25694	0.919000	0.55068	7.798000	0.85924	2.368000	0.80403	0.544000	0.68410	GGG	MBTPS2	-	pfam_Peptidase_M50,superfamily_PDZ	ENSG00000012174		0.398	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	HGNC	protein_coding	OTTHUMT00000056026.1	897	0.00	0	G			21886678	21886678	+1	no_errors	ENST00000379484	ensembl	human	known	69_37n	missense	434	32.19	206	SNP	0.999	C
KMT2D	8085	genome.wustl.edu	37	12	49424516	49424516	+	Silent	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:49424516G>T	ENST00000301067.7	-	41	13706	c.13707C>A	c.(13705-13707)atC>atA	p.I4569I		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4569					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AATTGGCGGTGATAGCAGGCT	0.592																																						dbGAP											0													44.0	46.0	46.0					12																	49424516		1889	4123	6012	-	-	-	SO:0001819	synonymous_variant	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.13707C>A	12.37:g.49424516G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O14687	Silent	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.I4569	ENST00000301067.7	37	c.13707	CCDS44873.1	12																																																																																			MLL2	-	NULL	ENSG00000167548		0.592	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	37	0.00	0	G			49424516	49424516	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	silent	58	12.12	8	SNP	1.000	T
MPHOSPH10	10199	genome.wustl.edu	37	2	71360505	71360505	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:71360505A>C	ENST00000244230.2	+	2	919	c.567A>C	c.(565-567)aaA>aaC	p.K189N	MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.K189N	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	189					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						TGCAAAACAAAGGACAGGGAA	0.393																																						dbGAP											0													83.0	89.0	87.0					2																	71360505		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.567A>C	2.37:g.71360505A>C	ENSP00000244230:p.Lys189Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVJ8	Missense_Mutation	SNP	pfam_Mpp10,pirsf_snoRNP_Mpp10	p.K189N	ENST00000244230.2	37	c.567	CCDS1916.1	2	.	.	.	.	.	.	.	.	.	.	A	7.931	0.740766	0.15642	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.10382	2.88;2.88	5.04	-1.79	0.07932	.	1.414530	0.03865	N	0.274585	T	0.09730	0.0239	L	0.40543	1.245	0.09310	N	1	P;P	0.40578	0.722;0.549	B;B	0.39617	0.305;0.129	T	0.31943	-0.9925	10	0.31617	T	0.26	.	5.5552	0.17113	0.5226:0.1431:0.3343:0.0	.	189;189	B3KPV5;O00566	.;MPP10_HUMAN	N	189;49	ENSP00000244230:K189N;ENSP00000393034:K49N	ENSP00000244230:K189N	K	+	3	2	MPHOSPH10	71214013	0.079000	0.21365	0.000000	0.03702	0.210000	0.24377	1.743000	0.38258	-0.217000	0.10033	0.397000	0.26171	AAA	MPHOSPH10	-	pfam_Mpp10,pirsf_snoRNP_Mpp10	ENSG00000124383		0.393	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH10	HGNC	protein_coding	OTTHUMT00000251924.2	223	0.00	0	A	NM_005791		71360505	71360505	+1	no_errors	ENST00000244230	ensembl	human	known	69_37n	missense	215	30.42	94	SNP	0.000	C
MRPL18	29074	genome.wustl.edu	37	6	160212096	160212096	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:160212096A>T	ENST00000367034.4	+	2	299	c.177A>T	c.(175-177)ttA>ttT	p.L59F	MRPL18_ENST00000480842.1_3'UTR|TCP1_ENST00000544255.1_5'Flank|TCP1_ENST00000321394.7_5'Flank|TCP1_ENST00000546023.1_5'Flank|TCP1_ENST00000392168.2_5'Flank|TCP1_ENST00000420894.2_5'Flank	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	59					rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		TGGAGCTTTTATCTGTAGCCA	0.567																																						dbGAP											0													29.0	35.0	33.0					6																	160212096		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.177A>T	6.37:g.160212096A>T	ENSP00000356001:p.Leu59Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP9|Q9NZW8	Missense_Mutation	SNP	pfam_Ribosomal_L18/L5	p.L59F	ENST00000367034.4	37	c.177	CCDS5270.1	6	.	.	.	.	.	.	.	.	.	.	A	20.2	3.955546	0.73902	.	.	ENSG00000112110	ENST00000367034	T	0.55930	0.49	5.33	-6.67	0.01783	.	0.128598	0.50627	D	0.000120	T	0.51244	0.1663	M	0.67953	2.075	0.20307	N	0.999913	D	0.65815	0.995	P	0.62560	0.904	T	0.67039	-0.5771	10	0.72032	D	0.01	-12.9655	18.4485	0.90695	0.3199:0.0:0.6801:0.0	.	59	Q9H0U6	RM18_HUMAN	F	59	ENSP00000356001:L59F	ENSP00000356001:L59F	L	+	3	2	MRPL18	160132086	1.000000	0.71417	0.001000	0.08648	0.677000	0.39632	0.567000	0.23608	-1.102000	0.03023	0.533000	0.62120	TTA	MRPL18	-	NULL	ENSG00000112110		0.567	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL18	HGNC	protein_coding	OTTHUMT00000042925.1	104	0.00	0	A			160212096	160212096	+1	no_errors	ENST00000367034	ensembl	human	known	69_37n	missense	100	13.79	16	SNP	0.031	T
MSH2	4436	genome.wustl.edu	37	2	47657032	47657032	+	Missense_Mutation	SNP	G	G	A	rs587782242		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:47657032G>A	ENST00000233146.2	+	7	1451	c.1228G>A	c.(1228-1230)Ggt>Agt	p.G410S	MSH2_ENST00000543555.1_Missense_Mutation_p.G344S|MSH2_ENST00000406134.1_Missense_Mutation_p.G410S	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	410					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ACTCTATCAGGGTATAAATCA	0.348			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	4	Whole gene deletion(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)											76.0	70.0	72.0					2																	47657032		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1228G>A	2.37:g.47657032G>A	ENSP00000233146:p.Gly410Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2Z2|O75488	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.G410S	ENST00000233146.2	37	c.1228	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	g	12.22	1.871248	0.33069	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000453755;ENST00000422810;ENST00000413880	D;D;D	0.89681	-2.55;-2.55;-2.55	5.45	4.56	0.56223	DNA mismatch repair protein MutS, core (3);	0.145762	0.64402	D	0.000008	T	0.65863	0.2732	N	0.00707	-1.245	0.38472	D	0.947489	B;B;B	0.12013	0.001;0.005;0.002	B;B;B	0.12837	0.005;0.008;0.006	T	0.65940	-0.6046	10	0.16420	T	0.52	-8.919	9.4215	0.38555	0.0747:0.0:0.7807:0.1446	.	344;410;410	B4E2Z2;E9PHA6;P43246	.;.;MSH2_HUMAN	S	410;344;410;410;410;410;60;196	ENSP00000233146:G410S;ENSP00000442697:G344S;ENSP00000384199:G410S	ENSP00000233146:G410S	G	+	1	0	MSH2	47510536	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.765000	0.62271	2.571000	0.86741	0.651000	0.88453	GGT	MSH2	-	pfam_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,pirsf_DNA_mismatch_repair_MSH2	ENSG00000095002		0.348	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3	174	0.00	0	G			47657032	47657032	+1	no_errors	ENST00000233146	ensembl	human	known	69_37n	missense	202	12.55	29	SNP	1.000	A
MTFR1	9650	genome.wustl.edu	37	8	66619371	66619371	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr8:66619371G>C	ENST00000262146.4	+	6	770	c.644G>C	c.(643-645)aGa>aCa	p.R215T	MTFR1_ENST00000458689.2_Missense_Mutation_p.R182T|MTFR1_ENST00000517944.1_3'UTR	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	215	Necessary and sufficient to promote mitochondrial fission. {ECO:0000250}.				aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AAAGAACGAAGAGAGAAAAGA	0.478																																						dbGAP											0													73.0	73.0	73.0					8																	66619371		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.644G>C	8.37:g.66619371G>C	ENSP00000262146:p.Arg215Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	pfam_Mtfr1	p.R215T	ENST00000262146.4	37	c.644	CCDS6182.1	8	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	14.27|14.27|14.27	2.484717|2.484717|2.484717	0.44147|0.44147|0.44147	.|.|.	.|.|.	ENSG00000066855|ENSG00000066855|ENSG00000066855	ENST00000518800|ENST00000527155|ENST00000518609;ENST00000262146;ENST00000458689;ENST00000521247	.|.|T;T;T	.|.|0.44881	.|.|0.91;0.91;0.91	5.49|5.49|5.49	3.68|3.68|3.68	0.42216|0.42216|0.42216	.|.|.	.|.|0.301563	.|.|0.38005	.|.|N	.|.|0.001856	T|T|T	0.58018|0.58018|0.58018	0.2093|0.2093|0.2093	M|M|M	0.82323|0.82323|0.82323	2.585|2.585|2.585	0.38169|0.38169|0.38169	D|D|D	0.939286|0.939286|0.939286	.|.|D;B;D;P	.|.|0.56035	.|.|0.957;0.177;0.974;0.878	.|.|P;B;P;P	.|.|0.58577	.|.|0.841;0.314;0.632;0.688	T|T|T	0.60757|0.60757|0.60757	-0.7200|-0.7200|-0.7200	5|5|10	.|.|0.36615	.|.|T	.|.|0.2	-1.1193|-1.1193|-1.1193	8.816|8.816|8.816	0.34996|0.34996|0.34996	0.2872:0.0:0.7128:0.0|0.2872:0.0:0.7128:0.0|0.2872:0.0:0.7128:0.0	.|.|.	.|.|215;199;182;215	.|.|B4E3G8;E5RJS5;E7EP84;Q15390	.|.|.;.;.;MTFR1_HUMAN	Q|N|T	173|28|199;215;182;31	.|.|ENSP00000262146:R215T;ENSP00000391502:R182T;ENSP00000429253:R31T	.|.|ENSP00000262146:R215T	E|K|R	+|+|+	1|3|2	0|2|0	MTFR1|MTFR1|MTFR1	66781925|66781925|66781925	0.999000|0.999000|0.999000	0.42202|0.42202|0.42202	0.406000|0.406000|0.406000	0.26421|0.26421|0.26421	0.240000|0.240000|0.240000	0.25518|0.25518|0.25518	0.995000|0.995000|0.995000	0.29706|0.29706|0.29706	0.663000|0.663000|0.663000	0.31027|0.31027|0.31027	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAG|AAG|AGA	MTFR1	-	pfam_Mtfr1	ENSG00000066855		0.478	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFR1	HGNC	protein_coding	OTTHUMT00000378894.1	94	0.00	0	G	NM_014637		66619371	66619371	+1	no_errors	ENST00000262146	ensembl	human	known	69_37n	missense	121	17.12	25	SNP	0.971	C
MYBL1	4603	genome.wustl.edu	37	8	67484779	67484779	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr8:67484779G>C	ENST00000522677.3	-	12	2076	c.1666C>G	c.(1666-1668)Cct>Gct	p.P556A	MYBL1_ENST00000517885.1_Missense_Mutation_p.P214A|MYBL1_ENST00000524176.2_Missense_Mutation_p.P556A	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	556					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			AAAGGAGTAGGAGTTCTTGGT	0.318																																						dbGAP											0													105.0	99.0	101.0					8																	67484779		1815	4073	5888	-	-	-	SO:0001583	missense	0			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1666C>G	8.37:g.67484779G>C	ENSP00000429633:p.Pro556Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EW29|Q495F9	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.P556A	ENST00000522677.3	37	c.1666	CCDS47867.1	8	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747055	0.89663	.	.	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	T;T;T	0.71934	-0.61;-0.61;-0.61	5.59	5.59	0.84812	C-myb, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87111	0.6096	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.995;1.0	D	0.88444	0.3044	10	0.87932	D	0	-17.094	19.961	0.97250	0.0:0.0:1.0:0.0	.	556;555;556	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	A	556;214;556	ENSP00000429633:P556A;ENSP00000428265:P214A;ENSP00000428011:P556A	ENSP00000428265:P214A	P	-	1	0	MYBL1	67647333	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.519000	0.90563	2.783000	0.95769	0.655000	0.94253	CCT	MYBL1	-	pfam_C-myb_C	ENSG00000185697		0.318	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	276	0.00	0	G	XM_034274		67484779	67484779	-1	no_errors	ENST00000522677	ensembl	human	known	69_37n	missense	593	12.02	81	SNP	1.000	C
MYH1	4619	genome.wustl.edu	37	17	10405125	10405125	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:10405125T>A	ENST00000226207.5	-	25	3309	c.3215A>T	c.(3214-3216)gAt>gTt	p.D1072V	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1072					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						ATTTTCTATATCCATTGTGGA	0.348																																						dbGAP											0													85.0	69.0	75.0					17																	10405125		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3215A>T	17.37:g.10405125T>A	ENSP00000226207:p.Asp1072Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1072V	ENST00000226207.5	37	c.3215	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294260	0.81025	.	.	ENSG00000109061	ENST00000226207	D	0.85629	-2.01	5.62	5.62	0.85841	Myosin tail (1);	0.000000	0.44285	U	0.000462	D	0.93706	0.7989	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94855	0.8017	10	0.87932	D	0	.	16.1323	0.81449	0.0:0.0:0.0:1.0	.	1072	P12882	MYH1_HUMAN	V	1072	ENSP00000226207:D1072V	ENSP00000226207:D1072V	D	-	2	0	MYH1	10345850	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	7.910000	0.87451	2.277000	0.76020	0.528000	0.53228	GAT	MYH1	-	pfam_Myosin_tail	ENSG00000109061		0.348	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	434	0.00	0	T	NM_005963		10405125	10405125	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	missense	256	25.07	86	SNP	1.000	A
MYO5C	55930	genome.wustl.edu	37	15	52517715	52517715	+	Silent	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr15:52517715G>A	ENST00000261839.7	-	26	3383	c.3222C>T	c.(3220-3222)ttC>ttT	p.F1074F		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1074						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TCTCTTTTTCGAACTCAGAGA	0.368																																						dbGAP											0													194.0	176.0	182.0					15																	52517715		1892	4124	6016	-	-	-	SO:0001819	synonymous_variant	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3222C>T	15.37:g.52517715G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1W8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F1074	ENST00000261839.7	37	c.3222	CCDS42036.1	15																																																																																			MYO5C	-	NULL	ENSG00000128833		0.368	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1	737	0.00	0	G	NM_018728		52517715	52517715	-1	no_errors	ENST00000261839	ensembl	human	known	69_37n	silent	438	17.36	92	SNP	0.952	A
MYO7A	4647	genome.wustl.edu	37	11	76918405	76918405	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:76918405G>C	ENST00000409709.3	+	42	6086	c.5814G>C	c.(5812-5814)aaG>aaC	p.K1938N	MYO7A_ENST00000458637.2_Missense_Mutation_p.K1900N|MYO7A_ENST00000605744.1_3'UTR|MYO7A_ENST00000409619.2_Missense_Mutation_p.K1889N	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1938	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGCTCCTCAAGTCCTCAGAGG	0.572																																						dbGAP											0													40.0	46.0	44.0					11																	76918405		2084	4204	6288	-	-	-	SO:0001583	missense	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5814G>C	11.37:g.76918405G>C	ENSP00000386331:p.Lys1938Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.K1938N	ENST00000409709.3	37	c.5814	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	g	14.43	2.533298	0.45073	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169;ENST00000544424	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.01	5.01	0.66863	Band 4.1 domain (1);FERM domain (1);	0.107328	0.64402	D	0.000005	T	0.75027	0.3794	M	0.66506	2.035	0.58432	D	0.999999	B;B	0.24618	0.01;0.107	B;B	0.26094	0.014;0.066	T	0.73949	-0.3821	10	0.51188	T	0.08	.	18.3515	0.90339	0.0:0.0:1.0:0.0	.	1900;1938	F8VUN5;Q13402	.;MYO7A_HUMAN	N	1938;1900;1889;1111;1937;1907;1814;1080;553	ENSP00000386331:K1938N;ENSP00000392185:K1900N;ENSP00000386635:K1889N;ENSP00000417017:K1080N	ENSP00000345075:K1814N	K	+	3	2	MYO7A	76596053	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.619000	0.46401	2.326000	0.78906	0.550000	0.68814	AAG	MYO7A	-	smart_Band_41_domain,pfscan_FERM_domain	ENSG00000137474		0.572	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	161	0.00	0	G	NM_000260		76918405	76918405	+1	no_errors	ENST00000409709	ensembl	human	known	69_37n	missense	144	14.79	25	SNP	1.000	C
MYOM2	9172	genome.wustl.edu	37	8	2026951	2026951	+	Missense_Mutation	SNP	C	C	G	rs376737112		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr8:2026951C>G	ENST00000262113.4	+	12	1540	c.1399C>G	c.(1399-1401)Cga>Gga	p.R467G	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	467	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GGGCATCAGCCGACCCTCCAG	0.547																																						dbGAP											0													148.0	159.0	155.0					8																	2026951		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1399C>G	8.37:g.2026951C>G	ENSP00000262113:p.Arg467Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R467G	ENST00000262113.4	37	c.1399	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	C	11.70	1.716044	0.30413	.	.	ENSG00000036448	ENST00000262113	T	0.56103	0.48	4.71	-0.0178	0.13967	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.064028	0.64402	D	0.000013	T	0.64583	0.2611	L	0.58302	1.8	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.61257	-0.7099	10	0.30854	T	0.27	.	15.6979	0.77515	0.6997:0.3003:0.0:0.0	.	467	P54296	MYOM2_HUMAN	G	467	ENSP00000262113:R467G	ENSP00000262113:R467G	R	+	1	2	MYOM2	2014358	0.988000	0.35896	0.518000	0.27811	0.449000	0.32228	0.336000	0.19823	-0.176000	0.10707	0.561000	0.74099	CGA	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000036448		0.547	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	100	0.00	0	C	NM_003970		2026951	2026951	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	missense	123	13.19	19	SNP	0.982	G
NEK8	284086	genome.wustl.edu	37	17	27067531	27067531	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:27067531C>A	ENST00000268766.6	+	11	1502	c.1468C>A	c.(1468-1470)Ccc>Acc	p.P490T	AC010761.6_ENST00000582536.1_RNA|AC010761.6_ENST00000584779.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	490					organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					CCAGCAGGTGCCCATGCCCCC	0.572																																					NSCLC(6;19 293 14866 25253 49845)	dbGAP											0													98.0	92.0	94.0					17																	27067531		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.1468C>A	17.37:g.27067531C>A	ENSP00000268766:p.Pro490Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Reg_chr_condens,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P490T	ENST00000268766.6	37	c.1468	CCDS32597.1	17	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470445	0.26423	.	.	ENSG00000160602	ENST00000268766	T	0.80304	-1.36	5.21	4.22	0.49857	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.399190	0.28983	N	0.013509	T	0.65533	0.2700	L	0.33485	1.01	0.27347	N	0.956339	B	0.10296	0.003	B	0.12837	0.008	T	0.49899	-0.8890	10	0.22706	T	0.39	.	3.4479	0.07487	0.275:0.4961:0.1406:0.0882	.	490	Q86SG6	NEK8_HUMAN	T	490	ENSP00000268766:P490T	ENSP00000268766:P490T	P	+	1	0	NEK8	24091658	0.409000	0.25368	0.971000	0.41717	0.993000	0.82548	0.247000	0.18179	1.126000	0.42016	0.555000	0.69702	CCC	NEK8	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000160602		0.572	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK8	HGNC	protein_coding	OTTHUMT00000446467.2	131	0.76	1	C			27067531	27067531	+1	no_errors	ENST00000268766	ensembl	human	known	69_37n	missense	92	17.12	19	SNP	0.963	A
NFS1	9054	genome.wustl.edu	37	20	34278343	34278343	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr20:34278343C>A	ENST00000374092.4	-	5	623	c.553G>T	c.(553-555)Gac>Tac	p.D185Y	NFS1_ENST00000397425.1_Missense_Mutation_p.D125Y|NFS1_ENST00000374085.1_Missense_Mutation_p.D125Y|NFS1_ENST00000540053.1_5'UTR|NFS1_ENST00000541387.1_Intron	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	185					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	ACCTTTAGGTCAATGATCCCA	0.522																																						dbGAP											0													272.0	265.0	268.0					20																	34278343		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.553G>T	20.37:g.34278343C>A	ENSP00000363205:p.Asp185Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cysteine_dSase_NifS,tigrfam_Cys_deSase	p.D185Y	ENST00000374092.4	37	c.553	CCDS13262.1	20	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945708	0.73672	.	.	ENSG00000244005	ENST00000374092;ENST00000374085;ENST00000397425	D;D;D	0.89196	-2.48;-2.48;-2.48	5.7	1.61	0.23674	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.089288	0.85682	D	0.000000	D	0.95853	0.8650	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.93603	0.6932	10	0.87932	D	0	-14.1357	8.0412	0.30523	0.0:0.6999:0.114:0.1861	.	185	Q9Y697	NFS1_HUMAN	Y	185;125;125	ENSP00000363205:D185Y;ENSP00000363198:D125Y;ENSP00000380570:D125Y	ENSP00000363198:D125Y	D	-	1	0	NFS1	33741757	1.000000	0.71417	0.369000	0.25952	0.976000	0.68499	3.823000	0.55715	0.075000	0.16796	0.467000	0.42956	GAC	NFS1	-	pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cysteine_dSase_NifS,tigrfam_Cys_deSase	ENSG00000244005		0.522	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFS1	HGNC	protein_coding	OTTHUMT00000078936.4	285	0.00	0	C	NM_021100		34278343	34278343	-1	no_errors	ENST00000374092	ensembl	human	known	69_37n	missense	302	10.91	37	SNP	0.967	A
NKX3-1	4824	genome.wustl.edu	37	8	23538848	23538848	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr8:23538848C>G	ENST00000380871.4	-	2	628	c.591G>C	c.(589-591)ttG>ttC	p.L197F	NKX3-1_ENST00000523261.1_Missense_Mutation_p.L122F	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	197					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		TCAGGGCCGGCAAAGAGGAGT	0.562																																						dbGAP											0													94.0	95.0	95.0					8																	23538848		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.591G>C	8.37:g.23538848C>G	ENSP00000370253:p.Leu197Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.L197F	ENST00000380871.4	37	c.591	CCDS6042.1	8	.	.	.	.	.	.	.	.	.	.	C	10.28	1.307641	0.23821	.	.	ENSG00000167034	ENST00000380871;ENST00000300332;ENST00000523261	D;D	0.92495	-2.91;-3.05	5.86	4.09	0.47781	.	1.038370	0.07718	N	0.943172	D	0.90618	0.7058	M	0.68317	2.08	0.34688	D	0.725461	P	0.44344	0.833	B	0.41271	0.352	D	0.83686	0.0174	10	0.16420	T	0.52	.	10.6689	0.45747	0.0:0.8451:0.0:0.1549	.	197	Q99801	NKX31_HUMAN	F	197;153;122	ENSP00000370253:L197F;ENSP00000429729:L122F	ENSP00000300332:L153F	L	-	3	2	NKX3-1	23594793	0.757000	0.28394	0.260000	0.24451	0.028000	0.11728	0.736000	0.26130	0.840000	0.34995	0.655000	0.94253	TTG	NKX3-1	-	NULL	ENSG00000167034		0.562	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX3-1	HGNC	protein_coding	OTTHUMT00000215141.2	222	0.00	0	C			23538848	23538848	-1	no_errors	ENST00000380871	ensembl	human	known	69_37n	missense	169	13.78	27	SNP	0.967	G
NLGN3	54413	genome.wustl.edu	37	X	70384048	70384048	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chrX:70384048G>C	ENST00000358741.3	+	6	1086	c.783G>C	c.(781-783)caG>caC	p.Q261H	NLGN3_ENST00000536169.1_Missense_Mutation_p.Q221H|NLGN3_ENST00000374051.3_Missense_Mutation_p.Q241H|NLGN3_ENST00000476589.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	261					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					TCCTTGACCAGATCCAGGCCC	0.572																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0													95.0	74.0	81.0					X																	70384048		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.783G>C	X.37:g.70384048G>C	ENSP00000351591:p.Gln261His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.Q261H	ENST00000358741.3	37	c.783	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775104	0.70107	.	.	ENSG00000196338	ENST00000536169;ENST00000542063;ENST00000374051;ENST00000395855;ENST00000358741	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.51	1.91	0.25777	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.90075	0.6900	H	0.99225	4.475	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.99;0.996;0.997	D	0.87649	0.2527	10	0.87932	D	0	.	6.8807	0.24170	0.5539:0.0:0.4461:0.0	.	221;221;261;241	D3DVV1;B7Z5Y1;Q9NZ94;Q9NZ94-2	.;.;NLGN3_HUMAN;.	H	221;124;241;221;261	ENSP00000445298:Q221H;ENSP00000363163:Q241H;ENSP00000379196:Q221H;ENSP00000351591:Q261H	ENSP00000351591:Q261H	Q	+	3	2	NLGN3	70300773	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.735000	0.47377	0.373000	0.24621	-0.348000	0.07805	CAG	NLGN3	-	pfam_CarbesteraseB,pfam_AB_hydrolase_3	ENSG00000196338		0.572	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	282	0.00	0	G	NM_018977		70384048	70384048	+1	no_errors	ENST00000358741	ensembl	human	known	69_37n	missense	180	19.28	43	SNP	1.000	C
NRXN3	9369	genome.wustl.edu	37	14	79175993	79175993	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:79175993G>T	ENST00000554719.1	+	4	1027	c.536G>T	c.(535-537)aGa>aTa	p.R179I	NRXN3_ENST00000335750.5_Missense_Mutation_p.R179I|RP11-232C2.2_ENST00000555680.1_RNA	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	183	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CGAGATGGCAGATCAGGTAGG	0.458																																						dbGAP											0													85.0	87.0	87.0					14																	79175993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.536G>T	14.37:g.79175993G>T	ENSP00000451648:p.Arg179Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.R550I	ENST00000554719.1	37	c.1649	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726076	0.89298	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.79247	-1.25;-1.25	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.88070	0.6338	.	.	.	0.80722	D	1	D;P	0.71674	0.998;0.524	D;B	0.67103	0.949;0.149	D	0.87595	0.2493	8	.	.	.	.	19.4379	0.94804	0.0:0.0:1.0:0.0	.	552;179	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	I	552;550;179;179	ENSP00000451648:R179I;ENSP00000338349:R179I	.	R	+	2	0	NRXN3	78245746	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.606000	0.88127	0.563000	0.77884	AGA	NRXN3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000021645		0.458	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413787.1	175	0.00	0	G	NM_001105250		79175993	79175993	+1	no_errors	ENST00000554738	ensembl	human	known	69_37n	missense	42	47.50	38	SNP	1.000	T
NWD1	284434	genome.wustl.edu	37	19	16874756	16874756	+	Splice_Site	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:16874756G>C	ENST00000552788.1	+	7	2251	c.2251G>C	c.(2251-2253)Ggc>Cgc	p.G751R	NWD1_ENST00000549814.1_Splice_Site_p.G751R|NWD1_ENST00000523826.1_Splice_Site_p.G545R|NWD1_ENST00000339803.6_Splice_Site_p.G616R|NWD1_ENST00000524140.2_Splice_Site_p.G751R|NWD1_ENST00000379808.3_Splice_Site_p.G751R			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	751							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGAGGTTCTGGGTAAGGGCTG	0.587																																						dbGAP											0													38.0	37.0	37.0					19																	16874756		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2251+1G>C	19.37:g.16874756G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G751R	ENST00000552788.1	37	c.2251		19	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852832	0.71719	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.57107	0.42;0.5;0.42;0.42;0.48;0.48	4.87	4.87	0.63330	.	0.057537	0.64402	U	0.000002	T	0.69967	0.3170	M	0.76574	2.34	0.46185	D	0.998916	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.79108	0.946;0.992;0.968	T	0.69573	-0.5109	10	0.35671	T	0.21	-33.6611	13.527	0.61601	0.0:0.0:1.0:0.0	.	751;751;616	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	R	616;751;751;751;545;751;616	ENSP00000428579:G751R;ENSP00000447548:G751R;ENSP00000369136:G751R;ENSP00000428955:G545R;ENSP00000447224:G751R;ENSP00000340159:G616R	ENSP00000340159:G616R	G	+	1	0	NWD1	16735756	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	5.380000	0.66202	2.252000	0.74401	0.465000	0.42564	GGC	NWD1	-	NULL	ENSG00000188039		0.587	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	98	0.00	0	G	NM_001007525	Missense_Mutation	16874756	16874756	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	1.000	C
NYNRIN	57523	genome.wustl.edu	37	14	24886547	24886547	+	Missense_Mutation	SNP	G	G	C	rs373108431		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:24886547G>C	ENST00000382554.3	+	9	5910	c.5592G>C	c.(5590-5592)tgG>tgC	p.W1864C		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1864					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						ATAGGATATGGGGCTTCCCAA	0.577																																						dbGAP											0													20.0	23.0	22.0					14																	24886547		1907	4118	6025	-	-	-	SO:0001583	missense	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.5592G>C	14.37:g.24886547G>C	ENSP00000371994:p.Trp1864Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.W1864C	ENST00000382554.3	37	c.5592	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	G	16.18	3.048933	0.55110	.	.	ENSG00000205978	ENST00000382554	T	0.10192	2.9	4.65	4.65	0.58169	.	.	.	.	.	T	0.20700	0.0498	N	0.24115	0.695	0.53688	D	0.999976	D	0.89917	1.0	D	0.83275	0.996	T	0.02132	-1.1208	9	0.72032	D	0.01	.	15.3964	0.74798	0.0:0.0:1.0:0.0	.	1864	Q9P2P1	NYNRI_HUMAN	C	1864	ENSP00000371994:W1864C	ENSP00000371994:W1864C	W	+	3	0	NYNRIN	23956387	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	3.250000	0.51445	2.571000	0.86741	0.563000	0.77884	TGG	NYNRIN	-	NULL	ENSG00000205978		0.577	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	74	0.00	0	G			24886547	24886547	+1	no_errors	ENST00000382554	ensembl	human	known	69_37n	missense	88	16.04	17	SNP	1.000	C
OGDH	4967	genome.wustl.edu	37	7	44737330	44737330	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr7:44737330G>T	ENST00000222673.5	+	17	2349	c.2307G>T	c.(2305-2307)tgG>tgT	p.W769C	OGDH_ENST00000543843.1_Missense_Mutation_p.W720C|OGDH_ENST00000449767.1_Missense_Mutation_p.W765C|OGDH_ENST00000444676.1_Missense_Mutation_p.W784C|OGDH_ENST00000439616.2_Missense_Mutation_p.W619C|OGDH_ENST00000447398.1_Missense_Mutation_p.W780C	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	769					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	AAGCCAAGTGGGTGCGGCAGA	0.602																																						dbGAP											0													117.0	102.0	107.0					7																	44737330		2203	4300	6503	-	-	-	SO:0001583	missense	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2307G>T	7.37:g.44737330G>T	ENSP00000222673:p.Trp769Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.W769C	ENST00000222673.5	37	c.2307	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571216	0.86542	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98;-2.98;-2.98	5.67	5.67	0.87782	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.97964	0.9330	H	0.98577	4.27	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99174	1.0865	10	0.87932	D	0	-18.3249	19.3632	0.94451	0.0:0.0:1.0:0.0	.	564;619;765;780;769	B4E3E9;E9PFG7;E9PBM1;E9PDF2;Q02218	.;.;.;.;ODO1_HUMAN	C	619;765;780;784;769;720	ENSP00000398576:W619C;ENSP00000392878:W765C;ENSP00000388183:W780C;ENSP00000414662:W784C;ENSP00000222673:W769C;ENSP00000443821:W720C	ENSP00000222673:W769C	W	+	3	0	OGDH	44703855	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.869000	0.99810	2.664000	0.90586	0.555000	0.69702	TGG	OGDH	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000105953		0.602	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	305	0.00	0	G			44737330	44737330	+1	no_errors	ENST00000222673	ensembl	human	known	69_37n	missense	136	15.00	24	SNP	1.000	T
OR13J1	392309	genome.wustl.edu	37	9	35869718	35869718	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:35869718C>T	ENST00000377981.2	-	1	743	c.681G>A	c.(679-681)agG>agA	p.R227R		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			CCGAGGGCACCCTCAGGATGG	0.587																																						dbGAP											0													57.0	50.0	53.0					9																	35869718		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.681G>A	9.37:g.35869718C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN66|Q6IF20|Q96R40	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R227	ENST00000377981.2	37	c.681	CCDS35011.1	9																																																																																			OR13J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000168828		0.587	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13J1	HGNC	protein_coding	OTTHUMT00000052381.1	123	0.00	0	C			35869718	35869718	-1	no_errors	ENST00000377981	ensembl	human	known	69_37n	silent	80	31.03	36	SNP	0.999	T
OR2L2	26246	genome.wustl.edu	37	1	248201729	248201729	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:248201729C>A	ENST00000366479.2	+	1	256	c.160C>A	c.(160-162)Ctc>Atc	p.L54I	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GGACATCCATCTCCACACACC	0.373																																						dbGAP											0													305.0	282.0	290.0					1																	248201729		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.160C>A	1.37:g.248201729C>A	ENSP00000355435:p.Leu54Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3T5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L54I	ENST00000366479.2	37	c.160	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	17.10	3.304026	0.60305	.	.	ENSG00000203663	ENST00000366479	T	0.13778	2.56	2.09	2.09	0.27110	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.49898	0.1584	H	0.97340	3.985	0.34298	D	0.684058	D	0.89917	1.0	D	0.91635	0.999	T	0.72606	-0.4242	9	0.87932	D	0	.	11.7681	0.51943	0.0:1.0:0.0:0.0	.	54	Q8NH16	OR2L2_HUMAN	I	54	ENSP00000355435:L54I	ENSP00000355435:L54I	L	+	1	0	OR2L2	246268352	0.749000	0.28305	0.819000	0.32651	0.083000	0.17756	1.535000	0.36061	1.016000	0.39470	0.194000	0.17425	CTC	OR2L2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000203663		0.373	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	743	0.00	0	C	NM_001004686		248201729	248201729	+1	no_errors	ENST00000366479	ensembl	human	known	69_37n	missense	595	17.45	126	SNP	0.996	A
OR4D2	124538	genome.wustl.edu	37	17	56247852	56247852	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:56247852delC	ENST00000545221.1	+	1	836	c.836delC	c.(835-837)accfs	p.T279fs		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						ACAGTCATGACCCCCATGCTC	0.527																																						dbGAP											0													130.0	118.0	122.0					17																	56247852		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.836delC	17.37:g.56247852delC	ENSP00000441354:p.Thr279fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFN8|Q96R75	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M281fs	ENST00000545221.1	37	c.836	CCDS32688.1	17																																																																																			OR4D2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000255713		0.527	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D2	HGNC	protein_coding	OTTHUMT00000443366.1	234	0.00	0	C			56247852	56247852	+1	no_errors	ENST00000545221	ensembl	human	known	69_37n	frame_shift_del	167	14.21	28	DEL	1.000	-
OR52N2	390077	genome.wustl.edu	37	11	5842494	5842494	+	Nonsense_Mutation	SNP	T	T	G	rs182590364	byFrequency	TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:5842494T>G	ENST00000317037.2	+	1	951	c.929T>G	c.(928-930)tTa>tGa	p.L310*	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	310						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATTAAATTTTTACTTGGAGAC	0.358																																						dbGAP											0													60.0	61.0	61.0					11																	5842494		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.929T>G	11.37:g.5842494T>G	ENSP00000322801:p.Leu310*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFF9	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L310*	ENST00000317037.2	37	c.929	CCDS31399.1	11	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457457	0.63401	.	.	ENSG00000180988	ENST00000317037	.	.	.	6.09	6.09	0.99107	.	0.222293	0.21869	N	0.067919	.	.	.	.	.	.	0.31806	N	0.62778	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	15.4925	0.75619	0.0:0.0:0.0:1.0	.	.	.	.	X	310	.	ENSP00000322801:L310X	L	+	2	0	OR52N2	5799070	0.300000	0.24435	0.014000	0.15608	0.005000	0.04900	2.950000	0.49081	2.336000	0.79503	0.523000	0.50628	TTA	OR52N2	-	NULL	ENSG00000180988		0.358	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N2	HGNC	protein_coding	OTTHUMT00000401143.1	215	0.00	0	T	NM_001005174		5842494	5842494	+1	no_errors	ENST00000317037	ensembl	human	known	69_37n	nonsense	95	15.93	18	SNP	0.166	G
OR5L1	219437	genome.wustl.edu	37	11	55579684	55579684	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:55579684A>T	ENST00000333973.2	+	1	831	c.742A>T	c.(742-744)Atc>Ttc	p.I248F		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CCTCACAGCTATCACTGTCTT	0.527																																						dbGAP											0													163.0	136.0	145.0					11																	55579684		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.742A>T	11.37:g.55579684A>T	ENSP00000335529:p.Ile248Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNK6|Q6IFD0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I248F	ENST00000333973.2	37	c.742	CCDS31509.1	11	.	.	.	.	.	.	.	.	.	.	a	15.62	2.887576	0.52014	.	.	ENSG00000186117	ENST00000333973	T	0.00164	8.64	4.12	0.466	0.16716	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000061	T	0.00271	0.0008	L	0.48986	1.54	0.09310	N	1	D	0.67145	0.996	D	0.72625	0.978	T	0.49808	-0.8900	10	0.87932	D	0	-53.1532	7.2279	0.26026	0.4764:0.0:0.5236:0.0	.	248	Q8NGL2	OR5L1_HUMAN	F	248	ENSP00000335529:I248F	ENSP00000335529:I248F	I	+	1	0	OR5L1	55336260	0.127000	0.22367	0.006000	0.13384	0.161000	0.22273	0.592000	0.23984	0.069000	0.16605	0.352000	0.21897	ATC	OR5L1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186117		0.527	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	HGNC	protein_coding	OTTHUMT00000391514.1	431	0.00	0	A	NM_001004738		55579684	55579684	+1	no_errors	ENST00000333973	ensembl	human	known	69_37n	missense	320	11.05	40	SNP	0.003	T
OR5AS1	219447	genome.wustl.edu	37	11	55798071	55798071	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:55798071G>C	ENST00000313555.1	+	1	177	c.177G>C	c.(175-177)atG>atC	p.M59I		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					AAATTCCCATGTATTATTTTC	0.338																																						dbGAP											0													52.0	55.0	54.0					11																	55798071		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.177G>C	11.37:g.55798071G>C	ENSP00000324111:p.Met59Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFB8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M59I	ENST00000313555.1	37	c.177	CCDS31516.1	11	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882770	0.72410	.	.	ENSG00000181785	ENST00000313555	T	0.09350	2.99	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42172	U	0.000753	T	0.46444	0.1393	H	0.94925	3.6	0.46901	D	0.999243	D	0.63880	0.993	D	0.70227	0.968	T	0.60357	-0.7279	10	0.87932	D	0	.	18.3047	0.90176	0.0:0.0:1.0:0.0	.	59	Q8N127	O5AS1_HUMAN	I	59	ENSP00000324111:M59I	ENSP00000324111:M59I	M	+	3	0	OR5AS1	55554647	1.000000	0.71417	1.000000	0.80357	0.470000	0.32858	9.211000	0.95120	2.663000	0.90544	0.643000	0.83706	ATG	OR5AS1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000181785		0.338	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	HGNC	protein_coding	OTTHUMT00000391538.1	156	0.00	0	G	NM_001001921		55798071	55798071	+1	no_errors	ENST00000313555	ensembl	human	known	69_37n	missense	118	15.11	21	SNP	1.000	C
OR6S1	341799	genome.wustl.edu	37	14	21109448	21109448	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:21109448G>T	ENST00000320704.3	-	1	402	c.403C>A	c.(403-405)Ccc>Acc	p.P135T		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		ATGAGCAAGGGGTAGCGCAGA	0.582																																						dbGAP											0													101.0	78.0	86.0					14																	21109448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.403C>A	14.37:g.21109448G>T	ENSP00000313110:p.Pro135Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P135T	ENST00000320704.3	37	c.403	CCDS32038.1	14	.	.	.	.	.	.	.	.	.	.	G	1.093	-0.663567	0.03428	.	.	ENSG00000181803	ENST00000320704	T	0.02301	4.35	5.76	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000160	T	0.01695	0.0054	L	0.29908	0.895	0.30369	N	0.783087	B	0.24823	0.112	B	0.24006	0.05	T	0.33137	-0.9880	10	0.02654	T	1	-20.5433	8.3991	0.32574	0.0:0.1505:0.5384:0.3111	.	135	Q8NH40	OR6S1_HUMAN	T	135	ENSP00000313110:P135T	ENSP00000313110:P135T	P	-	1	0	OR6S1	20179288	0.668000	0.27493	1.000000	0.80357	0.950000	0.60333	-0.253000	0.08794	1.422000	0.47177	0.655000	0.94253	CCC	OR6S1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181803		0.582	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR6S1	HGNC	protein_coding	OTTHUMT00000411227.1	182	0.55	1	G			21109448	21109448	-1	no_errors	ENST00000320704	ensembl	human	known	69_37n	missense	157	28.51	63	SNP	0.976	T
OR9G4	283189	genome.wustl.edu	37	11	56510423	56510423	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:56510423C>G	ENST00000302957.3	-	1	864	c.865G>C	c.(865-867)Gct>Cct	p.A289P		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						AACAGAGCAGCTACTTTGTCC	0.463																																						dbGAP											0													204.0	166.0	179.0					11																	56510423		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.865G>C	11.37:g.56510423C>G	ENSP00000307515:p.Ala289Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF62|Q96RA9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A289P	ENST00000302957.3	37	c.865	CCDS31537.1	11	.	.	.	.	.	.	.	.	.	.	C	12.67	2.006513	0.35415	.	.	ENSG00000172457	ENST00000302957	T	0.38722	1.12	5.07	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	0.187987	0.25890	N	0.027632	T	0.60818	0.2298	M	0.79926	2.475	0.24021	N	0.99614	D	0.89917	1.0	D	0.91635	0.999	T	0.52034	-0.8629	10	0.87932	D	0	-17.3432	6.4513	0.21906	0.0:0.6879:0.1488:0.1633	.	289	Q8NGQ1	OR9G4_HUMAN	P	289	ENSP00000307515:A289P	ENSP00000307515:A289P	A	-	1	0	OR9G4	56266999	0.000000	0.05858	0.997000	0.53966	0.205000	0.24178	-0.026000	0.12392	0.724000	0.32296	0.643000	0.83706	GCT	OR9G4	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172457		0.463	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G4	HGNC	protein_coding	OTTHUMT00000391945.1	593	0.00	0	C	NM_001005284		56510423	56510423	-1	no_errors	ENST00000302957	ensembl	human	known	69_37n	missense	467	15.70	87	SNP	0.463	G
PAH	5053	genome.wustl.edu	37	12	103234267	103234267	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:103234267G>T	ENST00000553106.1	-	12	1698	c.1226C>A	c.(1225-1227)cCc>cAc	p.P409H	PAH_ENST00000307000.2_Missense_Mutation_p.P404H	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	409					catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AACTGAGAAGGGCCGAGGTAT	0.458																																						dbGAP											0													160.0	143.0	149.0					12																	103234267		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.1226C>A	12.37:g.103234267G>T	ENSP00000448059:p.Pro409His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16717|Q8TC14	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Phe-4-hydroxylase_tetra	p.P409H	ENST00000553106.1	37	c.1226	CCDS9092.1	12	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881077	0.91740	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	D;D	0.99820	-6.93;-6.93	5.63	5.63	0.86233	Aromatic amino acid hydroxylase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	H	0.96430	3.82	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.96565	0.9418	10	0.87932	D	0	-23.6149	18.445	0.90681	0.0:0.0:1.0:0.0	.	409	P00439	PH4H_HUMAN	H	409;404	ENSP00000448059:P409H;ENSP00000303500:P404H	ENSP00000303500:P404H	P	-	2	0	PAH	101758397	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	8.952000	0.93031	2.664000	0.90586	0.561000	0.74099	CCC	PAH	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Phe-4-hydroxylase_tetra	ENSG00000171759		0.458	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAH	HGNC	protein_coding	OTTHUMT00000406692.1	360	0.00	0	G			103234267	103234267	-1	no_errors	ENST00000553106	ensembl	human	known	69_37n	missense	297	18.18	66	SNP	1.000	T
PALMD	54873	genome.wustl.edu	37	1	100154988	100154988	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:100154988A>T	ENST00000263174.4	+	7	1547	c.1172A>T	c.(1171-1173)gAc>gTc	p.D391V	PALMD_ENST00000605497.1_Missense_Mutation_p.D391V	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	391					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		TGTCAGGAGGACGAGGAAGAT	0.463																																						dbGAP											0													58.0	49.0	52.0					1																	100154988		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.1172A>T	1.37:g.100154988A>T	ENSP00000263174:p.Asp391Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	pfam_Paralemmin	p.D391V	ENST00000263174.4	37	c.1172	CCDS758.1	1	.	.	.	.	.	.	.	.	.	.	A	10.49	1.366136	0.24684	.	.	ENSG00000099260	ENST00000263174	T	0.18338	2.22	5.78	4.64	0.57946	.	0.734067	0.13690	N	0.369580	T	0.08133	0.0203	L	0.60455	1.87	0.58432	D	0.999999	B;B	0.33583	0.213;0.418	B;B	0.28916	0.096;0.058	T	0.04440	-1.0951	10	0.72032	D	0.01	-4.5661	8.1654	0.31224	0.7947:0.1361:0.0692:0.0	.	391;311	Q9NP74;Q9NP74-2	PALMD_HUMAN;.	V	391	ENSP00000263174:D391V	ENSP00000263174:D391V	D	+	2	0	PALMD	99927576	0.996000	0.38824	0.975000	0.42487	0.406000	0.30931	3.431000	0.52814	0.979000	0.38497	0.460000	0.39030	GAC	PALMD	-	NULL	ENSG00000099260		0.463	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALMD	HGNC	protein_coding	OTTHUMT00000029672.1	107	0.00	0	A	NM_017734		100154988	100154988	+1	no_errors	ENST00000263174	ensembl	human	known	69_37n	missense	78	15.05	14	SNP	0.998	T
PCDH17	27253	genome.wustl.edu	37	13	58240645	58240645	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr13:58240645A>C	ENST00000377918.3	+	2	2635	c.2609A>C	c.(2608-2610)cAg>cCg	p.Q870P		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	870					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GGCAGCAGGCAGCAGTTTGTT	0.413																																					Melanoma(72;952 1291 1619 12849 33676)	dbGAP											0													84.0	85.0	85.0					13																	58240645		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2609A>C	13.37:g.58240645A>C	ENSP00000367151:p.Gln870Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q870P	ENST00000377918.3	37	c.2609	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	A	14.37	2.514131	0.44763	.	.	ENSG00000118946	ENST00000377918	T	0.50277	0.75	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.53045	0.1772	L	0.27053	0.805	0.58432	D	0.999999	D;P	0.64830	0.994;0.804	P;P	0.61592	0.891;0.46	T	0.49781	-0.8903	9	.	.	.	.	16.1946	0.82018	1.0:0.0:0.0:0.0	.	870;870	O14917-2;O14917	.;PCD17_HUMAN	P	870	ENSP00000367151:Q870P	.	Q	+	2	0	PCDH17	57138646	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.228000	0.72767	0.528000	0.53228	CAG	PCDH17	-	NULL	ENSG00000118946		0.413	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	350	0.00	0	A	NM_001040429		58240645	58240645	+1	no_errors	ENST00000377918	ensembl	human	known	69_37n	missense	145	44.02	114	SNP	1.000	C
PCDH17	27253	genome.wustl.edu	37	13	58298937	58298937	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr13:58298937A>C	ENST00000377918.3	+	4	3015	c.2989A>C	c.(2989-2991)Act>Cct	p.T997P		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	997					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGGGAAAAAGACTTTTTGTAC	0.423																																					Melanoma(72;952 1291 1619 12849 33676)	dbGAP											0													109.0	107.0	108.0					13																	58298937		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2989A>C	13.37:g.58298937A>C	ENSP00000367151:p.Thr997Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T997P	ENST00000377918.3	37	c.2989	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	A	16.87	3.242367	0.58995	.	.	ENSG00000118946	ENST00000377918	T	0.57107	0.42	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.68696	0.3029	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66830	-0.5824	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	997	O14917	PCD17_HUMAN	P	997	ENSP00000367151:T997P	.	T	+	1	0	PCDH17	57196938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.326000	0.78906	0.533000	0.62120	ACT	PCDH17	-	NULL	ENSG00000118946		0.423	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	282	0.35	1	A	NM_001040429		58298937	58298937	+1	no_errors	ENST00000377918	ensembl	human	known	69_37n	missense	175	19.63	43	SNP	1.000	C
PCDHB3	56132	genome.wustl.edu	37	5	140480788	140480788	+	Silent	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:140480788T>C	ENST00000231130.2	+	1	555	c.555T>C	c.(553-555)cgT>cgC	p.R185R	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	185	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGCAGTCGTAGGGACGGAA	0.547																																						dbGAP											0													85.0	83.0	83.0					5																	140480788		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.555T>C	5.37:g.140480788T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8P2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R185	ENST00000231130.2	37	c.555	CCDS4245.1	5																																																																																			PCDHB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113205		0.547	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	118	0.00	0	T	NM_018937		140480788	140480788	+1	no_errors	ENST00000231130	ensembl	human	known	69_37n	silent	120	14.79	21	SNP	0.000	C
PCDHGB6	56100	genome.wustl.edu	37	5	140789181	140789181	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:140789181T>G	ENST00000520790.1	+	1	1412	c.1412T>G	c.(1411-1413)aTt>aGt	p.I471S	PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	471	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCCTCCATTGCGCAAGTG	0.582																																						dbGAP											0													34.0	40.0	38.0					5																	140789181		2094	4215	6309	-	-	-	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1412T>G	5.37:g.140789181T>G	ENSP00000428603:p.Ile471Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I471S	ENST00000520790.1	37	c.1412	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	t	14.32	2.500151	0.44455	.	.	ENSG00000253305	ENST00000520790	T	0.65364	-0.15	5.35	5.35	0.76521	Cadherin (3);Cadherin-like (1);	.	.	.	.	D	0.85771	0.5774	H	0.96943	3.91	0.33368	D	0.573209	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.988	D	0.93149	0.6548	9	0.87932	D	0	.	15.0121	0.71557	0.0:0.0:0.0:1.0	.	471;471	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	S	471	ENSP00000428603:I471S	ENSP00000428603:I471S	I	+	2	0	PCDHGB6	140769365	0.922000	0.31269	0.913000	0.36048	0.048000	0.14542	6.050000	0.71063	2.027000	0.59764	0.460000	0.39030	ATT	PCDHGB6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253305		0.582	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1	94	0.00	0	T	NM_018926		140789181	140789181	+1	no_errors	ENST00000520790	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	0.900	G
PCDHGC4	56098	genome.wustl.edu	37	5	140867095	140867096	+	In_Frame_Ins	INS	-	-	ATG			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:140867095_140867096insATG	ENST00000306593.1	+	1	2355_2356	c.2355_2356insATG	c.(2356-2358)atg>ATGatg	p.786_786M>MM	PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGC5_ENST00000252087.1_5'Flank|PCDHGA8_ENST00000398604.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000398587.2_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	786					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGATAGCTTCATGATGGTGAA	0.55																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.2359_2361dupATG	5.37:g.140867099_140867101dupATG	ENSP00000306918:p.Met787dup	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495T2|Q9Y5C3	In_Frame_Ins	INS	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.787in_frame_insM	ENST00000306593.1	37	c.2355_2356	CCDS4262.1	5																																																																																			PCDHGC4	-	NULL	ENSG00000242419		0.550	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC4	HGNC	protein_coding	OTTHUMT00000251820.1	166	0.00	0	-	NM_018928		140867095	140867096	+1	no_errors	ENST00000306593	ensembl	human	known	69_37n	in_frame_ins	68	17.07	14	INS	1.000:1.000	ATG
PDE4C	5143	genome.wustl.edu	37	19	18322000	18322000	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:18322000C>T	ENST00000355502.3	-	19	2749	c.1878G>A	c.(1876-1878)acG>acA	p.T626T	PDE4C_ENST00000594617.3_Silent_p.T626T|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000594465.3_Silent_p.T626T|PDE4C_ENST00000447275.3_Silent_p.T520T|PDE4C_ENST00000262805.12_Silent_p.T594T|PDE4C_ENST00000539010.1_Silent_p.T395T|PDE4C_ENST00000597297.1_Silent_p.T396T|AC068499.10_ENST00000599416.2_RNA|PDE4C_ENST00000598111.2_Silent_p.T341T			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	626					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	TGTCCTCCAGCGTGTCCAGCA	0.597																																						dbGAP											0													130.0	101.0	111.0					19																	18322000		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1878G>A	19.37:g.18322000C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.T626	ENST00000355502.3	37	c.1878	CCDS12373.1	19																																																																																			PDE4C	-	pfam_PDEase_catalytic_dom	ENSG00000105650		0.597	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1	308	0.32	1	C			18322000	18322000	-1	no_errors	ENST00000355502	ensembl	human	known	69_37n	silent	194	20.08	49	SNP	0.080	T
PDIA4	9601	genome.wustl.edu	37	7	148718210	148718210	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr7:148718210C>T	ENST00000286091.4	-	2	350	c.118G>A	c.(118-120)Gat>Aat	p.D40N		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	40	Asp/Glu-rich (acidic).|Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			tcctcttcatcctcAATGGCA	0.453																																						dbGAP											0													93.0	84.0	87.0					7																	148718210		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.118G>A	7.37:g.148718210C>T	ENSP00000286091:p.Asp40Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K6|Q549T6	Missense_Mutation	SNP	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.D40N	ENST00000286091.4	37	c.118	CCDS5893.1	7	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700597	0.68501	.	.	ENSG00000155660	ENST00000286091;ENST00000413966	T;T	0.25085	2.13;1.82	4.69	4.69	0.59074	Thioredoxin-like fold (1);	1.907560	0.02786	U	0.121457	T	0.32496	0.0831	L	0.60455	1.87	0.37544	D	0.918439	B	0.31318	0.319	B	0.26614	0.071	T	0.20605	-1.0270	10	0.49607	T	0.09	.	13.1339	0.59399	0.0:1.0:0.0:0.0	.	40	P13667	PDIA4_HUMAN	N	40;88	ENSP00000286091:D40N;ENSP00000408628:D88N	ENSP00000286091:D40N	D	-	1	0	PDIA4	148349143	0.838000	0.29461	1.000000	0.80357	0.974000	0.67602	3.530000	0.53539	2.156000	0.67533	0.563000	0.77884	GAT	PDIA4	-	pirsf_Protein_diS-isomerase_A4	ENSG00000155660		0.453	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1	529	0.00	0	C	NM_004911		148718210	148718210	-1	no_errors	ENST00000286091	ensembl	human	known	69_37n	missense	427	14.77	74	SNP	1.000	T
PIK3R4	30849	genome.wustl.edu	37	3	130463374	130463374	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr3:130463374C>G	ENST00000356763.3	-	2	1246	c.689G>C	c.(688-690)aGa>aCa	p.R230T		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	230	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TCCTCTTGTTCTCTGATTGCT	0.398																																						dbGAP											0													96.0	100.0	99.0					3																	130463374		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.689G>C	3.37:g.130463374C>G	ENSP00000349205:p.Arg230Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TBF4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_WD40_repeat,pfam_HEAT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_WD40_repeat,pfscan_HEAT_type_2,pfscan_Prot_kinase_cat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R230T	ENST00000356763.3	37	c.689	CCDS3067.1	3	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643477	0.67244	.	.	ENSG00000196455	ENST00000356763	T	0.05996	3.36	5.18	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.09069	0.0224	L	0.35341	1.055	0.80722	D	1	P	0.39094	0.659	B	0.43301	0.415	T	0.40590	-0.9555	10	0.22109	T	0.4	-23.1262	19.0395	0.92992	0.0:1.0:0.0:0.0	.	230	Q99570	PI3R4_HUMAN	T	230	ENSP00000349205:R230T	ENSP00000349205:R230T	R	-	2	0	PIK3R4	131946064	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.736000	0.84948	2.577000	0.86979	0.462000	0.41574	AGA	PIK3R4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196455		0.398	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	HGNC	protein_coding	OTTHUMT00000356668.1	261	0.00	0	C	NM_014602		130463374	130463374	-1	no_errors	ENST00000356763	ensembl	human	known	69_37n	missense	193	16.45	38	SNP	1.000	G
PITPNM1	9600	genome.wustl.edu	37	11	67270037	67270037	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:67270037C>T	ENST00000534749.1	-	2	419	c.231G>A	c.(229-231)ctG>ctA	p.L77L	PITPNM1_ENST00000436757.2_Silent_p.L77L|PITPNM1_ENST00000356404.3_Silent_p.L77L			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	77					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						CAGCCTTGGGCAGCAGTGCCC	0.657																																					GBM(28;144 709 4607 5525)	dbGAP											0													75.0	67.0	70.0					11																	67270037		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.231G>A	11.37:g.67270037C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.L77	ENST00000534749.1	37	c.231	CCDS31620.1	11																																																																																			PITPNM1	-	pfam_PI_transfer	ENSG00000110697		0.657	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	166	0.00	0	C	NM_004910		67270037	67270037	-1	no_errors	ENST00000356404	ensembl	human	known	69_37n	silent	103	16.94	21	SNP	1.000	T
PLEKHH2	130271	genome.wustl.edu	37	2	43937232	43937232	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:43937232A>T	ENST00000282406.4	+	12	2180	c.2070A>T	c.(2068-2070)aaA>aaT	p.K690N		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	690					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AGCTCCCAAAAACTTGCTCAT	0.403																																						dbGAP											0													103.0	102.0	102.0					2																	43937232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2070A>T	2.37:g.43937232A>T	ENSP00000282406:p.Lys690Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.K690N	ENST00000282406.4	37	c.2070	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	A	16.39	3.111064	0.56398	.	.	ENSG00000152527	ENST00000282406	T	0.74421	-0.84	5.23	4.07	0.47477	.	0.153074	0.56097	D	0.000026	T	0.76737	0.4029	L	0.29908	0.895	0.49483	D	0.999791	D;D;D	0.89917	0.993;1.0;1.0	D;D;D	0.91635	0.917;0.996;0.999	T	0.76708	-0.2860	10	0.72032	D	0.01	-22.2871	8.8955	0.35460	0.7923:0.0:0.2077:0.0	.	690;127;690	Q8IVE3;Q8IVE3-2;Q8IVE3-3	PKHH2_HUMAN;.;.	N	690	ENSP00000282406:K690N	ENSP00000282406:K690N	K	+	3	2	PLEKHH2	43790736	1.000000	0.71417	0.276000	0.24689	0.983000	0.72400	1.702000	0.37836	0.824000	0.34613	0.460000	0.39030	AAA	PLEKHH2	-	NULL	ENSG00000152527		0.403	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	338	0.29	1	A	NM_172069		43937232	43937232	+1	no_errors	ENST00000282406	ensembl	human	known	69_37n	missense	234	28.57	94	SNP	1.000	T
PLEK	5341	genome.wustl.edu	37	2	68621250	68621250	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:68621250C>T	ENST00000234313.7	+	8	1037	c.858C>T	c.(856-858)ccC>ccT	p.P286P		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	286	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		CAGAAGATCCCCTGGGAGCAA	0.448																																						dbGAP											0													134.0	131.0	132.0					2																	68621250		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.858C>T	2.37:g.68621250C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Silent	SNP	pfam_Pleckstrin_homology,pfam_DEP_dom,smart_Pleckstrin_homology,smart_DEP_dom,pfscan_DEP_dom,pfscan_Pleckstrin_homology	p.P286	ENST00000234313.7	37	c.858	CCDS1887.1	2																																																																																			PLEK	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115956		0.448	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK	HGNC	protein_coding	OTTHUMT00000251755.1	244	0.41	1	C	NM_002664		68621250	68621250	+1	no_errors	ENST00000234313	ensembl	human	known	69_37n	silent	232	14.39	39	SNP	0.820	T
PLTP	5360	genome.wustl.edu	37	20	44527701	44527701	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr20:44527701C>T	ENST00000477313.1	-	15	1955	c.1361G>A	c.(1360-1362)gGa>gAa	p.G454E	PLTP_ENST00000542937.1_Splice_Site_p.G474E|PLTP_ENST00000354050.4_Splice_Site_p.G402E|PLTP_ENST00000372431.3_Splice_Site_p.G454E|PLTP_ENST00000420868.2_Splice_Site_p.G359E|PLTP_ENST00000372420.1_Splice_Site_p.G366E			P55058	PLTP_HUMAN	phospholipid transfer protein	454					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GGTGAGGAATCCCTGTGTTGG	0.517																																						dbGAP											0													79.0	80.0	80.0					20																	44527701		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.1360-1G>A	20.37:g.44527701C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.G474E	ENST00000477313.1	37	c.1421	CCDS13386.1	20	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488125	0.84854	.	.	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08;3.08	5.28	5.28	0.74379	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.996;0.996;0.996;0.996;0.998	D;D;D;D;D;D;D	0.71656	0.964;0.974;0.946;0.946;0.964;0.946;0.946	T	0.00415	-1.1753	10	0.72032	D	0.01	-17.9291	17.2646	0.87083	0.0:1.0:0.0:0.0	.	359;359;366;454;402;454;474	E7EV16;B4DRB4;B4DDD5;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;.;PLTP_HUMAN;.	E	366;454;402;454;474;359	ENSP00000361497:G366E;ENSP00000361508:G454E;ENSP00000335290:G402E;ENSP00000417138:G454E;ENSP00000440296:G474E;ENSP00000411671:G359E	ENSP00000335290:G402E	G	-	2	0	PLTP	43961108	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.443000	0.66581	2.755000	0.94549	0.655000	0.94253	GGA	PLTP	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	ENSG00000100979		0.517	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLTP	HGNC	protein_coding	OTTHUMT00000354633.1	180	0.00	0	C	NM_006227	Missense_Mutation	44527701	44527701	-1	no_errors	ENST00000542937	ensembl	human	known	69_37n	missense	136	20.35	35	SNP	1.000	T
PPIP5K1	9677	genome.wustl.edu	37	15	43873233	43873233	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr15:43873233A>T	ENST00000396923.3	-	9	1149	c.1028T>A	c.(1027-1029)aTg>aAg	p.M343K	PPIP5K1_ENST00000381885.1_Missense_Mutation_p.M343K|PPIP5K1_ENST00000360135.4_Missense_Mutation_p.M343K|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.M343K|PPIP5K1_ENST00000432870.3_5'UTR|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.M343K|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.M343K|PPIP5K1_ENST00000420765.1_Missense_Mutation_p.M343K|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.M343K			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	343					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						GTAGTATTTCATCGAGTTCTT	0.418																																						dbGAP											0													5.0	8.0	7.0					15																	43873233		1659	4019	5678	-	-	-	SO:0001583	missense	0			AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.1028T>A	15.37:g.43873233A>T	ENSP00000380129:p.Met343Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2,superfamily_MTCP1	p.M343K	ENST00000396923.3	37	c.1028	CCDS45252.1	15	.	.	.	.	.	.	.	.	.	.	A	5.992	0.366997	0.11352	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806;ENST00000335092	T;T;T;T;T;T;T;T	0.20598	2.06;2.07;2.67;2.07;2.06;2.06;2.07;2.67	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.14874	0.0359	N	0.20685	0.6	0.58432	D	0.999999	B;B;B;B	0.12630	0.002;0.001;0.002;0.006	B;B;B;B	0.15870	0.014;0.006;0.014;0.014	T	0.07868	-1.0750	10	0.22706	T	0.39	-15.3033	15.2474	0.73517	1.0:0.0:0.0:0.0	.	343;343;343;343	Q6PFW1-7;Q6PFW1;Q6PFW1-2;Q6PFW1-3	.;VIP1_HUMAN;.;.	K	343;343;343;343;343;343;343;343;343;343;344	ENSP00000371309:M343K;ENSP00000353446:M343K;ENSP00000353253:M343K;ENSP00000334779:M343K;ENSP00000380129:M343K;ENSP00000400887:M343K;ENSP00000371303:M343K;ENSP00000308773:M343K	ENSP00000304750:M343K	M	-	2	0	PPIP5K1	41660525	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	9.121000	0.94375	2.180000	0.69256	0.524000	0.50904	ATG	PPIP5K1	-	NULL	ENSG00000168781		0.418	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PPIP5K1	HGNC	protein_coding	OTTHUMT00000132907.1	53	0.00	0	A	NM_014659		43873233	43873233	-1	no_errors	ENST00000420765	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	1.000	T
PRDM4	11108	genome.wustl.edu	37	12	108133303	108133303	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:108133303C>G	ENST00000228437.5	-	11	2409	c.1950G>C	c.(1948-1950)ttG>ttC	p.L650F	RP11-864J10.4_ENST00000546714.1_RNA|RP11-864J10.4_ENST00000546829.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	650					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						ACTTGTCACACAAGGTACACC	0.463																																						dbGAP											0													93.0	80.0	84.0					12																	108133303		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.1950G>C	12.37:g.108133303C>G	ENSP00000228437:p.Leu650Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UFA6	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_Znf_PRDM4,pfscan_SET_dom,pfscan_Znf_C2H2	p.L650F	ENST00000228437.5	37	c.1950	CCDS9115.1	12	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217723	0.58560	.	.	ENSG00000110851	ENST00000228437	T	0.09073	3.02	5.95	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.127923	0.52532	D	0.000070	T	0.15349	0.0370	L	0.52011	1.625	0.39894	D	0.973818	D	0.59767	0.986	P	0.58210	0.835	T	0.13255	-1.0516	10	0.09338	T	0.73	-3.5745	11.9247	0.52812	0.118:0.7136:0.1684:0.0	.	650	Q9UKN5	PRDM4_HUMAN	F	650	ENSP00000228437:L650F	ENSP00000228437:L650F	L	-	3	2	PRDM4	106657433	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	1.819000	0.39022	1.485000	0.48380	0.650000	0.86243	TTG	PRDM4	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_Znf_PRDM4,pfscan_Znf_C2H2	ENSG00000110851		0.463	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM4	HGNC	protein_coding	OTTHUMT00000406546.1	189	0.00	0	C	NM_012406		108133303	108133303	-1	no_errors	ENST00000228437	ensembl	human	known	69_37n	missense	134	15.72	25	SNP	1.000	G
PREPL	9581	genome.wustl.edu	37	2	44559718	44559718	+	Silent	SNP	T	T	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:44559718T>A	ENST00000409936.1	-	9	1670	c.1233A>T	c.(1231-1233)ccA>ccT	p.P411P	PREPL_ENST00000541738.1_Silent_p.P322P|PREPL_ENST00000409957.1_Silent_p.P322P|PREPL_ENST00000378511.3_Silent_p.P349P|PREPL_ENST00000409411.1_Silent_p.P322P|PREPL_ENST00000409272.1_Silent_p.P411P|PREPL_ENST00000410081.1_Silent_p.P411P|PREPL_ENST00000378520.3_Intron|PREPL_ENST00000260648.6_Silent_p.P411P	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	411						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GGGGACGTATTGGAGAGCAAA	0.423																																						dbGAP											0													125.0	122.0	123.0					2																	44559718		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.1233A>T	2.37:g.44559718T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	pfam_Peptidase_S9,pfam_Peptidase_S9A_B_C_N,superfamily_Peptidase_S9A_B_C_N,prints_Peptidase_S9A	p.P411	ENST00000409936.1	37	c.1233	CCDS33190.1	2																																																																																			PREPL	-	pfam_Peptidase_S9A_B_C_N,superfamily_Peptidase_S9A_B_C_N	ENSG00000138078		0.423	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	HGNC	protein_coding	OTTHUMT00000327900.1	537	0.00	0	T	NM_006036		44559718	44559718	-1	no_errors	ENST00000260648	ensembl	human	known	69_37n	silent	554	16.42	109	SNP	1.000	A
PRKCH	5583	genome.wustl.edu	37	14	62014470	62014470	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:62014470A>G	ENST00000332981.5	+	13	2156	c.1771A>G	c.(1771-1773)Aag>Gag	p.K591E	RP11-47I22.1_ENST00000556543.1_RNA|PRKCH_ENST00000555082.1_Missense_Mutation_p.K430E|RP11-47I22.4_ENST00000556347.1_Silent_p.P95P|PRKCH_ENST00000556245.1_3'UTR	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	591	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		GTTCATGACCAAGAACCCCAC	0.522																																					Melanoma(135;863 1779 8064 14443 26348)	dbGAP											0													254.0	256.0	255.0					14																	62014470		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1771A>G	14.37:g.62014470A>G	ENSP00000329127:p.Lys591Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.K591E	ENST00000332981.5	37	c.1771	CCDS9752.1	14	.	.	.	.	.	.	.	.	.	.	A	27.0	4.789769	0.90367	.	.	ENSG00000027075	ENST00000332981;ENST00000555082	T;T	0.59772	0.24;0.24	5.99	4.84	0.62591	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.77068	0.4076	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.80348	-0.1420	10	0.87932	D	0	.	12.69	0.56970	0.8765:0.0:0.0:0.1235	.	591	P24723	KPCL_HUMAN	E	591;430	ENSP00000329127:K591E;ENSP00000450981:K430E	ENSP00000329127:K591E	K	+	1	0	PRKCH	61084223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.279000	0.95777	1.068000	0.40764	0.533000	0.62120	AAG	PRKCH	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_cat_dom	ENSG00000027075		0.522	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCH	HGNC	protein_coding	OTTHUMT00000276974.2	138	0.00	0	A	NM_006255		62014470	62014470	+1	no_errors	ENST00000332981	ensembl	human	known	69_37n	missense	65	14.29	11	SNP	1.000	G
PRKD3	23683	genome.wustl.edu	37	2	37501724	37501724	+	Silent	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:37501724A>G	ENST00000379066.1	-	11	2253	c.1491T>C	c.(1489-1491)gtT>gtC	p.V497V	PRKD3_ENST00000234179.2_Silent_p.V497V			O94806	KPCD3_HUMAN	protein kinase D3	497	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				TGTTCTCACCAACGAAGTATA	0.438																																					Melanoma(80;621 1355 8613 11814 51767)	dbGAP											0													127.0	113.0	118.0					2																	37501724		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.1491T>C	2.37:g.37501724A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W587|Q53TR7|Q8NEL8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.V497	ENST00000379066.1	37	c.1491	CCDS1789.1	2																																																																																			PRKD3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115825		0.438	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	319	0.00	0	A	NM_005813		37501724	37501724	-1	no_errors	ENST00000234179	ensembl	human	known	69_37n	silent	173	37.05	103	SNP	0.995	G
PTPRM	5797	genome.wustl.edu	37	18	8076452	8076452	+	Splice_Site	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr18:8076452G>T	ENST00000332175.8	+	9	2478		c.e9-1		PTPRM_ENST00000400053.4_Splice_Site|PTPRM_ENST00000444013.1_Splice_Site|PTPRM_ENST00000400060.4_Splice_Site|PTPRM_ENST00000580170.1_Splice_Site|PTPRM_ENST00000578571.1_Splice_Site	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CCCTCCTTTAGTCCCAGGTGC	0.348																																						dbGAP											0													61.0	60.0	60.0					18																	8076452		2203	4298	6501	-	-	-	SO:0001630	splice_region_variant	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1442-1G>T	18.37:g.8076452G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN1|D3DUH8|J3QL11	Splice_Site	SNP	-	e9-1	ENST00000332175.8	37	c.1442-1	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371843	0.61624	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	.	.	.	5.74	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9948	0.80232	0.0:0.0:0.8645:0.1355	.	.	.	.	.	-1	.	.	.	+	.	.	PTPRM	8066452	1.000000	0.71417	0.977000	0.42913	0.816000	0.46133	9.807000	0.99171	1.386000	0.46466	0.650000	0.86243	.	PTPRM	-	-	ENSG00000173482		0.348	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	178	0.00	0	G		Intron	8076452	8076452	+1	no_errors	ENST00000400060	ensembl	human	known	69_37n	splice_site	202	12.55	29	SNP	1.000	T
RAB3GAP2	25782	genome.wustl.edu	37	1	220345979	220345979	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:220345979C>T	ENST00000358951.2	-	22	2532	c.2416G>A	c.(2416-2418)Gtg>Atg	p.V806M		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	806					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CTTTGTTTACCTTTCATCTTG	0.413																																						dbGAP											0													112.0	98.0	103.0					1																	220345979		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2416+1G>A	1.37:g.220345979C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.V806M	ENST00000358951.2	37	c.2416	CCDS31028.1	1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764587	0.89932	.	.	ENSG00000118873	ENST00000358951	T	0.32753	1.44	5.69	5.69	0.88448	.	0.055478	0.64402	D	0.000001	T	0.44540	0.1298	L	0.36672	1.1	0.52501	D	0.999952	D	0.67145	0.996	P	0.60473	0.875	T	0.08785	-1.0705	9	.	.	.	.	19.808	0.96537	0.0:1.0:0.0:0.0	.	806	Q9H2M9	RBGPR_HUMAN	M	806	ENSP00000351832:V806M	.	V	-	1	0	RAB3GAP2	218412602	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	6.359000	0.73060	2.671000	0.90904	0.655000	0.94253	GTG	RAB3GAP2	-	NULL	ENSG00000118873		0.413	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	291	0.34	1	C	NM_012414	Missense_Mutation	220345979	220345979	-1	no_errors	ENST00000358951	ensembl	human	known	69_37n	missense	260	22.16	74	SNP	1.000	T
RALY	22913	genome.wustl.edu	37	20	32663708	32663708	+	Missense_Mutation	SNP	C	C	A	rs144940499		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr20:32663708C>A	ENST00000246194.3	+	6	908	c.406C>A	c.(406-408)Ccc>Acc	p.P136T	RALY_ENST00000375114.3_Missense_Mutation_p.P120T|RALY_ENST00000493399.1_3'UTR	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	136					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						CCGTCTGTCGCCCGTGCCAGT	0.647																																						dbGAP											0													29.0	27.0	28.0					20																	32663708		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.406C>A	20.37:g.32663708C>A	ENSP00000246194:p.Pro136Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.P136T	ENST00000246194.3	37	c.406	CCDS13230.1	20	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109990	0.77210	.	.	ENSG00000125970	ENST00000375114;ENST00000448364;ENST00000246194;ENST00000333552;ENST00000442805	T;T;T;T;T	0.28666	2.61;2.42;2.27;1.6;2.65	5.06	4.1	0.47936	.	0.056868	0.64402	D	0.000001	T	0.49558	0.1564	M	0.76727	2.345	0.38253	D	0.941663	D;D	0.67145	0.996;0.993	P;P	0.59056	0.851;0.714	T	0.57242	-0.7845	10	0.56958	D	0.05	-11.7995	13.7538	0.62923	0.0:0.9232:0.0:0.0768	.	120;136	Q9UKM9-2;Q9UKM9	.;RALY_HUMAN	T	120;136;136;70;120	ENSP00000364255:P120T;ENSP00000413638:P136T;ENSP00000246194:P136T;ENSP00000327522:P70T;ENSP00000415973:P120T	ENSP00000246194:P136T	P	+	1	0	RALY	32127369	0.236000	0.23804	0.518000	0.27811	0.676000	0.39594	3.018000	0.49625	2.641000	0.89580	0.460000	0.39030	CCC	RALY	-	pirsf_hnRNP_C_Raly	ENSG00000125970		0.647	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	HGNC	protein_coding	OTTHUMT00000078753.1	90	0.00	0	C			32663708	32663708	+1	no_errors	ENST00000246194	ensembl	human	known	69_37n	missense	65	10.96	8	SNP	0.994	A
RYR2	6262	genome.wustl.edu	37	1	237693803	237693803	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:237693803C>A	ENST00000366574.2	+	25	3216	c.2899C>A	c.(2899-2901)Ccc>Acc	p.P967T	RYR2_ENST00000542537.1_Missense_Mutation_p.P951T|RYR2_ENST00000360064.6_Missense_Mutation_p.P965T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	967	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AATGAAGCTACCCAAGAAGTA	0.363																																						dbGAP											0													94.0	87.0	89.0					1																	237693803		1857	4099	5956	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2899C>A	1.37:g.237693803C>A	ENSP00000355533:p.Pro967Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.P965T	ENST00000366574.2	37	c.2893	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.226247	0.39300	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97256	-4.31;-4.25;-4.3	5.21	5.21	0.72293	.	0.090614	0.46145	D	0.000312	D	0.95674	0.8593	M	0.64260	1.97	0.80722	D	1	B	0.12013	0.005	B	0.06405	0.002	D	0.93483	0.6829	10	0.52906	T	0.07	.	15.6754	0.77316	0.0:1.0:0.0:0.0	.	967	Q92736	RYR2_HUMAN	T	967;965;951	ENSP00000355533:P967T;ENSP00000353174:P965T;ENSP00000443798:P951T	ENSP00000353174:P965T	P	+	1	0	RYR2	235760426	0.955000	0.32602	0.513000	0.27749	0.914000	0.54420	2.876000	0.48498	2.411000	0.81874	0.557000	0.71058	CCC	RYR2	-	NULL	ENSG00000198626		0.363	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	356	0.00	0	C	NM_001035		237693803	237693803	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	278	25.40	95	SNP	0.373	A
SAMD4A	23034	genome.wustl.edu	37	14	55231251	55231251	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:55231251T>C	ENST00000554335.1	+	8	2252	c.1589T>C	c.(1588-1590)aTt>aCt	p.I530T	SAMD4A_ENST00000357634.3_Missense_Mutation_p.I529T|SAMD4A_ENST00000392067.3_Missense_Mutation_p.I530T|SAMD4A_ENST00000251091.5_Missense_Mutation_p.I442T|SAMD4A_ENST00000555192.1_Missense_Mutation_p.I121T			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	530					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						AAGTGTCTAATTCATGAGGTG	0.358																																						dbGAP											0													131.0	135.0	134.0					14																	55231251		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1589T>C	14.37:g.55231251T>C	ENSP00000452535:p.Ile530Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.I530T	ENST00000554335.1	37	c.1589	CCDS32084.2	14	.	.	.	.	.	.	.	.	.	.	T	1.251	-0.618483	0.03663	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634;ENST00000555192	.	.	.	4.78	4.78	0.61160	Smaug, pseudo-HEAT analogous topology (1);	0.350897	0.28914	N	0.013729	T	0.21841	0.0526	N	0.14661	0.345	0.27497	N	0.9521	B;B;B	0.13145	0.002;0.007;0.001	B;B;B	0.17433	0.008;0.018;0.002	T	0.18618	-1.0331	9	0.07482	T	0.82	-10.6866	9.0635	0.36449	0.0:0.0824:0.0:0.9176	.	121;442;530	G3V2R1;Q9UPU9-3;Q9UPU9	.;.;SMAG1_HUMAN	T	530;530;442;441;529;121	.	ENSP00000251091:I159T	I	+	2	0	SAMD4A	54301001	1.000000	0.71417	0.898000	0.35279	0.983000	0.72400	3.030000	0.49720	2.015000	0.59207	0.421000	0.28195	ATT	SAMD4A	-	NULL	ENSG00000020577		0.358	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4A	HGNC	protein_coding	OTTHUMT00000411186.1	273	0.00	0	T	NM_015589		55231251	55231251	+1	no_errors	ENST00000392067	ensembl	human	known	69_37n	missense	114	42.42	84	SNP	0.975	C
SAT2	112483	genome.wustl.edu	37	17	7530899	7530899	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:7530899T>A	ENST00000269298.5	-	1	274	c.55A>T	c.(55-57)Agg>Tgg	p.R19W	SHBG_ENST00000441599.2_5'Flank|SHBG_ENST00000576728.1_Intron|SHBG_ENST00000575903.1_5'Flank|SHBG_ENST00000570547.1_Intron|SHBG_ENST00000572262.1_Intron|SHBG_ENST00000574539.1_Intron|SHBG_ENST00000416273.3_5'Flank|SAT2_ENST00000573566.1_Missense_Mutation_p.R19W|SHBG_ENST00000576478.1_Intron|SHBG_ENST00000340624.5_5'Flank|SHBG_ENST00000380450.4_5'Flank|SHBG_ENST00000572182.1_Intron|SAT2_ENST00000380466.2_5'UTR|SHBG_ENST00000575314.1_Intron	NM_133491.3	NP_597998.1	Q96F10	SAT2_HUMAN	spermidine/spermine N1-acetyltransferase family member 2	19	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				nor-spermidine metabolic process (GO:0046204)|putrescine acetylation (GO:0032920)|putrescine catabolic process (GO:0009447)|spermidine acetylation (GO:0032918)|spermine acetylation (GO:0032919)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	diamine N-acetyltransferase activity (GO:0004145)	p.?(1)		kidney(1)|large_intestine(2)	3				READ - Rectum adenocarcinoma(115;0.166)	Spermine(DB00127)	CGAATCAGCCTCAGGATATCT	0.677																																						dbGAP											1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											55.0	49.0	51.0					17																	7530899		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348524	CCDS11116.1	17p13.2	2011-11-16	2008-01-07		ENSG00000141504	ENSG00000141504	2.3.1.57		23160	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 2"""	611463	"""spermidine/spermine N1-acetyltransferase 2"""			15283699, 17558023	Standard	NM_133491		Approved	SSAT2	uc002gic.2	Q96F10	OTTHUMG00000108152	ENST00000269298.5:c.55A>T	17.37:g.7530899T>A	ENSP00000269298:p.Arg19Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.R19W	ENST00000269298.5	37	c.55	CCDS11116.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.4|25.4	4.635546|4.635546	0.87760|0.87760	.|.	.|.	ENSG00000141504|ENSG00000141504	ENST00000380466|ENST00000269298	.|T	.|0.46063	.|0.88	4.71|4.71	4.71|4.71	0.59529|0.59529	.|GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000|.	0.34088|.	N|.	0.004271|.	T|T	0.69504|0.69504	0.3118|0.3118	M|M	0.92169|0.92169	3.28|3.28	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.75484	.|0.986	T|T	0.76438|0.76438	-0.2959|-0.2959	7|9	0.35671|0.87932	T|D	0.21|0	-28.6394|-28.6394	10.5061|10.5061	0.44834|0.44834	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|19	.|Q96F10	.|SAT2_HUMAN	V|W	92|19	.|ENSP00000269298:R19W	ENSP00000369833:E92V|ENSP00000269298:R19W	E|R	-|-	2|1	0|2	SAT2|SAT2	7471624|7471624	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.820000|0.820000	0.46376|0.46376	2.345000|2.345000	0.44018|0.44018	1.985000|1.985000	0.57927|0.57927	0.533000|0.533000	0.62120|0.62120	GAG|AGG	SAT2	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000141504		0.677	SAT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAT2	HGNC	protein_coding	OTTHUMT00000440078.1	95	0.00	0	T	NM_133491		7530899	7530899	-1	no_errors	ENST00000269298	ensembl	human	known	69_37n	missense	53	21.74	15	SNP	1.000	A
SDCBP2	27111	genome.wustl.edu	37	20	1300251	1300251	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr20:1300251G>C	ENST00000360779.3	-	3	280	c.107C>G	c.(106-108)gCc>gGc	p.A36G	SDCBP2_ENST00000339987.3_Missense_Mutation_p.A36G|SDCBP2_ENST00000381812.1_Missense_Mutation_p.A36G	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	36					intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						TGGGGAAATGGCTGTTGCCTG	0.627																																						dbGAP											0													18.0	22.0	21.0					20																	1300251		1961	4134	6095	-	-	-	SO:0001583	missense	0			AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.107C>G	20.37:g.1300251G>C	ENSP00000354013:p.Ala36Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A36G	ENST00000360779.3	37	c.107	CCDS42848.1	20	.	.	.	.	.	.	.	.	.	.	G	7.432	0.638920	0.14386	.	.	ENSG00000125775	ENST00000381812;ENST00000360779;ENST00000339987	T;T;T	0.34275	1.37;1.37;1.37	4.04	0.894	0.19242	.	0.653264	0.14139	N	0.338857	T	0.18215	0.0437	N	0.24115	0.695	0.09310	N	1	B;B	0.33103	0.397;0.022	B;B	0.28991	0.097;0.015	T	0.13335	-1.0513	10	0.28530	T	0.3	-1.788	4.0125	0.09629	0.225:0.1977:0.5773:0.0	.	36;36	B4DKI5;Q9H190	.;SDCB2_HUMAN	G	36	ENSP00000371233:A36G;ENSP00000354013:A36G;ENSP00000342935:A36G	ENSP00000342935:A36G	A	-	2	0	SDCBP2	1248251	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.595000	0.24029	0.107000	0.17824	0.561000	0.74099	GCC	SDCBP2	-	NULL	ENSG00000125775		0.627	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCBP2	HGNC	protein_coding	OTTHUMT00000077513.2	101	0.00	0	G	NM_080489		1300251	1300251	-1	no_errors	ENST00000339987	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	0.000	C
SELP	6403	genome.wustl.edu	37	1	169581541	169581541	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:169581541C>T	ENST00000263686.6	-	6	912	c.875G>A	c.(874-876)tGt>tAt	p.C292Y	SELP_ENST00000367793.2_Intron|SELP_ENST00000367786.2_Missense_Mutation_p.C292Y|SELP_ENST00000367794.2_Missense_Mutation_p.C292Y|SELP_ENST00000367791.2_Missense_Mutation_p.C292Y|SELP_ENST00000367792.2_Missense_Mutation_p.C292Y|SELP_ENST00000367788.2_Intron|SELP_ENST00000458599.2_Missense_Mutation_p.C292Y	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	292	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TCCCTCTTCACAACTGAAGCT	0.532																																						dbGAP											0													119.0	108.0	112.0					1																	169581541		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.875G>A	1.37:g.169581541C>T	ENSP00000263686:p.Cys292Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R344|Q8IVD1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.C292Y	ENST00000263686.6	37	c.875	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.161530	0.38119	.	.	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367786;ENST00000458599	D;D;D;D;D	0.99784	-6.74;-6.74;-6.74;-6.74;-6.74	5.39	3.49	0.39957	Complement control module (2);Sushi/SCR/CCP (3);	0.553134	0.16581	N	0.208208	D	0.99880	0.9943	H	0.99752	4.75	0.52099	D	0.999944	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.97702	1.0185	10	0.87932	D	0	.	9.3685	0.38239	0.1439:0.7795:0.0:0.0766	.	292;292;292	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	Y	292;292;291;292;292;292;292;292;292;292;277	ENSP00000263686:C292Y;ENSP00000356768:C292Y;ENSP00000356766:C292Y;ENSP00000356765:C292Y;ENSP00000356760:C292Y	ENSP00000263686:C292Y	C	-	2	0	SELP	167848165	0.990000	0.36364	0.001000	0.08648	0.104000	0.19210	3.008000	0.49544	0.620000	0.30215	0.650000	0.86243	TGT	SELP	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000174175		0.532	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4	310	0.00	0	C	NM_003005		169581541	169581541	-1	no_errors	ENST00000263686	ensembl	human	known	69_37n	missense	291	12.87	43	SNP	0.880	T
SELL	6402	genome.wustl.edu	37	1	169672428	169672428	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:169672428C>G	ENST00000236147.4	-	6	1119	c.959G>C	c.(958-960)gGa>gCa	p.G320A	C1orf112_ENST00000498289.1_Intron|SELL_ENST00000463108.1_5'UTR	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	307					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					TGACCAGATTCCAGATGATTC	0.423																																						dbGAP											0													95.0	88.0	90.0					1																	169672428		1891	4125	6016	-	-	-	SO:0001583	missense	0			M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.959G>C	1.37:g.169672428C>G	ENSP00000236147:p.Gly320Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	pirsf_L-selectin,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_EGF-like,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.G320A	ENST00000236147.4	37	c.959	CCDS53427.1	1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463584	0.63513	.	.	ENSG00000188404	ENST00000236147	T	0.71817	-0.6	4.59	4.59	0.56863	Complement control module (2);Sushi/SCR/CCP (3);	0.121589	0.36703	N	0.002444	D	0.83064	0.5173	M	0.90145	3.09	0.53005	D	0.999967	D;D	0.63880	0.991;0.993	P;D	0.63033	0.879;0.91	D	0.86567	0.1845	10	0.87932	D	0	-17.0621	15.2861	0.73828	0.0:1.0:0.0:0.0	.	320;307	Q8WW79;P14151	.;LYAM1_HUMAN	A	320	ENSP00000236147:G320A	ENSP00000236147:G320A	G	-	2	0	SELL	167939052	0.934000	0.31675	0.818000	0.32626	0.567000	0.35839	4.365000	0.59486	2.542000	0.85734	0.650000	0.86243	GGA	SELL	-	pirsf_L-selectin,pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000188404		0.423	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELL	HGNC	protein_coding	OTTHUMT00000084233.1	286	0.00	0	C	NM_000655		169672428	169672428	-1	no_errors	ENST00000236147	ensembl	human	known	69_37n	missense	339	22.95	101	SNP	0.992	G
SGCG	6445	genome.wustl.edu	37	13	23808841	23808841	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr13:23808841A>C	ENST00000218867.3	+	3	411	c.287A>C	c.(286-288)cAc>cCc	p.H96P	SGCG_ENST00000545013.1_Missense_Mutation_p.H96P|SGCG_ENST00000537476.1_Missense_Mutation_p.H96P	NM_000231.2	NP_000222	Q13326	SGCG_HUMAN	sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)	96					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		AAAGAAATACACTCCAGAGTG	0.338																																						dbGAP											0													105.0	109.0	107.0					13																	23808841		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34976	CCDS9299.1	13q12-q13	2014-09-17	2002-08-29		ENSG00000102683	ENSG00000102683			10809	protein-coding gene	gene with protein product	"""Maghrebian myopathy (autosomal recessive)"", ""35kD dystrophin-associated glycoprotein"", ""limb girdle muscular dystrophy 2C (Duchenne-like muscular dystrophy, autosomal recessive)"", ""gamma sarcoglycan"""	608896	"""sarcoglycan, gamma (35kD dystrophin-associated glycoprotein)"""	DMDA1, MAM, LGMD2C		8968757	Standard	NM_000231		Approved	SCARMD2, DAGA4, SCG3, DMDA, TYPE, A4, MGC130048	uc001uom.2	Q13326	OTTHUMG00000016563	ENST00000218867.3:c.287A>C	13.37:g.23808841A>C	ENSP00000218867:p.His96Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32M32|Q5T9J6	Missense_Mutation	SNP	pfam_Sarcoglycan	p.H96P	ENST00000218867.3	37	c.287	CCDS9299.1	13	.	.	.	.	.	.	.	.	.	.	A	15.63	2.890750	0.52014	.	.	ENSG00000102683	ENST00000218867;ENST00000537476;ENST00000545013	D;D;D	0.94793	-3.52;-3.52;-3.52	5.55	0.442	0.16582	.	0.181977	0.64402	D	0.000015	D	0.93154	0.7820	M	0.68952	2.095	0.38835	D	0.955925	P	0.47484	0.896	P	0.49192	0.602	D	0.89165	0.3533	10	0.32370	T	0.25	1.2825	8.6843	0.34227	0.7054:0.0:0.2946:0.0	.	96	Q13326	SGCG_HUMAN	P	96	ENSP00000218867:H96P;ENSP00000444100:H96P;ENSP00000442232:H96P	ENSP00000218867:H96P	H	+	2	0	SGCG	22706841	0.999000	0.42202	0.997000	0.53966	0.936000	0.57629	0.818000	0.27295	-0.123000	0.11745	0.477000	0.44152	CAC	SGCG	-	pfam_Sarcoglycan	ENSG00000102683		0.338	SGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCG	HGNC	protein_coding	OTTHUMT00000044151.1	157	0.63	1	A	NM_000231		23808841	23808841	+1	no_errors	ENST00000218867	ensembl	human	known	69_37n	missense	151	11.11	19	SNP	1.000	C
SIDT2	51092	genome.wustl.edu	37	11	117054809	117054809	+	Silent	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:117054809G>C	ENST00000324225.4	+	8	1353	c.822G>C	c.(820-822)ggG>ggC	p.G274G	SIDT2_ENST00000530948.1_3'UTR|SIDT2_ENST00000431081.2_Silent_p.G274G	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	274					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TCGATCAAGGGCACCGCCAGA	0.542																																						dbGAP											0													79.0	70.0	73.0					11																	117054809		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.822G>C	11.37:g.117054809G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBY7|Q9Y357	Silent	SNP	NULL	p.G274	ENST00000324225.4	37	c.822	CCDS31682.1	11																																																																																			SIDT2	-	NULL	ENSG00000149577		0.542	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1	219	0.00	0	G	NM_015996		117054809	117054809	+1	no_errors	ENST00000278951	ensembl	human	known	69_37n	silent	85	52.51	94	SNP	1.000	C
SIGLEC10	89790	genome.wustl.edu	37	19	51920020	51920020	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:51920020G>T	ENST00000339313.5	-	3	722	c.606C>A	c.(604-606)ttC>ttA	p.F202L	CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.F144L|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.F144L|SIGLEC10_ENST00000442846.3_Missense_Mutation_p.F144L|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.F202L|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.F202L|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.F202L|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000436984.2_Missense_Mutation_p.F154L			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	202	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GTCTGGGCGTGAAGCTGAGCA	0.607																																						dbGAP											0													137.0	111.0	120.0					19																	51920020		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.606C>A	19.37:g.51920020G>T	ENSP00000345243:p.Phe202Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.F202L	ENST00000339313.5	37	c.606	CCDS12832.1	19	.	.	.	.	.	.	.	.	.	.	.	2.744	-0.261479	0.05791	.	.	ENSG00000142512	ENST00000353836;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313;ENST00000529627;ENST00000530476	T;D;T;D;T;D;D;T;D;T	0.85258	-0.77;-1.96;-0.77;-1.96;-0.77;-1.96;-1.96;-0.77;-1.96;-0.77	4.69	1.11	0.20524	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.686361	0.13350	N	0.394504	T	0.61652	0.2364	N	0.04090	-0.28	0.09310	N	1	B;B;B;B;B;B;B	0.31125	0.004;0.309;0.002;0.006;0.022;0.006;0.021	B;B;B;B;B;B;B	0.32022	0.006;0.139;0.001;0.02;0.028;0.028;0.112	T	0.54622	-0.8266	10	0.07175	T	0.84	.	4.5876	0.12289	0.2151:0.1812:0.6038:0.0	.	154;202;144;202;144;144;202	C9JM10;E9PL79;C9JJ33;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;SIG10_HUMAN	L	202;144;202;144;202;144;154;202;16;169	ENSP00000342389:F202L;ENSP00000395475:F144L;ENSP00000348646:F202L;ENSP00000408387:F144L;ENSP00000431444:F202L;ENSP00000389132:F144L;ENSP00000414324:F154L;ENSP00000345243:F202L;ENSP00000435281:F16L;ENSP00000433838:F169L	ENSP00000345243:F202L	F	-	3	2	SIGLEC10	56611832	0.989000	0.36119	0.003000	0.11579	0.145000	0.21501	1.514000	0.35834	0.027000	0.15297	0.313000	0.20887	TTC	SIGLEC10	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000142512		0.607	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC10	HGNC	protein_coding	OTTHUMT00000384620.2	677	0.15	1	G	NM_033130		51920020	51920020	-1	no_errors	ENST00000339313	ensembl	human	known	69_37n	missense	415	31.40	190	SNP	0.067	T
SIT1	27240	genome.wustl.edu	37	9	35650368	35650368	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:35650368T>A	ENST00000259608.3	-	3	367	c.281A>T	c.(280-282)cAt>cTt	p.H94L	SIT1_ENST00000474403.1_5'UTR	NM_014450.2	NP_055265.1	Q9Y3P8	SIT1_HUMAN	signaling threshold regulating transmembrane adaptor 1	94					immune system process (GO:0002376)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	kinase binding (GO:0019900)|SH2 domain binding (GO:0042169)			endometrium(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	9			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGTAGATAATGCAGGTTCCC	0.582																																						dbGAP											0													83.0	81.0	81.0					9																	35650368		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6582.1	9p13-p12	2008-02-05	2005-04-26		ENSG00000137078	ENSG00000137078			17710	protein-coding gene	gene with protein product	"""SHP2 interacting transmembrane adaptor"""	604964	"""suppression inducing transmembrane adaptor 1"""			11491537, 10209036	Standard	NM_014450		Approved	SIT	uc003zxe.1	Q9Y3P8	OTTHUMG00000019867	ENST00000259608.3:c.281A>T	9.37:g.35650368T>A	ENSP00000259608:p.His94Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBP9	Missense_Mutation	SNP	NULL	p.H94L	ENST00000259608.3	37	c.281	CCDS6582.1	9	.	.	.	.	.	.	.	.	.	.	T	12.74	2.029519	0.35797	.	.	ENSG00000137078	ENST00000259608	T	0.43294	0.95	5.04	2.46	0.29980	.	0.279483	0.26122	N	0.026206	T	0.28699	0.0711	L	0.27053	0.805	0.34796	D	0.736202	P	0.36535	0.557	B	0.38842	0.283	T	0.34700	-0.9818	10	0.30078	T	0.28	-9.5484	9.2345	0.37457	0.0:0.0:0.4488:0.5512	.	94	Q9Y3P8	SIT1_HUMAN	L	94	ENSP00000259608:H94L	ENSP00000259608:H94L	H	-	2	0	SIT1	35640368	0.999000	0.42202	0.999000	0.59377	0.949000	0.60115	1.648000	0.37271	0.853000	0.35312	0.383000	0.25322	CAT	SIT1	-	NULL	ENSG00000137078		0.582	SIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIT1	HGNC	protein_coding	OTTHUMT00000052322.1	201	0.00	0	T	NM_014450		35650368	35650368	-1	no_errors	ENST00000259608	ensembl	human	known	69_37n	missense	121	33.70	62	SNP	0.995	A
SKA2P1	729012	genome.wustl.edu	37	9	125524220	125524220	+	IGR	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:125524220G>C								OR1L6 (11158 upstream) : OR5C1 (26929 downstream)																							ATTCAATACAGGCTGGAATAT	0.393																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.125524220G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R30T		37	c.89		9	.	.	.	.	.	.	.	.	.	.	g	11.52	1.663519	0.29515	.	.	ENSG00000232387	ENST00000425592	.	.	.	3.07	2.16	0.27623	.	0.341536	0.33040	N	0.005347	T	0.59636	0.2208	.	.	.	0.36792	D	0.884895	.	.	.	.	.	.	T	0.65121	-0.6245	6	0.72032	D	0.01	.	5.8192	0.18518	0.1495:0.0:0.8505:0.0	.	.	.	.	T	30	.	ENSP00000407425:R30T	R	+	2	0	SKA2L	124564041	0.994000	0.37717	1.000000	0.80357	0.055000	0.15305	0.218000	0.17622	0.858000	0.35431	0.586000	0.80456	AGG	SKA2L	-	NULL	ENSG00000232387	0	0.393					SKA2L	HGNC			406	0.00	0	G			125524220	125524220	+1	no_errors	ENST00000425592	ensembl	human	known	69_37n	missense	181	38.85	115	SNP	1.000	C
SLC12A7	10723	genome.wustl.edu	37	5	1073784	1073784	+	Silent	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:1073784G>A	ENST00000264930.5	-	17	2248	c.2205C>T	c.(2203-2205)taC>taT	p.Y735Y		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	735					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GCTTGTCCAGGTACGTCCCCT	0.701																																						dbGAP											0													58.0	62.0	60.0					5																	1073784		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2205C>T	5.37:g.1073784G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	NULL	p.P93S	ENST00000264930.5	37	c.277	CCDS34129.1	5	.	.	.	.	.	.	.	.	.	.	g	4.219	0.039445	0.08148	.	.	ENSG00000113504	ENST00000513223	.	.	.	4.04	1.13	0.20643	.	.	.	.	.	T	0.54464	0.1860	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44877	-0.9299	4	.	.	.	.	7.2242	0.26005	0.3971:0.0:0.6029:0.0	.	.	.	.	S	93	.	.	P	-	1	0	SLC12A7	1126784	1.000000	0.71417	0.994000	0.49952	0.421000	0.31385	0.867000	0.27968	0.277000	0.22141	0.467000	0.42956	CCT	SLC12A7	-	NULL	ENSG00000113504		0.701	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2	50	0.00	0	G	NM_006598		1073784	1073784	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000513223	ensembl	human	putative	69_37n	missense	21	25.00	7	SNP	0.999	A
SLC4A11	83959	genome.wustl.edu	37	20	3208935	3208935	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr20:3208935G>A	ENST00000380056.3	-	18	2623	c.2576C>T	c.(2575-2577)cCc>cTc	p.P859L	SLC4A11_ENST00000539553.2_Missense_Mutation_p.P843L|SLC4A11_ENST00000380059.3_Missense_Mutation_p.P886L|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	859	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CATGATGAGGGGAAAGATCAT	0.617																																					NSCLC(190;922 2139 10266 10292 38692)	dbGAP											0													78.0	69.0	72.0					20																	3208935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.2576C>T	20.37:g.3208935G>A	ENSP00000369396:p.Pro859Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_PTS_EIIA_2,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk	p.P886L	ENST00000380056.3	37	c.2657	CCDS13052.1	20	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689252	0.88735	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	D;D;D	0.95272	-3.66;-3.66;-3.63	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.96577	0.8883	M	0.68593	2.085	0.80722	D	1	D;P;P	0.54207	0.965;0.941;0.941	P;P;P	0.61201	0.885;0.77;0.621	D	0.96963	0.9703	10	0.87932	D	0	.	19.0884	0.93215	0.0:0.0:1.0:0.0	.	843;886;859	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	L	886;859;843	ENSP00000369399:P886L;ENSP00000369396:P859L;ENSP00000441370:P843L	ENSP00000369396:P859L	P	-	2	0	SLC4A11	3156935	1.000000	0.71417	0.987000	0.45799	0.811000	0.45836	7.977000	0.88081	2.515000	0.84797	0.455000	0.32223	CCC	SLC4A11	-	NULL	ENSG00000088836		0.617	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	92	0.00	0	G			3208935	3208935	-1	no_errors	ENST00000380059	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	A
SLC4A2	6522	genome.wustl.edu	37	7	150769218	150769218	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr7:150769218G>C	ENST00000485713.1	+	16	3570	c.2530G>C	c.(2530-2532)Gtg>Ctg	p.V844L	SLC4A2_ENST00000413384.2_Missense_Mutation_p.V844L|SLC4A2_ENST00000461735.1_Missense_Mutation_p.V830L|SLC4A2_ENST00000392826.2_Missense_Mutation_p.V835L|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000310317.5_Missense_Mutation_p.V762L	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	844	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTACAAGCTGGTGAAGGTGGG	0.607																																						dbGAP											0													82.0	89.0	86.0					7																	150769218		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.2530G>C	7.37:g.150769218G>C	ENSP00000419412:p.Val844Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.V844L	ENST00000485713.1	37	c.2530	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	G	9.956	1.221411	0.22457	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	4.85	-4.14	0.03892	Bicarbonate transporter, C-terminal (1);	0.733878	0.12820	N	0.436517	T	0.60971	0.2310	L	0.33753	1.03	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.15870	0.005;0.008;0.014	T	0.45071	-0.9286	10	0.28530	T	0.3	.	8.5236	0.33291	0.7106:0.0:0.1661:0.1233	.	835;830;844	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	L	844;844;762;835;830	ENSP00000419412:V844L;ENSP00000405600:V844L;ENSP00000311402:V762L;ENSP00000376571:V835L;ENSP00000419164:V830L	ENSP00000311402:V762L	V	+	1	0	SLC4A2	150400151	0.000000	0.05858	0.917000	0.36280	0.992000	0.81027	-0.264000	0.08658	-0.655000	0.05387	0.561000	0.74099	GTG	SLC4A2	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	ENSG00000164889		0.607	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	294	0.00	0	G	NM_003040		150769218	150769218	+1	no_errors	ENST00000413384	ensembl	human	known	69_37n	missense	215	13.31	33	SNP	0.100	C
SLIT3	6586	genome.wustl.edu	37	5	168199824	168199824	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:168199824C>T	ENST00000519560.1	-	14	1840	c.1421G>A	c.(1420-1422)cGc>cAc	p.R474H	SLIT3_ENST00000404867.3_Missense_Mutation_p.R474H|SLIT3_ENST00000332966.8_Missense_Mutation_p.R474H	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	474	LRRCT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGCTGATGCGCTTGTTGGC	0.627																																					Ovarian(29;311 847 10864 17279 24903)	dbGAP											0													47.0	48.0	47.0					5																	168199824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1421G>A	5.37:g.168199824C>T	ENSP00000430333:p.Arg474His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.R474H	ENST00000519560.1	37	c.1421	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.537947	0.96460	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.76709	-1.04;-1.03;-1.03	5.49	5.49	0.81192	Cysteine-rich flanking region, C-terminal (2);	0.107094	0.64402	D	0.000009	D	0.89497	0.6732	M	0.83223	2.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.997;0.999	D	0.90598	0.4542	10	0.87932	D	0	.	19.3785	0.94521	0.0:1.0:0.0:0.0	.	474;474;474	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	H	474	ENSP00000430333:R474H;ENSP00000332164:R474H;ENSP00000384890:R474H	ENSP00000332164:R474H	R	-	2	0	SLIT3	168132402	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.566000	0.86566	0.561000	0.74099	CGC	SLIT3	-	pfam_Cys-rich_flank_reg_C,smart_Cys-rich_flank_reg_C	ENSG00000184347		0.627	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	123	0.00	0	C	NM_003062		168199824	168199824	-1	no_errors	ENST00000519560	ensembl	human	known	69_37n	missense	59	14.29	10	SNP	1.000	T
SP100	6672	genome.wustl.edu	37	2	231331031	231331031	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:231331031G>A	ENST00000264052.5	+	12	1512	c.1157G>A	c.(1156-1158)aGa>aAa	p.R386K	SP100_ENST00000409824.1_Missense_Mutation_p.R361K|SP100_ENST00000340126.4_Missense_Mutation_p.R386K|SP100_ENST00000409341.1_Missense_Mutation_p.R386K|SP100_ENST00000409897.1_Missense_Mutation_p.R351K|SP100_ENST00000341950.4_Missense_Mutation_p.R386K|SP100_ENST00000409112.1_Missense_Mutation_p.R386K|SP100_ENST00000427101.2_Missense_Mutation_p.R361K	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	386	Sufficient to mediate interaction with ETS1.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ATGGATTTCAGAAAATTATCT	0.343																																						dbGAP											0													46.0	48.0	47.0					2																	231331031		2202	4295	6497	-	-	-	SO:0001583	missense	0			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1157G>A	2.37:g.231331031G>A	ENSP00000264052:p.Arg386Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.R386K	ENST00000264052.5	37	c.1157	CCDS2477.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.91|11.91	1.779174|1.779174	0.31502|0.31502	.|.	.|.	ENSG00000067066|ENSG00000067066	ENST00000413284|ENST00000264052;ENST00000427101;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897;ENST00000452345	.|T;T;T;T;D;T;T;T;T	.|0.83335	.|1.95;1.8;1.8;1.77;-1.71;-0.12;2.03;1.79;0.26	3.85|3.85	1.05|1.05	0.20165|0.20165	.|.	.|.	.|.	.|.	.|.	T|T	0.65801|0.65801	0.2726|0.2726	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	.|P;P;P;P;P;P;P	.|0.41393	.|0.748;0.633;0.506;0.633;0.633;0.633;0.748	.|B;B;B;B;B;B;B	.|0.36959	.|0.237;0.12;0.237;0.075;0.12;0.12;0.237	T|T	0.57877|0.57877	-0.7735|-0.7735	5|9	.|0.05436	.|T	.|0.98	.|.	5.676|5.676	0.17749|0.17749	0.3538:0.0:0.6462:0.0|0.3538:0.0:0.6462:0.0	.|.	.|361;351;386;386;386;361;386	.|F8WFE2;B8ZZD8;P23497-4;P23497;E7EUA7;E9PHV6;P23497-2	.|.;.;.;SP100_HUMAN;.;.;.	K|K	34|386;361;361;386;386;386;386;351;51	.|ENSP00000264052:R386K;ENSP00000399389:R361K;ENSP00000387311:R361K;ENSP00000386404:R386K;ENSP00000386427:R386K;ENSP00000343023:R386K;ENSP00000342729:R386K;ENSP00000386998:R351K;ENSP00000416563:R51K	.|ENSP00000264052:R386K	E|R	+|+	1|2	0|0	SP100|SP100	231039275|231039275	0.007000|0.007000	0.16637|0.16637	0.002000|0.002000	0.10522|0.10522	0.022000|0.022000	0.10575|0.10575	1.017000|1.017000	0.29989|0.29989	0.222000|0.222000	0.20900|0.20900	0.460000|0.460000	0.39030|0.39030	GAA|AGA	SP100	-	NULL	ENSG00000067066		0.343	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	HGNC	protein_coding	OTTHUMT00000256914.2	78	0.00	0	G	NM_003113		231331031	231331031	+1	no_errors	ENST00000340126	ensembl	human	known	69_37n	missense	119	15.60	22	SNP	0.002	A
CTBS	1486	genome.wustl.edu	37	1	85018771	85018772	+	3'UTR	INS	-	-	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:85018771_85018772insA	ENST00000370630.5	-	0	3116_3117				CTBS_ENST00000477677.1_5'Flank	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-						chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)	p.I452fs*1(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		AACTGGCACAGAAAAAAAAAAT	0.238																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)																																								-	-	-	SO:0001624	3_prime_UTR_variant	0			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.*1911->T	1.37:g.85018781_85018781dupA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX50	RNA	INS	-	NULL	ENST00000370630.5	37	NULL	CCDS698.1	1																																																																																			SPATA1	-	-	ENSG00000122432		0.238	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA1	HGNC	protein_coding	OTTHUMT00000027457.2	18	0.00	0	-	NM_004388		85018771	85018772	+1	no_errors	ENST00000460286	ensembl	human	known	69_37n	rna	13	18.75	3	INS	1.000:1.000	A
SPAG17	200162	genome.wustl.edu	37	1	118550690	118550690	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:118550690C>A	ENST00000336338.5	-	31	4629	c.4564G>T	c.(4564-4566)Gca>Tca	p.A1522S		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1522						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TGTGGCTTTGCAATAATAGTT	0.488																																						dbGAP											0													149.0	128.0	135.0					1																	118550690		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4564G>T	1.37:g.118550690C>A	ENSP00000337804:p.Ala1522Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.A1522S	ENST00000336338.5	37	c.4564	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221541	0.58560	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.20200	2.09	5.83	5.83	0.93111	.	0.050787	0.85682	D	0.000000	T	0.26846	0.0657	M	0.68952	2.095	0.36657	D	0.87773	P	0.51537	0.946	P	0.52672	0.706	T	0.02526	-1.1146	10	0.62326	D	0.03	.	14.4191	0.67171	0.1481:0.8519:0.0:0.0	.	1522	Q6Q759	SPG17_HUMAN	S	1522;2	ENSP00000337804:A1522S	ENSP00000337804:A1522S	A	-	1	0	SPAG17	118352213	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.704000	0.54815	2.763000	0.94921	0.563000	0.77884	GCA	SPAG17	-	NULL	ENSG00000155761		0.488	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	342	0.00	0	C	NM_206996		118550690	118550690	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	missense	280	14.11	46	SNP	0.998	A
SQRDL	58472	genome.wustl.edu	37	15	45951281	45951281	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr15:45951281G>A	ENST00000260324.7	+	2	546	c.160G>A	c.(160-162)Ggc>Agc	p.G54S	RP11-96O20.4_ENST00000564080.1_Missense_Mutation_p.G54S|SQRDL_ENST00000568606.1_Missense_Mutation_p.G54S	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	54					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		TGGGGGCAGTGGCGGAATCAC	0.632																																						dbGAP											0													38.0	40.0	40.0					15																	45951281		2198	4297	6495	-	-	-	SO:0001583	missense	0			AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.160G>A	15.37:g.45951281G>A	ENSP00000260324:p.Gly54Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQM8	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.G54S	ENST00000260324.7	37	c.160	CCDS10127.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.511391	0.96386	.	.	ENSG00000137767	ENST00000260324	T	0.54479	0.57	5.5	5.5	0.81552	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.74550	0.3731	M	0.81239	2.535	0.80722	D	1	D	0.65815	0.995	D	0.70016	0.967	T	0.77958	-0.2392	10	0.87932	D	0	.	17.982	0.89144	0.0:0.0:1.0:0.0	.	54	Q9Y6N5	SQRD_HUMAN	S	54	ENSP00000260324:G54S	ENSP00000260324:G54S	G	+	1	0	SQRDL	43738573	1.000000	0.71417	0.897000	0.35233	0.986000	0.74619	8.888000	0.92464	2.580000	0.87095	0.655000	0.94253	GGC	SQRDL	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000137767		0.632	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SQRDL	HGNC	protein_coding	OTTHUMT00000254319.2	214	0.00	0	G			45951281	45951281	+1	no_errors	ENST00000260324	ensembl	human	known	69_37n	missense	110	23.61	34	SNP	0.998	A
SRGAP1	57522	genome.wustl.edu	37	12	64456793	64456793	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:64456793G>T	ENST00000355086.3	+	7	1422	c.898G>T	c.(898-900)Gac>Tac	p.D300Y	SRGAP1_ENST00000357825.3_Missense_Mutation_p.D300Y|SRGAP1_ENST00000543397.1_Missense_Mutation_p.D260Y|RP11-196H14.2_ENST00000535594.1_RNA	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	300	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TGAGGGCTTAGACATTATTGA	0.453																																						dbGAP											0													117.0	106.0	109.0					12																	64456793		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.898G>T	12.37:g.64456793G>T	ENSP00000347198:p.Asp300Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.D300Y	ENST00000355086.3	37	c.898	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673318	0.88445	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.50548	0.74;0.74;2.34	4.65	4.65	0.58169	.	0.000000	0.36815	U	0.002397	T	0.68860	0.3047	M	0.77103	2.36	0.80722	D	1	D;D;D	0.65815	0.995;0.991;0.982	P;D;D	0.66602	0.845;0.945;0.926	T	0.69562	-0.5112	9	.	.	.	.	18.8491	0.92220	0.0:0.0:1.0:0.0	.	300;260;300	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	Y	300;300;260	ENSP00000347198:D300Y;ENSP00000350480:D300Y;ENSP00000437948:D260Y	.	D	+	1	0	SRGAP1	62743060	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.519000	0.98025	2.868000	0.98415	0.557000	0.71058	GAC	SRGAP1	-	NULL	ENSG00000196935		0.453	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	294	0.34	1	G			64456793	64456793	+1	no_errors	ENST00000355086	ensembl	human	known	69_37n	missense	258	14.85	45	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2815562	2815562	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:2815562C>G	ENST00000301740.8	+	11	5582	c.5033C>G	c.(5032-5034)cCc>cGc	p.P1678R		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1678	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TCACCAGAGCCCAAGACCAAG	0.577																																						dbGAP											0													105.0	84.0	91.0					16																	2815562		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5033C>G	16.37:g.2815562C>G	ENSP00000301740:p.Pro1678Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.P1678R	ENST00000301740.8	37	c.5033	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	1.806	-0.475781	0.04414	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.47177	0.85	5.47	4.52	0.55395	.	0.206622	0.34628	N	0.003805	T	0.29588	0.0738	N	0.08118	0	0.31194	N	0.700544	B	0.29085	0.232	B	0.31191	0.125	T	0.38178	-0.9673	10	0.72032	D	0.01	-4.455	11.8123	0.52189	0.0:0.9147:0.0:0.0853	.	1678	Q9UQ35	SRRM2_HUMAN	R	1678;1678;930	ENSP00000301740:P1678R	ENSP00000301740:P1678R	P	+	2	0	SRRM2	2755563	0.978000	0.34361	0.974000	0.42286	0.978000	0.69477	1.974000	0.40559	1.307000	0.44944	0.655000	0.94253	CCC	SRRM2	-	NULL	ENSG00000167978		0.577	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	167	0.00	0	C			2815562	2815562	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	174	14.29	29	SNP	0.952	G
ST6GALNAC1	55808	genome.wustl.edu	37	17	74639652	74639652	+	Silent	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:74639652G>C	ENST00000156626.7	-	1	268	c.69C>G	c.(67-69)gtC>gtG	p.V23V	ST6GALNAC1_ENST00000590878.1_5'UTR|ST6GALNAC1_ENST00000589992.1_Silent_p.V23V	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	23					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						AGAAGACCAGGACAGCCAGAA	0.517																																						dbGAP											0													90.0	82.0	85.0					17																	74639652		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.69C>G	17.37:g.74639652G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW90|Q9NSC6	Silent	SNP	pfam_Glyco_trans_29	p.V23	ENST00000156626.7	37	c.69	CCDS11748.1	17																																																																																			ST6GALNAC1	-	NULL	ENSG00000070526		0.517	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC1	HGNC	protein_coding	OTTHUMT00000450974.1	170	0.58	1	G	NM_018414		74639652	74639652	-1	no_errors	ENST00000156626	ensembl	human	known	69_37n	silent	326	11.41	42	SNP	0.000	C
STIP1	10963	genome.wustl.edu	37	11	63960739	63960739	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:63960739C>G	ENST00000305218.4	+	2	346	c.199C>G	c.(199-201)Cta>Gta	p.L67V	STIP1_ENST00000538945.1_Missense_Mutation_p.L67V|STIP1_ENST00000358794.5_Missense_Mutation_p.L114V|STIP1_ENST00000540501.1_3'UTR|STIP1_ENST00000543847.1_Missense_Mutation_p.L67V	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	67					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						GACTGTCGACCTAAAGCCTGA	0.557																																						dbGAP											0													87.0	81.0	83.0					11																	63960739		2201	4297	6498	-	-	-	SO:0001583	missense	0			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.199C>G	11.37:g.63960739C>G	ENSP00000305958:p.Leu67Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_STI1_HS-bd,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L67V	ENST00000305218.4	37	c.199	CCDS8058.1	11	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636282	0.47049	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945;ENST00000543847	T;T;T;T	0.21734	1.99;1.99;2.21;1.99	5.19	-4.1	0.03940	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.343528	0.26503	N	0.024009	T	0.29976	0.0750	M	0.82923	2.615	0.54753	D	0.999986	P;B;B	0.44281	0.831;0.361;0.259	P;B;B	0.46237	0.508;0.254;0.125	T	0.46596	-0.9180	10	0.62326	D	0.03	-19.4712	13.037	0.58877	0.0:0.4287:0.0:0.5713	.	67;67;67	F5H0T1;P31948;F5H783	.;STIP1_HUMAN;.	V	114;67;67;67	ENSP00000351646:L114V;ENSP00000305958:L67V;ENSP00000445957:L67V;ENSP00000442704:L67V	ENSP00000305958:L67V	L	+	1	2	STIP1	63717315	0.989000	0.36119	0.105000	0.21289	0.468000	0.32798	0.224000	0.17738	-0.601000	0.05783	-0.302000	0.09304	CTA	STIP1	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168439		0.557	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIP1	HGNC	protein_coding	OTTHUMT00000396289.2	158	0.00	0	C	NM_006819		63960739	63960739	+1	no_errors	ENST00000305218	ensembl	human	known	69_37n	missense	162	16.06	31	SNP	0.648	G
SYMPK	8189	genome.wustl.edu	37	19	46341763	46341763	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:46341763C>A	ENST00000245934.7	-	10	1442	c.1198G>T	c.(1198-1200)Gag>Tag	p.E400*		NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	400					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TGCAGGAACTCAGCTGTGATG	0.612																																						dbGAP											0													76.0	59.0	64.0					19																	46341763		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.1198G>T	19.37:g.46341763C>A	ENSP00000245934:p.Glu400*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00521|O00689|O00733|Q59GT5|Q8N2U5	Nonsense_Mutation	SNP	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.E400*	ENST00000245934.7	37	c.1198	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	C	41	8.778794	0.98950	.	.	ENSG00000125755	ENST00000245934	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	17.7724	0.88496	0.0:1.0:0.0:0.0	.	.	.	.	X	400	.	ENSP00000245934:E400X	E	-	1	0	SYMPK	51033603	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	6.827000	0.75303	2.798000	0.96311	0.650000	0.86243	GAG	SYMPK	-	superfamily_ARM-type_fold	ENSG00000125755		0.612	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	HGNC	protein_coding	OTTHUMT00000316581.1	123	0.00	0	C	NM_004819		46341763	46341763	-1	no_errors	ENST00000245934	ensembl	human	known	69_37n	nonsense	101	18.55	23	SNP	1.000	A
TCHP	84260	genome.wustl.edu	37	12	110352416	110352416	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:110352416A>C	ENST00000312777.5	+	11	1518	c.1304A>C	c.(1303-1305)cAg>cCg	p.Q435P	TCHP_ENST00000405876.4_Missense_Mutation_p.Q435P	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						GCCAGGAAGCAGGAGCTGGAA	0.577																																						dbGAP											0													47.0	47.0	47.0					12																	110352416		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.1304A>C	12.37:g.110352416A>C	ENSP00000324404:p.Gln435Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q435P	ENST00000312777.5	37	c.1304	CCDS9137.1	12	.	.	.	.	.	.	.	.	.	.	A	8.772	0.926235	0.18056	.	.	ENSG00000139437	ENST00000405876;ENST00000312777;ENST00000551627	T;T	0.10288	2.89;2.89	5.57	0.409	0.16382	.	0.299003	0.32244	N	0.006380	T	0.09069	0.0224	L	0.59436	1.845	0.34879	D	0.744377	P	0.39157	0.662	B	0.39617	0.305	T	0.21177	-1.0253	10	0.35671	T	0.21	-6.3261	1.4006	0.02270	0.5029:0.1361:0.2294:0.1315	.	435	Q9BT92	TCHP_HUMAN	P	435;435;79	ENSP00000384520:Q435P;ENSP00000324404:Q435P	ENSP00000324404:Q435P	Q	+	2	0	TCHP	108836799	0.990000	0.36364	0.981000	0.43875	0.004000	0.04260	0.821000	0.27338	0.066000	0.16515	-2.033000	0.00422	CAG	TCHP	-	NULL	ENSG00000139437		0.577	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TCHP	HGNC	protein_coding	OTTHUMT00000403289.1	133	0.00	0	A	NM_032300		110352416	110352416	+1	no_errors	ENST00000312777	ensembl	human	known	69_37n	missense	147	15.52	27	SNP	0.989	C
TEP1	7011	genome.wustl.edu	37	14	20837883	20837883	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:20837883T>A	ENST00000262715.5	-	52	7413	c.7373A>T	c.(7372-7374)gAg>gTg	p.E2458V	TEP1_ENST00000556935.1_Missense_Mutation_p.E2350V	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2458					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		ACTAGGATTCTCTAAGTTTAT	0.448																																						dbGAP											0													119.0	119.0	119.0					14																	20837883		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.7373A>T	14.37:g.20837883T>A	ENSP00000262715:p.Glu2458Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV9	Missense_Mutation	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E2458V	ENST00000262715.5	37	c.7373	CCDS9548.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.09|17.09	3.301675|3.301675	0.60195|0.60195	.|.	.|.	ENSG00000129566|ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935|ENST00000553984	T;T|.	0.51071|.	0.73;0.72|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.576272|.	0.18086|.	N|.	0.152159|.	T|T	0.65302|0.65302	0.2678|0.2678	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D;D;D|.	0.61080|.	0.989;0.98;0.982|.	P;P;P|.	0.61722|.	0.893;0.711;0.785|.	T|T	0.64711|0.64711	-0.6343|-0.6343	10|5	0.21540|.	T|.	0.41|.	-8.7607|-8.7607	11.9586|11.9586	0.52995|0.52995	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2350;1801;2458|.	G3V5X7;G3V2A4;Q99973|.	.;.;TEP1_HUMAN|.	V|S	2458;2458;2350|114	ENSP00000262715:E2458V;ENSP00000452574:E2350V|.	ENSP00000262715:E2458V|.	E|R	-|-	2|3	0|2	TEP1|TEP1	19907723|19907723	0.921000|0.921000	0.31238|0.31238	0.936000|0.936000	0.37596|0.37596	0.446000|0.446000	0.32137|0.32137	2.100000|2.100000	0.41777|0.41777	2.085000|2.085000	0.62840|0.62840	0.402000|0.402000	0.26972|0.26972	GAG|AGA	TEP1	-	NULL	ENSG00000129566		0.448	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	392	0.00	0	T	NM_007110		20837883	20837883	-1	no_errors	ENST00000262715	ensembl	human	known	69_37n	missense	382	16.59	76	SNP	0.988	A
TEX15	56154	genome.wustl.edu	37	8	30705392	30705392	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr8:30705392G>T	ENST00000256246.2	-	1	1216	c.1142C>A	c.(1141-1143)gCt>gAt	p.A381D	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	381					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTTCGGGAAAGCTTCAGTTAT	0.343																																						dbGAP											0													102.0	100.0	101.0					8																	30705392		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1142C>A	8.37:g.30705392G>T	ENSP00000256246:p.Ala381Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A381D	ENST00000256246.2	37	c.1142	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571681	0.28003	.	.	ENSG00000133863	ENST00000256246	T	0.11063	2.81	5.61	-2.11	0.07187	.	0.842647	0.10516	N	0.665497	T	0.06690	0.0171	L	0.32530	0.975	0.19575	N	0.999969	B	0.25390	0.125	B	0.21917	0.037	T	0.37934	-0.9684	10	0.87932	D	0	.	1.6655	0.02801	0.2038:0.1023:0.2774:0.4165	.	381	Q9BXT5	TEX15_HUMAN	D	381	ENSP00000256246:A381D	ENSP00000256246:A381D	A	-	2	0	TEX15	30824934	0.108000	0.22018	0.671000	0.29857	0.010000	0.07245	0.119000	0.15626	-0.366000	0.08064	-0.157000	0.13467	GCT	TEX15	-	NULL	ENSG00000133863		0.343	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	492	0.40	2	G			30705392	30705392	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	missense	424	20.90	112	SNP	0.125	T
TG	7038	genome.wustl.edu	37	8	134034236	134034236	+	Splice_Site	SNP	G	G	A	rs137871955		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr8:134034236G>A	ENST00000220616.4	+	40	6917	c.6877G>A	c.(6877-6879)Gcc>Acc	p.A2293T	TG_ENST00000542445.1_Splice_Site_p.A663T|TG_ENST00000519543.1_Splice_Site_p.A426T|TG_ENST00000377869.1_Splice_Site_p.A2236T	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2293					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATACCCACAGGCCCCTAACGC	0.567																																						dbGAP											0													106.0	88.0	94.0					8																	134034236		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6877-1G>A	8.37:g.134034236G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.A2293T	ENST00000220616.4	37	c.6877	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.90|10.90	1.480341|1.480341	0.26598|0.26598	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543|ENST00000519178;ENST00000518108	T;T;T;T|.	0.66815|.	-0.23;-0.23;-0.23;-0.23|.	5.68|5.68	4.8|4.8	0.61643|0.61643	Carboxylesterase, type B (1);|.	1.423370|.	0.04163|.	N|.	0.323319|.	T|T	0.39200|0.39200	0.1069|0.1069	N|N	0.11845|0.11845	0.185|0.185	0.36426|0.36426	D|D	0.864648|0.864648	B;B;B|.	0.19445|.	0.008;0.004;0.036|.	B;B;B|.	0.19666|.	0.018;0.009;0.026|.	T|T	0.41448|0.41448	-0.9508|-0.9508	9|5	.|.	.|.	.|.	.|.	12.1536|12.1536	0.54064|0.54064	0.082:0.0:0.918:0.0|0.082:0.0:0.918:0.0	.|.	426;663;2293|.	E7EVM0;F5GWW5;P01266|.	.;.;THYG_HUMAN|.	T|D	2236;1099;2293;663;426|748;88	ENSP00000367100:A2236T;ENSP00000220616:A2293T;ENSP00000441693:A663T;ENSP00000430430:A426T|.	.|.	A|G	+|+	1|2	0|0	TG|TG	134103418|134103418	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.053000|0.053000	0.15095|0.15095	4.402000|4.402000	0.59722|0.59722	2.692000|2.692000	0.91855|0.91855	0.561000|0.561000	0.74099|0.74099	GCC|GGC	TG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin	ENSG00000042832		0.567	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	240	0.00	0	G	NM_003235	Missense_Mutation	134034236	134034236	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	313	12.53	45	SNP	0.957	A
TGFBI	7045	genome.wustl.edu	37	5	135388753	135388753	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:135388753C>G	ENST00000442011.2	+	8	1232	c.1071C>G	c.(1069-1071)atC>atG	p.I357M	TGFBI_ENST00000305126.8_Missense_Mutation_p.I357M	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	357	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ATAAAGACATCCTAGCCACCA	0.602																																						dbGAP											0													76.0	84.0	81.0					5																	135388753		2085	4215	6300	-	-	-	SO:0001583	missense	0			M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.1071C>G	5.37:g.135388753C>G	ENSP00000416330:p.Ile357Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_EMI_domain,pfscan_FAS1_domain	p.I357M	ENST00000442011.2	37	c.1071	CCDS47266.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.03|15.03	2.713682|2.713682	0.48517|0.48517	.|.	.|.	ENSG00000120708|ENSG00000120708	ENST00000442011;ENST00000398813;ENST00000305126|ENST00000508767;ENST00000514554	D;D|.	0.92699|.	-3.09;-3.09|.	5.65|5.65	2.67|2.67	0.31697|0.31697	FAS1 domain (5);|.	0.872321|.	0.10458|.	N|.	0.672250|.	T|T	0.47838|0.47838	0.1467|0.1467	M|M	0.78344|0.78344	2.41|2.41	0.21020|0.21020	N|N	0.999805|0.999805	P;P|.	0.36354|.	0.544;0.549|.	P;B|.	0.50896|.	0.653;0.369|.	T|T	0.44314|0.44314	-0.9336|-0.9336	10|5	0.87932|.	D|.	0|.	-14.6476|-14.6476	3.7734|3.7734	0.08650|0.08650	0.1375:0.5897:0.1326:0.1402|0.1375:0.5897:0.1326:0.1402	.|.	90;357|.	B9ZVW9;Q15582|.	.;BGH3_HUMAN|.	M|A	357;90;357|96;75	ENSP00000416330:I357M;ENSP00000306306:I357M|.	ENSP00000306306:I357M|.	I|P	+|+	3|1	3|0	TGFBI|TGFBI	135416652|135416652	0.001000|0.001000	0.12720|0.12720	0.950000|0.950000	0.38849|0.38849	0.734000|0.734000	0.41952|0.41952	0.290000|0.290000	0.18975|0.18975	0.824000|0.824000	0.34613|0.34613	-0.136000|-0.136000	0.14681|0.14681	ATC|CCT	TGFBI	-	pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain	ENSG00000120708		0.602	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBI	HGNC	protein_coding	OTTHUMT00000372108.1	152	0.00	0	C			135388753	135388753	+1	no_errors	ENST00000305126	ensembl	human	known	69_37n	missense	109	16.67	22	SNP	0.166	G
TLE3	7090	genome.wustl.edu	37	15	70346800	70346800	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr15:70346800G>C	ENST00000558939.1	-	16	3189	c.1812C>G	c.(1810-1812)gaC>gaG	p.D604E	TLE3_ENST00000451782.2_Missense_Mutation_p.D601E|TLE3_ENST00000558379.1_Missense_Mutation_p.D599E|TLE3_ENST00000559048.1_Missense_Mutation_p.D604E|TLE3_ENST00000317509.8_Missense_Mutation_p.D592E|TLE3_ENST00000558201.1_Missense_Mutation_p.D610E|TLE3_ENST00000559929.1_Missense_Mutation_p.D614E|TLE3_ENST00000559191.1_Missense_Mutation_p.D185E|TLE3_ENST00000440567.3_Missense_Mutation_p.D594E|TLE3_ENST00000560939.1_Missense_Mutation_p.D606E|TLE3_ENST00000442299.2_Missense_Mutation_p.D596E|TLE3_ENST00000560589.1_Missense_Mutation_p.D548E|TLE3_ENST00000557907.1_Missense_Mutation_p.D596E|TLE3_ENST00000557997.1_Missense_Mutation_p.D596E|TLE3_ENST00000539550.1_Missense_Mutation_p.D531E	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	604					Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGTTGTGCAGGTCCCAGACAG	0.592																																						dbGAP											0													68.0	72.0	70.0					15																	70346800		2168	4289	6457	-	-	-	SO:0001583	missense	0			M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1812C>G	15.37:g.70346800G>C	ENSP00000452871:p.Asp604Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.D604E	ENST00000558939.1	37	c.1812	CCDS45293.1	15	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170292	0.78452	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.01	4.09	0.47781	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.79358	0.4432	M	0.77406	2.37	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.998;0.999;1.0;1.0;0.997;1.0;0.992;0.999	D;D;D;D;D;D;D;D	0.87578	0.968;0.983;0.988;0.989;0.998;0.989;0.928;0.93	T	0.80538	-0.1338	10	0.87932	D	0	-8.1519	8.8375	0.35121	0.1745:0.0:0.8255:0.0	.	594;601;596;599;592;604;604;531	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	E	596;601;604;594;531	ENSP00000390007:D596E;ENSP00000394717:D601E;ENSP00000415057:D594E;ENSP00000442594:D531E	ENSP00000319233:D604E	D	-	3	2	TLE3	68133854	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.667000	0.46808	1.321000	0.45227	0.462000	0.41574	GAC	TLE3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000140332		0.592	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE3	HGNC	protein_coding	OTTHUMT00000416913.1	154	0.00	0	G	NM_005078		70346800	70346800	-1	no_errors	ENST00000558939	ensembl	human	known	69_37n	missense	87	19.44	21	SNP	1.000	C
TLR4	7099	genome.wustl.edu	37	9	120475509	120475509	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:120475509C>A	ENST00000355622.6	+	3	1204	c.1103C>A	c.(1102-1104)tCa>tAa	p.S368*	TLR4_ENST00000394487.4_Nonsense_Mutation_p.S328*|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	368					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	AATGCTTTTTCAGAAGTTGAT	0.378																																						dbGAP											0													53.0	57.0	55.0					9																	120475509		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1103C>A	9.37:g.120475509C>A	ENSP00000363089:p.Ser368*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Nonsense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.S368*	ENST00000355622.6	37	c.1103	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206040	0.58234	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	.	.	.	5.71	-11.4	0.00090	.	3.938130	0.00397	N	0.000054	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.9914	0.01458	0.3515:0.1233:0.2857:0.2395	.	.	.	.	X	328;368	.	ENSP00000363089:S368X	S	+	2	0	TLR4	119515330	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.454000	0.00465	-2.306000	0.00653	-0.140000	0.14226	TCA	TLR4	-	pirsf_Toll-like_receptor	ENSG00000136869		0.378	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	126	0.00	0	C	NM_138554		120475509	120475509	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	nonsense	117	11.36	15	SNP	0.000	A
TLR4	7099	genome.wustl.edu	37	9	120476776	120476776	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:120476776C>A	ENST00000355622.6	+	3	2471	c.2370C>A	c.(2368-2370)agC>agA	p.S790R	TLR4_ENST00000394487.4_Missense_Mutation_p.S750R|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	790	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GCCTTCTCAGCAGGAACACTT	0.552																																						dbGAP											0													78.0	78.0	78.0					9																	120476776		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2370C>A	9.37:g.120476776C>A	ENSP00000363089:p.Ser790Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.S790R	ENST00000355622.6	37	c.2370	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	1.651	-0.514052	0.04200	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.07444	3.19;3.19	5.91	4.07	0.47477	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.791255	0.12376	N	0.474339	T	0.03520	0.0101	N	0.02865	-0.47	0.27544	N	0.950695	B	0.16166	0.016	B	0.16289	0.015	T	0.38735	-0.9647	10	0.07482	T	0.82	.	11.067	0.47980	0.0:0.6305:0.2993:0.0702	.	790	O00206	TLR4_HUMAN	R	750;790	ENSP00000377997:S750R;ENSP00000363089:S790R	ENSP00000363089:S790R	S	+	3	2	TLR4	119516597	0.993000	0.37304	0.941000	0.38009	0.795000	0.44927	2.588000	0.46137	0.835000	0.34877	-0.165000	0.13383	AGC	TLR4	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000136869		0.552	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	133	0.00	0	C	NM_138554		120476776	120476776	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	83	20.19	21	SNP	0.614	A
TM9SF1	10548	genome.wustl.edu	37	14	24658635	24658635	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr14:24658635G>C	ENST00000261789.4	-	6	2165	c.1807C>G	c.(1807-1809)Ctc>Gtc	p.L603V	IPO4_ENST00000354464.6_5'Flank|TM9SF1_ENST00000524835.1_Missense_Mutation_p.L516V|TM9SF1_ENST00000528669.1_Missense_Mutation_p.L586V|TM9SF1_ENST00000530611.1_Missense_Mutation_p.L812V|TM9SF1_ENST00000556387.1_Missense_Mutation_p.L812V|RP11-468E2.2_ENST00000561419.1_Silent_p.T139T	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	603					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		TCCATCTTGAGGTTAACATAG	0.443																																						dbGAP											0													106.0	111.0	109.0					14																	24658635		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1807C>G	14.37:g.24658635G>C	ENSP00000261789:p.Leu603Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	pfam_EMP70,pfam_Snf7	p.L812V	ENST00000261789.4	37	c.2434	CCDS9617.1	14	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046692	0.36085	.	.	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000524835;ENST00000530611	T;T;T;T;T	0.36340	1.85;1.77;1.26;1.28;1.26	5.65	5.65	0.86999	.	0.064006	0.64402	D	0.000005	T	0.20659	0.0497	N	0.12471	0.22	0.51482	D	0.999927	B	0.14012	0.009	B	0.14578	0.011	T	0.07309	-1.0779	10	0.02654	T	1	-18.6628	17.2626	0.87075	0.0:0.0:1.0:0.0	.	603	O15321	TM9S1_HUMAN	V	603;586;812;516;812	ENSP00000261789:L603V;ENSP00000432997:L586V;ENSP00000451949:L812V;ENSP00000434387:L516V;ENSP00000433967:L812V	ENSP00000433967:L812V	L	-	1	0	TM9SF1;RP11-468E2.1	23728475	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.962000	0.56766	2.941000	0.99782	0.655000	0.94253	CTC	TM9SF1	-	NULL	ENSG00000100926		0.443	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	TM9SF1	HGNC	protein_coding	OTTHUMT00000073136.2	89	0.00	0	G	NM_006405		24658635	24658635	-1	no_errors	ENST00000556387	ensembl	human	known	69_37n	missense	125	16.67	25	SNP	1.000	C
TMEM131	23505	genome.wustl.edu	37	2	98409038	98409038	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:98409038C>A	ENST00000186436.5	-	31	4183	c.3955G>T	c.(3955-3957)Gaa>Taa	p.E1319*		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1319	Pro-rich.					integral component of membrane (GO:0016021)		p.E1206Q(1)|p.E1206*(1)|p.E1319Q(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GACAGCCTTTCAGGCTGCGGC	0.677																																						dbGAP											3	Substitution - Missense(2)|Substitution - Nonsense(1)	cervix(2)|breast(1)											21.0	25.0	23.0					2																	98409038		2093	4223	6316	-	-	-	SO:0001587	stop_gained	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3955G>T	2.37:g.98409038C>A	ENSP00000186436:p.Glu1319*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_DUF3651_TMEM131	p.E1319*	ENST00000186436.5	37	c.3955	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	42	9.552362	0.99202	.	.	ENSG00000075568	ENST00000186436	.	.	.	5.91	5.91	0.95273	.	0.562624	0.18838	N	0.129774	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-2.0572	19.8936	0.96942	0.0:1.0:0.0:0.0	.	.	.	.	X	1319	.	ENSP00000186436:E1319X	E	-	1	0	TMEM131	97775470	0.161000	0.22892	0.008000	0.14137	0.651000	0.38670	3.599000	0.54045	2.793000	0.96121	0.655000	0.94253	GAA	TMEM131	-	NULL	ENSG00000075568		0.677	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	215	0.00	0	C	XM_371542		98409038	98409038	-1	no_errors	ENST00000186436	ensembl	human	known	69_37n	nonsense	156	14.29	26	SNP	0.036	A
TMEM201	199953	genome.wustl.edu	37	1	9656053	9656053	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:9656053C>G	ENST00000340381.6	+	2	228	c.219C>G	c.(217-219)taC>taG	p.Y73*	TMEM201_ENST00000340305.5_Nonsense_Mutation_p.Y73*|TMEM201_ENST00000377376.4_Nonsense_Mutation_p.Y73*	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	73					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GCGAGCAGTACAACGGCTTCC	0.622																																						dbGAP											0													77.0	63.0	68.0					1																	9656053		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.219C>G	1.37:g.9656053C>G	ENSP00000344503:p.Tyr73*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH90|Q5SNT3	Nonsense_Mutation	SNP	pfam_DUF2448,pfam_DUF2349	p.Y73*	ENST00000340381.6	37	c.219	CCDS44055.2	1	.	.	.	.	.	.	.	.	.	.	C	36	5.942691	0.97128	.	.	ENSG00000188807	ENST00000377376;ENST00000340305;ENST00000340381	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.0165	15.9746	0.80054	0.0:1.0:0.0:0.0	.	.	.	.	X	73	.	ENSP00000344772:Y73X	Y	+	3	2	TMEM201	9578640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.130000	0.57964	2.448000	0.82819	0.655000	0.94253	TAC	TMEM201	-	pfam_DUF2349	ENSG00000188807		0.622	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM201	HGNC	protein_coding	OTTHUMT00000127672.1	153	0.00	0	C	NM_001010866		9656053	9656053	+1	no_errors	ENST00000340381	ensembl	human	known	69_37n	nonsense	66	23.26	20	SNP	1.000	G
TMEM246	84302	genome.wustl.edu	37	9	104238305	104238305	+	Missense_Mutation	SNP	T	T	C	rs567771189		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr9:104238305T>C	ENST00000374851.1	-	4	2217	c.1070A>G	c.(1069-1071)cAc>cGc	p.H357R	TMEM246_ENST00000374848.3_Missense_Mutation_p.H357R|RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000425734.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.H357R|RP11-490D19.6_ENST00000450109.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	357						integral component of membrane (GO:0016021)											AAAGCCCTTGTGGCAGTACAC	0.607																																						dbGAP											0													69.0	64.0	66.0					9																	104238305		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.1070A>G	9.37:g.104238305T>C	ENSP00000363984:p.His357Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AQ4	Missense_Mutation	SNP	NULL	p.H357R	ENST00000374851.1	37	c.1070	CCDS6757.1	9	.	.	.	.	.	.	.	.	.	.	T	6.461	0.453270	0.12283	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.7	2.97	0.34412	.	0.410433	0.27539	N	0.018906	T	0.06690	0.0171	N	0.00707	-1.245	0.28734	N	0.902353	B	0.02656	0.0	B	0.01281	0.0	T	0.33548	-0.9864	9	0.10636	T	0.68	-28.3884	3.5328	0.07784	0.1977:0.141:0.0:0.6613	.	357	Q9BRR3	CI125_HUMAN	R	357	.	ENSP00000363980:H357R	H	-	2	0	C9orf125	103278126	0.312000	0.24545	1.000000	0.80357	0.988000	0.76386	0.505000	0.22642	2.181000	0.69327	0.460000	0.39030	CAC	TMEM246	-	NULL	ENSG00000165152		0.607	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM246	HGNC	protein_coding	OTTHUMT00000053444.1	199	0.50	1	T	NM_032342		104238305	104238305	-1	no_errors	ENST00000374847	ensembl	human	known	69_37n	missense	177	14.29	30	SNP	0.919	C
TOM1L2	146691	genome.wustl.edu	37	17	17786172	17786172	+	Silent	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:17786172G>A	ENST00000379504.3	-	6	590	c.507C>T	c.(505-507)gtC>gtT	p.V169V	TOM1L2_ENST00000318094.10_Silent_p.V124V|TOM1L2_ENST00000540946.1_Intron|TOM1L2_ENST00000542206.1_Intron|TOM1L2_ENST00000395739.4_Silent_p.V124V|TOM1L2_ENST00000535933.1_Intron|TOM1L2_ENST00000581396.1_Silent_p.V119V	NM_001082968.1	NP_001076437.1	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 (chicken)	169					intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	clathrin binding (GO:0030276)|protein kinase binding (GO:0019901)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(2)	10	all_neural(463;0.228)					CCACTTCAGGGACACTCTGGC	0.592																																					Melanoma(192;2505 2909 14455 25269)	dbGAP											0													165.0	129.0	141.0					17																	17786172		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ230803	CCDS32584.1, CCDS42270.1, CCDS74000.1, CCDS74001.1, CCDS74002.1, CCDS74003.1	17p11.2	2008-07-03	2001-11-28		ENSG00000175662	ENSG00000175662			11984	protein-coding gene	gene with protein product		615519	"""target of myb1 (chicken) homolog-like 1"""			10036180	Standard	NM_001082968		Approved		uc002grz.4	Q6ZVM7	OTTHUMG00000059353	ENST00000379504.3:c.507C>T	17.37:g.17786172G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2L7|B7Z7F4|Q86V61|Q8TDE7|Q96M88	Silent	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.V169	ENST00000379504.3	37	c.507	CCDS42270.1	17																																																																																			TOM1L2	-	pirsf_TOM1	ENSG00000175662		0.592	TOM1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOM1L2	HGNC	protein_coding	OTTHUMT00000131928.1	210	0.00	0	G			17786172	17786172	-1	no_errors	ENST00000379504	ensembl	human	known	69_37n	silent	134	19.64	33	SNP	1.000	A
TPP1	1200	genome.wustl.edu	37	11	6638925	6638925	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:6638925C>A	ENST00000299427.6	-	4	372	c.312G>T	c.(310-312)ttG>ttT	p.L104F	RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000533371.1_5'UTR|TPP1_ENST00000534644.1_5'UTR	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	CTCCGGCTGCCAAGAGCCATT	0.542																																						dbGAP											0													156.0	147.0	150.0					11																	6638925		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.312G>T	11.37:g.6638925C>A	ENSP00000299427:p.Leu104Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71V64	Missense_Mutation	SNP	pfam_Peptidase_S53_propep,pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	p.L104F	ENST00000299427.6	37	c.312	CCDS7770.1	11	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181993	0.38511	.	.	ENSG00000166340	ENST00000299427;ENST00000453338;ENST00000436873	T;T	0.63255	-0.03;-0.03	5.7	2.33	0.28932	Proteinase inhibitor, propeptide (1);Peptidase S53, propeptide (2);	0.500497	0.21576	N	0.072325	T	0.55752	0.1940	L	0.39245	1.2	0.35522	D	0.80156	P;B	0.45902	0.868;0.036	P;B	0.45881	0.496;0.112	T	0.65319	-0.6197	10	0.56958	D	0.05	-25.8562	10.2866	0.43570	0.0:0.6955:0.0:0.3045	.	104;104	B4DEQ3;O14773	.;TPP1_HUMAN	F	104	ENSP00000299427:L104F;ENSP00000398136:L104F	ENSP00000299427:L104F	L	-	3	2	TPP1	6595501	0.585000	0.26774	0.694000	0.30210	0.531000	0.34715	0.917000	0.28665	0.739000	0.32628	0.655000	0.94253	TTG	TPP1	-	pfam_Peptidase_S53_propep,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	ENSG00000166340		0.542	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257261.2	474	0.21	1	C			6638925	6638925	-1	no_errors	ENST00000299427	ensembl	human	known	69_37n	missense	171	39.15	110	SNP	0.258	A
TRIM2	23321	genome.wustl.edu	37	4	154243810	154243810	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr4:154243810G>T	ENST00000437508.2	+	9	1913	c.1712G>T	c.(1711-1713)gGa>gTa	p.G571V	TRIM2_ENST00000338700.5_Missense_Mutation_p.G598V	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	571					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		ACAAAAATTGGATCAGGAAAG	0.408																																						dbGAP											0													66.0	63.0	64.0					4																	154243810		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.1712G>T	4.37:g.154243810G>T	ENSP00000415812:p.Gly571Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.G598V	ENST00000437508.2	37	c.1793	CCDS47147.1	4	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577252	0.86645	.	.	ENSG00000109654	ENST00000437508;ENST00000338700	D;D	0.89681	-2.55;-2.55	5.23	5.23	0.72850	Six-bladed beta-propeller, TolB-like (1);	0.047934	0.85682	D	0.000000	D	0.95178	0.8437	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.95737	0.8780	10	0.87932	D	0	-13.2556	18.8767	0.92341	0.0:0.0:1.0:0.0	.	598;571	D3DP09;Q9C040	.;TRIM2_HUMAN	V	571;598	ENSP00000415812:G571V;ENSP00000339659:G598V	ENSP00000339659:G598V	G	+	2	0	TRIM2	154463260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.439000	0.82584	0.650000	0.86243	GGA	TRIM2	-	pfscan_NHL_repeat_subgr	ENSG00000109654		0.408	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM2	HGNC	protein_coding	OTTHUMT00000342652.1	147	0.00	0	G			154243810	154243810	+1	no_errors	ENST00000338700	ensembl	human	known	69_37n	missense	111	24.83	37	SNP	1.000	T
TRIM64DP	727828	genome.wustl.edu	37	11	89515423	89515423	+	IGR	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:89515423C>G								RP11-313I2.11 (27302 upstream) : TRIM49 (15399 downstream)																							TGGGGTGTTTCTGGATTATGA	0.428																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															11.37:g.89515423C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		11																																																																																			TRIM64DP	-	-	ENSG00000254751	0	0.428					TRIM64DP	HGNC			291	0.00	0	C			89515423	89515423	+1	no_errors	ENST00000532821	ensembl	human	known	69_37n	rna	162	12.37	23	SNP	1.000	G
TRIM67	440730	genome.wustl.edu	37	1	231334915	231334915	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:231334915G>A	ENST00000366653.5	+	3	1263	c.1263G>A	c.(1261-1263)aaG>aaA	p.K421K	TRIM67_ENST00000449018.3_Splice_Site_p.K359K|TRIM67_ENST00000366652.2_Splice_Site_p.K421K|TRIM67_ENST00000444294.3_Splice_Site_p.K421K			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	421					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				ACAAGTtgaaggtaggtacct	0.532																																						dbGAP											0													91.0	95.0	94.0					1																	231334915		2035	4183	6218	-	-	-	SO:0001630	splice_region_variant	0			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1263+1G>A	1.37:g.231334915G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.K421	ENST00000366653.5	37	c.1263	CCDS44333.1	1																																																																																			TRIM67	-	smart_Bbox_C	ENSG00000119283		0.532	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	222	0.00	0	G	NM_001004342	Silent	231334915	231334915	+1	no_errors	ENST00000366652	ensembl	human	known	69_37n	silent	227	10.98	28	SNP	1.000	A
TTC28	23331	genome.wustl.edu	37	22	28497221	28497221	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr22:28497221delT	ENST00000397906.2	-	9	3496	c.3355delA	c.(3355-3357)attfs	p.I1119fs		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1119					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CCATGGCGAATTTTTGCCTCA	0.458																																						dbGAP											0													119.0	107.0	110.0					22																	28497221		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.3355delA	22.37:g.28497221delT	ENSP00000381003:p.Ile1119fs	Somatic		WXS	Illumina GAIIx	Phase_IV	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Frame_Shift_Del	DEL	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I1119fs	ENST00000397906.2	37	c.3355	CCDS46678.1	22																																																																																			TTC28	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000100154		0.458	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	266	0.00	0	T	XM_929318		28497221	28497221	-1	no_errors	ENST00000397906	ensembl	human	novel	69_37n	frame_shift_del	167	17.56	36	DEL	1.000	-
TTN	7273	genome.wustl.edu	37	2	179645892	179645892	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr2:179645892T>C	ENST00000591111.1	-	21	3703	c.3479A>G	c.(3478-3480)aAt>aGt	p.N1160S	TTN_ENST00000359218.5_Missense_Mutation_p.N1114S|TTN_ENST00000589042.1_Missense_Mutation_p.N1160S|TTN_ENST00000460472.2_Missense_Mutation_p.N1114S|TTN_ENST00000342992.6_Missense_Mutation_p.N1160S|TTN_ENST00000360870.5_Missense_Mutation_p.N1160S|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N1114S			Q8WZ42	TITIN_HUMAN	titin	33377	Ig-like 4.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCATGCTTATTGCGAACAAC	0.393																																						dbGAP											0													189.0	164.0	173.0					2																	179645892		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3479A>G	2.37:g.179645892T>C	ENSP00000465570:p.Asn1160Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.N1160S	ENST00000591111.1	37	c.3479		2	.	.	.	.	.	.	.	.	.	.	T	16.05	3.011676	0.54468	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76513	0.3998	M	0.75264	2.295	0.36173	D	0.848923	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.85130	0.996;0.996;0.996;0.996;0.997	T	0.83312	-0.0022	9	0.87932	D	0	.	16.3364	0.83064	0.0:0.0:0.0:1.0	.	1114;1114;1114;1160;1160	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	S	1160;1114;1114;1114;1114;1160	ENSP00000343764:N1160S;ENSP00000434586:N1114S;ENSP00000340554:N1114S;ENSP00000352154:N1114S;ENSP00000354117:N1160S	ENSP00000340554:N1114S	N	-	2	0	TTN	179354137	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	8.003000	0.88520	2.252000	0.74401	0.528000	0.53228	AAT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	658	0.00	0	T	NM_133378		179645892	179645892	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	385	15.54	71	SNP	1.000	C
UBR2	23304	genome.wustl.edu	37	6	42652568	42652568	+	Silent	SNP	A	A	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:42652568A>G	ENST00000372899.1	+	44	5070	c.4812A>G	c.(4810-4812)ccA>ccG	p.P1604P	UBR2_ENST00000372883.3_3'UTR|UBR2_ENST00000372901.1_Silent_p.P1604P	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1604					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TAAACCTTCCAGAGGATTACA	0.348																																						dbGAP											0													62.0	63.0	63.0					6																	42652568		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.4812A>G	6.37:g.42652568A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Silent	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.P1604	ENST00000372899.1	37	c.4812	CCDS4870.1	6																																																																																			UBR2	-	NULL	ENSG00000024048		0.348	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	129	0.00	0	A	NM_015255		42652568	42652568	+1	no_errors	ENST00000372899	ensembl	human	known	69_37n	silent	143	33.94	74	SNP	0.186	G
UCK2	7371	genome.wustl.edu	37	1	165865490	165865490	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:165865490C>T	ENST00000367879.4	+	4	723	c.420C>T	c.(418-420)ttC>ttT	p.F140F	UCK2_ENST00000469256.2_5'UTR|UCK2_ENST00000470820.1_5'UTR|RP11-525G13.2_ENST00000455257.2_RNA|UCK2_ENST00000372212.4_Intron|UCK2_ENST00000462329.1_3'UTR	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	140					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					TCCTGGCCTTCTACTCCCAGG	0.547																																						dbGAP											0													213.0	201.0	205.0					1																	165865490		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.420C>T	1.37:g.165865490C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Silent	SNP	pfam_PRK/URK,pfam_Depp_CoAkinase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.F140	ENST00000367879.4	37	c.420	CCDS1252.1	1																																																																																			UCK2	-	pfam_PRK/URK,pfam_Depp_CoAkinase,prints_PRK,tigrfam_Uridine_kinase	ENSG00000143179		0.547	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK2	HGNC	protein_coding	OTTHUMT00000096753.1	241	0.00	0	C	NM_012474		165865490	165865490	+1	no_errors	ENST00000367879	ensembl	human	known	69_37n	silent	232	13.38	36	SNP	1.000	T
UTP20	27340	genome.wustl.edu	37	12	101699822	101699822	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:101699822C>T	ENST00000261637.4	+	16	2085	c.1911C>T	c.(1909-1911)aaC>aaT	p.N637N		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	637					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TACAAGCAAACATTTCAACTG	0.428																																						dbGAP											0													162.0	162.0	162.0					12																	101699822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.1911C>T	12.37:g.101699822C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Silent	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.N637	ENST00000261637.4	37	c.1911	CCDS9081.1	12																																																																																			UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.428	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	365	0.00	0	C	NM_014503		101699822	101699822	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	silent	310	12.89	46	SNP	0.997	T
WDFY3	23001	genome.wustl.edu	37	4	85672736	85672736	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr4:85672736G>A	ENST00000295888.4	-	36	6280	c.5873C>T	c.(5872-5874)gCt>gTt	p.A1958V	WDFY3_ENST00000322366.6_Missense_Mutation_p.A1958V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1958					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GAACTTTTTAGCCGGGTGATT	0.458																																						dbGAP											0													140.0	133.0	135.0					4																	85672736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5873C>T	4.37:g.85672736G>A	ENSP00000295888:p.Ala1958Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1958V	ENST00000295888.4	37	c.5873	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355915	0.61293	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.66280	-0.2;-0.2	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.49389	0.1554	L	0.34521	1.04	0.80722	D	1	P	0.40360	0.714	B	0.30251	0.113	T	0.47328	-0.9126	10	0.22706	T	0.39	.	19.9997	0.97405	0.0:0.0:1.0:0.0	.	1958	Q8IZQ1	WDFY3_HUMAN	V	1958	ENSP00000318466:A1958V;ENSP00000295888:A1958V	ENSP00000295888:A1958V	A	-	2	0	WDFY3	85891760	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	9.471000	0.97696	2.717000	0.92951	0.585000	0.79938	GCT	WDFY3	-	NULL	ENSG00000163625		0.458	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	316	0.00	0	G	NM_014991		85672736	85672736	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	missense	201	20.55	52	SNP	1.000	A
WDR46	9277	genome.wustl.edu	37	6	33248475	33248475	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr6:33248475C>G	ENST00000374617.4	-	11	1761	c.1405G>C	c.(1405-1407)Ggc>Cgc	p.G469R	B3GALT4_ENST00000606990.1_Intron	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	469							poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						CTGGTGATGCCCCCAGTGTGC	0.607																																						dbGAP											0													48.0	44.0	45.0					6																	33248475		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.1405G>C	6.37:g.33248475C>G	ENSP00000363746:p.Gly469Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	pfam_BING4_C_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G469R	ENST00000374617.4	37	c.1405	CCDS4772.1	6	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750185	0.89753	.	.	ENSG00000227057	ENST00000374617	T	0.02050	4.48	5.39	5.39	0.77823	BING4, C-terminal (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.13114	0.0318	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00619	-1.1641	10	0.72032	D	0.01	-26.079	16.6862	0.85309	0.0:1.0:0.0:0.0	.	415;469	B4DP15;O15213	.;WDR46_HUMAN	R	469	ENSP00000363746:G469R	ENSP00000363746:G469R	G	-	1	0	WDR46	33356453	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.727000	0.74764	2.806000	0.96561	0.549000	0.68633	GGC	WDR46	-	pfam_BING4_C_dom,superfamily_WD40_repeat_dom	ENSG00000227057		0.607	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR46	HGNC	protein_coding	OTTHUMT00000076382.2	148	0.00	0	C	NM_005452		33248475	33248475	-1	no_errors	ENST00000374617	ensembl	human	known	69_37n	missense	119	17.45	26	SNP	1.000	G
WNT3A	89780	genome.wustl.edu	37	1	228246812	228246812	+	Silent	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:228246812C>T	ENST00000284523.1	+	4	783	c.705C>T	c.(703-705)taC>taT	p.Y235Y	WNT3A_ENST00000366753.2_Silent_p.Y235Y	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	235					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				AGGACAAGTACGACAGCGCCT	0.652																																						dbGAP											0													62.0	64.0	63.0					1																	228246812		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.705C>T	1.37:g.228246812C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY79|Q3SY80|Q969P2	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt3	p.Y235	ENST00000284523.1	37	c.705	CCDS1564.1	1																																																																																			WNT3A	-	pfam_Wnt,smart_Wnt	ENSG00000154342		0.652	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT3A	HGNC	protein_coding	OTTHUMT00000091648.1	131	0.00	0	C	NM_033131		228246812	228246812	+1	no_errors	ENST00000366753	ensembl	human	known	69_37n	silent	86	31.20	39	SNP	1.000	T
YME1L1	10730	genome.wustl.edu	37	10	27434428	27434428	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:27434428T>G	ENST00000326799.3	-	4	579	c.431A>C	c.(430-432)aAa>aCa	p.K144T	YME1L1_ENST00000375972.3_Missense_Mutation_p.K87T|YME1L1_ENST00000376016.3_Missense_Mutation_p.K87T|YME1L1_ENST00000477432.1_3'UTR	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	144					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						GTTTTTGCCTTTACAAAATCC	0.343																																						dbGAP											0													96.0	101.0	99.0					10																	27434428		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.431A>C	10.37:g.27434428T>G	ENSP00000318480:p.Lys144Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_FtsH	p.K144T	ENST00000326799.3	37	c.431	CCDS7152.1	10	.	.	.	.	.	.	.	.	.	.	T	11.75	1.733128	0.30684	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000427324;ENST00000396296	D;D;D	0.92545	-3.06;-3.06;-3.04	5.69	3.41	0.39046	Peptidase M41, FtsH (1);	0.365615	0.34156	N	0.004204	T	0.77412	0.4126	N	0.04508	-0.205	0.26943	N	0.966194	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.64114	-0.6483	10	0.32370	T	0.25	-9.8933	2.7085	0.05168	0.116:0.0898:0.3222:0.472	.	87;87;144	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	T	87;144;144;87;87;79	ENSP00000365184:K87T;ENSP00000318480:K144T;ENSP00000365139:K87T	ENSP00000318480:K144T	K	-	2	0	YME1L1	27474434	0.997000	0.39634	0.996000	0.52242	0.998000	0.95712	1.799000	0.38824	1.000000	0.39049	0.529000	0.55759	AAA	YME1L1	-	NULL	ENSG00000136758		0.343	YME1L1-005	KNOWN	basic|CCDS	protein_coding	YME1L1	HGNC	protein_coding	OTTHUMT00000047306.1	207	0.00	0	T	NM_139312		27434428	27434428	-1	no_errors	ENST00000326799	ensembl	human	known	69_37n	missense	160	25.23	54	SNP	0.994	G
XPNPEP1	7511	genome.wustl.edu	37	10	111646073	111646073	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:111646073C>T	ENST00000502935.1	-	8	798	c.679G>A	c.(679-681)Gac>Aac	p.D227N	XPNPEP1_ENST00000322238.8_Missense_Mutation_p.D227N|XPNPEP1_ENST00000369683.1_Missense_Mutation_p.D113N|XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.D184N					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AACCGAAGGTCTGCAACCTTG	0.507																																						dbGAP											0													230.0	138.0	169.0					10																	111646073		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.679G>A	10.37:g.111646073C>T	ENSP00000421566:p.Asp227Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.D227N	ENST00000502935.1	37	c.679	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181451	0.57800	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680;ENST00000403138	.	.	.	5.76	5.76	0.90799	.	0.161069	0.56097	D	0.000036	T	0.45836	0.1362	L	0.35414	1.06	0.39132	D	0.961868	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.003;0.003;0.0	T	0.37731	-0.9693	9	0.20519	T	0.43	-23.3193	13.9327	0.64006	0.1514:0.8486:0.0:0.0	.	227;227;184	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	N	227;113;227;184;184	.	ENSP00000324011:D227N	D	-	1	0	XPNPEP1	111636063	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.670000	0.37502	2.713000	0.92767	0.655000	0.94253	GAC	XPNPEP1	-	NULL	ENSG00000108039		0.507	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2	286	0.00	0	C			111646073	111646073	-1	no_errors	ENST00000502935	ensembl	human	known	69_37n	missense	262	15.76	49	SNP	1.000	T
ZC3H10	84872	genome.wustl.edu	37	12	56515095	56515095	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr12:56515095G>T	ENST00000257940.2	+	3	1025	c.749G>T	c.(748-750)cGg>cTg	p.R250L	RP11-603J24.5_ENST00000550947.1_RNA|RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.5_ENST00000549438.1_RNA	NM_032786.1	NP_116175.1	Q96K80	ZC3HA_HUMAN	zinc finger CCCH-type containing 10	250							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	11			OV - Ovarian serous cystadenocarcinoma(18;0.12)			CTCAGGAAGCGGGTAGAGGAG	0.517																																						dbGAP											0													74.0	74.0	74.0					12																	56515095		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018708	CCDS8903.1	12q13.2	2012-07-05	2005-06-02	2005-06-02		ENSG00000135482		"""Zinc fingers, CCCH-type domain containing"""	25893	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 10"""	ZC3HDC10		12477932	Standard	NM_032786		Approved	FLJ14451	uc001sjp.1	Q96K80		ENST00000257940.2:c.749G>T	12.37:g.56515095G>T	ENSP00000257940:p.Arg250Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.R250L	ENST00000257940.2	37	c.749	CCDS8903.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063433	0.76187	.	.	ENSG00000135482	ENST00000257940	.	.	.	5.13	5.13	0.70059	.	0.000000	0.64402	D	0.000001	T	0.56411	0.1983	N	0.24115	0.695	0.80722	D	1	D	0.64830	0.994	P	0.51866	0.682	T	0.62473	-0.6847	9	0.72032	D	0.01	-9.1509	17.7325	0.88382	0.0:0.0:1.0:0.0	.	250	Q96K80	ZC3HA_HUMAN	L	250	.	ENSP00000257940:R250L	R	+	2	0	ZC3H10	54801362	1.000000	0.71417	0.995000	0.50966	0.958000	0.62258	8.797000	0.91882	2.561000	0.86390	0.655000	0.94253	CGG	ZC3H10	-	NULL	ENSG00000135482		0.517	ZC3H10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H10	HGNC	protein_coding	OTTHUMT00000407826.1	99	0.00	0	G	NM_032786		56515095	56515095	+1	no_errors	ENST00000257940	ensembl	human	known	69_37n	missense	73	20.65	19	SNP	1.000	T
ZC3H11A	9877	genome.wustl.edu	37	1	203821334	203821334	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:203821334C>T	ENST00000545588.1	+	17	6067	c.2240C>T	c.(2239-2241)tCa>tTa	p.S747L	ZC3H11A_ENST00000332127.4_Missense_Mutation_p.S747L|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.S747L|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.S747L|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.S747L	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	747					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGCCCTTCCTCATCCCAAATG	0.483																																						dbGAP											0													26.0	30.0	29.0					1																	203821334		2188	4287	6475	-	-	-	SO:0001583	missense	0				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.2240C>T	1.37:g.203821334C>T	ENSP00000438527:p.Ser747Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	smart_Znf_CCCH	p.S747L	ENST00000545588.1	37	c.2240	CCDS30978.1	1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.749482	0.49257	.	.	ENSG00000058673	ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.56	5.56	0.83823	.	0.304354	0.30446	N	0.009605	T	0.66694	0.2815	M	0.72118	2.19	0.45852	D	0.998711	D	0.89917	1.0	D	0.76575	0.988	T	0.60409	-0.7269	10	0.15952	T	0.53	-28.67	18.3078	0.90188	0.0:1.0:0.0:0.0	.	747	O75152	ZC11A_HUMAN	L	747;693;747;747;747;747	ENSP00000356183:S747L;ENSP00000356181:S747L;ENSP00000333253:S747L;ENSP00000438527:S747L;ENSP00000356179:S747L	ENSP00000333253:S747L	S	+	2	0	ZC3H11A	202087957	1.000000	0.71417	1.000000	0.80357	0.251000	0.25915	5.671000	0.68095	2.619000	0.88677	0.557000	0.71058	TCA	ZC3H11A	-	NULL	ENSG00000058673		0.483	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H11A	HGNC	protein_coding	OTTHUMT00000087471.3	174	0.57	1	C	NM_014827		203821334	203821334	+1	no_errors	ENST00000332127	ensembl	human	known	69_37n	missense	142	30.77	64	SNP	1.000	T
ZC3H12C	85463	genome.wustl.edu	37	11	110034079	110034079	+	Missense_Mutation	SNP	A	A	C	rs571337036		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr11:110034079A>C	ENST00000278590.3	+	5	1281	c.1230A>C	c.(1228-1230)gaA>gaC	p.E410D	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.E379D|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.E411D	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	410							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TTGTTCCTGAACACAAAAAGC	0.378																																						dbGAP											0													52.0	49.0	50.0					11																	110034079		1848	4086	5934	-	-	-	SO:0001583	missense	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1230A>C	11.37:g.110034079A>C	ENSP00000278590:p.Glu410Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.E410D	ENST00000278590.3	37	c.1230	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	A	23.3	4.400559	0.83120	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.37411	1.2;1.2;1.2	5.82	0.814	0.18756	Zinc finger, CCCH-type (1);	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	L	0.47716	1.5	0.35100	D	0.765132	D;D;D	0.76494	0.991;0.999;0.991	P;D;P	0.78314	0.82;0.991;0.82	T	0.53351	-0.8451	10	0.45353	T	0.12	-27.3496	10.6878	0.45854	0.6842:0.0:0.3158:0.0	.	411;410;410	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	D	410;411;379	ENSP00000278590:E410D;ENSP00000431821:E411D;ENSP00000413094:E379D	ENSP00000278590:E410D	E	+	3	2	ZC3H12C	109539289	0.997000	0.39634	0.997000	0.53966	0.997000	0.91878	0.653000	0.24902	-0.100000	0.12241	0.459000	0.35465	GAA	ZC3H12C	-	NULL	ENSG00000149289		0.378	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	169	0.00	0	A	NM_033390		110034079	110034079	+1	no_errors	ENST00000278590	ensembl	human	known	69_37n	missense	113	26.14	40	SNP	0.997	C
ZCCHC10	54819	genome.wustl.edu	37	5	132335893	132335893	+	Intron	SNP	C	C	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr5:132335893C>T	ENST00000509437.1	-	4	277				ZCCHC10_ENST00000508080.1_5'UTR|ZCCHC10_ENST00000355372.2_Intron|ZCCHC10_ENST00000324170.3_Intron|ZCCHC10_ENST00000509008.1_Splice_Site_p.R68R|ZCCHC10_ENST00000513541.1_Splice_Site_p.R90R|ZCCHC10_ENST00000513848.1_Intron			Q8TBK6	ZCH10_HUMAN	zinc finger, CCHC domain containing 10								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAAAAAAGCTCCTGTTAATAG	0.373																																						dbGAP											0													92.0	89.0	90.0					5																	132335893		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC005211	CCDS4165.1, CCDS75300.1, CCDS75301.1, CCDS75302.1	5q31.1	2008-05-02			ENSG00000155329	ENSG00000155329		"""Zinc fingers, CCHC domain containing"""	25954	protein-coding gene	gene with protein product						12477932	Standard	XM_005272024		Approved	FLJ20094	uc003kyg.3	Q8TBK6	OTTHUMG00000129013	ENST00000509437.1:c.270-28G>A	5.37:g.132335893C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NXR4	Silent	SNP	superfamily_Znf_CCHC	p.R90	ENST00000509437.1	37	c.270		5																																																																																			ZCCHC10	-	NULL	ENSG00000155329		0.373	ZCCHC10-004	NOVEL	basic|appris_candidate_longest	protein_coding	ZCCHC10	HGNC	protein_coding	OTTHUMT00000370163.1	433	0.00	0	C	NM_017665		132335893	132335893	-1	no_errors	ENST00000513541	ensembl	human	putative	69_37n	silent	329	16.71	66	SNP	0.529	T
ZDHHC1	29800	genome.wustl.edu	37	16	67428930	67428930	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:67428930C>G	ENST00000348579.2	-	10	1546	c.1205G>C	c.(1204-1206)cGt>cCt	p.R402P	TPPP3_ENST00000290942.5_5'Flank|ZDHHC1_ENST00000566075.1_5'UTR|TPPP3_ENST00000393957.2_5'Flank|TPPP3_ENST00000562206.1_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	402					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		AGGTCTCAGACGTTCGCACTT	0.642																																						dbGAP											0													22.0	27.0	25.0					16																	67428930		2197	4300	6497	-	-	-	SO:0001583	missense	0			U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.1205G>C	16.37:g.67428930C>G	ENSP00000340299:p.Arg402Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O15461	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.R402P	ENST00000348579.2	37	c.1205	CCDS10836.1	16	.	.	.	.	.	.	.	.	.	.	C	8.040	0.763646	0.15914	.	.	ENSG00000159714	ENST00000348579	T	0.45276	0.9	3.9	-0.392	0.12442	.	7.942560	0.00589	U	0.000353	T	0.25232	0.0613	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10428	-1.0630	10	0.34782	T	0.22	.	3.0818	0.06265	0.1352:0.2671:0.4738:0.1238	.	402	Q8WTX9	ZDHC1_HUMAN	P	402	ENSP00000340299:R402P	ENSP00000340299:R402P	R	-	2	0	ZDHHC1	65986431	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.369000	0.07533	-0.127000	0.11661	-1.080000	0.02220	CGT	ZDHHC1	-	NULL	ENSG00000159714		0.642	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC1	HGNC	protein_coding	OTTHUMT00000268845.1	45	0.00	0	C	NM_013304		67428930	67428930	-1	no_errors	ENST00000348579	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.000	G
ZMYM6	9204	genome.wustl.edu	37	1	35453751	35453751	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr1:35453751G>C	ENST00000357182.4	-	16	3159	c.2932C>G	c.(2932-2934)Ctc>Gtc	p.L978V	ZMYM6_ENST00000487874.1_Intron|ZMYM6NB_ENST00000373337.3_5'Flank|ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000493328.1_5'UTR|RP11-244H3.1_ENST00000417456.1_RNA	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	978					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				tcggtacagagaccaacacaa	0.348																																						dbGAP											0													19.0	19.0	19.0					1																	35453751		1157	2512	3669	-	-	-	SO:0001583	missense	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.2932C>G	1.37:g.35453751G>C	ENSP00000349708:p.Leu978Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH	p.L978V	ENST00000357182.4	37	c.2932	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	G	0.688	-0.795438	0.02862	.	.	ENSG00000163867	ENST00000357182	T	0.20463	2.07	4.36	1.46	0.22682	Ribonuclease H-like (1);	0.438115	0.23872	N	0.043727	T	0.04497	0.0123	N	0.00778	-1.195	0.80722	D	1	B	0.16166	0.016	B	0.21151	0.033	T	0.38329	-0.9666	10	0.02654	T	1	-2.3285	5.838	0.18617	0.3375:0.0:0.6625:0.0	.	978	O95789	ZMYM6_HUMAN	V	978	ENSP00000349708:L978V	ENSP00000349708:L978V	L	-	1	0	ZMYM6	35226338	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.004000	0.29822	0.352000	0.24053	0.655000	0.94253	CTC	ZMYM6	-	superfamily_RNaseH-like_dom	ENSG00000163867		0.348	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	35	0.00	0	G	NM_007167		35453751	35453751	-1	no_errors	ENST00000357182	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	0.997	C
ZNF350	59348	genome.wustl.edu	37	19	52472379	52472379	+	Silent	SNP	G	G	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:52472379G>C	ENST00000243644.4	-	3	248	c.21C>G	c.(19-21)tcC>tcG	p.S7S	HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'UTR|HCCAT3_ENST00000595010.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	7					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		CCAGTGTTATGGATTCCTGTA	0.458																																						dbGAP											0													115.0	107.0	110.0					19																	52472379		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.21C>G	19.37:g.52472379G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96G73|Q9HAQ4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S7	ENST00000243644.4	37	c.21	CCDS12845.1	19																																																																																			ZNF350	-	superfamily_Krueppel-associated_box	ENSG00000256683		0.458	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF350	HGNC	protein_coding	OTTHUMT00000462278.1	465	0.00	0	G	NM_021632		52472379	52472379	-1	no_errors	ENST00000243644	ensembl	human	known	69_37n	silent	174	39.45	114	SNP	0.000	C
ZNF419	79744	genome.wustl.edu	37	19	58005131	58005131	+	Silent	SNP	T	T	C			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:58005131T>C	ENST00000221735.7	+	5	1392	c.1206T>C	c.(1204-1206)aaT>aaC	p.N402N	ZNF419_ENST00000424930.2_Silent_p.N403N|ZNF419_ENST00000415379.2_Silent_p.N356N|ZNF419_ENST00000426954.2_Silent_p.N390N|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000442920.2_Silent_p.N389N|ZNF419_ENST00000354197.4_Silent_p.N390N|ZNF419_ENST00000347466.6_Silent_p.N370N			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		TTAAGTGCAATGAATGTGGGA	0.433																																						dbGAP											0													89.0	93.0	92.0					19																	58005131		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.1206T>C	19.37:g.58005131T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N403	ENST00000221735.7	37	c.1209	CCDS54326.1	19																																																																																			ZNF419	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000105136		0.433	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	ZNF419	HGNC	protein_coding	OTTHUMT00000378506.1	290	0.00	0	T	NM_024691		58005131	58005131	+1	no_errors	ENST00000424930	ensembl	human	known	69_37n	silent	220	17.91	48	SNP	0.009	C
ZNF423	23090	genome.wustl.edu	37	16	49669760	49669760	+	Silent	SNP	G	G	A	rs200411543		TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr16:49669760G>A	ENST00000561648.1	-	4	3356	c.3303C>T	c.(3301-3303)aaC>aaT	p.N1101N	ZNF423_ENST00000535559.1_Silent_p.N984N|ZNF423_ENST00000563137.2_Silent_p.N1041N|ZNF423_ENST00000567169.1_Silent_p.N984N|ZNF423_ENST00000262383.2_Silent_p.N1101N|ZNF423_ENST00000562520.1_Silent_p.N1041N|ZNF423_ENST00000562871.1_Silent_p.N1041N	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1101					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CCACCTGTCCGTTGGCGCTGC	0.687													G|||	1	0.000199681	0.0	0.0	5008	,	,		13801	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													16.0	19.0	18.0					16																	49669760		2196	4294	6490	-	-	-	SO:0001819	synonymous_variant	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3303C>T	16.37:g.49669760G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94860|Q76N04|Q9NZ13	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N1101	ENST00000561648.1	37	c.3303	CCDS32445.1	16																																																																																			ZNF423	-	NULL	ENSG00000102935		0.687	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	32	0.00	0	G	NM_015069		49669760	49669760	-1	no_errors	ENST00000262383	ensembl	human	known	69_37n	silent	13	35.00	7	SNP	0.192	A
ZNF438	220929	genome.wustl.edu	37	10	31137957	31137957	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr10:31137957C>A	ENST00000361310.3	-	6	1706	c.1377G>T	c.(1375-1377)caG>caT	p.Q459H	ZNF438_ENST00000375311.1_Missense_Mutation_p.Q23H|ZNF438_ENST00000436087.2_Missense_Mutation_p.Q459H|ZNF438_ENST00000331737.6_Missense_Mutation_p.Q449H|ZNF438_ENST00000444692.2_Missense_Mutation_p.Q449H|ZNF438_ENST00000442986.1_Missense_Mutation_p.Q459H|ZNF438_ENST00000452305.1_Missense_Mutation_p.Q449H|ZNF438_ENST00000413025.1_Missense_Mutation_p.Q459H|ZNF438_ENST00000538351.2_Missense_Mutation_p.Q410H			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	459					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				CCCCAAGCATCTGGGACTGTA	0.478																																						dbGAP											0													60.0	67.0	64.0					10																	31137957		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1377G>T	10.37:g.31137957C>A	ENSP00000354663:p.Gln459His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q459H	ENST00000361310.3	37	c.1377	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	C	9.947	1.219163	0.22373	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.07908	3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15	5.57	-11.1	0.00147	.	0.805087	0.11673	N	0.540606	T	0.04861	0.0131	L	0.54323	1.7	0.09310	N	1	B;B	0.14438	0.006;0.01	B;B	0.16289	0.007;0.015	T	0.47886	-0.9082	10	0.02654	T	1	-3.0317	8.7964	0.34883	0.0:0.298:0.2656:0.4364	.	459;449	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	H	449;459;459;459;459;449;449;410;178;23	ENSP00000333571:Q449H;ENSP00000354663:Q459H;ENSP00000406934:Q459H;ENSP00000412363:Q459H;ENSP00000387546:Q459H;ENSP00000413060:Q449H;ENSP00000410898:Q449H;ENSP00000445461:Q410H;ENSP00000364460:Q23H	ENSP00000333571:Q449H	Q	-	3	2	ZNF438	31177963	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.021000	0.00085	-2.146000	0.00800	-0.793000	0.03317	CAG	ZNF438	-	NULL	ENSG00000183621		0.478	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1	141	0.00	0	C	NM_182755		31137957	31137957	-1	no_errors	ENST00000361310	ensembl	human	known	69_37n	missense	68	27.66	26	SNP	0.000	A
ZNF552	79818	genome.wustl.edu	37	19	58319602	58319602	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:58319602T>A	ENST00000391701.1	-	3	1199	c.1030A>T	c.(1030-1032)Aga>Tga	p.R344*	ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000599802.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		GTGTGAACTCTCTTATGAACA	0.463																																						dbGAP											0													98.0	92.0	94.0					19																	58319602		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.1030A>T	19.37:g.58319602T>A	ENSP00000375582:p.Arg344*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUE9|Q6P5A6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R344*	ENST00000391701.1	37	c.1030	CCDS12963.1	19	.	.	.	.	.	.	.	.	.	.	T	32	5.141357	0.94560	.	.	ENSG00000178935	ENST00000391701	.	.	.	1.74	1.74	0.24563	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.1217	0.25448	0.0:0.0:0.0:1.0	.	.	.	.	X	344	.	ENSP00000375582:R344X	R	-	1	2	ZNF552	63011414	0.000000	0.05858	0.064000	0.19789	0.194000	0.23727	-1.042000	0.03539	0.781000	0.33589	0.172000	0.16884	AGA	ZNF552	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178935		0.463	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF552	HGNC	protein_coding	OTTHUMT00000466829.1	470	0.00	0	T	NM_024762		58319602	58319602	-1	no_errors	ENST00000391701	ensembl	human	known	69_37n	nonsense	227	16.24	44	SNP	0.995	A
ZNF552	79818	genome.wustl.edu	37	19	58319607	58319608	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:58319607_58319608insGA	ENST00000391701.1	-	3	1193_1194	c.1024_1025insTC	c.(1024-1026)catfs	p.H342fs	ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000599802.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		AACTCTCTTATGAACACGGAAT	0.46																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.1023_1024dupTC	19.37:g.58319608_58319609dupGA	ENSP00000375582:p.His342fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUE9|Q6P5A6	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H342fs	ENST00000391701.1	37	c.1025_1024	CCDS12963.1	19																																																																																			ZNF552	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178935		0.460	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF552	HGNC	protein_coding	OTTHUMT00000466829.1	476	0.00	0	-	NM_024762		58319607	58319608	-1	no_errors	ENST00000391701	ensembl	human	known	69_37n	frame_shift_ins	236	13.87	38	INS	0.647:0.658	GA
ZNF676	163223	genome.wustl.edu	37	19	22362986	22362986	+	Silent	SNP	G	G	T			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:22362986G>T	ENST00000397121.2	-	3	1850	c.1533C>A	c.(1531-1533)ggC>ggA	p.G511G		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TGAAGGCTTTGCCACATTCTT	0.393																																						dbGAP											0													63.0	67.0	66.0					19																	22362986		2156	4274	6430	-	-	-	SO:0001819	synonymous_variant	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1533C>A	19.37:g.22362986G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVX5	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G511	ENST00000397121.2	37	c.1533	CCDS42539.1	19																																																																																			ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.393	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	127	0.00	0	G	NM_001001411		22362986	22362986	-1	no_errors	ENST00000397121	ensembl	human	known	69_37n	silent	61	29.55	26	SNP	0.970	T
ZSCAN5B	342933	genome.wustl.edu	37	19	56704353	56704353	+	Silent	SNP	T	T	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:56704353T>G	ENST00000586855.2	-	2	382	c.69A>C	c.(67-69)ccA>ccC	p.P23P	ZSCAN5B_ENST00000358992.3_Silent_p.P23P			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	23					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CCACAGACCGTGGAGTGTCTG	0.527																																						dbGAP											0													56.0	48.0	51.0					19																	56704353		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.69A>C	19.37:g.56704353T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.P23	ENST00000586855.2	37	c.69	CCDS46203.1	19																																																																																			ZSCAN5B	-	NULL	ENSG00000197213		0.527	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	HGNC	protein_coding	OTTHUMT00000457834.2	204	0.00	0	T	NM_001080456		56704353	56704353	-1	no_errors	ENST00000358992	ensembl	human	known	69_37n	silent	156	16.58	31	SNP	0.000	G
ZNF587B	100293516	genome.wustl.edu	37	19	58352673	58352673	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr19:58352673G>A	ENST00000442832.4	+	3	865	c.631G>A	c.(631-633)Gga>Aga	p.G211R	ZNF587B_ENST00000594901.1_Missense_Mutation_p.G211R|CTD-2583A14.10_ENST00000598031.1_Intron|ZNF587B_ENST00000316462.4_Intron	NM_001204818.1	NP_001191747.1	E7ETH6	Z587B_HUMAN	zinc finger protein 587B	211					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TCAGTGTGGGGGAGCTCACTA	0.483																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK299091	CCDS56109.1	19q13.43	2013-01-08				ENSG00000269343		"""Zinc fingers, C2H2-type"", ""-"""	37142	protein-coding gene	gene with protein product							Standard	NM_001204818		Approved		uc021vcp.1	E7ETH6		ENST00000442832.4:c.631G>A	19.37:g.58352673G>A	ENSP00000392410:p.Gly211Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR41	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G211R	ENST00000442832.4	37	c.631	CCDS56109.1	19	.	.	.	.	.	.	.	.	.	.	.	4.509	0.094399	0.08632	.	.	ENSG00000198466	ENST00000442832	T	0.05139	3.49	1.76	-2.15	0.07102	.	.	.	.	.	T	0.03390	0.0098	N	0.17474	0.49	.	.	.	B;B	0.19583	0.004;0.037	B;B	0.17722	0.004;0.019	T	0.46076	-0.9217	7	.	.	.	.	6.5143	0.22239	0.5332:0.0:0.4668:0.0	.	211;160	E7ETH6;Q92967	.;.	R	211	ENSP00000392410:G211R	.	G	+	1	0	ZNF587	63044485	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.237000	0.08990	-0.608000	0.05731	-0.818000	0.03119	GGA	ZNF587	-	NULL	ENSG00000198466		0.483	ZNF587B-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	ZNF587	HGNC	protein_coding	OTTHUMT00000466834.2	388	0.00	0	G	NM_001204818		58352673	58352673	+1	no_errors	ENST00000442832	ensembl	human	known	69_37n	missense	166	18.93	39	SNP	0.000	A
ZZEF1	23140	genome.wustl.edu	37	17	3980054	3980054	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0BZ-01A-31D-A12Q-09	TCGA-BH-A0BZ-11A-61D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f07765a-3f2b-4b6f-88ef-0d7aab17a758	be00304b-7a7a-464c-b5f7-d784d0c2c0ab	g.chr17:3980054C>G	ENST00000381638.2	-	21	3236		c.e21-1		ZZEF1_ENST00000574474.1_Splice_Site	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1								calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GGAAGATAACCTAATGGAAGA	0.517																																						dbGAP											0													70.0	69.0	69.0					17																	3980054		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.3112-1G>C	17.37:g.3980054C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Splice_Site	SNP	-	e21-1	ENST00000381638.2	37	c.3112-1	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959558	0.74016	.	.	ENSG00000074755	ENST00000381638	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9576	0.97228	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZZEF1	3926803	1.000000	0.71417	0.990000	0.47175	0.595000	0.36748	7.054000	0.76649	2.736000	0.93811	0.655000	0.94253	.	ZZEF1	-	-	ENSG00000074755		0.517	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	202	0.00	0	C	NM_015113	Intron	3980054	3980054	-1	no_errors	ENST00000381638	ensembl	human	known	69_37n	splice_site	107	28.00	42	SNP	1.000	G
