#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA9	10350	genome.wustl.edu	37	17	66982401	66982401	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr17:66982401T>C	ENST00000340001.4	-	32	4323	c.4112A>G	c.(4111-4113)aAt>aGt	p.N1371S	ABCA9_ENST00000453985.2_Missense_Mutation_p.N1333S|ABCA9_ENST00000370732.2_Missense_Mutation_p.N1371S|ABCA9_ENST00000482072.1_5'Flank	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1371	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.N1371S(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CCACAGCGCATTCTCCTGAGG	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	104.0	111.0					17																	66982401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4112A>G	17.37:g.66982401T>C	ENSP00000342216:p.Asn1371Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.N1371S	ENST00000340001.4	37	c.4112	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	T	13.22	2.172229	0.38315	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732	T;T	0.13196	2.61;2.61	4.87	3.79	0.43588	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.648452	0.14209	N	0.334183	T	0.15392	0.0371	L	0.27975	0.815	0.30416	N	0.778592	B;P	0.41450	0.428;0.75	B;P	0.47941	0.251;0.562	T	0.05599	-1.0875	10	0.66056	D	0.02	.	9.8923	0.41298	0.0:0.0809:0.0:0.9191	.	1371;1371	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	S	1371;1316;1371	ENSP00000342216:N1371S;ENSP00000359767:N1371S	ENSP00000342216:N1371S	N	-	2	0	ABCA9	64493996	0.810000	0.29049	0.550000	0.28217	0.298000	0.27526	3.601000	0.54059	0.825000	0.34637	0.533000	0.62120	AAT	ABCA9	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154258		0.547	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	399	0.00	0	T	NM_172386		66982401	66982401	-1	no_errors	ENST00000340001	ensembl	human	known	69_37n	missense	247	35.68	137	SNP	0.985	C
ABCA9	10350	genome.wustl.edu	37	17	66982401	66982401	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr17:66982401T>C	ENST00000340001.4	-	32	4323	c.4112A>G	c.(4111-4113)aAt>aGt	p.N1371S	ABCA9_ENST00000453985.2_Missense_Mutation_p.N1333S|ABCA9_ENST00000370732.2_Missense_Mutation_p.N1371S|ABCA9_ENST00000482072.1_5'Flank	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1371	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.N1371S(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CCACAGCGCATTCTCCTGAGG	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	104.0	111.0					17																	66982401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4112A>G	17.37:g.66982401T>C	ENSP00000342216:p.Asn1371Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.N1371S	ENST00000340001.4	37	c.4112	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	T	13.22	2.172229	0.38315	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732	T;T	0.13196	2.61;2.61	4.87	3.79	0.43588	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.648452	0.14209	N	0.334183	T	0.15392	0.0371	L	0.27975	0.815	0.30416	N	0.778592	B;P	0.41450	0.428;0.75	B;P	0.47941	0.251;0.562	T	0.05599	-1.0875	10	0.66056	D	0.02	.	9.8923	0.41298	0.0:0.0809:0.0:0.9191	.	1371;1371	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	S	1371;1316;1371	ENSP00000342216:N1371S;ENSP00000359767:N1371S	ENSP00000342216:N1371S	N	-	2	0	ABCA9	64493996	0.810000	0.29049	0.550000	0.28217	0.298000	0.27526	3.601000	0.54059	0.825000	0.34637	0.533000	0.62120	AAT	ABCA9	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154258		0.547	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	205	0.00	0	T	NM_172386		66982401	66982401	-1	no_errors	ENST00000340001	ensembl	human	known	69_37n	missense	247	35.68	137	SNP	0.985	C
ACSM3	6296	genome.wustl.edu	37	16	20788842	20788842	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr16:20788842C>T	ENST00000289416.5	+	4	1053	c.578C>T	c.(577-579)tCc>tTc	p.S193F	ACSM3_ENST00000450120.2_Missense_Mutation_p.S148F|ACSM3_ENST00000440284.2_Missense_Mutation_p.S193F	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	193					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)	p.S193F(2)		breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						AATCTGCACTCCAAGCTGATT	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											60.0	56.0	57.0					16																	20788842		2201	4300	6501	-	-	-	SO:0001583	missense	0			D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.578C>T	16.37:g.20788842C>T	ENSP00000289416:p.Ser193Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.S193F	ENST00000289416.5	37	c.578	CCDS10589.1	16	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444893	0.25987	.	.	ENSG00000005187	ENST00000289416;ENST00000440284;ENST00000450120	T;T;T	0.49139	0.93;0.93;0.79	6.05	2.84	0.33178	AMP-dependent synthetase/ligase (1);	0.379374	0.27088	N	0.021000	T	0.24275	0.0588	N	0.17082	0.46	0.26744	N	0.970323	B;B;B	0.11235	0.003;0.003;0.004	B;B;B	0.15484	0.013;0.005;0.005	T	0.17930	-1.0353	10	0.09590	T	0.72	-4.1933	5.8318	0.18584	0.1183:0.4493:0.3456:0.0868	.	148;193;193	E7ETR5;Q53FZ2;Q53FZ2-2	.;ACSM3_HUMAN;.	F	193;193;148	ENSP00000289416:S193F;ENSP00000394565:S193F;ENSP00000395297:S148F	ENSP00000289416:S193F	S	+	2	0	ACSM3	20696343	0.394000	0.25246	0.998000	0.56505	0.477000	0.33069	0.465000	0.22004	0.838000	0.34948	0.650000	0.86243	TCC	ACSM3	-	pfam_AMP-dep_Synth/Lig	ENSG00000005187		0.448	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM3	HGNC	protein_coding	OTTHUMT00000254414.2	129	0.00	0	C	NM_005622		20788842	20788842	+1	no_errors	ENST00000289416	ensembl	human	known	69_37n	missense	91	16.51	18	SNP	0.750	T
ACSM3	6296	genome.wustl.edu	37	16	20788842	20788842	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr16:20788842C>T	ENST00000289416.5	+	4	1053	c.578C>T	c.(577-579)tCc>tTc	p.S193F	ACSM3_ENST00000450120.2_Missense_Mutation_p.S148F|ACSM3_ENST00000440284.2_Missense_Mutation_p.S193F	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	193					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)	p.S193F(2)		breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						AATCTGCACTCCAAGCTGATT	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											60.0	56.0	57.0					16																	20788842		2201	4300	6501	-	-	-	SO:0001583	missense	0			D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.578C>T	16.37:g.20788842C>T	ENSP00000289416:p.Ser193Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.S193F	ENST00000289416.5	37	c.578	CCDS10589.1	16	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444893	0.25987	.	.	ENSG00000005187	ENST00000289416;ENST00000440284;ENST00000450120	T;T;T	0.49139	0.93;0.93;0.79	6.05	2.84	0.33178	AMP-dependent synthetase/ligase (1);	0.379374	0.27088	N	0.021000	T	0.24275	0.0588	N	0.17082	0.46	0.26744	N	0.970323	B;B;B	0.11235	0.003;0.003;0.004	B;B;B	0.15484	0.013;0.005;0.005	T	0.17930	-1.0353	10	0.09590	T	0.72	-4.1933	5.8318	0.18584	0.1183:0.4493:0.3456:0.0868	.	148;193;193	E7ETR5;Q53FZ2;Q53FZ2-2	.;ACSM3_HUMAN;.	F	193;193;148	ENSP00000289416:S193F;ENSP00000394565:S193F;ENSP00000395297:S148F	ENSP00000289416:S193F	S	+	2	0	ACSM3	20696343	0.394000	0.25246	0.998000	0.56505	0.477000	0.33069	0.465000	0.22004	0.838000	0.34948	0.650000	0.86243	TCC	ACSM3	-	pfam_AMP-dep_Synth/Lig	ENSG00000005187		0.448	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM3	HGNC	protein_coding	OTTHUMT00000254414.2	53	0.00	0	C	NM_005622		20788842	20788842	+1	no_errors	ENST00000289416	ensembl	human	known	69_37n	missense	91	16.51	18	SNP	0.750	T
AKAP3	10566	genome.wustl.edu	37	12	4747364	4747364	+	Splice_Site	SNP	T	T	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr12:4747364T>G	ENST00000545990.2	-	4	525		c.e4-2		AKAP3_ENST00000228850.1_Splice_Site|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3						acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						TTCTGACATCTGGAAGCAGGG	0.418																																						dbGAP											0													164.0	172.0	169.0					12																	4747364		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1-2A>C	12.37:g.4747364T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O75945|Q86X01|Q9UM61	Splice_Site	SNP	-	e1-2	ENST00000545990.2	37	c.1-2	CCDS8531.1	12																																																																																			AKAP3	-	-	ENSG00000111254		0.418	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	413	0.24	1	T	NM_006422	Intron	4747364	4747364	-1	no_errors	ENST00000228850	ensembl	human	known	69_37n	splice_site	252	21.50	69	SNP	0.985	G
AKAP3	10566	genome.wustl.edu	37	12	4747364	4747364	+	Splice_Site	SNP	T	T	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr12:4747364T>G	ENST00000545990.2	-	4	525		c.e4-2		AKAP3_ENST00000228850.1_Splice_Site|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3						acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						TTCTGACATCTGGAAGCAGGG	0.418																																						dbGAP											0													164.0	172.0	169.0					12																	4747364		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1-2A>C	12.37:g.4747364T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O75945|Q86X01|Q9UM61	Splice_Site	SNP	-	e1-2	ENST00000545990.2	37	c.1-2	CCDS8531.1	12																																																																																			AKAP3	-	-	ENSG00000111254		0.418	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	189	0.00	0	T	NM_006422	Intron	4747364	4747364	-1	no_errors	ENST00000228850	ensembl	human	known	69_37n	splice_site	252	21.50	69	SNP	0.985	G
ALG5	29880	genome.wustl.edu	37	13	37569662	37569662	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr13:37569662G>T	ENST00000239891.3	-	2	204	c.138C>A	c.(136-138)ttC>ttA	p.F46L	ALG5_ENST00000413537.2_Missense_Mutation_p.F46L|ALG5_ENST00000496689.1_5'UTR|ALG5_ENST00000443765.1_Missense_Mutation_p.F46L	NM_013338.4	NP_037470.1	Q9Y673	ALG5_HUMAN	ALG5, dolichyl-phosphate beta-glucosyltransferase	46					cellular protein metabolic process (GO:0044267)|determination of left/right symmetry (GO:0007368)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dolichyl-phosphate beta-glucosyltransferase activity (GO:0004581)|oligosaccharyl transferase activity (GO:0004576)	p.F46L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		TGGCATTTAAGAAGAATTTCT	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	114.0	114.0					13																	37569662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088028	CCDS9361.1, CCDS45033.1	13q13.1	2013-02-22	2013-02-21		ENSG00000120697	ENSG00000120697	2.4.1.117	"""Glycosyltransferase family 2 domain containing"""	20266	protein-coding gene	gene with protein product		604565	"""asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase)"", ""asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)"""			10359825	Standard	NM_013338		Approved	bA421P11.2	uc001uvy.3	Q9Y673	OTTHUMG00000016741	ENST00000239891.3:c.138C>A	13.37:g.37569662G>T	ENSP00000239891:p.Phe46Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR37|Q5TBA6	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.F46L	ENST00000239891.3	37	c.138	CCDS9361.1	13	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593728	0.66219	.	.	ENSG00000120697	ENST00000443765;ENST00000239891;ENST00000413537	D;T	0.83419	-1.72;-1.15	6.17	2.01	0.26516	.	0.000000	0.85682	D	0.000000	D	0.88418	0.6431	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.97	D;P	0.77557	0.99;0.824	D	0.85626	0.1267	10	0.45353	T	0.12	.	7.8216	0.29290	0.2581:0.0:0.626:0.1159	.	46;46	Q9Y673-2;Q9Y673	.;ALG5_HUMAN	L	46	ENSP00000239891:F46L;ENSP00000389647:F46L	ENSP00000239891:F46L	F	-	3	2	ALG5	36467662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.207000	0.32333	0.473000	0.27368	0.655000	0.94253	TTC	ALG5	-	NULL	ENSG00000120697		0.388	ALG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG5	HGNC	protein_coding	OTTHUMT00000044528.2	66	0.00	0	G	NM_013338		37569662	37569662	-1	no_errors	ENST00000239891	ensembl	human	known	69_37n	missense	55	26.67	20	SNP	0.974	T
ALG5	29880	genome.wustl.edu	37	13	37569662	37569662	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr13:37569662G>T	ENST00000239891.3	-	2	204	c.138C>A	c.(136-138)ttC>ttA	p.F46L	ALG5_ENST00000413537.2_Missense_Mutation_p.F46L|ALG5_ENST00000496689.1_5'UTR|ALG5_ENST00000443765.1_Missense_Mutation_p.F46L	NM_013338.4	NP_037470.1	Q9Y673	ALG5_HUMAN	ALG5, dolichyl-phosphate beta-glucosyltransferase	46					cellular protein metabolic process (GO:0044267)|determination of left/right symmetry (GO:0007368)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dolichyl-phosphate beta-glucosyltransferase activity (GO:0004581)|oligosaccharyl transferase activity (GO:0004576)	p.F46L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		TGGCATTTAAGAAGAATTTCT	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	114.0	114.0					13																	37569662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088028	CCDS9361.1, CCDS45033.1	13q13.1	2013-02-22	2013-02-21		ENSG00000120697	ENSG00000120697	2.4.1.117	"""Glycosyltransferase family 2 domain containing"""	20266	protein-coding gene	gene with protein product		604565	"""asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase)"", ""asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)"""			10359825	Standard	NM_013338		Approved	bA421P11.2	uc001uvy.3	Q9Y673	OTTHUMG00000016741	ENST00000239891.3:c.138C>A	13.37:g.37569662G>T	ENSP00000239891:p.Phe46Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR37|Q5TBA6	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.F46L	ENST00000239891.3	37	c.138	CCDS9361.1	13	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593728	0.66219	.	.	ENSG00000120697	ENST00000443765;ENST00000239891;ENST00000413537	D;T	0.83419	-1.72;-1.15	6.17	2.01	0.26516	.	0.000000	0.85682	D	0.000000	D	0.88418	0.6431	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.97	D;P	0.77557	0.99;0.824	D	0.85626	0.1267	10	0.45353	T	0.12	.	7.8216	0.29290	0.2581:0.0:0.626:0.1159	.	46;46	Q9Y673-2;Q9Y673	.;ALG5_HUMAN	L	46	ENSP00000239891:F46L;ENSP00000389647:F46L	ENSP00000239891:F46L	F	-	3	2	ALG5	36467662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.207000	0.32333	0.473000	0.27368	0.655000	0.94253	TTC	ALG5	-	NULL	ENSG00000120697		0.388	ALG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG5	HGNC	protein_coding	OTTHUMT00000044528.2	102	0.00	0	G	NM_013338		37569662	37569662	-1	no_errors	ENST00000239891	ensembl	human	known	69_37n	missense	55	26.67	20	SNP	0.974	T
AMZ2	51321	genome.wustl.edu	37	17	66246405	66246405	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr17:66246405A>G	ENST00000359904.3	+	2	1209	c.77A>G	c.(76-78)tAt>tGt	p.Y26C	AMZ2_ENST00000577273.1_Missense_Mutation_p.Y26C|AMZ2_ENST00000577866.1_Missense_Mutation_p.Y26C|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000359783.4_Missense_Mutation_p.Y26C|AMZ2_ENST00000580753.1_Missense_Mutation_p.Y26C|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577985.1_Missense_Mutation_p.Y26C|AMZ2_ENST00000392720.2_Missense_Mutation_p.Y26C	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	26							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Y26C(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTATCACAGTATGAGAAATTA	0.408																																						dbGAP											2	Substitution - Missense(2)	breast(2)											113.0	111.0	112.0					17																	66246405		2203	4300	6503	-	-	-	SO:0001583	missense	0			CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.77A>G	17.37:g.66246405A>G	ENSP00000352976:p.Tyr26Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	pfam_Pept_M54_archaemetzincn	p.Y26C	ENST00000359904.3	37	c.77	CCDS11674.1	17	.	.	.	.	.	.	.	.	.	.	A	9.306	1.054378	0.19907	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.18657	2.2;2.2;2.2	3.58	3.58	0.41010	.	0.000000	0.56097	D	0.000024	T	0.44582	0.1300	M	0.79258	2.445	0.40163	D	0.977081	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.49579	-0.8925	10	0.87932	D	0	-17.3404	10.4655	0.44604	1.0:0.0:0.0:0.0	.	26;26	A6NLD9;Q86W34	.;AMZ2_HUMAN	C	26	ENSP00000352976:Y26C;ENSP00000352831:Y26C;ENSP00000376481:Y26C	ENSP00000352831:Y26C	Y	+	2	0	AMZ2	63758000	1.000000	0.71417	0.842000	0.33263	0.703000	0.40648	5.479000	0.66813	1.619000	0.50296	0.254000	0.18369	TAT	AMZ2	-	NULL	ENSG00000196704		0.408	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	HGNC	protein_coding	OTTHUMT00000448261.1	175	0.00	0	A	NM_016627		66246405	66246405	+1	no_errors	ENST00000359904	ensembl	human	known	69_37n	missense	179	11.82	24	SNP	0.993	G
AMZ2	51321	genome.wustl.edu	37	17	66246405	66246405	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr17:66246405A>G	ENST00000359904.3	+	2	1209	c.77A>G	c.(76-78)tAt>tGt	p.Y26C	AMZ2_ENST00000577273.1_Missense_Mutation_p.Y26C|AMZ2_ENST00000577866.1_Missense_Mutation_p.Y26C|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000359783.4_Missense_Mutation_p.Y26C|AMZ2_ENST00000580753.1_Missense_Mutation_p.Y26C|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577985.1_Missense_Mutation_p.Y26C|AMZ2_ENST00000392720.2_Missense_Mutation_p.Y26C	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	26							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Y26C(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTATCACAGTATGAGAAATTA	0.408																																						dbGAP											2	Substitution - Missense(2)	breast(2)											113.0	111.0	112.0					17																	66246405		2203	4300	6503	-	-	-	SO:0001583	missense	0			CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.77A>G	17.37:g.66246405A>G	ENSP00000352976:p.Tyr26Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	pfam_Pept_M54_archaemetzincn	p.Y26C	ENST00000359904.3	37	c.77	CCDS11674.1	17	.	.	.	.	.	.	.	.	.	.	A	9.306	1.054378	0.19907	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.18657	2.2;2.2;2.2	3.58	3.58	0.41010	.	0.000000	0.56097	D	0.000024	T	0.44582	0.1300	M	0.79258	2.445	0.40163	D	0.977081	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.49579	-0.8925	10	0.87932	D	0	-17.3404	10.4655	0.44604	1.0:0.0:0.0:0.0	.	26;26	A6NLD9;Q86W34	.;AMZ2_HUMAN	C	26	ENSP00000352976:Y26C;ENSP00000352831:Y26C;ENSP00000376481:Y26C	ENSP00000352831:Y26C	Y	+	2	0	AMZ2	63758000	1.000000	0.71417	0.842000	0.33263	0.703000	0.40648	5.479000	0.66813	1.619000	0.50296	0.254000	0.18369	TAT	AMZ2	-	NULL	ENSG00000196704		0.408	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	HGNC	protein_coding	OTTHUMT00000448261.1	257	0.00	0	A	NM_016627		66246405	66246405	+1	no_errors	ENST00000359904	ensembl	human	known	69_37n	missense	179	11.82	24	SNP	0.993	G
ANKRD20A4	728747	genome.wustl.edu	37	9	69385951	69385951	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr9:69385951G>A	ENST00000357336.3	+	3	669	c.388G>A	c.(388-390)Gat>Aat	p.D130N		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	130								p.D130N(1)		breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						AAACCTTAAGGATATCTACGG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											1.0	1.0	1.0					9																	69385951		179	317	496	-	-	-	SO:0001583	missense	0				CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.388G>A	9.37:g.69385951G>A	ENSP00000349891:p.Asp130Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D130N	ENST00000357336.3	37	c.388	CCDS43828.1	9	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005412	0.54254	.	.	ENSG00000172014	ENST00000357336	T	0.57273	0.41	2.26	2.26	0.28386	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.53690	0.1812	N	0.20304	0.555	0.18873	N	0.999985	D	0.76494	0.999	D	0.77004	0.989	T	0.36578	-0.9742	9	0.54805	T	0.06	.	7.9999	0.30291	0.0:0.0:1.0:0.0	.	130	Q4UJ75	A20A4_HUMAN	N	130	ENSP00000349891:D130N	ENSP00000349891:D130N	D	+	1	0	ANKRD20A4	68675771	1.000000	0.71417	0.003000	0.11579	0.056000	0.15407	5.318000	0.65829	1.256000	0.44068	0.184000	0.17185	GAT	ANKRD20A4	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000172014		0.488	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	HGNC	protein_coding	OTTHUMT00000143287.3	127	0.00	0	G	NM_001098805		69385951	69385951	+1	no_errors	ENST00000357336	ensembl	human	known	69_37n	missense	51	28.17	20	SNP	0.161	A
ANKRD20A4	728747	genome.wustl.edu	37	9	69385951	69385951	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr9:69385951G>A	ENST00000357336.3	+	3	669	c.388G>A	c.(388-390)Gat>Aat	p.D130N		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	130								p.D130N(1)		breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						AAACCTTAAGGATATCTACGG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											1.0	1.0	1.0					9																	69385951		179	317	496	-	-	-	SO:0001583	missense	0				CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.388G>A	9.37:g.69385951G>A	ENSP00000349891:p.Asp130Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D130N	ENST00000357336.3	37	c.388	CCDS43828.1	9	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005412	0.54254	.	.	ENSG00000172014	ENST00000357336	T	0.57273	0.41	2.26	2.26	0.28386	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.53690	0.1812	N	0.20304	0.555	0.18873	N	0.999985	D	0.76494	0.999	D	0.77004	0.989	T	0.36578	-0.9742	9	0.54805	T	0.06	.	7.9999	0.30291	0.0:0.0:1.0:0.0	.	130	Q4UJ75	A20A4_HUMAN	N	130	ENSP00000349891:D130N	ENSP00000349891:D130N	D	+	1	0	ANKRD20A4	68675771	1.000000	0.71417	0.003000	0.11579	0.056000	0.15407	5.318000	0.65829	1.256000	0.44068	0.184000	0.17185	GAT	ANKRD20A4	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000172014		0.488	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	HGNC	protein_coding	OTTHUMT00000143287.3	40	0.00	0	G	NM_001098805		69385951	69385951	+1	no_errors	ENST00000357336	ensembl	human	known	69_37n	missense	51	28.17	20	SNP	0.161	A
ARHGAP35	2909	genome.wustl.edu	37	19	47503649	47503649	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr19:47503649C>A	ENST00000404338.3	+	6	4204	c.4204C>A	c.(4204-4206)Ccc>Acc	p.P1402T		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1402	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CTGCTTCTGGCCCACCTTGAT	0.532																																						dbGAP											0													257.0	272.0	267.0					19																	47503649		2174	4267	6441	-	-	-	SO:0001583	missense	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.4204C>A	19.37:g.47503649C>A	ENSP00000385720:p.Pro1402Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P1402T	ENST00000404338.3	37	c.4204	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	C	27.7	4.859422	0.91433	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.41758	0.99	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.73916	0.3648	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81470	-0.0918	10	0.87932	D	0	-22.0265	17.3875	0.87421	0.0:1.0:0.0:0.0	.	1402	Q9NRY4-2	.	T	1402	ENSP00000385720:P1402T	ENSP00000324820:P1402T	P	+	1	0	ARHGAP35	52195489	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.517000	0.81783	2.643000	0.89663	0.650000	0.86243	CCC	ARHGAP35	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000160007		0.532	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	463	0.00	0	C	NM_004491		47503649	47503649	+1	no_errors	ENST00000404338	ensembl	human	known	69_37n	missense	60	25.00	20	SNP	1.000	A
ARL17B	100506084	genome.wustl.edu	37	17	44430254	44430254	+	Missense_Mutation	SNP	G	G	C	rs35595570	byFrequency	TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr17:44430254G>C	ENST00000450673.3	-	3	296	c.191C>G	c.(190-192)gCt>gGt	p.A64G	ARL17B_ENST00000575698.1_Missense_Mutation_p.A64G|ARL17B_ENST00000575960.1_Missense_Mutation_p.A64G|ARL17B_ENST00000571246.1_Missense_Mutation_p.A64G|ARL17B_ENST00000434041.2_Missense_Mutation_p.A64G|ARL17B_ENST00000570618.1_Missense_Mutation_p.A64G	NM_001039083.3	NP_001034172.3	Q8IVW1	ARL17_HUMAN	ADP-ribosylation factor-like 17B	64					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)	GTP binding (GO:0005525)	p.A64G(1)		pancreas(1)	1						ATCCCAGACAGCGAAGGTGTT	0.378																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											3.0	3.0	3.0					17																	44430254		1275	3002	4277	-	-	-	SO:0001583	missense	0			AF493886	CCDS54137.1, CCDS58557.1	17q21.31	2014-05-09	2009-11-17	2009-11-17	ENSG00000228696	ENSG00000228696		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	32387	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 17"""	ARL17			Standard	NM_001039083		Approved			Q8IVW1	OTTHUMG00000178031	ENST00000450673.3:c.191C>G	17.37:g.44430254G>C	ENSP00000404247:p.Ala64Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B0AZR6|Q59FW5|Q8N6E2|Q8TD73|Q8WW54|Q9NZD5|Q9P158	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR	p.A64G	ENST00000450673.3	37	c.191	CCDS58557.1	17	.	.	.	.	.	.	.	.	.	.	g	4.858	0.159467	0.09236	.	.	ENSG00000228696	ENST00000434041;ENST00000450673	T;T	0.63744	-0.06;-0.06	2.89	2.89	0.33648	.	.	.	.	.	T	0.51736	0.1692	.	.	.	0.29739	N	0.837233	B;B;B	0.31817	0.164;0.054;0.341	B;B;B	0.31686	0.134;0.038;0.08	T	0.55768	-0.8089	8	0.52906	T	0.07	.	11.9465	0.52930	0.0:0.0:1.0:0.0	.	64;64;64	Q8IVW1;Q8IVW1-2;F8VZA5	ARL17_HUMAN;.;.	G	64	ENSP00000391751:A64G;ENSP00000404247:A64G	ENSP00000391751:A64G	A	-	2	0	ARL17B	41786010	1.000000	0.71417	0.999000	0.59377	0.006000	0.05464	8.736000	0.91554	1.898000	0.54952	0.393000	0.25936	GCT	ARL17B	-	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR	ENSG00000228696		0.378	ARL17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARL17B	HGNC	protein_coding	OTTHUMT00000440297.1	9	0.00	0	G	NM_001039083		44430254	44430254	-1	no_errors	ENST00000450673	ensembl	human	known	69_37n	missense	51	32.89	25	SNP	1.000	C
ATOH1	474	genome.wustl.edu	37	4	94750648	94750648	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr4:94750648A>C	ENST00000306011.3	+	1	607	c.571A>C	c.(571-573)Aac>Cac	p.N191H		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	191	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N191H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		GTCGTTCAACAACGACAAGAA	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	54.0	53.0					4																	94750648		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.571A>C	4.37:g.94750648A>C	ENSP00000302216:p.Asn191His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CT9	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.N191H	ENST00000306011.3	37	c.571	CCDS3638.1	4	.	.	.	.	.	.	.	.	.	.	A	16.71	3.199700	0.58126	.	.	ENSG00000172238	ENST00000306011	D	0.97941	-4.62	4.41	4.41	0.53225	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	L	0.41124	1.26	0.51012	D	0.999905	D	0.57899	0.981	P	0.60886	0.88	D	0.97454	1.0030	10	0.54805	T	0.06	-21.6602	13.5045	0.61477	1.0:0.0:0.0:0.0	.	191	Q92858	ATOH1_HUMAN	H	191	ENSP00000302216:N191H	ENSP00000302216:N191H	N	+	1	0	ATOH1	94969671	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.906000	0.56340	1.859000	0.53934	0.448000	0.29417	AAC	ATOH1	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000172238		0.582	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH1	HGNC	protein_coding	OTTHUMT00000253585.1	81	0.00	0	A	NM_005172		94750648	94750648	+1	no_errors	ENST00000306011	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	C
ATOH1	474	genome.wustl.edu	37	4	94750648	94750648	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr4:94750648A>C	ENST00000306011.3	+	1	607	c.571A>C	c.(571-573)Aac>Cac	p.N191H		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	191	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N191H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		GTCGTTCAACAACGACAAGAA	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	54.0	53.0					4																	94750648		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.571A>C	4.37:g.94750648A>C	ENSP00000302216:p.Asn191His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CT9	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.N191H	ENST00000306011.3	37	c.571	CCDS3638.1	4	.	.	.	.	.	.	.	.	.	.	A	16.71	3.199700	0.58126	.	.	ENSG00000172238	ENST00000306011	D	0.97941	-4.62	4.41	4.41	0.53225	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	L	0.41124	1.26	0.51012	D	0.999905	D	0.57899	0.981	P	0.60886	0.88	D	0.97454	1.0030	10	0.54805	T	0.06	-21.6602	13.5045	0.61477	1.0:0.0:0.0:0.0	.	191	Q92858	ATOH1_HUMAN	H	191	ENSP00000302216:N191H	ENSP00000302216:N191H	N	+	1	0	ATOH1	94969671	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.906000	0.56340	1.859000	0.53934	0.448000	0.29417	AAC	ATOH1	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000172238		0.582	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH1	HGNC	protein_coding	OTTHUMT00000253585.1	50	0.00	0	A	NM_005172		94750648	94750648	+1	no_errors	ENST00000306011	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	C
BCL9L	283149	genome.wustl.edu	37	11	118770742	118770742	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr11:118770742G>C	ENST00000334801.3	-	7	4254	c.3290C>G	c.(3289-3291)cCc>cGc	p.P1097R	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1097	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.P1097R(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GGTGGAGCTGGGCATGGCGTA	0.632																																						dbGAP											2	Substitution - Missense(2)	breast(2)											191.0	161.0	171.0					11																	118770742		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3290C>G	11.37:g.118770742G>C	ENSP00000335320:p.Pro1097Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.P1097R	ENST00000334801.3	37	c.3290	CCDS8403.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.92|14.92	2.679720|2.679720	0.47886|0.47886	.|.	.|.	ENSG00000186174|ENSG00000186174	ENST00000530293|ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	.|T	.|0.54866	.|0.55	4.41|4.41	3.5|3.5	0.40072|0.40072	.|.	0.000000|0.000000	0.50627|0.50627	D|D	0.000108|0.000108	T|T	0.61489|0.61489	0.2351|0.2351	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.85130	.|0.996;0.997	T|T	0.64351|0.64351	-0.6428|-0.6428	7|10	0.87932|0.87932	D|D	0|0	-12.2889|-12.2889	12.3504|12.3504	0.55144|0.55144	0.0817:0.0:0.9183:0.0|0.0817:0.0:0.9183:0.0	.|.	.|1092;1097	.|Q86UU0-2;Q86UU0	.|.;BCL9L_HUMAN	A|R	117|1097;1060;390;1097;1097	.|ENSP00000335320:P1097R	ENSP00000432158:P117A|ENSP00000335320:P1097R	P|P	-|-	1|2	0|0	BCL9L|BCL9L	118275952|118275952	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.007000|0.007000	0.05969|0.05969	9.648000|9.648000	0.98483|0.98483	1.073000|1.073000	0.40885|0.40885	-0.136000|-0.136000	0.14681|0.14681	CCA|CCC	BCL9L	-	NULL	ENSG00000186174		0.632	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1	96	0.00	0	G	NM_182557		118770742	118770742	-1	no_errors	ENST00000334801	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	C
BCL9L	283149	genome.wustl.edu	37	11	118770742	118770742	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr11:118770742G>C	ENST00000334801.3	-	7	4254	c.3290C>G	c.(3289-3291)cCc>cGc	p.P1097R	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1097	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.P1097R(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GGTGGAGCTGGGCATGGCGTA	0.632																																						dbGAP											2	Substitution - Missense(2)	breast(2)											191.0	161.0	171.0					11																	118770742		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3290C>G	11.37:g.118770742G>C	ENSP00000335320:p.Pro1097Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.P1097R	ENST00000334801.3	37	c.3290	CCDS8403.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.92|14.92	2.679720|2.679720	0.47886|0.47886	.|.	.|.	ENSG00000186174|ENSG00000186174	ENST00000530293|ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	.|T	.|0.54866	.|0.55	4.41|4.41	3.5|3.5	0.40072|0.40072	.|.	0.000000|0.000000	0.50627|0.50627	D|D	0.000108|0.000108	T|T	0.61489|0.61489	0.2351|0.2351	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.85130	.|0.996;0.997	T|T	0.64351|0.64351	-0.6428|-0.6428	7|10	0.87932|0.87932	D|D	0|0	-12.2889|-12.2889	12.3504|12.3504	0.55144|0.55144	0.0817:0.0:0.9183:0.0|0.0817:0.0:0.9183:0.0	.|.	.|1092;1097	.|Q86UU0-2;Q86UU0	.|.;BCL9L_HUMAN	A|R	117|1097;1060;390;1097;1097	.|ENSP00000335320:P1097R	ENSP00000432158:P117A|ENSP00000335320:P1097R	P|P	-|-	1|2	0|0	BCL9L|BCL9L	118275952|118275952	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.007000|0.007000	0.05969|0.05969	9.648000|9.648000	0.98483|0.98483	1.073000|1.073000	0.40885|0.40885	-0.136000|-0.136000	0.14681|0.14681	CCA|CCC	BCL9L	-	NULL	ENSG00000186174		0.632	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1	26	0.00	0	G	NM_182557		118770742	118770742	-1	no_errors	ENST00000334801	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	C
ZBED8	63920	genome.wustl.edu	37	5	159822112	159822112	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr5:159822112C>T	ENST00000408953.3	-	2	893	c.386G>A	c.(385-387)gGa>gAa	p.G129E	C5orf54_ENST00000523213.1_Missense_Mutation_p.G129E	NM_022090.3	NP_071373.2												p.G129E(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						tgcatctggtcccaaaactat	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	65.0	65.0					5																	159822112		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000408953.3:c.386G>A	5.37:g.159822112C>T	ENSP00000386184:p.Gly129Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.G129E	ENST00000408953.3	37	c.386	CCDS34283.1	5	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506791	0.44558	.	.	ENSG00000221886	ENST00000408953;ENST00000523213	T;T	0.14640	2.49;2.49	3.47	2.58	0.30949	.	.	.	.	.	T	0.25419	0.0618	L	0.60067	1.865	0.32572	N	0.529613	D	0.76494	0.999	D	0.69479	0.964	T	0.17745	-1.0359	9	0.15499	T	0.54	.	8.365	0.32380	0.2324:0.7676:0.0:0.0	.	129	Q8IZ13	CE054_HUMAN	E	129	ENSP00000386184:G129E;ENSP00000428831:G129E	ENSP00000386184:G129E	G	-	2	0	C5orf54	159754690	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.712000	0.25779	1.005000	0.39183	0.655000	0.94253	GGA	C5orf54	-	NULL	ENSG00000221886		0.383	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf54	HGNC	protein_coding	OTTHUMT00000374143.1	131	0.00	0	C			159822112	159822112	-1	no_errors	ENST00000408953	ensembl	human	known	69_37n	missense	134	20.71	35	SNP	1.000	T
ZBED8	63920	genome.wustl.edu	37	5	159822112	159822112	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr5:159822112C>T	ENST00000408953.3	-	2	893	c.386G>A	c.(385-387)gGa>gAa	p.G129E	C5orf54_ENST00000523213.1_Missense_Mutation_p.G129E	NM_022090.3	NP_071373.2												p.G129E(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						tgcatctggtcccaaaactat	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	65.0	65.0					5																	159822112		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000408953.3:c.386G>A	5.37:g.159822112C>T	ENSP00000386184:p.Gly129Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.G129E	ENST00000408953.3	37	c.386	CCDS34283.1	5	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506791	0.44558	.	.	ENSG00000221886	ENST00000408953;ENST00000523213	T;T	0.14640	2.49;2.49	3.47	2.58	0.30949	.	.	.	.	.	T	0.25419	0.0618	L	0.60067	1.865	0.32572	N	0.529613	D	0.76494	0.999	D	0.69479	0.964	T	0.17745	-1.0359	9	0.15499	T	0.54	.	8.365	0.32380	0.2324:0.7676:0.0:0.0	.	129	Q8IZ13	CE054_HUMAN	E	129	ENSP00000386184:G129E;ENSP00000428831:G129E	ENSP00000386184:G129E	G	-	2	0	C5orf54	159754690	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.712000	0.25779	1.005000	0.39183	0.655000	0.94253	GGA	C5orf54	-	NULL	ENSG00000221886		0.383	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf54	HGNC	protein_coding	OTTHUMT00000374143.1	111	0.00	0	C			159822112	159822112	-1	no_errors	ENST00000408953	ensembl	human	known	69_37n	missense	134	20.71	35	SNP	1.000	T
TBC1D32	221322	genome.wustl.edu	37	6	121481215	121481215	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr6:121481215G>A	ENST00000398212.2	-	24	2763	c.2714C>T	c.(2713-2715)tCa>tTa	p.S905L	TBC1D32_ENST00000275159.6_Missense_Mutation_p.S946L|TBC1D32_ENST00000398197.2_5'UTR	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	905					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)	p.S905L(1)									CAATGGATATGATGAAAACAT	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	110.0	112.0					6																	121481215		1820	4083	5903	-	-	-	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2714C>T	6.37:g.121481215G>A	ENSP00000381270:p.Ser905Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.S946L	ENST00000398212.2	37	c.2837	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368205	0.82463	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.20200	2.09;2.09	5.03	5.03	0.67393	.	0.197325	0.44483	D	0.000450	T	0.40119	0.1104	M	0.69823	2.125	0.47123	D	0.999325	D;P	0.67145	0.996;0.935	D;P	0.77557	0.99;0.63	T	0.29549	-1.0008	10	0.59425	D	0.04	.	18.7188	0.91686	0.0:0.0:1.0:0.0	.	946;905	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	L	946;905	ENSP00000275159:S946L;ENSP00000381270:S905L	ENSP00000275159:S946L	S	-	2	0	C6orf170	121522914	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.274000	0.78538	2.479000	0.83701	0.460000	0.39030	TCA	C6orf170	-	NULL	ENSG00000146350		0.303	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	HGNC	protein_coding	OTTHUMT00000380937.2	117	0.00	0	G	NM_152730		121481215	121481215	-1	no_errors	ENST00000275159	ensembl	human	putative	69_37n	missense	148	14.37	25	SNP	1.000	A
TBC1D32	221322	genome.wustl.edu	37	6	121481215	121481215	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr6:121481215G>A	ENST00000398212.2	-	24	2763	c.2714C>T	c.(2713-2715)tCa>tTa	p.S905L	TBC1D32_ENST00000275159.6_Missense_Mutation_p.S946L|TBC1D32_ENST00000398197.2_5'UTR	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	905					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)	p.S905L(1)									CAATGGATATGATGAAAACAT	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	110.0	112.0					6																	121481215		1820	4083	5903	-	-	-	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2714C>T	6.37:g.121481215G>A	ENSP00000381270:p.Ser905Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.S946L	ENST00000398212.2	37	c.2837	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368205	0.82463	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.20200	2.09;2.09	5.03	5.03	0.67393	.	0.197325	0.44483	D	0.000450	T	0.40119	0.1104	M	0.69823	2.125	0.47123	D	0.999325	D;P	0.67145	0.996;0.935	D;P	0.77557	0.99;0.63	T	0.29549	-1.0008	10	0.59425	D	0.04	.	18.7188	0.91686	0.0:0.0:1.0:0.0	.	946;905	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	L	946;905	ENSP00000275159:S946L;ENSP00000381270:S905L	ENSP00000275159:S946L	S	-	2	0	C6orf170	121522914	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.274000	0.78538	2.479000	0.83701	0.460000	0.39030	TCA	C6orf170	-	NULL	ENSG00000146350		0.303	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	HGNC	protein_coding	OTTHUMT00000380937.2	99	0.00	0	G	NM_152730		121481215	121481215	-1	no_errors	ENST00000275159	ensembl	human	putative	69_37n	missense	148	14.37	25	SNP	1.000	A
CAMK2D	817	genome.wustl.edu	37	4	114438800	114438800	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr4:114438800A>T	ENST00000342666.5	-	9	614	c.615T>A	c.(613-615)taT>taA	p.Y205*	CAMK2D_ENST00000418639.2_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000394524.3_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000394522.3_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000508738.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000515496.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000514328.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000296402.5_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000379773.2_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000429180.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000505990.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000511664.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000454265.2_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000394526.2_Nonsense_Mutation_p.Y205*			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	205	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)	p.Y205*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		CAAGTAGAATATAGAGAATGA	0.368																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											93.0	97.0	96.0					4																	114438800		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.615T>A	4.37:g.114438800A>T	ENSP00000339740:p.Tyr205*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y205*	ENST00000342666.5	37	c.615	CCDS3703.1	4	.	.	.	.	.	.	.	.	.	.	A	47	13.455881	0.99743	.	.	ENSG00000145349	ENST00000394524;ENST00000454265;ENST00000429180;ENST00000418639;ENST00000394526;ENST00000296402;ENST00000511664;ENST00000342666;ENST00000515496;ENST00000514328;ENST00000394522;ENST00000505990;ENST00000379773;ENST00000508738	.	.	.	5.4	-2.48	0.06423	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6741	0.77300	0.3626:0.0:0.6374:0.0	.	.	.	.	X	205	.	ENSP00000296402:Y205X	Y	-	3	2	CAMK2D	114658249	0.994000	0.37717	0.588000	0.28705	0.990000	0.78478	0.404000	0.20999	-0.722000	0.04922	0.533000	0.62120	TAT	CAMK2D	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000145349		0.368	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	CAMK2D	HGNC	protein_coding	OTTHUMT00000256420.2	169	0.00	0	A			114438800	114438800	-1	no_errors	ENST00000454265	ensembl	human	known	69_37n	nonsense	196	17.65	42	SNP	0.992	T
CAMK2D	817	genome.wustl.edu	37	4	114438800	114438800	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr4:114438800A>T	ENST00000342666.5	-	9	614	c.615T>A	c.(613-615)taT>taA	p.Y205*	CAMK2D_ENST00000418639.2_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000394524.3_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000394522.3_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000508738.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000515496.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000514328.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000296402.5_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000379773.2_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000429180.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000505990.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000511664.1_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000454265.2_Nonsense_Mutation_p.Y205*|CAMK2D_ENST00000394526.2_Nonsense_Mutation_p.Y205*			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	205	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)	p.Y205*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		CAAGTAGAATATAGAGAATGA	0.368																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											93.0	97.0	96.0					4																	114438800		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.615T>A	4.37:g.114438800A>T	ENSP00000339740:p.Tyr205*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y205*	ENST00000342666.5	37	c.615	CCDS3703.1	4	.	.	.	.	.	.	.	.	.	.	A	47	13.455881	0.99743	.	.	ENSG00000145349	ENST00000394524;ENST00000454265;ENST00000429180;ENST00000418639;ENST00000394526;ENST00000296402;ENST00000511664;ENST00000342666;ENST00000515496;ENST00000514328;ENST00000394522;ENST00000505990;ENST00000379773;ENST00000508738	.	.	.	5.4	-2.48	0.06423	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6741	0.77300	0.3626:0.0:0.6374:0.0	.	.	.	.	X	205	.	ENSP00000296402:Y205X	Y	-	3	2	CAMK2D	114658249	0.994000	0.37717	0.588000	0.28705	0.990000	0.78478	0.404000	0.20999	-0.722000	0.04922	0.533000	0.62120	TAT	CAMK2D	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000145349		0.368	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	CAMK2D	HGNC	protein_coding	OTTHUMT00000256420.2	131	0.00	0	A			114438800	114438800	-1	no_errors	ENST00000454265	ensembl	human	known	69_37n	nonsense	196	17.65	42	SNP	0.992	T
CCDC110	256309	genome.wustl.edu	37	4	186379415	186379415	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr4:186379415C>T	ENST00000307588.3	-	6	2401	c.2326G>A	c.(2326-2328)Gat>Aat	p.D776N	CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Missense_Mutation_p.D739N|CCDC110_ENST00000510617.1_Missense_Mutation_p.D776N	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	776						nucleus (GO:0005634)		p.D776N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		CAAATTTTATCACTTAAACTT	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	63.0	64.0					4																	186379415		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.2326G>A	4.37:g.186379415C>T	ENSP00000306776:p.Asp776Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YI9|Q8N7W0	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.D776N	ENST00000307588.3	37	c.2326	CCDS3843.1	4	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843069	0.51057	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.27720	1.65;1.65;1.65	5.54	4.68	0.58851	.	0.215240	0.32273	N	0.006333	T	0.29882	0.0747	L	0.38175	1.15	0.28403	N	0.918564	P;P;P	0.35272	0.493;0.493;0.493	B;B;B	0.39465	0.3;0.206;0.206	T	0.18272	-1.0342	10	0.48119	T	0.1	-8.5893	14.6057	0.68478	0.0:0.854:0.146:0.0	.	776;739;776	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	N	739;776;776	ENSP00000377172:D739N;ENSP00000306776:D776N;ENSP00000427246:D776N	ENSP00000306776:D776N	D	-	1	0	CCDC110	186616409	0.998000	0.40836	0.993000	0.49108	0.901000	0.52897	1.150000	0.31639	1.426000	0.47256	0.650000	0.86243	GAT	CCDC110	-	superfamily_4_helix_cytokine-like_core	ENSG00000168491		0.308	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC110	HGNC	protein_coding	OTTHUMT00000360519.2	56	0.00	0	C	NM_152775		186379415	186379415	-1	no_errors	ENST00000307588	ensembl	human	known	69_37n	missense	60	23.08	18	SNP	0.801	T
CCDC110	256309	genome.wustl.edu	37	4	186379415	186379415	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr4:186379415C>T	ENST00000307588.3	-	6	2401	c.2326G>A	c.(2326-2328)Gat>Aat	p.D776N	CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Missense_Mutation_p.D739N|CCDC110_ENST00000510617.1_Missense_Mutation_p.D776N	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	776						nucleus (GO:0005634)		p.D776N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		CAAATTTTATCACTTAAACTT	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	63.0	64.0					4																	186379415		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.2326G>A	4.37:g.186379415C>T	ENSP00000306776:p.Asp776Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YI9|Q8N7W0	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.D776N	ENST00000307588.3	37	c.2326	CCDS3843.1	4	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843069	0.51057	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.27720	1.65;1.65;1.65	5.54	4.68	0.58851	.	0.215240	0.32273	N	0.006333	T	0.29882	0.0747	L	0.38175	1.15	0.28403	N	0.918564	P;P;P	0.35272	0.493;0.493;0.493	B;B;B	0.39465	0.3;0.206;0.206	T	0.18272	-1.0342	10	0.48119	T	0.1	-8.5893	14.6057	0.68478	0.0:0.854:0.146:0.0	.	776;739;776	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	N	739;776;776	ENSP00000377172:D739N;ENSP00000306776:D776N;ENSP00000427246:D776N	ENSP00000306776:D776N	D	-	1	0	CCDC110	186616409	0.998000	0.40836	0.993000	0.49108	0.901000	0.52897	1.150000	0.31639	1.426000	0.47256	0.650000	0.86243	GAT	CCDC110	-	superfamily_4_helix_cytokine-like_core	ENSG00000168491		0.308	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC110	HGNC	protein_coding	OTTHUMT00000360519.2	125	0.00	0	C	NM_152775		186379415	186379415	-1	no_errors	ENST00000307588	ensembl	human	known	69_37n	missense	60	23.08	18	SNP	0.801	T
CCDC27	148870	genome.wustl.edu	37	1	3672038	3672038	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:3672038G>A	ENST00000294600.2	+	3	544	c.460G>A	c.(460-462)Gat>Aat	p.D154N		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	154								p.D154N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CACTGAGGCCGATTTGTCCGG	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											214.0	226.0	222.0					1																	3672038		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.460G>A	1.37:g.3672038G>A	ENSP00000294600:p.Asp154Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBV3|Q96M50	Missense_Mutation	SNP	superfamily_Prefoldin	p.D154N	ENST00000294600.2	37	c.460	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	G	7.651	0.682928	0.14907	.	.	ENSG00000162592	ENST00000294600	T	0.21734	1.99	3.37	-5.16	0.02857	.	4.361770	0.00628	N	0.000461	T	0.08133	0.0203	N	0.19112	0.55	0.09310	N	1	P	0.41673	0.759	B	0.21917	0.037	T	0.23261	-1.0193	10	0.66056	D	0.02	0.3929	0.3293	0.00316	0.233:0.2862:0.1919:0.2888	.	154	Q2M243	CCD27_HUMAN	N	154	ENSP00000294600:D154N	ENSP00000294600:D154N	D	+	1	0	CCDC27	3661898	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.266000	0.02842	-1.139000	0.02881	-0.314000	0.08810	GAT	CCDC27	-	NULL	ENSG00000162592		0.562	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1	226	0.00	0	G	NM_152492		3672038	3672038	+1	no_errors	ENST00000294600	ensembl	human	known	69_37n	missense	121	25.15	41	SNP	0.000	A
CCDC27	148870	genome.wustl.edu	37	1	3672038	3672038	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:3672038G>A	ENST00000294600.2	+	3	544	c.460G>A	c.(460-462)Gat>Aat	p.D154N		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	154								p.D154N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CACTGAGGCCGATTTGTCCGG	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											214.0	226.0	222.0					1																	3672038		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.460G>A	1.37:g.3672038G>A	ENSP00000294600:p.Asp154Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBV3|Q96M50	Missense_Mutation	SNP	superfamily_Prefoldin	p.D154N	ENST00000294600.2	37	c.460	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	G	7.651	0.682928	0.14907	.	.	ENSG00000162592	ENST00000294600	T	0.21734	1.99	3.37	-5.16	0.02857	.	4.361770	0.00628	N	0.000461	T	0.08133	0.0203	N	0.19112	0.55	0.09310	N	1	P	0.41673	0.759	B	0.21917	0.037	T	0.23261	-1.0193	10	0.66056	D	0.02	0.3929	0.3293	0.00316	0.233:0.2862:0.1919:0.2888	.	154	Q2M243	CCD27_HUMAN	N	154	ENSP00000294600:D154N	ENSP00000294600:D154N	D	+	1	0	CCDC27	3661898	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.266000	0.02842	-1.139000	0.02881	-0.314000	0.08810	GAT	CCDC27	-	NULL	ENSG00000162592		0.562	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1	101	0.00	0	G	NM_152492		3672038	3672038	+1	no_errors	ENST00000294600	ensembl	human	known	69_37n	missense	121	25.15	41	SNP	0.000	A
CKAP2	26586	genome.wustl.edu	37	13	53035596	53035596	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr13:53035596C>A	ENST00000378037.5	+	4	728	c.638C>A	c.(637-639)cCt>cAt	p.P213H	CKAP2_ENST00000258607.5_Missense_Mutation_p.P212H|CKAP2_ENST00000378034.3_Missense_Mutation_p.P212H|CKAP2_ENST00000490903.1_Missense_Mutation_p.P164H	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2									p.P212H(1)		breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		GCCACTATACCTAAAGCCACA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	81.0	83.0					13																	53035596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.638C>A	13.37:g.53035596C>A	ENSP00000367276:p.Pro213His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P213H	ENST00000378037.5	37	c.638	CCDS41893.1	13	.	.	.	.	.	.	.	.	.	.	.	10.19	1.281038	0.23392	.	.	ENSG00000136108	ENST00000398044;ENST00000258607;ENST00000378034;ENST00000378037;ENST00000490903	T;T;T;T	0.25414	2.12;1.8;2.12;2.14	5.43	2.75	0.32379	.	0.686384	0.14725	N	0.302128	T	0.34424	0.0897	L	0.54323	1.7	0.09310	N	1	D;D;D;P	0.56035	0.974;0.974;0.974;0.944	P;P;P;P	0.53360	0.639;0.724;0.724;0.465	T	0.08827	-1.0703	9	.	.	.	-0.0724	10.1303	0.42674	0.0:0.7748:0.0:0.2252	.	164;213;212;213	E9PD90;Q8WWK9;B2RMQ4;A8MYU4	.;CKAP2_HUMAN;.;.	H	213;212;212;213;164	ENSP00000258607:P212H;ENSP00000367273:P212H;ENSP00000367276:P213H;ENSP00000417830:P164H	.	P	+	2	0	CKAP2	51933597	0.676000	0.27567	0.009000	0.14445	0.015000	0.08874	2.352000	0.44080	0.666000	0.31087	-0.150000	0.13652	CCT	CKAP2	-	NULL	ENSG00000136108		0.393	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CKAP2	HGNC	protein_coding	OTTHUMT00000355010.2	77	0.00	0	C			53035596	53035596	+1	no_errors	ENST00000378037	ensembl	human	known	69_37n	missense	73	13.10	11	SNP	0.024	A
CKAP2	26586	genome.wustl.edu	37	13	53035596	53035596	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr13:53035596C>A	ENST00000378037.5	+	4	728	c.638C>A	c.(637-639)cCt>cAt	p.P213H	CKAP2_ENST00000258607.5_Missense_Mutation_p.P212H|CKAP2_ENST00000378034.3_Missense_Mutation_p.P212H|CKAP2_ENST00000490903.1_Missense_Mutation_p.P164H	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2									p.P212H(1)		breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		GCCACTATACCTAAAGCCACA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	81.0	83.0					13																	53035596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.638C>A	13.37:g.53035596C>A	ENSP00000367276:p.Pro213His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P213H	ENST00000378037.5	37	c.638	CCDS41893.1	13	.	.	.	.	.	.	.	.	.	.	.	10.19	1.281038	0.23392	.	.	ENSG00000136108	ENST00000398044;ENST00000258607;ENST00000378034;ENST00000378037;ENST00000490903	T;T;T;T	0.25414	2.12;1.8;2.12;2.14	5.43	2.75	0.32379	.	0.686384	0.14725	N	0.302128	T	0.34424	0.0897	L	0.54323	1.7	0.09310	N	1	D;D;D;P	0.56035	0.974;0.974;0.974;0.944	P;P;P;P	0.53360	0.639;0.724;0.724;0.465	T	0.08827	-1.0703	9	.	.	.	-0.0724	10.1303	0.42674	0.0:0.7748:0.0:0.2252	.	164;213;212;213	E9PD90;Q8WWK9;B2RMQ4;A8MYU4	.;CKAP2_HUMAN;.;.	H	213;212;212;213;164	ENSP00000258607:P212H;ENSP00000367273:P212H;ENSP00000367276:P213H;ENSP00000417830:P164H	.	P	+	2	0	CKAP2	51933597	0.676000	0.27567	0.009000	0.14445	0.015000	0.08874	2.352000	0.44080	0.666000	0.31087	-0.150000	0.13652	CCT	CKAP2	-	NULL	ENSG00000136108		0.393	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CKAP2	HGNC	protein_coding	OTTHUMT00000355010.2	167	0.00	0	C			53035596	53035596	+1	no_errors	ENST00000378037	ensembl	human	known	69_37n	missense	73	13.10	11	SNP	0.024	A
COL4A1	1282	genome.wustl.edu	37	13	110847369	110847369	+	Splice_Site	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr13:110847369C>A	ENST00000375820.4	-	22	1503		c.e22+1		COL4A1_ENST00000543140.1_Splice_Site	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1						axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.?(2)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			AAATTTCTTACCTTTCTCTCC	0.468																																						dbGAP											2	Unknown(2)	breast(2)											36.0	40.0	38.0					13																	110847369		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1381+1G>T	13.37:g.110847369C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Splice_Site	SNP	-	e22+1	ENST00000375820.4	37	c.1381+1	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383129	0.61845	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9032	0.86118	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL4A1	109645370	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	5.003000	0.63959	2.583000	0.87209	0.561000	0.74099	.	COL4A1	-	-	ENSG00000187498		0.468	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	34	0.00	0	C		Intron	110847369	110847369	-1	no_errors	ENST00000375820	ensembl	human	known	69_37n	splice_site	48	16.95	10	SNP	1.000	A
COL4A1	1282	genome.wustl.edu	37	13	110847369	110847369	+	Splice_Site	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr13:110847369C>A	ENST00000375820.4	-	22	1503		c.e22+1		COL4A1_ENST00000543140.1_Splice_Site	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1						axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.?(2)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			AAATTTCTTACCTTTCTCTCC	0.468																																						dbGAP											2	Unknown(2)	breast(2)											36.0	40.0	38.0					13																	110847369		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1381+1G>T	13.37:g.110847369C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Splice_Site	SNP	-	e22+1	ENST00000375820.4	37	c.1381+1	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383129	0.61845	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9032	0.86118	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL4A1	109645370	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	5.003000	0.63959	2.583000	0.87209	0.561000	0.74099	.	COL4A1	-	-	ENSG00000187498		0.468	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	61	0.00	0	C		Intron	110847369	110847369	-1	no_errors	ENST00000375820	ensembl	human	known	69_37n	splice_site	48	16.95	10	SNP	1.000	A
CREB3L2	64764	genome.wustl.edu	37	7	137600703	137600703	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr7:137600703G>C	ENST00000330387.6	-	3	726	c.375C>G	c.(373-375)atC>atG	p.I125M	CREB3L2_ENST00000452463.1_Missense_Mutation_p.I125M|CREB3L2_ENST00000456390.1_Missense_Mutation_p.I125M|CREB3L2_ENST00000458726.1_Missense_Mutation_p.I62M	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	125					cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.I125M(1)	FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						GCTCTGTCTTGATGGATGTTG	0.502			T	FUS	fibromyxoid sarcoma																																	dbGAP		Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	1	Substitution - Missense(1)	breast(1)											230.0	193.0	205.0					7																	137600703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.375C>G	7.37:g.137600703G>C	ENSP00000329140:p.Ile125Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P454|Q6ZMR6	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.I125M	ENST00000330387.6	37	c.375	CCDS34760.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.33|12.33	1.904182|1.904182	0.33628|0.33628	.|.	.|.	ENSG00000182158|ENSG00000182158	ENST00000544877|ENST00000330387;ENST00000417785;ENST00000456390;ENST00000452463;ENST00000458726;ENST00000420629	.|T;T;T;T;T	.|0.67523	.|0.12;-0.27;0.7;0.68;0.3	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.300780	.|0.36591	.|N	.|0.002517	.|T	.|0.74068	.|0.3668	L|L	0.52573|0.52573	1.65|1.65	0.54753|0.54753	D|D	0.99998|0.99998	.|D;D;D	.|0.89917	.|1.0;0.998;0.988	.|D;D;P	.|0.76575	.|0.988;0.962;0.797	.|T	.|0.72527	.|-0.4266	.|10	.|0.40728	.|T	.|0.16	.|-0.0556	8.4325|8.4325	0.32766|0.32766	0.0746:0.0:0.7314:0.194|0.0746:0.0:0.7314:0.194	.|.	.|125;125;125	.|Q70SY1-3;Q70SY1-2;Q70SY1	.|.;.;CR3L2_HUMAN	.|M	-1|125;125;125;125;62;118	.|ENSP00000329140:I125M;ENSP00000403550:I125M;ENSP00000410314:I125M;ENSP00000388917:I62M;ENSP00000402889:I118M	.|ENSP00000329140:I125M	.|I	-|-	.|3	.|3	CREB3L2|CREB3L2	137251243|137251243	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.519000|0.519000	0.34347|0.34347	3.098000|3.098000	0.50259|0.50259	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	.|ATC	CREB3L2	-	NULL	ENSG00000182158		0.502	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3L2	HGNC	protein_coding	OTTHUMT00000341462.1	113	0.00	0	G	NM_194071		137600703	137600703	-1	no_errors	ENST00000330387	ensembl	human	known	69_37n	missense	65	10.96	8	SNP	1.000	C
CREB3L2	64764	genome.wustl.edu	37	7	137600703	137600703	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr7:137600703G>C	ENST00000330387.6	-	3	726	c.375C>G	c.(373-375)atC>atG	p.I125M	CREB3L2_ENST00000452463.1_Missense_Mutation_p.I125M|CREB3L2_ENST00000456390.1_Missense_Mutation_p.I125M|CREB3L2_ENST00000458726.1_Missense_Mutation_p.I62M	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	125					cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.I125M(1)	FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						GCTCTGTCTTGATGGATGTTG	0.502			T	FUS	fibromyxoid sarcoma																																	dbGAP		Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	1	Substitution - Missense(1)	breast(1)											230.0	193.0	205.0					7																	137600703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.375C>G	7.37:g.137600703G>C	ENSP00000329140:p.Ile125Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P454|Q6ZMR6	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.I125M	ENST00000330387.6	37	c.375	CCDS34760.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.33|12.33	1.904182|1.904182	0.33628|0.33628	.|.	.|.	ENSG00000182158|ENSG00000182158	ENST00000544877|ENST00000330387;ENST00000417785;ENST00000456390;ENST00000452463;ENST00000458726;ENST00000420629	.|T;T;T;T;T	.|0.67523	.|0.12;-0.27;0.7;0.68;0.3	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.300780	.|0.36591	.|N	.|0.002517	.|T	.|0.74068	.|0.3668	L|L	0.52573|0.52573	1.65|1.65	0.54753|0.54753	D|D	0.99998|0.99998	.|D;D;D	.|0.89917	.|1.0;0.998;0.988	.|D;D;P	.|0.76575	.|0.988;0.962;0.797	.|T	.|0.72527	.|-0.4266	.|10	.|0.40728	.|T	.|0.16	.|-0.0556	8.4325|8.4325	0.32766|0.32766	0.0746:0.0:0.7314:0.194|0.0746:0.0:0.7314:0.194	.|.	.|125;125;125	.|Q70SY1-3;Q70SY1-2;Q70SY1	.|.;.;CR3L2_HUMAN	.|M	-1|125;125;125;125;62;118	.|ENSP00000329140:I125M;ENSP00000403550:I125M;ENSP00000410314:I125M;ENSP00000388917:I62M;ENSP00000402889:I118M	.|ENSP00000329140:I125M	.|I	-|-	.|3	.|3	CREB3L2|CREB3L2	137251243|137251243	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.519000|0.519000	0.34347|0.34347	3.098000|3.098000	0.50259|0.50259	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	.|ATC	CREB3L2	-	NULL	ENSG00000182158		0.502	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3L2	HGNC	protein_coding	OTTHUMT00000341462.1	63	0.00	0	G	NM_194071		137600703	137600703	-1	no_errors	ENST00000330387	ensembl	human	known	69_37n	missense	65	10.96	8	SNP	1.000	C
ERO1L	30001	genome.wustl.edu	37	14	53119001	53119001	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr14:53119001T>C	ENST00000395686.3	-	13	1304	c.1081A>G	c.(1081-1083)Aat>Gat	p.N361D		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	361					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)	p.N361D(1)	ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					AAAAATGAATTCTCATCAAAA	0.279																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	94.0	93.0					14																	53119001		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.1081A>G	14.37:g.53119001T>C	ENSP00000379042:p.Asn361Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Missense_Mutation	SNP	pfam_ER_oxidoreductin-1,superfamily_ER_oxidoreductin-1,pirsf_ER_oxidoreductin-1	p.N361D	ENST00000395686.3	37	c.1081	CCDS9709.1	14	.	.	.	.	.	.	.	.	.	.	T	15.41	2.824174	0.50739	.	.	ENSG00000197930	ENST00000395686;ENST00000556358	T;T	0.41400	1.0;1.0	5.06	5.06	0.68205	.	0.044097	0.85682	D	0.000000	T	0.40473	0.1118	L	0.45422	1.42	0.54753	D	0.99998	P	0.39216	0.664	B	0.41135	0.348	T	0.26643	-1.0097	10	0.39692	T	0.17	-24.0899	15.1115	0.72362	0.0:0.0:0.0:1.0	.	361	Q96HE7	ERO1A_HUMAN	D	361;20	ENSP00000379042:N361D;ENSP00000450655:N20D	ENSP00000379042:N361D	N	-	1	0	ERO1L	52188751	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.766000	0.68843	2.022000	0.59522	0.482000	0.46254	AAT	ERO1L	-	pfam_ER_oxidoreductin-1,superfamily_ER_oxidoreductin-1,pirsf_ER_oxidoreductin-1	ENSG00000197930		0.279	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERO1L	HGNC	protein_coding	OTTHUMT00000276892.1	79	0.00	0	T	NM_014584		53119001	53119001	-1	no_errors	ENST00000395686	ensembl	human	known	69_37n	missense	102	11.30	13	SNP	1.000	C
ERO1L	30001	genome.wustl.edu	37	14	53119001	53119001	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr14:53119001T>C	ENST00000395686.3	-	13	1304	c.1081A>G	c.(1081-1083)Aat>Gat	p.N361D		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	361					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)	p.N361D(1)	ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					AAAAATGAATTCTCATCAAAA	0.279																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	94.0	93.0					14																	53119001		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.1081A>G	14.37:g.53119001T>C	ENSP00000379042:p.Asn361Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Missense_Mutation	SNP	pfam_ER_oxidoreductin-1,superfamily_ER_oxidoreductin-1,pirsf_ER_oxidoreductin-1	p.N361D	ENST00000395686.3	37	c.1081	CCDS9709.1	14	.	.	.	.	.	.	.	.	.	.	T	15.41	2.824174	0.50739	.	.	ENSG00000197930	ENST00000395686;ENST00000556358	T;T	0.41400	1.0;1.0	5.06	5.06	0.68205	.	0.044097	0.85682	D	0.000000	T	0.40473	0.1118	L	0.45422	1.42	0.54753	D	0.99998	P	0.39216	0.664	B	0.41135	0.348	T	0.26643	-1.0097	10	0.39692	T	0.17	-24.0899	15.1115	0.72362	0.0:0.0:0.0:1.0	.	361	Q96HE7	ERO1A_HUMAN	D	361;20	ENSP00000379042:N361D;ENSP00000450655:N20D	ENSP00000379042:N361D	N	-	1	0	ERO1L	52188751	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.766000	0.68843	2.022000	0.59522	0.482000	0.46254	AAT	ERO1L	-	pfam_ER_oxidoreductin-1,superfamily_ER_oxidoreductin-1,pirsf_ER_oxidoreductin-1	ENSG00000197930		0.279	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERO1L	HGNC	protein_coding	OTTHUMT00000276892.1	72	0.00	0	T	NM_014584		53119001	53119001	-1	no_errors	ENST00000395686	ensembl	human	known	69_37n	missense	102	11.30	13	SNP	1.000	C
EYA4	2070	genome.wustl.edu	37	6	133777745	133777745	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr6:133777745C>T	ENST00000367895.5	+	6	793	c.329C>T	c.(328-330)gCc>gTc	p.A110V	EYA4_ENST00000452339.2_Intron|EYA4_ENST00000525849.1_Missense_Mutation_p.A87V|EYA4_ENST00000355167.3_Missense_Mutation_p.A110V|EYA4_ENST00000355286.6_Missense_Mutation_p.A87V|RP1-283K11.2_ENST00000457081.1_RNA|EYA4_ENST00000531901.1_Missense_Mutation_p.A110V|EYA4_ENST00000431403.2_Missense_Mutation_p.A110V|EYA4_ENST00000430974.2_Intron	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	110					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.A110V(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		GAAACCACAGCCACGACTGGA	0.458																																					Melanoma(57;398 1237 3528 4702 7415)	dbGAP											2	Substitution - Missense(2)	breast(2)											214.0	210.0	211.0					6																	133777745		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.329C>T	6.37:g.133777745C>T	ENSP00000356870:p.Ala110Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA	p.A110V	ENST00000367895.5	37	c.329	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	C	16.99	3.275253	0.59649	.	.	ENSG00000112319	ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.38	4.49	0.54785	.	0.212024	0.48767	D	0.000175	T	0.27454	0.0674	N	0.08118	0	0.09310	N	0.999997	B;B;B;B	0.15930	0.015;0.01;0.015;0.015	B;B;B;B	0.25405	0.06;0.033;0.06;0.06	T	0.32134	-0.9918	10	0.54805	T	0.06	-15.3994	15.8553	0.78975	0.0:0.8638:0.1362:0.0	.	110;87;110;110	F2Z2Y1;O95677-2;O95677-4;O95677	.;.;.;EYA4_HUMAN	V	110;110;87;110;87;110	ENSP00000356870:A110V;ENSP00000347294:A110V;ENSP00000347434:A87V;ENSP00000432770:A110V;ENSP00000433219:A87V;ENSP00000404558:A110V	ENSP00000347294:A110V	A	+	2	0	EYA4	133819438	0.998000	0.40836	0.997000	0.53966	0.991000	0.79684	2.840000	0.48215	1.220000	0.43490	0.655000	0.94253	GCC	EYA4	-	NULL	ENSG00000112319		0.458	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	HGNC	protein_coding	OTTHUMT00000042282.2	411	0.00	0	C	NM_004100		133777745	133777745	+1	no_errors	ENST00000355167	ensembl	human	known	69_37n	missense	276	15.08	49	SNP	1.000	T
EYA4	2070	genome.wustl.edu	37	6	133777745	133777745	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr6:133777745C>T	ENST00000367895.5	+	6	793	c.329C>T	c.(328-330)gCc>gTc	p.A110V	EYA4_ENST00000452339.2_Intron|EYA4_ENST00000525849.1_Missense_Mutation_p.A87V|EYA4_ENST00000355167.3_Missense_Mutation_p.A110V|EYA4_ENST00000355286.6_Missense_Mutation_p.A87V|RP1-283K11.2_ENST00000457081.1_RNA|EYA4_ENST00000531901.1_Missense_Mutation_p.A110V|EYA4_ENST00000431403.2_Missense_Mutation_p.A110V|EYA4_ENST00000430974.2_Intron	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	110					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.A110V(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		GAAACCACAGCCACGACTGGA	0.458																																					Melanoma(57;398 1237 3528 4702 7415)	dbGAP											2	Substitution - Missense(2)	breast(2)											214.0	210.0	211.0					6																	133777745		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.329C>T	6.37:g.133777745C>T	ENSP00000356870:p.Ala110Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA	p.A110V	ENST00000367895.5	37	c.329	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	C	16.99	3.275253	0.59649	.	.	ENSG00000112319	ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.38	4.49	0.54785	.	0.212024	0.48767	D	0.000175	T	0.27454	0.0674	N	0.08118	0	0.09310	N	0.999997	B;B;B;B	0.15930	0.015;0.01;0.015;0.015	B;B;B;B	0.25405	0.06;0.033;0.06;0.06	T	0.32134	-0.9918	10	0.54805	T	0.06	-15.3994	15.8553	0.78975	0.0:0.8638:0.1362:0.0	.	110;87;110;110	F2Z2Y1;O95677-2;O95677-4;O95677	.;.;.;EYA4_HUMAN	V	110;110;87;110;87;110	ENSP00000356870:A110V;ENSP00000347294:A110V;ENSP00000347434:A87V;ENSP00000432770:A110V;ENSP00000433219:A87V;ENSP00000404558:A110V	ENSP00000347294:A110V	A	+	2	0	EYA4	133819438	0.998000	0.40836	0.997000	0.53966	0.991000	0.79684	2.840000	0.48215	1.220000	0.43490	0.655000	0.94253	GCC	EYA4	-	NULL	ENSG00000112319		0.458	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	HGNC	protein_coding	OTTHUMT00000042282.2	223	0.00	0	C	NM_004100		133777745	133777745	+1	no_errors	ENST00000355167	ensembl	human	known	69_37n	missense	276	15.08	49	SNP	1.000	T
FBXO40	51725	genome.wustl.edu	37	3	121340395	121340395	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr3:121340395T>G	ENST00000338040.4	+	3	533	c.119T>G	c.(118-120)cTg>cGg	p.L40R		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	40					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L40R(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		AGCTGCCACCTGCTCTGTGGT	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	85.0	89.0					3																	121340395		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.119T>G	3.37:g.121340395T>G	ENSP00000337510:p.Leu40Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like,superfamily_TRAF-like,pfscan_F-box_dom_cyclin-like,pfscan_Znf_TRAF	p.L40R	ENST00000338040.4	37	c.119	CCDS33835.1	3	.	.	.	.	.	.	.	.	.	.	T	0.895	-0.724335	0.03158	.	.	ENSG00000163833	ENST00000338040	T	0.26373	1.74	5.58	4.37	0.52481	.	0.399954	0.25238	N	0.032110	T	0.20007	0.0481	L	0.42245	1.32	0.39736	D	0.971686	B	0.20671	0.047	B	0.22386	0.039	T	0.08513	-1.0718	10	0.38643	T	0.18	-9.5477	6.4787	0.22051	0.0:0.0889:0.1709:0.7402	.	40	Q9UH90	FBX40_HUMAN	R	40	ENSP00000337510:L40R	ENSP00000337510:L40R	L	+	2	0	FBXO40	122823085	0.012000	0.17670	1.000000	0.80357	0.743000	0.42351	1.245000	0.32790	2.136000	0.66102	0.533000	0.62120	CTG	FBXO40	-	superfamily_TRAF-like	ENSG00000163833		0.587	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO40	HGNC	protein_coding	OTTHUMT00000355158.1	179	0.00	0	T	NM_016298		121340395	121340395	+1	no_errors	ENST00000338040	ensembl	human	known	69_37n	missense	80	15.62	15	SNP	0.780	G
FBXO40	51725	genome.wustl.edu	37	3	121340395	121340395	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr3:121340395T>G	ENST00000338040.4	+	3	533	c.119T>G	c.(118-120)cTg>cGg	p.L40R		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	40					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L40R(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		AGCTGCCACCTGCTCTGTGGT	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	85.0	89.0					3																	121340395		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.119T>G	3.37:g.121340395T>G	ENSP00000337510:p.Leu40Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like,superfamily_TRAF-like,pfscan_F-box_dom_cyclin-like,pfscan_Znf_TRAF	p.L40R	ENST00000338040.4	37	c.119	CCDS33835.1	3	.	.	.	.	.	.	.	.	.	.	T	0.895	-0.724335	0.03158	.	.	ENSG00000163833	ENST00000338040	T	0.26373	1.74	5.58	4.37	0.52481	.	0.399954	0.25238	N	0.032110	T	0.20007	0.0481	L	0.42245	1.32	0.39736	D	0.971686	B	0.20671	0.047	B	0.22386	0.039	T	0.08513	-1.0718	10	0.38643	T	0.18	-9.5477	6.4787	0.22051	0.0:0.0889:0.1709:0.7402	.	40	Q9UH90	FBX40_HUMAN	R	40	ENSP00000337510:L40R	ENSP00000337510:L40R	L	+	2	0	FBXO40	122823085	0.012000	0.17670	1.000000	0.80357	0.743000	0.42351	1.245000	0.32790	2.136000	0.66102	0.533000	0.62120	CTG	FBXO40	-	superfamily_TRAF-like	ENSG00000163833		0.587	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO40	HGNC	protein_coding	OTTHUMT00000355158.1	183	0.00	0	T	NM_016298		121340395	121340395	+1	no_errors	ENST00000338040	ensembl	human	known	69_37n	missense	80	15.62	15	SNP	0.780	G
FBXO5	26271	genome.wustl.edu	37	6	153293436	153293436	+	Missense_Mutation	SNP	T	T	G	rs200130410		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr6:153293436T>G	ENST00000229758.3	-	4	1121	c.1063A>C	c.(1063-1065)Act>Cct	p.T355P	FBXO5_ENST00000367241.3_Missense_Mutation_p.T309P|FBXO5_ENST00000477822.1_5'UTR	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	355					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.T355P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		CGACTATAAGTAGAACCTTTC	0.348																																					NSCLC(121;372 1757 17721 17977 29669)	dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	107.0	108.0					6																	153293436		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.1063A>C	6.37:g.153293436T>G	ENSP00000229758:p.Thr355Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like	p.T355P	ENST00000229758.3	37	c.1063	CCDS5242.1	6	.	.	.	.	.	.	.	.	.	.	T	11.12	1.545157	0.27652	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.33438	1.41;1.42	5.36	-1.89	0.07689	.	1.225830	0.05604	N	0.576825	T	0.09862	0.0242	M	0.61703	1.905	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.32295	-0.9912	10	0.37606	T	0.19	-2.0952	1.12	0.01722	0.2347:0.3179:0.12:0.3273	.	355	Q9UKT4	FBX5_HUMAN	P	355;309	ENSP00000229758:T355P;ENSP00000356210:T309P	ENSP00000229758:T355P	T	-	1	0	FBXO5	153335129	0.372000	0.25064	0.818000	0.32626	0.980000	0.70556	-0.693000	0.05121	-0.269000	0.09298	0.533000	0.62120	ACT	FBXO5	-	NULL	ENSG00000112029		0.348	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	HGNC	protein_coding	OTTHUMT00000042757.1	68	0.00	0	T			153293436	153293436	-1	no_errors	ENST00000229758	ensembl	human	known	69_37n	missense	119	11.03	15	SNP	0.058	G
FBXO5	26271	genome.wustl.edu	37	6	153293436	153293436	+	Missense_Mutation	SNP	T	T	G	rs200130410		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr6:153293436T>G	ENST00000229758.3	-	4	1121	c.1063A>C	c.(1063-1065)Act>Cct	p.T355P	FBXO5_ENST00000367241.3_Missense_Mutation_p.T309P|FBXO5_ENST00000477822.1_5'UTR	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	355					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.T355P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		CGACTATAAGTAGAACCTTTC	0.348																																					NSCLC(121;372 1757 17721 17977 29669)	dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	107.0	108.0					6																	153293436		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.1063A>C	6.37:g.153293436T>G	ENSP00000229758:p.Thr355Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like	p.T355P	ENST00000229758.3	37	c.1063	CCDS5242.1	6	.	.	.	.	.	.	.	.	.	.	T	11.12	1.545157	0.27652	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.33438	1.41;1.42	5.36	-1.89	0.07689	.	1.225830	0.05604	N	0.576825	T	0.09862	0.0242	M	0.61703	1.905	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.32295	-0.9912	10	0.37606	T	0.19	-2.0952	1.12	0.01722	0.2347:0.3179:0.12:0.3273	.	355	Q9UKT4	FBX5_HUMAN	P	355;309	ENSP00000229758:T355P;ENSP00000356210:T309P	ENSP00000229758:T355P	T	-	1	0	FBXO5	153335129	0.372000	0.25064	0.818000	0.32626	0.980000	0.70556	-0.693000	0.05121	-0.269000	0.09298	0.533000	0.62120	ACT	FBXO5	-	NULL	ENSG00000112029		0.348	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	HGNC	protein_coding	OTTHUMT00000042757.1	83	0.00	0	T			153293436	153293436	-1	no_errors	ENST00000229758	ensembl	human	known	69_37n	missense	119	11.03	15	SNP	0.058	G
FCGBP	8857	genome.wustl.edu	37	19	40377034	40377034	+	Silent	SNP	G	G	A	rs201304305	byFrequency	TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr19:40377034G>A	ENST00000221347.6	-	24	11395	c.11388C>T	c.(11386-11388)aaC>aaT	p.N3796N	FCGBP_ENST00000595713.1_5'UTR	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3796	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGGGGTCGCCGTTGTAGTTCC	0.597																																						dbGAP											0													4.0	4.0	4.0					19																	40377034		1716	3539	5255	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11388C>T	19.37:g.40377034G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.N3796	ENST00000221347.6	37	c.11388	CCDS12546.1	19																																																																																			FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	19	0.00	0	G	NM_003890		40377034	40377034	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	12	40.91	9	SNP	0.470	A
FERD3L	222894	genome.wustl.edu	37	7	19184943	19184943	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr7:19184943C>G	ENST00000275461.3	-	1	101	c.43G>C	c.(43-45)Gac>Cac	p.D15H	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	15					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D15H(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						GCGACGAAGTCCAGCACCGTA	0.677																																						dbGAP											1	Substitution - Missense(1)	breast(1)											34.0	33.0	33.0					7																	19184943		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.43G>C	7.37:g.19184943C>G	ENSP00000275461:p.Asp15His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495K0	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D15H	ENST00000275461.3	37	c.43	CCDS5368.1	7	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064132	0.55432	.	.	ENSG00000146618	ENST00000275461	D	0.97066	-4.23	5.66	4.77	0.60923	.	0.305900	0.28031	N	0.016873	D	0.93294	0.7863	N	0.24115	0.695	0.28825	N	0.897442	D	0.53151	0.958	B	0.44278	0.445	D	0.89692	0.3898	10	0.62326	D	0.03	-0.2533	9.2399	0.37489	0.0:0.8354:0.0:0.1646	.	15	Q96RJ6	FER3L_HUMAN	H	15	ENSP00000275461:D15H	ENSP00000275461:D15H	D	-	1	0	FERD3L	19151468	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.733000	0.55029	1.376000	0.46267	0.650000	0.86243	GAC	FERD3L	-	NULL	ENSG00000146618		0.677	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1	60	0.00	0	C			19184943	19184943	-1	no_errors	ENST00000275461	ensembl	human	known	69_37n	missense	32	33.33	16	SNP	1.000	G
FERD3L	222894	genome.wustl.edu	37	7	19184943	19184943	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr7:19184943C>G	ENST00000275461.3	-	1	101	c.43G>C	c.(43-45)Gac>Cac	p.D15H	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	15					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D15H(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						GCGACGAAGTCCAGCACCGTA	0.677																																						dbGAP											1	Substitution - Missense(1)	breast(1)											34.0	33.0	33.0					7																	19184943		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.43G>C	7.37:g.19184943C>G	ENSP00000275461:p.Asp15His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495K0	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D15H	ENST00000275461.3	37	c.43	CCDS5368.1	7	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064132	0.55432	.	.	ENSG00000146618	ENST00000275461	D	0.97066	-4.23	5.66	4.77	0.60923	.	0.305900	0.28031	N	0.016873	D	0.93294	0.7863	N	0.24115	0.695	0.28825	N	0.897442	D	0.53151	0.958	B	0.44278	0.445	D	0.89692	0.3898	10	0.62326	D	0.03	-0.2533	9.2399	0.37489	0.0:0.8354:0.0:0.1646	.	15	Q96RJ6	FER3L_HUMAN	H	15	ENSP00000275461:D15H	ENSP00000275461:D15H	D	-	1	0	FERD3L	19151468	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.733000	0.55029	1.376000	0.46267	0.650000	0.86243	GAC	FERD3L	-	NULL	ENSG00000146618		0.677	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1	17	0.00	0	C			19184943	19184943	-1	no_errors	ENST00000275461	ensembl	human	known	69_37n	missense	32	33.33	16	SNP	1.000	G
FRG1B	284802	genome.wustl.edu	37	20	29614296	29614297	+	5'UTR	INS	-	-	AGA	rs376619640		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr20:29614296_29614297insAGA	ENST00000278882.3	+	0	289_290				FRG1B_ENST00000358464.4_5'UTR|FRG1B_ENST00000439954.2_5'UTR			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						aagagaaaaagagaagatgaag	0.292																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-91->AGA	20.37:g.29614300_29614302dupAGA		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	RNA	INS	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.292	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	65	0.00	0	-	NR_003579		29614296	29614297	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	109	14.17	18	INS	0.998:0.997	AGA
FRMD4A	55691	genome.wustl.edu	37	10	13804668	13804668	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr10:13804668C>A	ENST00000357447.2	-	7	765	c.397G>T	c.(397-399)Gtt>Ttt	p.V133F	FRMD4A_ENST00000342409.2_Missense_Mutation_p.V149F|FRMD4A_ENST00000378503.1_Missense_Mutation_p.V133F|FRMD4A_ENST00000358621.4_Missense_Mutation_p.V118F	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	133	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)		p.V133F(1)		breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TCGCTGTCAACGTCAATAAGC	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	77.0	79.0					10																	13804668		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.397G>T	10.37:g.13804668C>A	ENSP00000350032:p.Val133Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.V133F	ENST00000357447.2	37	c.397	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749978	0.69533	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27	5.11	5.11	0.69529	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.86594	0.5970	M	0.76838	2.35	0.80722	D	1	P;P;P	0.52170	0.838;0.906;0.951	P;P;P	0.61940	0.665;0.665;0.896	D	0.88163	0.2859	10	0.87932	D	0	-13.8791	14.4029	0.67063	0.0:1.0:0.0:0.0	.	149;166;133	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	F	118;133;133;166;149	ENSP00000351438:V118F;ENSP00000350032:V133F;ENSP00000367764:V133F;ENSP00000264546:V166F;ENSP00000344237:V149F	ENSP00000264546:V166F	V	-	1	0	FRMD4A	13844674	0.994000	0.37717	0.933000	0.37362	0.992000	0.81027	4.947000	0.63583	2.504000	0.84457	0.655000	0.94253	GTT	FRMD4A	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000151474		0.373	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	77	0.00	0	C	NM_018027		13804668	13804668	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	missense	55	15.38	10	SNP	0.985	A
FRMD4A	55691	genome.wustl.edu	37	10	13804668	13804668	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr10:13804668C>A	ENST00000357447.2	-	7	765	c.397G>T	c.(397-399)Gtt>Ttt	p.V133F	FRMD4A_ENST00000342409.2_Missense_Mutation_p.V149F|FRMD4A_ENST00000378503.1_Missense_Mutation_p.V133F|FRMD4A_ENST00000358621.4_Missense_Mutation_p.V118F	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	133	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)		p.V133F(1)		breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TCGCTGTCAACGTCAATAAGC	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	77.0	79.0					10																	13804668		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.397G>T	10.37:g.13804668C>A	ENSP00000350032:p.Val133Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.V133F	ENST00000357447.2	37	c.397	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749978	0.69533	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27	5.11	5.11	0.69529	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.86594	0.5970	M	0.76838	2.35	0.80722	D	1	P;P;P	0.52170	0.838;0.906;0.951	P;P;P	0.61940	0.665;0.665;0.896	D	0.88163	0.2859	10	0.87932	D	0	-13.8791	14.4029	0.67063	0.0:1.0:0.0:0.0	.	149;166;133	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	F	118;133;133;166;149	ENSP00000351438:V118F;ENSP00000350032:V133F;ENSP00000367764:V133F;ENSP00000264546:V166F;ENSP00000344237:V149F	ENSP00000264546:V166F	V	-	1	0	FRMD4A	13844674	0.994000	0.37717	0.933000	0.37362	0.992000	0.81027	4.947000	0.63583	2.504000	0.84457	0.655000	0.94253	GTT	FRMD4A	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000151474		0.373	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	178	0.56	1	C	NM_018027		13804668	13804668	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	missense	55	15.38	10	SNP	0.985	A
FSCB	84075	genome.wustl.edu	37	14	44974189	44974189	+	Missense_Mutation	SNP	C	C	A	rs11621923	byFrequency	TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr14:44974189C>A	ENST00000340446.4	-	1	2293	c.2002G>T	c.(2002-2004)Gct>Tct	p.A668S	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	668	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TGAACTTCAGCGGGGGCCTCC	0.617																																						dbGAP											0													10.0	12.0	11.0					14																	44974189		2171	4287	6458	-	-	-	SO:0001583	missense	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2002G>T	14.37:g.44974189C>A	ENSP00000344579:p.Ala668Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.A668S	ENST00000340446.4	37	c.2002	CCDS9679.1	14	839	0.3841575091575092	172	0.34959349593495936	128	0.35359116022099446	225	0.39335664335664333	314	0.41424802110817943	C	8.835	0.940852	0.18281	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.12039	2.72	4.24	-8.48	0.00935	.	.	.	.	.	T	0.00012	0.0000	L	0.52573	1.65	0.80722	P	0.0	B	0.25105	0.118	B	0.24155	0.051	T	0.44982	-0.9292	8	0.14656	T	0.56	-0.0478	4.397	0.11367	0.4313:0.2556:0.2435:0.0696	rs11621923	668	Q5H9T9	FSCB_HUMAN	S	668;561	ENSP00000344579:A668S	ENSP00000344579:A668S	A	-	1	0	FSCB	44043939	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-1.504000	0.02275	-1.989000	0.00979	-0.719000	0.03609	GCT	FSCB	-	NULL	ENSG00000189139		0.617	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	14	0.00	0	C	NM_032135		44974189	44974189	-1	no_errors	ENST00000340446	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.000	A
GLUD2	2747	genome.wustl.edu	37	X	120182736	120182736	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chrX:120182736A>G	ENST00000328078.1	+	1	1275	c.1198A>G	c.(1198-1200)Atc>Gtc	p.I400V		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	400					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.I400V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CAAAGCCAAGATCATTGCTGA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											203.0	185.0	192.0					X																	120182736		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1198A>G	X.37:g.120182736A>G	ENSP00000327589:p.Ile400Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.I400V	ENST00000328078.1	37	c.1198	CCDS14603.1	X	.	.	.	.	.	.	.	.	.	.	A	8.511	0.866420	0.17250	.	.	ENSG00000182890	ENST00000328078	D	0.95035	-3.59	1.7	1.7	0.24286	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87525	0.6199	N	0.21508	0.67	0.80722	D	1	B	0.17667	0.023	B	0.21546	0.035	T	0.81031	-0.1117	10	0.41790	T	0.15	.	7.0383	0.25004	1.0:0.0:0.0:0.0	.	400	P49448	DHE4_HUMAN	V	400	ENSP00000327589:I400V	ENSP00000327589:I400V	I	+	1	0	GLUD2	120010417	1.000000	0.71417	0.859000	0.33776	0.617000	0.37484	2.838000	0.48199	0.969000	0.38237	0.384000	0.25694	ATC	GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C	ENSG00000182890		0.473	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	334	0.00	0	A	NM_012084		120182736	120182736	+1	no_errors	ENST00000328078	ensembl	human	known	69_37n	missense	110	32.10	52	SNP	1.000	G
GLUD2	2747	genome.wustl.edu	37	X	120182736	120182736	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chrX:120182736A>G	ENST00000328078.1	+	1	1275	c.1198A>G	c.(1198-1200)Atc>Gtc	p.I400V		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	400					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.I400V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CAAAGCCAAGATCATTGCTGA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											203.0	185.0	192.0					X																	120182736		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1198A>G	X.37:g.120182736A>G	ENSP00000327589:p.Ile400Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.I400V	ENST00000328078.1	37	c.1198	CCDS14603.1	X	.	.	.	.	.	.	.	.	.	.	A	8.511	0.866420	0.17250	.	.	ENSG00000182890	ENST00000328078	D	0.95035	-3.59	1.7	1.7	0.24286	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87525	0.6199	N	0.21508	0.67	0.80722	D	1	B	0.17667	0.023	B	0.21546	0.035	T	0.81031	-0.1117	10	0.41790	T	0.15	.	7.0383	0.25004	1.0:0.0:0.0:0.0	.	400	P49448	DHE4_HUMAN	V	400	ENSP00000327589:I400V	ENSP00000327589:I400V	I	+	1	0	GLUD2	120010417	1.000000	0.71417	0.859000	0.33776	0.617000	0.37484	2.838000	0.48199	0.969000	0.38237	0.384000	0.25694	ATC	GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C	ENSG00000182890		0.473	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	261	0.00	0	A	NM_012084		120182736	120182736	+1	no_errors	ENST00000328078	ensembl	human	known	69_37n	missense	110	32.10	52	SNP	1.000	G
GOLGA8DP	100132979	genome.wustl.edu	37	15	22709040	22709040	+	RNA	SNP	T	T	C	rs374515784	byFrequency	TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr15:22709040T>C	ENST00000314246.8	-	0	1356				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											CCTCCTGCTCTGGAAGCCTCT	0.617													T|||	217	0.0433307	0.0045	0.098	5008	,	,		8951	0.0397		0.0368	False		,,,				2504	0.0675					dbGAP											0																																										-	-	-			0					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709040T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000314246.8	37	NULL		15																																																																																			GOLGA8DP	-	-	ENSG00000185182		0.617	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	HGNC	pseudogene	OTTHUMT00000415613.1	12	0.00	0	T	NR_027407		22709040	22709040	-1	no_errors	ENST00000314246	ensembl	human	known	69_37n	rna	21	38.24	13	SNP	0.999	C
GPAM	57678	genome.wustl.edu	37	10	113915699	113915699	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr10:113915699G>T	ENST00000348367.4	-	20	2431	c.2234C>A	c.(2233-2235)cCt>cAt	p.P745H	GPAM_ENST00000369425.1_3'UTR|GPAM_ENST00000423155.1_Missense_Mutation_p.P745H			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	745					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.P745H(1)		breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		TTCTGGAACAGGACCACTGAA	0.428																																					Ovarian(161;1017 2606 18293 52943)	dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	93.0	97.0					10																	113915699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2234C>A	10.37:g.113915699G>T	ENSP00000265276:p.Pro745His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW51|Q86TA3	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.P745H	ENST00000348367.4	37	c.2234	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091953	0.76756	.	.	ENSG00000119927	ENST00000348367;ENST00000423155	T;T	0.70399	-0.48;-0.48	5.08	5.08	0.68730	.	0.058303	0.64402	D	0.000001	T	0.75221	0.3820	L	0.59436	1.845	0.80722	D	1	D	0.60160	0.987	P	0.50440	0.641	T	0.78971	-0.1993	10	0.72032	D	0.01	-10.9278	17.0217	0.86435	0.0:0.0:1.0:0.0	.	745	Q9HCL2	GPAT1_HUMAN	H	745	ENSP00000265276:P745H;ENSP00000409242:P745H	ENSP00000265276:P745H	P	-	2	0	GPAM	113905689	1.000000	0.71417	0.048000	0.18961	0.755000	0.42902	9.005000	0.93587	2.507000	0.84556	0.655000	0.94253	CCT	GPAM	-	NULL	ENSG00000119927		0.428	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	214	0.00	0	G	NM_020918		113915699	113915699	-1	no_errors	ENST00000348367	ensembl	human	known	69_37n	missense	137	22.60	40	SNP	0.989	T
GPAM	57678	genome.wustl.edu	37	10	113915699	113915699	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr10:113915699G>T	ENST00000348367.4	-	20	2431	c.2234C>A	c.(2233-2235)cCt>cAt	p.P745H	GPAM_ENST00000369425.1_3'UTR|GPAM_ENST00000423155.1_Missense_Mutation_p.P745H			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	745					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.P745H(1)		breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		TTCTGGAACAGGACCACTGAA	0.428																																					Ovarian(161;1017 2606 18293 52943)	dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	93.0	97.0					10																	113915699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2234C>A	10.37:g.113915699G>T	ENSP00000265276:p.Pro745His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW51|Q86TA3	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.P745H	ENST00000348367.4	37	c.2234	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091953	0.76756	.	.	ENSG00000119927	ENST00000348367;ENST00000423155	T;T	0.70399	-0.48;-0.48	5.08	5.08	0.68730	.	0.058303	0.64402	D	0.000001	T	0.75221	0.3820	L	0.59436	1.845	0.80722	D	1	D	0.60160	0.987	P	0.50440	0.641	T	0.78971	-0.1993	10	0.72032	D	0.01	-10.9278	17.0217	0.86435	0.0:0.0:1.0:0.0	.	745	Q9HCL2	GPAT1_HUMAN	H	745	ENSP00000265276:P745H;ENSP00000409242:P745H	ENSP00000265276:P745H	P	-	2	0	GPAM	113905689	1.000000	0.71417	0.048000	0.18961	0.755000	0.42902	9.005000	0.93587	2.507000	0.84556	0.655000	0.94253	CCT	GPAM	-	NULL	ENSG00000119927		0.428	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	134	0.00	0	G	NM_020918		113915699	113915699	-1	no_errors	ENST00000348367	ensembl	human	known	69_37n	missense	137	22.60	40	SNP	0.989	T
GRIK3	2899	genome.wustl.edu	37	1	37307422	37307422	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:37307422T>A	ENST00000373091.3	-	10	1461	c.1445A>T	c.(1444-1446)gAg>gTg	p.E482V	GRIK3_ENST00000373093.4_Missense_Mutation_p.E482V	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	482					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.E482V(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CAGCCGGATCTCATAGGAGAA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											183.0	170.0	174.0					1																	37307422		2203	4300	6503	-	-	-	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1445A>T	1.37:g.37307422T>A	ENSP00000362183:p.Glu482Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E482V	ENST00000373091.3	37	c.1445	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.883853	0.51908	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.15256	2.44;2.44	4.86	4.86	0.63082	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.055161	0.64402	D	0.000001	T	0.28366	0.0701	M	0.64997	1.995	0.80722	D	1	P;B	0.34934	0.476;0.097	B;B	0.43950	0.437;0.16	T	0.04796	-1.0926	10	0.56958	D	0.05	.	14.7586	0.69588	0.0:0.0:0.0:1.0	.	482;482	A9Z1Z8;Q13003	.;GRIK3_HUMAN	V	482	ENSP00000362183:E482V;ENSP00000362185:E482V	ENSP00000362183:E482V	E	-	2	0	GRIK3	37080009	1.000000	0.71417	0.994000	0.49952	0.664000	0.39144	7.997000	0.88414	1.943000	0.56356	0.482000	0.46254	GAG	GRIK3	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	ENSG00000163873		0.567	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	220	0.00	0	T	NM_000831		37307422	37307422	-1	no_errors	ENST00000373091	ensembl	human	known	69_37n	missense	105	10.17	12	SNP	1.000	A
GRIK3	2899	genome.wustl.edu	37	1	37307422	37307422	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:37307422T>A	ENST00000373091.3	-	10	1461	c.1445A>T	c.(1444-1446)gAg>gTg	p.E482V	GRIK3_ENST00000373093.4_Missense_Mutation_p.E482V	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	482					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.E482V(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CAGCCGGATCTCATAGGAGAA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											183.0	170.0	174.0					1																	37307422		2203	4300	6503	-	-	-	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1445A>T	1.37:g.37307422T>A	ENSP00000362183:p.Glu482Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E482V	ENST00000373091.3	37	c.1445	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.883853	0.51908	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.15256	2.44;2.44	4.86	4.86	0.63082	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.055161	0.64402	D	0.000001	T	0.28366	0.0701	M	0.64997	1.995	0.80722	D	1	P;B	0.34934	0.476;0.097	B;B	0.43950	0.437;0.16	T	0.04796	-1.0926	10	0.56958	D	0.05	.	14.7586	0.69588	0.0:0.0:0.0:1.0	.	482;482	A9Z1Z8;Q13003	.;GRIK3_HUMAN	V	482	ENSP00000362183:E482V;ENSP00000362185:E482V	ENSP00000362183:E482V	E	-	2	0	GRIK3	37080009	1.000000	0.71417	0.994000	0.49952	0.664000	0.39144	7.997000	0.88414	1.943000	0.56356	0.482000	0.46254	GAG	GRIK3	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	ENSG00000163873		0.567	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	104	0.00	0	T	NM_000831		37307422	37307422	-1	no_errors	ENST00000373091	ensembl	human	known	69_37n	missense	105	10.17	12	SNP	1.000	A
HHAT	55733	genome.wustl.edu	37	1	210573999	210573999	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:210573999A>C	ENST00000367010.1	+	5	688	c.461A>C	c.(460-462)gAa>gCa	p.E154A	HHAT_ENST00000308852.6_Missense_Mutation_p.E109A|HHAT_ENST00000545154.1_Missense_Mutation_p.E155A|HHAT_ENST00000413764.2_Missense_Mutation_p.E154A|HHAT_ENST00000545781.1_Missense_Mutation_p.E91A|HHAT_ENST00000391905.3_Missense_Mutation_p.E154A|HHAT_ENST00000537898.1_Intron|HHAT_ENST00000261458.3_Missense_Mutation_p.E154A|HHAT_ENST00000541565.1_Intron	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	154					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)	p.E154A(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		GGTGTGGAAGAAGTTAAGGTA	0.522											OREG0012978	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	93.0	98.0					1																	210573999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.461A>C	1.37:g.210573999A>C	ENSP00000355977:p.Glu154Ala	Somatic	2191	WXS	Illumina GAIIx	Phase_IV	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	pfam_MBOAT_fam	p.E154A	ENST00000367010.1	37	c.461	CCDS1495.1	1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163130	0.57476	.	.	ENSG00000054392	ENST00000413764;ENST00000545154;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010	T;T;T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61	4.77	3.65	0.41850	.	0.278149	0.39687	N	0.001295	T	0.67785	0.2930	M	0.62723	1.935	0.40282	D	0.978401	P;P;P	0.47545	0.768;0.897;0.768	P;P;P	0.47299	0.528;0.543;0.504	T	0.64166	-0.6471	10	0.12430	T	0.62	-3.152	9.9937	0.41887	0.9189:0.0:0.0811:0.0	.	109;155;154	B7Z2U8;F5H444;Q5VTY9	.;.;HHAT_HUMAN	A	154;155;154;91;154;109;154	ENSP00000416845:E154A;ENSP00000438468:E155A;ENSP00000375773:E154A;ENSP00000439229:E91A;ENSP00000261458:E154A;ENSP00000308628:E109A;ENSP00000355977:E154A	ENSP00000261458:E154A	E	+	2	0	HHAT	208640622	1.000000	0.71417	0.994000	0.49952	0.935000	0.57460	5.849000	0.69465	0.789000	0.33779	0.460000	0.39030	GAA	HHAT	-	pfam_MBOAT_fam	ENSG00000054392		0.522	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HHAT	HGNC	protein_coding	OTTHUMT00000088662.1	127	0.00	0	A	NM_018194		210573999	210573999	+1	no_errors	ENST00000391905	ensembl	human	known	69_37n	missense	72	22.58	21	SNP	0.994	C
HHAT	55733	genome.wustl.edu	37	1	210573999	210573999	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:210573999A>C	ENST00000367010.1	+	5	688	c.461A>C	c.(460-462)gAa>gCa	p.E154A	HHAT_ENST00000308852.6_Missense_Mutation_p.E109A|HHAT_ENST00000545154.1_Missense_Mutation_p.E155A|HHAT_ENST00000413764.2_Missense_Mutation_p.E154A|HHAT_ENST00000545781.1_Missense_Mutation_p.E91A|HHAT_ENST00000391905.3_Missense_Mutation_p.E154A|HHAT_ENST00000537898.1_Intron|HHAT_ENST00000261458.3_Missense_Mutation_p.E154A|HHAT_ENST00000541565.1_Intron	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	154					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)	p.E154A(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		GGTGTGGAAGAAGTTAAGGTA	0.522											OREG0012978	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	93.0	98.0					1																	210573999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.461A>C	1.37:g.210573999A>C	ENSP00000355977:p.Glu154Ala	Somatic	2191	WXS	Illumina GAIIx	Phase_IV	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	pfam_MBOAT_fam	p.E154A	ENST00000367010.1	37	c.461	CCDS1495.1	1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163130	0.57476	.	.	ENSG00000054392	ENST00000413764;ENST00000545154;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010	T;T;T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61	4.77	3.65	0.41850	.	0.278149	0.39687	N	0.001295	T	0.67785	0.2930	M	0.62723	1.935	0.40282	D	0.978401	P;P;P	0.47545	0.768;0.897;0.768	P;P;P	0.47299	0.528;0.543;0.504	T	0.64166	-0.6471	10	0.12430	T	0.62	-3.152	9.9937	0.41887	0.9189:0.0:0.0811:0.0	.	109;155;154	B7Z2U8;F5H444;Q5VTY9	.;.;HHAT_HUMAN	A	154;155;154;91;154;109;154	ENSP00000416845:E154A;ENSP00000438468:E155A;ENSP00000375773:E154A;ENSP00000439229:E91A;ENSP00000261458:E154A;ENSP00000308628:E109A;ENSP00000355977:E154A	ENSP00000261458:E154A	E	+	2	0	HHAT	208640622	1.000000	0.71417	0.994000	0.49952	0.935000	0.57460	5.849000	0.69465	0.789000	0.33779	0.460000	0.39030	GAA	HHAT	-	pfam_MBOAT_fam	ENSG00000054392		0.522	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HHAT	HGNC	protein_coding	OTTHUMT00000088662.1	55	0.00	0	A	NM_018194		210573999	210573999	+1	no_errors	ENST00000391905	ensembl	human	known	69_37n	missense	72	22.58	21	SNP	0.994	C
ITGA11	22801	genome.wustl.edu	37	15	68643690	68643690	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr15:68643690A>G	ENST00000315757.7	-	8	886	c.800T>C	c.(799-801)aTt>aCt	p.I267T	ITGA11_ENST00000423218.2_Missense_Mutation_p.I267T|ITGA11_ENST00000562826.1_5'UTR	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	267	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)	p.I267T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TGTGATGACAATCATCACCTT	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											128.0	134.0	132.0					15																	68643690		2058	4213	6271	-	-	-	SO:0001583	missense	0			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.800T>C	15.37:g.68643690A>G	ENSP00000327290:p.Ile267Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.I267T	ENST00000315757.7	37	c.800	CCDS45291.1	15	.	.	.	.	.	.	.	.	.	.	A	26.8	4.769436	0.90020	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000537153	D;D	0.87491	-2.26;-2.26	5.4	5.4	0.78164	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.92864	0.7730	M	0.89534	3.04	0.58432	D	0.999998	B;P	0.50272	0.375;0.933	P;P	0.53912	0.524;0.737	D	0.94207	0.7455	10	0.87932	D	0	.	14.5912	0.68365	1.0:0.0:0.0:0.0	.	267;267	A8K8T0;Q9UKX5	.;ITA11_HUMAN	T	267	ENSP00000327290:I267T;ENSP00000403392:I267T	ENSP00000327290:I267T	I	-	2	0	ITGA11	66430744	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.051000	0.93849	2.048000	0.60808	0.459000	0.35465	ATT	ITGA11	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000137809		0.537	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		110	0.00	0	A	NM_012211		68643690	68643690	-1	no_errors	ENST00000315757	ensembl	human	known	69_37n	missense	55	17.65	12	SNP	1.000	G
ITGA11	22801	genome.wustl.edu	37	15	68643690	68643690	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr15:68643690A>G	ENST00000315757.7	-	8	886	c.800T>C	c.(799-801)aTt>aCt	p.I267T	ITGA11_ENST00000423218.2_Missense_Mutation_p.I267T|ITGA11_ENST00000562826.1_5'UTR	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	267	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)	p.I267T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TGTGATGACAATCATCACCTT	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											128.0	134.0	132.0					15																	68643690		2058	4213	6271	-	-	-	SO:0001583	missense	0			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.800T>C	15.37:g.68643690A>G	ENSP00000327290:p.Ile267Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.I267T	ENST00000315757.7	37	c.800	CCDS45291.1	15	.	.	.	.	.	.	.	.	.	.	A	26.8	4.769436	0.90020	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000537153	D;D	0.87491	-2.26;-2.26	5.4	5.4	0.78164	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.92864	0.7730	M	0.89534	3.04	0.58432	D	0.999998	B;P	0.50272	0.375;0.933	P;P	0.53912	0.524;0.737	D	0.94207	0.7455	10	0.87932	D	0	.	14.5912	0.68365	1.0:0.0:0.0:0.0	.	267;267	A8K8T0;Q9UKX5	.;ITA11_HUMAN	T	267	ENSP00000327290:I267T;ENSP00000403392:I267T	ENSP00000327290:I267T	I	-	2	0	ITGA11	66430744	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.051000	0.93849	2.048000	0.60808	0.459000	0.35465	ATT	ITGA11	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000137809		0.537	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		49	0.00	0	A	NM_012211		68643690	68643690	-1	no_errors	ENST00000315757	ensembl	human	known	69_37n	missense	55	17.65	12	SNP	1.000	G
KCNA1	3736	genome.wustl.edu	37	12	5021590	5021590	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr12:5021590C>T	ENST00000382545.3	+	2	2153	c.1046C>T	c.(1045-1047)gCg>gTg	p.A349V	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	349					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.A349E(2)|p.A349V(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TTTGCCGAGGCGGAAGAAGCT	0.532																																						dbGAP											3	Substitution - Missense(3)	lung(2)|breast(1)											150.0	148.0	149.0					12																	5021590		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1046C>T	12.37:g.5021590C>T	ENSP00000371985:p.Ala349Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.A349V	ENST00000382545.3	37	c.1046	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724709	0.48833	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.97529	-4.42	5.08	5.08	0.68730	Ion transport (1);	0.054087	0.64402	D	0.000001	D	0.93122	0.7810	N	0.16833	0.445	0.80722	D	1	B	0.15719	0.014	B	0.10450	0.005	D	0.88864	0.3328	10	0.30078	T	0.28	.	18.0083	0.89216	0.0:1.0:0.0:0.0	.	349	Q09470	KCNA1_HUMAN	V	349	ENSP00000371985:A349V	ENSP00000228858:A349V	A	+	2	0	KCNA1	4891851	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.597000	0.82733	2.793000	0.96121	0.655000	0.94253	GCG	KCNA1	-	pfam_Ion_trans_dom,pfam_Ion_trans_2	ENSG00000111262		0.532	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	291	0.00	0	C	NM_000217		5021590	5021590	+1	no_errors	ENST00000382545	ensembl	human	known	69_37n	missense	162	19.80	40	SNP	1.000	T
KCNA1	3736	genome.wustl.edu	37	12	5021590	5021590	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr12:5021590C>T	ENST00000382545.3	+	2	2153	c.1046C>T	c.(1045-1047)gCg>gTg	p.A349V	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	349					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.A349E(2)|p.A349V(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TTTGCCGAGGCGGAAGAAGCT	0.532																																						dbGAP											3	Substitution - Missense(3)	lung(2)|breast(1)											150.0	148.0	149.0					12																	5021590		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1046C>T	12.37:g.5021590C>T	ENSP00000371985:p.Ala349Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.A349V	ENST00000382545.3	37	c.1046	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724709	0.48833	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.97529	-4.42	5.08	5.08	0.68730	Ion transport (1);	0.054087	0.64402	D	0.000001	D	0.93122	0.7810	N	0.16833	0.445	0.80722	D	1	B	0.15719	0.014	B	0.10450	0.005	D	0.88864	0.3328	10	0.30078	T	0.28	.	18.0083	0.89216	0.0:1.0:0.0:0.0	.	349	Q09470	KCNA1_HUMAN	V	349	ENSP00000371985:A349V	ENSP00000228858:A349V	A	+	2	0	KCNA1	4891851	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.597000	0.82733	2.793000	0.96121	0.655000	0.94253	GCG	KCNA1	-	pfam_Ion_trans_dom,pfam_Ion_trans_2	ENSG00000111262		0.532	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	286	0.00	0	C	NM_000217		5021590	5021590	+1	no_errors	ENST00000382545	ensembl	human	known	69_37n	missense	162	19.80	40	SNP	1.000	T
KIAA1211	57482	genome.wustl.edu	37	4	57180592	57180592	+	Frame_Shift_Del	DEL	T	T	-	rs386674634		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr4:57180592delT	ENST00000504228.1	+	6	1029	c.924delT	c.(922-924)cgtfs	p.R308fs	KIAA1211_ENST00000541073.1_Frame_Shift_Del_p.R301fs|KIAA1211_ENST00000264229.6_Frame_Shift_Del_p.R308fs			Q6ZU35	K1211_HUMAN	KIAA1211	308	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GGAGGGAGCGTGAGGAGCGCG	0.736																																						dbGAP											0													5.0	7.0	6.0					4																	57180592		1903	3760	5663	-	-	-	SO:0001589	frameshift_variant	0			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.924delT	4.37:g.57180592delT	ENSP00000423366:p.Arg308fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTE2|Q9NTP8|Q9ULK9	Frame_Shift_Del	DEL	NULL	p.E309fs	ENST00000504228.1	37	c.924	CCDS43230.1	4																																																																																			KIAA1211	-	NULL	ENSG00000109265		0.736	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	8	0.00	0	T	NM_020722		57180592	57180592	+1	no_errors	ENST00000504228	ensembl	human	known	69_37n	frame_shift_del	0	100.00	3	DEL	0.000	-
LAMC2	3918	genome.wustl.edu	37	1	183177174	183177174	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:183177174C>T	ENST00000264144.4	+	2	303	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	LAMC2_ENST00000493293.1_Missense_Mutation_p.R80C	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	80	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.R80C(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						AGAAAGGGACCGCTGTTTGCC	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											228.0	222.0	224.0					1																	183177174		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.238C>T	1.37:g.183177174C>T	ENSP00000264144:p.Arg80Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin	p.R80C	ENST00000264144.4	37	c.238	CCDS1352.1	1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831552	0.32329	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	T;T	0.61980	0.06;0.06	4.81	3.87	0.44632	EGF-like, laminin (3);Growth factor, receptor (1);	0.315493	0.27567	N	0.018795	T	0.46756	0.1409	L	0.41236	1.265	0.38863	D	0.956537	B;B	0.21606	0.058;0.022	B;B	0.17433	0.018;0.008	T	0.45731	-0.9241	10	0.45353	T	0.12	.	3.3432	0.07126	0.3112:0.4531:0.1509:0.0847	.	80;80	Q13753;Q13753-2	LAMC2_HUMAN;.	C	80	ENSP00000432063:R80C;ENSP00000264144:R80C	ENSP00000264144:R80C	R	+	1	0	LAMC2	181443797	0.000000	0.05858	0.998000	0.56505	0.910000	0.53928	0.359000	0.20233	0.976000	0.38417	0.591000	0.81541	CGC	LAMC2	-	superfamily_Growth_fac_rcpt,smart_EGF_laminin	ENSG00000058085		0.512	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	HGNC	protein_coding	OTTHUMT00000086258.1	1269	0.00	0	C	NM_005562		183177174	183177174	+1	no_errors	ENST00000264144	ensembl	human	known	69_37n	missense	665	17.16	138	SNP	0.991	T
LAMC2	3918	genome.wustl.edu	37	1	183177174	183177174	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:183177174C>T	ENST00000264144.4	+	2	303	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	LAMC2_ENST00000493293.1_Missense_Mutation_p.R80C	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	80	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.R80C(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						AGAAAGGGACCGCTGTTTGCC	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											228.0	222.0	224.0					1																	183177174		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.238C>T	1.37:g.183177174C>T	ENSP00000264144:p.Arg80Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin	p.R80C	ENST00000264144.4	37	c.238	CCDS1352.1	1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831552	0.32329	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	T;T	0.61980	0.06;0.06	4.81	3.87	0.44632	EGF-like, laminin (3);Growth factor, receptor (1);	0.315493	0.27567	N	0.018795	T	0.46756	0.1409	L	0.41236	1.265	0.38863	D	0.956537	B;B	0.21606	0.058;0.022	B;B	0.17433	0.018;0.008	T	0.45731	-0.9241	10	0.45353	T	0.12	.	3.3432	0.07126	0.3112:0.4531:0.1509:0.0847	.	80;80	Q13753;Q13753-2	LAMC2_HUMAN;.	C	80	ENSP00000432063:R80C;ENSP00000264144:R80C	ENSP00000264144:R80C	R	+	1	0	LAMC2	181443797	0.000000	0.05858	0.998000	0.56505	0.910000	0.53928	0.359000	0.20233	0.976000	0.38417	0.591000	0.81541	CGC	LAMC2	-	superfamily_Growth_fac_rcpt,smart_EGF_laminin	ENSG00000058085		0.512	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	HGNC	protein_coding	OTTHUMT00000086258.1	562	0.18	1	C	NM_005562		183177174	183177174	+1	no_errors	ENST00000264144	ensembl	human	known	69_37n	missense	665	17.16	138	SNP	0.991	T
LIMS1	3987	genome.wustl.edu	37	2	109293130	109293130	+	Silent	SNP	A	A	G	rs2438733	byFrequency	TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr2:109293130A>G	ENST00000393310.1	+	7	881	c.714A>G	c.(712-714)gcA>gcG	p.A238A	AC010095.5_ENST00000411710.1_RNA|LIMS1_ENST00000338045.3_Silent_p.A238A|LIMS1_ENST00000332345.6_Silent_p.A238A|LIMS1_ENST00000542845.1_Silent_p.A300A|LIMS1_ENST00000409441.1_Silent_p.A275A|LIMS1_ENST00000410093.1_Silent_p.A242A|LIMS1_ENST00000544547.1_Silent_p.A250A	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	238	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						AAGGCCTGGCATATTGTGAAA	0.373																																						dbGAP											0													58.0	45.0	50.0					2																	109293130		2104	3948	6052	-	-	-	SO:0001819	synonymous_variant	0				CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	ENST00000393310.1:c.714A>G	2.37:g.109293130A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH,pfscan_Znf_LIM	p.A300	ENST00000393310.1	37	c.900	CCDS2078.1	2																																																																																			LIMS1	-	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH,pfscan_Znf_LIM	ENSG00000169756		0.373	LIMS1-001	KNOWN	basic|CCDS	protein_coding	LIMS1	HGNC	protein_coding	OTTHUMT00000253596.1	37	0.00	0	A	NM_004987		109293130	109293130	+1	no_errors	ENST00000542845	ensembl	human	known	69_37n	silent	34	22.73	10	SNP	0.000	G
MBTPS1	8720	genome.wustl.edu	37	16	84088111	84088111	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr16:84088111C>A	ENST00000343411.3	-	23	3597	c.3102G>T	c.(3100-3102)agG>agT	p.R1034S		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	1034	Arg/Lys/Pro-rich (basic).				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.R1034S(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGCGCTTCACCCTGGGCTTCC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	57.0	59.0					16																	84088111		2200	4300	6500	-	-	-	SO:0001583	missense	0			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.3102G>T	16.37:g.84088111C>A	ENSP00000344223:p.Arg1034Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.R1034S	ENST00000343411.3	37	c.3102	CCDS10941.1	16	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002484	0.74932	.	.	ENSG00000140943	ENST00000343411;ENST00000347334	T	0.36699	1.24	5.91	1.85	0.25348	.	0.123613	0.53938	D	0.000058	T	0.47135	0.1429	L	0.56769	1.78	0.58432	D	0.999994	D	0.54601	0.967	D	0.63597	0.916	T	0.43702	-0.9375	10	0.87932	D	0	-31.3784	6.1874	0.20506	0.0:0.5051:0.1267:0.3682	.	1034	Q14703	MBTP1_HUMAN	S	1034;479	ENSP00000344223:R1034S	ENSP00000344223:R1034S	R	-	3	2	MBTPS1	82645612	0.986000	0.35501	0.999000	0.59377	0.995000	0.86356	0.168000	0.16622	0.850000	0.35239	0.655000	0.94253	AGG	MBTPS1	-	NULL	ENSG00000140943		0.617	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS1	HGNC	protein_coding	OTTHUMT00000269080.2	33	0.00	0	C	NM_003791		84088111	84088111	-1	no_errors	ENST00000343411	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.994	A
MMP8	4317	genome.wustl.edu	37	11	102589268	102589268	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr11:102589268G>T	ENST00000236826.3	-	5	759	c.661C>A	c.(661-663)Cat>Aat	p.H221N		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	221					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.H221N(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	CCCAAAGAATGGCCAAATTCA	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											155.0	128.0	137.0					11																	102589268		2203	4299	6502	-	-	-	SO:0001583	missense	0			J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.661C>A	11.37:g.102589268G>T	ENSP00000236826:p.His221Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q45F99	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.H221N	ENST00000236826.3	37	c.661	CCDS8320.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.101255|4.101255	0.76983|0.76983	.|.	.|.	ENSG00000118113|ENSG00000118113	ENST00000236826;ENST00000544383;ENST00000534942|ENST00000438475	D|.	0.94758|.	-3.51|.	5.61|5.61	5.61|5.61	0.85477|0.85477	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);|.	0.000000|.	0.64402|.	D|.	0.000011|.	D|D	0.90872|0.90872	0.7132|0.7132	H|H	0.98111|0.98111	4.15|4.15	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.93631|0.93631	0.6956|0.6956	10|5	0.87932|.	D|.	0|.	.|.	20.0018|20.0018	0.97417|0.97417	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	221;156;221|.	A8K9E4;F5GXB5;P22894|.	.;.;MMP8_HUMAN|.	N|Q	221;198;156|196	ENSP00000236826:H221N|.	ENSP00000236826:H221N|.	H|P	-|-	1|2	0|0	MMP8|MMP8	102094478|102094478	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.369000|0.369000	0.29798|0.29798	9.279000|9.279000	0.95777|0.95777	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CAT|CCA	MMP8	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	ENSG00000118113		0.478	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP8	HGNC	protein_coding	OTTHUMT00000395223.1	156	0.00	0	G	NM_002424		102589268	102589268	-1	no_errors	ENST00000236826	ensembl	human	known	69_37n	missense	69	18.82	16	SNP	1.000	T
MMP8	4317	genome.wustl.edu	37	11	102589268	102589268	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr11:102589268G>T	ENST00000236826.3	-	5	759	c.661C>A	c.(661-663)Cat>Aat	p.H221N		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	221					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.H221N(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	CCCAAAGAATGGCCAAATTCA	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											155.0	128.0	137.0					11																	102589268		2203	4299	6502	-	-	-	SO:0001583	missense	0			J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.661C>A	11.37:g.102589268G>T	ENSP00000236826:p.His221Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q45F99	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.H221N	ENST00000236826.3	37	c.661	CCDS8320.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.101255|4.101255	0.76983|0.76983	.|.	.|.	ENSG00000118113|ENSG00000118113	ENST00000236826;ENST00000544383;ENST00000534942|ENST00000438475	D|.	0.94758|.	-3.51|.	5.61|5.61	5.61|5.61	0.85477|0.85477	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);|.	0.000000|.	0.64402|.	D|.	0.000011|.	D|D	0.90872|0.90872	0.7132|0.7132	H|H	0.98111|0.98111	4.15|4.15	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.93631|0.93631	0.6956|0.6956	10|5	0.87932|.	D|.	0|.	.|.	20.0018|20.0018	0.97417|0.97417	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	221;156;221|.	A8K9E4;F5GXB5;P22894|.	.;.;MMP8_HUMAN|.	N|Q	221;198;156|196	ENSP00000236826:H221N|.	ENSP00000236826:H221N|.	H|P	-|-	1|2	0|0	MMP8|MMP8	102094478|102094478	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.369000|0.369000	0.29798|0.29798	9.279000|9.279000	0.95777|0.95777	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CAT|CCA	MMP8	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	ENSG00000118113		0.478	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP8	HGNC	protein_coding	OTTHUMT00000395223.1	103	0.00	0	G	NM_002424		102589268	102589268	-1	no_errors	ENST00000236826	ensembl	human	known	69_37n	missense	69	18.82	16	SNP	1.000	T
MST1L	11223	genome.wustl.edu	37	1	17085452	17085452	+	RNA	SNP	A	A	G	rs3981980		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:17085452A>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GAGCGGGAGCAAAATCGTGGC	0.617																																						dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085452A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.F413	ENST00000455405.2	37	c.1239		1																																																																																			MST1P9	-	superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.617	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	37	0.00	0	A	NM_001271733		17085452	17085452	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	silent	78	11.36	10	SNP	0.995	G
MUC16	94025	genome.wustl.edu	37	19	9019327	9019327	+	Silent	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr19:9019327G>C	ENST00000397910.4	-	23	37763	c.37560C>G	c.(37558-37560)tcC>tcG	p.S12520S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12522					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S12520S(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTCCACTGTGGAGGTCCCAG	0.478																																						dbGAP											2	Substitution - coding silent(2)	lung(1)|breast(1)											74.0	67.0	69.0					19																	9019327		1893	4121	6014	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37560C>G	19.37:g.9019327G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S12520	ENST00000397910.4	37	c.37560	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	262	0.00	0	G	NM_024690		9019327	9019327	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	217	10.70	26	SNP	0.091	C
MUC16	94025	genome.wustl.edu	37	19	9019327	9019327	+	Silent	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr19:9019327G>C	ENST00000397910.4	-	23	37763	c.37560C>G	c.(37558-37560)tcC>tcG	p.S12520S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12522					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S12520S(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTCCACTGTGGAGGTCCCAG	0.478																																						dbGAP											2	Substitution - coding silent(2)	lung(1)|breast(1)											74.0	67.0	69.0					19																	9019327		1893	4121	6014	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37560C>G	19.37:g.9019327G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S12520	ENST00000397910.4	37	c.37560	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	232	0.00	0	G	NM_024690		9019327	9019327	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	217	10.70	26	SNP	0.091	C
NSL1	25936	genome.wustl.edu	37	1	212911865	212911865	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:212911865G>C	ENST00000366977.3	-	6	749	c.731C>G	c.(730-732)aCa>aGa	p.T244R	NSL1_ENST00000366978.1_Intron|NSL1_ENST00000366976.1_3'UTR|NSL1_ENST00000366975.6_Missense_Mutation_p.T203R|NSL1_ENST00000422588.2_3'UTR	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	244					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)		p.T244R(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		AGCAGTCTCTGTTGGTGTGGT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											178.0	180.0	179.0					1																	212911865		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.731C>G	1.37:g.212911865G>C	ENSP00000355944:p.Thr244Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	pfam_Kinetochore_Mis14	p.T244R	ENST00000366977.3	37	c.731	CCDS1509.1	1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024022	0.54683	.	.	ENSG00000117697	ENST00000366977;ENST00000366975	T;T	0.35421	1.31;1.32	5.65	3.79	0.43588	.	0.631891	0.16041	N	0.232421	T	0.41581	0.1165	L	0.40543	1.245	0.80722	D	1	P;P	0.51933	0.949;0.938	P;P	0.55455	0.776;0.467	T	0.05767	-1.0865	10	0.31617	T	0.26	0.0717	10.3336	0.43837	0.1521:0.0:0.8479:0.0	.	203;244	B4E071;Q96IY1	.;NSL1_HUMAN	R	244;203	ENSP00000355944:T244R;ENSP00000355942:T203R	ENSP00000355942:T203R	T	-	2	0	NSL1	210978488	0.996000	0.38824	0.386000	0.26170	0.959000	0.62525	3.910000	0.56371	0.868000	0.35678	0.650000	0.86243	ACA	NSL1	-	NULL	ENSG00000117697		0.423	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSL1	HGNC	protein_coding	OTTHUMT00000089398.2	131	0.00	0	G	NM_015471		212911865	212911865	-1	no_errors	ENST00000366977	ensembl	human	known	69_37n	missense	200	19.68	49	SNP	0.976	C
NSL1	25936	genome.wustl.edu	37	1	212911865	212911865	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:212911865G>C	ENST00000366977.3	-	6	749	c.731C>G	c.(730-732)aCa>aGa	p.T244R	NSL1_ENST00000366978.1_Intron|NSL1_ENST00000366976.1_3'UTR|NSL1_ENST00000366975.6_Missense_Mutation_p.T203R|NSL1_ENST00000422588.2_3'UTR	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	244					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)		p.T244R(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		AGCAGTCTCTGTTGGTGTGGT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											178.0	180.0	179.0					1																	212911865		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.731C>G	1.37:g.212911865G>C	ENSP00000355944:p.Thr244Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	pfam_Kinetochore_Mis14	p.T244R	ENST00000366977.3	37	c.731	CCDS1509.1	1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024022	0.54683	.	.	ENSG00000117697	ENST00000366977;ENST00000366975	T;T	0.35421	1.31;1.32	5.65	3.79	0.43588	.	0.631891	0.16041	N	0.232421	T	0.41581	0.1165	L	0.40543	1.245	0.80722	D	1	P;P	0.51933	0.949;0.938	P;P	0.55455	0.776;0.467	T	0.05767	-1.0865	10	0.31617	T	0.26	0.0717	10.3336	0.43837	0.1521:0.0:0.8479:0.0	.	203;244	B4E071;Q96IY1	.;NSL1_HUMAN	R	244;203	ENSP00000355944:T244R;ENSP00000355942:T203R	ENSP00000355942:T203R	T	-	2	0	NSL1	210978488	0.996000	0.38824	0.386000	0.26170	0.959000	0.62525	3.910000	0.56371	0.868000	0.35678	0.650000	0.86243	ACA	NSL1	-	NULL	ENSG00000117697		0.423	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSL1	HGNC	protein_coding	OTTHUMT00000089398.2	165	0.00	0	G	NM_015471		212911865	212911865	-1	no_errors	ENST00000366977	ensembl	human	known	69_37n	missense	200	19.68	49	SNP	0.976	C
NUAK1	9891	genome.wustl.edu	37	12	106461617	106461617	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr12:106461617A>T	ENST00000261402.2	-	7	2328	c.949T>A	c.(949-951)Tgt>Agt	p.C317S		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	317					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.C317S(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						AGGGCATCACAGTCACACACG	0.577																																						dbGAP											2	Substitution - Missense(2)	breast(2)											77.0	65.0	69.0					12																	106461617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.949T>A	12.37:g.106461617A>T	ENSP00000261402:p.Cys317Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C317S	ENST00000261402.2	37	c.949	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	A	13.28	2.188857	0.38707	.	.	ENSG00000074590	ENST00000261402;ENST00000553094;ENST00000549704	T;T;T	0.36878	1.23;1.23;1.23	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000003	T	0.41834	0.1176	M	0.66939	2.045	0.80722	D	1	P	0.46859	0.885	P	0.46585	0.521	T	0.34054	-0.9844	10	0.08381	T	0.77	.	15.9208	0.79570	1.0:0.0:0.0:0.0	.	317	O60285	NUAK1_HUMAN	S	317;32;67	ENSP00000261402:C317S;ENSP00000446873:C32S;ENSP00000449990:C67S	ENSP00000261402:C317S	C	-	1	0	NUAK1	104985747	1.000000	0.71417	0.995000	0.50966	0.828000	0.46876	7.109000	0.77062	2.155000	0.67459	0.459000	0.35465	TGT	NUAK1	-	superfamily_Kinase-like_dom	ENSG00000074590		0.577	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	80	0.00	0	A	NM_014840		106461617	106461617	-1	no_errors	ENST00000261402	ensembl	human	known	69_37n	missense	51	36.25	29	SNP	1.000	T
NUAK1	9891	genome.wustl.edu	37	12	106461617	106461617	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr12:106461617A>T	ENST00000261402.2	-	7	2328	c.949T>A	c.(949-951)Tgt>Agt	p.C317S		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	317					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.C317S(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						AGGGCATCACAGTCACACACG	0.577																																						dbGAP											2	Substitution - Missense(2)	breast(2)											77.0	65.0	69.0					12																	106461617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.949T>A	12.37:g.106461617A>T	ENSP00000261402:p.Cys317Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C317S	ENST00000261402.2	37	c.949	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	A	13.28	2.188857	0.38707	.	.	ENSG00000074590	ENST00000261402;ENST00000553094;ENST00000549704	T;T;T	0.36878	1.23;1.23;1.23	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000003	T	0.41834	0.1176	M	0.66939	2.045	0.80722	D	1	P	0.46859	0.885	P	0.46585	0.521	T	0.34054	-0.9844	10	0.08381	T	0.77	.	15.9208	0.79570	1.0:0.0:0.0:0.0	.	317	O60285	NUAK1_HUMAN	S	317;32;67	ENSP00000261402:C317S;ENSP00000446873:C32S;ENSP00000449990:C67S	ENSP00000261402:C317S	C	-	1	0	NUAK1	104985747	1.000000	0.71417	0.995000	0.50966	0.828000	0.46876	7.109000	0.77062	2.155000	0.67459	0.459000	0.35465	TGT	NUAK1	-	superfamily_Kinase-like_dom	ENSG00000074590		0.577	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	41	0.00	0	A	NM_014840		106461617	106461617	-1	no_errors	ENST00000261402	ensembl	human	known	69_37n	missense	51	36.25	29	SNP	1.000	T
TENM4	26011	genome.wustl.edu	37	11	78423693	78423693	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr11:78423693G>T	ENST00000278550.7	-	26	4350	c.3888C>A	c.(3886-3888)gaC>gaA	p.D1296E		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1296					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GGCTGTTGCTGTCAGAAAGGA	0.537																																						dbGAP											0													62.0	65.0	64.0					11																	78423693		1902	4098	6000	-	-	-	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3888C>A	11.37:g.78423693G>T	ENSP00000278550:p.Asp1296Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.D1296E	ENST00000278550.7	37	c.3888	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	18.60	3.657966	0.67586	.	.	ENSG00000149256	ENST00000278550	D	0.91894	-2.93	5.29	5.29	0.74685	.	0.050075	0.85682	D	0.000000	D	0.90477	0.7017	M	0.75884	2.315	0.58432	D	0.999998	B	0.06786	0.001	B	0.06405	0.002	D	0.85654	0.1284	9	.	.	.	.	12.4427	0.55634	0.0758:0.0:0.9242:0.0	.	1296	Q6N022	TEN4_HUMAN	E	1296	ENSP00000278550:D1296E	.	D	-	3	2	ODZ4	78101341	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	3.313000	0.51935	2.767000	0.95098	0.655000	0.94253	GAC	ODZ4	-	NULL	ENSG00000149256		0.537	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ4	HGNC	protein_coding	OTTHUMT00000391406.2	155	0.00	0	G			78423693	78423693	-1	no_errors	ENST00000278550	ensembl	human	known	69_37n	missense	111	26.00	39	SNP	1.000	T
OR10C1	442194	genome.wustl.edu	37	6	29407949	29407949	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr6:29407949G>A	ENST00000444197.2	+	1	867	c.157G>A	c.(157-159)Gcc>Acc	p.A53T	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A53T(1)		NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CACTGATGCTGCCCTCCAGTC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	164.0	175.0					6																	29407949		1511	2708	4219	-	-	-	SO:0001583	missense	0				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.157G>A	6.37:g.29407949G>A	ENSP00000419119:p.Ala53Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SUN7|Q96R18	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A53T	ENST00000444197.2	37	c.157	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108309	0.37242	.	.	ENSG00000206474	ENST00000444197	T	0.01084	5.36	3.73	0.858	0.19030	GPCR, rhodopsin-like superfamily (1);	0.522459	0.14630	U	0.307841	T	0.00241	0.0007	N	0.02985	-0.445	0.09310	N	1	B	0.22683	0.073	B	0.29524	0.103	T	0.32025	-0.9922	10	0.29301	T	0.29	.	6.4985	0.22155	0.1858:0.3454:0.4688:0.0	.	53	Q96KK4	O10C1_HUMAN	T	53	ENSP00000419119:A53T	ENSP00000419119:A53T	A	+	1	0	OR10C1	29515928	0.000000	0.05858	0.001000	0.08648	0.591000	0.36615	-0.875000	0.04205	0.347000	0.23924	0.537000	0.68136	GCC	OR10C1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000206474		0.567	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	HGNC	protein_coding	OTTHUMT00000076415.2	727	0.00	0	G			29407949	29407949	+1	no_errors	ENST00000444197	ensembl	human	known	69_37n	missense	364	12.23	51	SNP	0.000	A
OR10C1	442194	genome.wustl.edu	37	6	29407949	29407949	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr6:29407949G>A	ENST00000444197.2	+	1	867	c.157G>A	c.(157-159)Gcc>Acc	p.A53T	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A53T(1)		NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CACTGATGCTGCCCTCCAGTC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	164.0	175.0					6																	29407949		1511	2708	4219	-	-	-	SO:0001583	missense	0				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.157G>A	6.37:g.29407949G>A	ENSP00000419119:p.Ala53Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SUN7|Q96R18	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A53T	ENST00000444197.2	37	c.157	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108309	0.37242	.	.	ENSG00000206474	ENST00000444197	T	0.01084	5.36	3.73	0.858	0.19030	GPCR, rhodopsin-like superfamily (1);	0.522459	0.14630	U	0.307841	T	0.00241	0.0007	N	0.02985	-0.445	0.09310	N	1	B	0.22683	0.073	B	0.29524	0.103	T	0.32025	-0.9922	10	0.29301	T	0.29	.	6.4985	0.22155	0.1858:0.3454:0.4688:0.0	.	53	Q96KK4	O10C1_HUMAN	T	53	ENSP00000419119:A53T	ENSP00000419119:A53T	A	+	1	0	OR10C1	29515928	0.000000	0.05858	0.001000	0.08648	0.591000	0.36615	-0.875000	0.04205	0.347000	0.23924	0.537000	0.68136	GCC	OR10C1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000206474		0.567	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	HGNC	protein_coding	OTTHUMT00000076415.2	395	0.25	1	G			29407949	29407949	+1	no_errors	ENST00000444197	ensembl	human	known	69_37n	missense	364	12.23	51	SNP	0.000	A
OR1L8	138881	genome.wustl.edu	37	9	125329851	125329851	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr9:125329851C>A	ENST00000304865.2	-	1	987	c.906G>T	c.(904-906)agG>agT	p.R302S		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R302S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TCATAAGCTTCCTCAGGCCCT	0.443																																						dbGAP											2	Substitution - Missense(2)	breast(2)											88.0	89.0	89.0					9																	125329851		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.906G>T	9.37:g.125329851C>A	ENSP00000306607:p.Arg302Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R302S	ENST00000304865.2	37	c.906	CCDS35124.1	9	.	.	.	.	.	.	.	.	.	.	C	9.963	1.223356	0.22457	.	.	ENSG00000171496	ENST00000304865	T	0.39787	1.06	4.64	2.78	0.32641	.	0.642146	0.13432	N	0.388371	T	0.37320	0.0999	M	0.66378	2.025	0.09310	N	1	B	0.25563	0.129	B	0.26614	0.071	T	0.27839	-1.0062	10	0.21014	T	0.42	-0.2245	6.7492	0.23477	0.0:0.683:0.1472:0.1698	.	302	Q8NGR8	OR1L8_HUMAN	S	302	ENSP00000306607:R302S	ENSP00000306607:R302S	R	-	3	2	OR1L8	124369672	0.000000	0.05858	0.011000	0.14972	0.852000	0.48524	-1.426000	0.02443	0.705000	0.31890	0.449000	0.29647	AGG	OR1L8	-	pfam_7TM_GPCR_olfarory/Srsx	ENSG00000171496		0.443	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L8	HGNC	protein_coding	OTTHUMT00000053939.1	200	0.00	0	C			125329851	125329851	-1	no_errors	ENST00000304865	ensembl	human	known	69_37n	missense	161	28.44	64	SNP	0.147	A
OR1L8	138881	genome.wustl.edu	37	9	125329851	125329851	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr9:125329851C>A	ENST00000304865.2	-	1	987	c.906G>T	c.(904-906)agG>agT	p.R302S		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R302S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TCATAAGCTTCCTCAGGCCCT	0.443																																						dbGAP											2	Substitution - Missense(2)	breast(2)											88.0	89.0	89.0					9																	125329851		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.906G>T	9.37:g.125329851C>A	ENSP00000306607:p.Arg302Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R302S	ENST00000304865.2	37	c.906	CCDS35124.1	9	.	.	.	.	.	.	.	.	.	.	C	9.963	1.223356	0.22457	.	.	ENSG00000171496	ENST00000304865	T	0.39787	1.06	4.64	2.78	0.32641	.	0.642146	0.13432	N	0.388371	T	0.37320	0.0999	M	0.66378	2.025	0.09310	N	1	B	0.25563	0.129	B	0.26614	0.071	T	0.27839	-1.0062	10	0.21014	T	0.42	-0.2245	6.7492	0.23477	0.0:0.683:0.1472:0.1698	.	302	Q8NGR8	OR1L8_HUMAN	S	302	ENSP00000306607:R302S	ENSP00000306607:R302S	R	-	3	2	OR1L8	124369672	0.000000	0.05858	0.011000	0.14972	0.852000	0.48524	-1.426000	0.02443	0.705000	0.31890	0.449000	0.29647	AGG	OR1L8	-	pfam_7TM_GPCR_olfarory/Srsx	ENSG00000171496		0.443	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L8	HGNC	protein_coding	OTTHUMT00000053939.1	135	0.00	0	C			125329851	125329851	-1	no_errors	ENST00000304865	ensembl	human	known	69_37n	missense	161	28.44	64	SNP	0.147	A
OR4N2	390429	genome.wustl.edu	37	14	20296167	20296167	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr14:20296167T>A	ENST00000315947.1	+	1	560	c.560T>A	c.(559-561)cTg>cAg	p.L187Q	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L187Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GTCATCAAGCTGGCCTGCACC	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	149.0	148.0					14																	20296167		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.560T>A	14.37:g.20296167T>A	ENSP00000319601:p.Leu187Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L187Q	ENST00000315947.1	37	c.560	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	17.10	3.304248	0.60305	.	.	ENSG00000176294	ENST00000315947	T	0.00411	7.53	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38720	N	0.001586	T	0.02119	0.0066	H	0.99026	4.405	0.32495	N	0.53963	D	0.89917	1.0	D	0.87578	0.998	T	0.01018	-1.1479	10	0.87932	D	0	-7.6861	6.8588	0.24056	0.0:0.1038:0.0:0.8962	.	187	Q8NGD1	OR4N2_HUMAN	Q	187	ENSP00000319601:L187Q	ENSP00000319601:L187Q	L	+	2	0	OR4N2	19366007	0.234000	0.23783	1.000000	0.80357	0.842000	0.47809	3.502000	0.53332	2.008000	0.58898	0.477000	0.44152	CTG	OR4N2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000176294		0.542	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	736	0.00	0	T			20296167	20296167	+1	no_errors	ENST00000315947	ensembl	human	known	69_37n	missense	689	12.09	95	SNP	1.000	A
OR4N2	390429	genome.wustl.edu	37	14	20296167	20296167	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr14:20296167T>A	ENST00000315947.1	+	1	560	c.560T>A	c.(559-561)cTg>cAg	p.L187Q	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L187Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GTCATCAAGCTGGCCTGCACC	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	149.0	148.0					14																	20296167		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.560T>A	14.37:g.20296167T>A	ENSP00000319601:p.Leu187Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L187Q	ENST00000315947.1	37	c.560	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	17.10	3.304248	0.60305	.	.	ENSG00000176294	ENST00000315947	T	0.00411	7.53	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38720	N	0.001586	T	0.02119	0.0066	H	0.99026	4.405	0.32495	N	0.53963	D	0.89917	1.0	D	0.87578	0.998	T	0.01018	-1.1479	10	0.87932	D	0	-7.6861	6.8588	0.24056	0.0:0.1038:0.0:0.8962	.	187	Q8NGD1	OR4N2_HUMAN	Q	187	ENSP00000319601:L187Q	ENSP00000319601:L187Q	L	+	2	0	OR4N2	19366007	0.234000	0.23783	1.000000	0.80357	0.842000	0.47809	3.502000	0.53332	2.008000	0.58898	0.477000	0.44152	CTG	OR4N2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000176294		0.542	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	441	0.00	0	T			20296167	20296167	+1	no_errors	ENST00000315947	ensembl	human	known	69_37n	missense	689	12.09	95	SNP	1.000	A
OR8U1	219417	genome.wustl.edu	37	11	56143625	56143625	+	Missense_Mutation	SNP	C	C	A	rs202218073		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr11:56143625C>A	ENST00000302270.1	+	1	526	c.526C>A	c.(526-528)Cat>Aat	p.H176N		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H176N(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CATTGTCAACCATTTCTATTG	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											247.0	240.0	242.0					11																	56143625		2126	4230	6356	-	-	-	SO:0001583	missense	0			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.526C>A	11.37:g.56143625C>A	ENSP00000304188:p.His176Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H176N	ENST00000302270.1	37	c.526	CCDS41647.1	11	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860164	0.32884	.	.	ENSG00000172199	ENST00000302270	T	0.00164	8.64	5.78	4.84	0.62591	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000129	T	0.00552	0.0018	M	0.86573	2.825	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.44267	-0.9339	10	0.72032	D	0.01	.	14.5116	0.67791	0.2577:0.7422:0.0:0.0	.	176	Q8NH10	OR8U1_HUMAN	N	176	ENSP00000304188:H176N	ENSP00000304188:H176N	H	+	1	0	OR8U1	55900201	0.066000	0.20996	0.969000	0.41365	0.105000	0.19272	0.717000	0.25851	2.743000	0.94032	0.643000	0.83706	CAT	OR8U1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172199		0.453	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	HGNC	protein_coding	OTTHUMT00000391607.1	1109	0.00	0	C	NM_001005204		56143625	56143625	+1	no_errors	ENST00000302270	ensembl	human	known	69_37n	missense	684	10.20	78	SNP	0.074	A
OR8U1	219417	genome.wustl.edu	37	11	56143625	56143625	+	Missense_Mutation	SNP	C	C	A	rs202218073		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr11:56143625C>A	ENST00000302270.1	+	1	526	c.526C>A	c.(526-528)Cat>Aat	p.H176N		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H176N(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CATTGTCAACCATTTCTATTG	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											247.0	240.0	242.0					11																	56143625		2126	4230	6356	-	-	-	SO:0001583	missense	0			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.526C>A	11.37:g.56143625C>A	ENSP00000304188:p.His176Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H176N	ENST00000302270.1	37	c.526	CCDS41647.1	11	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860164	0.32884	.	.	ENSG00000172199	ENST00000302270	T	0.00164	8.64	5.78	4.84	0.62591	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000129	T	0.00552	0.0018	M	0.86573	2.825	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.44267	-0.9339	10	0.72032	D	0.01	.	14.5116	0.67791	0.2577:0.7422:0.0:0.0	.	176	Q8NH10	OR8U1_HUMAN	N	176	ENSP00000304188:H176N	ENSP00000304188:H176N	H	+	1	0	OR8U1	55900201	0.066000	0.20996	0.969000	0.41365	0.105000	0.19272	0.717000	0.25851	2.743000	0.94032	0.643000	0.83706	CAT	OR8U1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172199		0.453	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	HGNC	protein_coding	OTTHUMT00000391607.1	777	0.00	0	C	NM_001005204		56143625	56143625	+1	no_errors	ENST00000302270	ensembl	human	known	69_37n	missense	684	10.20	78	SNP	0.074	A
PLOD3	8985	genome.wustl.edu	37	7	100856125	100856126	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr7:100856125_100856126insC	ENST00000223127.3	-	8	1274_1275	c.876_877insG	c.(874-879)gggcagfs	p.Q293fs		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	293					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CACCTCACCTGCCCCCCCGGGA	0.673																																						dbGAP											0										29,4225		1,27,2099						4.0	1.0			29	20,8212		0,20,4096	no	frameshift	PLOD3	NM_001084.4		1,47,6195	A1A1,A1R,RR		0.243,0.6817,0.3924				49,12437				-	-	-	SO:0001589	frameshift_variant	0			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.877dupG	7.37:g.100856132_100856132dupC	ENSP00000223127:p.Gln293fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6W6|Q540C3	Frame_Shift_Ins	INS	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.Q292fs	ENST00000223127.3	37	c.877_876	CCDS5715.1	7																																																																																			PLOD3	-	NULL	ENSG00000106397		0.673	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1	14	0.00	0	-			100856125	100856126	-1	no_errors	ENST00000223127	ensembl	human	known	69_37n	frame_shift_ins	9	25.00	3	INS	1.000:1.000	C
POTEF	728378	genome.wustl.edu	37	2	130832165	130832165	+	Silent	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr2:130832165C>T	ENST00000409914.2	-	17	3279	c.2880G>A	c.(2878-2880)gcG>gcA	p.A960A	POTEF_ENST00000357462.5_Silent_p.A960A	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	960	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCTGGAAGAGCGCCTCGGGGC	0.587																																						dbGAP											0													1.0	1.0	1.0					2																	130832165		295	872	1167	-	-	-	SO:0001819	synonymous_variant	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2880G>A	2.37:g.130832165C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC34	Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A960	ENST00000409914.2	37	c.2880	CCDS46409.1	2																																																																																			POTEF	-	pfam_Actin-like,smart_Actin-like	ENSG00000196604		0.587	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	28	0.00	0	C	NM_001099771		130832165	130832165	-1	no_errors	ENST00000357462	ensembl	human	known	69_37n	silent	32	27.27	12	SNP	1.000	T
PRAMEF7	441871	genome.wustl.edu	37	1	12980232	12980232	+	Silent	SNP	G	G	A	rs201674075		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:12980232G>A	ENST00000361079.2	+	4	1507	c.1424G>A	c.(1423-1425)tGa>tAa	p.*475*	RNU6-1072P_ENST00000384703.1_RNA			Q5VXH5	PRAM7_HUMAN	PRAME family member 7	0					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(2)|kidney(5)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)	18	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCTCTGTTGAATGCCTGCC	0.532																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS30593.1	1p36.21	2013-01-17			ENSG00000204510	ENSG00000204510		"""-"""	28415	protein-coding gene	gene with protein product							Standard	NM_001012277		Approved			Q5VXH5	OTTHUMG00000001982	ENST00000361079.2:c.1424G>A	1.37:g.12980232G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIP0	Silent	SNP	NULL	p.*475	ENST00000361079.2	37	c.1424	CCDS30593.1	1																																																																																			PRAMEF7	-	NULL	ENSG00000204510		0.532	PRAMEF7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF7	HGNC	protein_coding		38	0.00	0	G	NM_001012277		12980232	12980232	+1	no_errors	ENST00000330881	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	0.000	A
POU2F1	5451	genome.wustl.edu	37	1	167382293	167382293	+	Silent	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:167382293C>A	ENST00000541643.3	+	16	2025	c.1863C>A	c.(1861-1863)acC>acA	p.T621T	POU2F1_ENST00000429375.2_Silent_p.T581T|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Silent_p.T633T|POU2F1_ENST00000367866.2_Silent_p.T644T|POU2F1_ENST00000420254.3_Silent_p.T621T			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	621					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T621T(1)|p.T644T(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						ATCCAGGGACCCTGAGCGGTG	0.473																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											126.0	127.0	127.0					1																	167382293		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.1863C>A	1.37:g.167382293C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.T644	ENST00000541643.3	37	c.1932		1																																																																																			POU2F1	-	NULL	ENSG00000143190		0.473	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		164	0.00	0	C	NM_002697		167382293	167382293	+1	no_errors	ENST00000367866	ensembl	human	known	69_37n	silent	157	18.65	36	SNP	0.990	A
POU2F1	5451	genome.wustl.edu	37	1	167382293	167382293	+	Silent	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:167382293C>A	ENST00000541643.3	+	16	2025	c.1863C>A	c.(1861-1863)acC>acA	p.T621T	POU2F1_ENST00000429375.2_Silent_p.T581T|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Silent_p.T633T|POU2F1_ENST00000367866.2_Silent_p.T644T|POU2F1_ENST00000420254.3_Silent_p.T621T			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	621					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T621T(1)|p.T644T(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						ATCCAGGGACCCTGAGCGGTG	0.473																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											126.0	127.0	127.0					1																	167382293		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.1863C>A	1.37:g.167382293C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.T644	ENST00000541643.3	37	c.1932		1																																																																																			POU2F1	-	NULL	ENSG00000143190		0.473	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		130	0.00	0	C	NM_002697		167382293	167382293	+1	no_errors	ENST00000367866	ensembl	human	known	69_37n	silent	157	18.65	36	SNP	0.990	A
PTCHD1	139411	genome.wustl.edu	37	X	23411647	23411647	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chrX:23411647T>A	ENST00000379361.4	+	3	2872	c.2012T>A	c.(2011-2013)cTt>cAt	p.L671H		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	671					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.L566H(1)|p.L671H(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CTGAGGAGACTTTCTGTCACC	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											82.0	75.0	77.0					X																	23411647		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2012T>A	X.37:g.23411647T>A	ENSP00000368666:p.Leu671His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.L671H	ENST00000379361.4	37	c.2012	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	T	16.78	3.217492	0.58560	.	.	ENSG00000165186	ENST00000379361	D	0.86164	-2.08	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.91613	0.7350	M	0.64170	1.965	0.54753	D	0.999986	D	0.54397	0.966	D	0.63957	0.92	D	0.92463	0.5979	10	0.87932	D	0	.	14.5487	0.68050	0.0:0.0:0.0:1.0	.	671	Q96NR3	PTHD1_HUMAN	H	671	ENSP00000368666:L671H	ENSP00000368666:L671H	L	+	2	0	PTCHD1	23321568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.694000	0.84235	1.816000	0.52996	0.486000	0.48141	CTT	PTCHD1	-	pfam_Patched	ENSG00000165186		0.493	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	103	0.00	0	T	NM_173495		23411647	23411647	+1	no_errors	ENST00000379361	ensembl	human	known	69_37n	missense	96	26.72	35	SNP	1.000	A
PTCHD1	139411	genome.wustl.edu	37	X	23411647	23411647	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chrX:23411647T>A	ENST00000379361.4	+	3	2872	c.2012T>A	c.(2011-2013)cTt>cAt	p.L671H		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	671					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.L566H(1)|p.L671H(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CTGAGGAGACTTTCTGTCACC	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											82.0	75.0	77.0					X																	23411647		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2012T>A	X.37:g.23411647T>A	ENSP00000368666:p.Leu671His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.L671H	ENST00000379361.4	37	c.2012	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	T	16.78	3.217492	0.58560	.	.	ENSG00000165186	ENST00000379361	D	0.86164	-2.08	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.91613	0.7350	M	0.64170	1.965	0.54753	D	0.999986	D	0.54397	0.966	D	0.63957	0.92	D	0.92463	0.5979	10	0.87932	D	0	.	14.5487	0.68050	0.0:0.0:0.0:1.0	.	671	Q96NR3	PTHD1_HUMAN	H	671	ENSP00000368666:L671H	ENSP00000368666:L671H	L	+	2	0	PTCHD1	23321568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.694000	0.84235	1.816000	0.52996	0.486000	0.48141	CTT	PTCHD1	-	pfam_Patched	ENSG00000165186		0.493	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	236	0.00	0	T	NM_173495		23411647	23411647	+1	no_errors	ENST00000379361	ensembl	human	known	69_37n	missense	96	26.72	35	SNP	1.000	A
PTCHD4	442213	genome.wustl.edu	37	6	47976671	47976671	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr6:47976671T>C	ENST00000339488.4	-	2	639	c.606A>G	c.(604-606)atA>atG	p.I202M	PTCHD4_ENST00000543600.1_Missense_Mutation_p.I185M	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	202						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.I202M(1)									GGAGCTTCCTTATAAGCTTAC	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	54.0	55.0					6																	47976671		1883	4126	6009	-	-	-	SO:0001583	missense	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.606A>G	6.37:g.47976671T>C	ENSP00000341914:p.Ile202Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.I202M	ENST00000339488.4	37	c.606	CCDS34473.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.982|0.982	-0.696713|-0.696713	0.03279|0.03279	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000339488;ENST00000543600|ENST00000398738	D;D|.	0.86297|.	-2.1;-2.1|.	6.16|6.16	4.4|4.4	0.53042|0.53042	.|.	0.233969|.	0.45126|.	N|.	0.000382|.	T|T	0.03095|0.03095	0.0091|0.0091	N|N	0.00436|0.00436	-1.5|-1.5	0.27786|0.27786	N|N	0.942995|0.942995	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.09377|.	0.004;0.001|.	T|T	0.39563|0.39563	-0.9608|-0.9608	10|5	0.08599|.	T|.	0.76|.	.|.	13.1564|13.1564	0.59520|0.59520	0.0:0.8711:0.0:0.1289|0.0:0.8711:0.0:0.1289	.|.	202;185|.	Q6ZW05;B0QZ29|.	CF138_HUMAN;.|.	M|E	202;185|202	ENSP00000341914:I202M;ENSP00000439864:I185M|.	ENSP00000341914:I202M|.	I|K	-|-	3|1	3|0	C6orf138|C6orf138	48084630|48084630	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.990000|0.990000	0.78478|0.78478	1.843000|1.843000	0.39259|0.39259	0.947000|0.947000	0.37659|0.37659	-0.137000|-0.137000	0.14449|0.14449	ATA|AAG	PTCHD4	-	pfam_Patched	ENSG00000244694		0.502	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	85	0.00	0	T	NM_001013732		47976671	47976671	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	missense	83	12.63	12	SNP	1.000	C
PTCHD4	442213	genome.wustl.edu	37	6	47976671	47976671	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr6:47976671T>C	ENST00000339488.4	-	2	639	c.606A>G	c.(604-606)atA>atG	p.I202M	PTCHD4_ENST00000543600.1_Missense_Mutation_p.I185M	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	202						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.I202M(1)									GGAGCTTCCTTATAAGCTTAC	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	54.0	55.0					6																	47976671		1883	4126	6009	-	-	-	SO:0001583	missense	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.606A>G	6.37:g.47976671T>C	ENSP00000341914:p.Ile202Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.I202M	ENST00000339488.4	37	c.606	CCDS34473.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.982|0.982	-0.696713|-0.696713	0.03279|0.03279	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000339488;ENST00000543600|ENST00000398738	D;D|.	0.86297|.	-2.1;-2.1|.	6.16|6.16	4.4|4.4	0.53042|0.53042	.|.	0.233969|.	0.45126|.	N|.	0.000382|.	T|T	0.03095|0.03095	0.0091|0.0091	N|N	0.00436|0.00436	-1.5|-1.5	0.27786|0.27786	N|N	0.942995|0.942995	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.09377|.	0.004;0.001|.	T|T	0.39563|0.39563	-0.9608|-0.9608	10|5	0.08599|.	T|.	0.76|.	.|.	13.1564|13.1564	0.59520|0.59520	0.0:0.8711:0.0:0.1289|0.0:0.8711:0.0:0.1289	.|.	202;185|.	Q6ZW05;B0QZ29|.	CF138_HUMAN;.|.	M|E	202;185|202	ENSP00000341914:I202M;ENSP00000439864:I185M|.	ENSP00000341914:I202M|.	I|K	-|-	3|1	3|0	C6orf138|C6orf138	48084630|48084630	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.990000|0.990000	0.78478|0.78478	1.843000|1.843000	0.39259|0.39259	0.947000|0.947000	0.37659|0.37659	-0.137000|-0.137000	0.14449|0.14449	ATA|AAG	PTCHD4	-	pfam_Patched	ENSG00000244694		0.502	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	112	0.00	0	T	NM_001013732		47976671	47976671	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	missense	83	12.63	12	SNP	1.000	C
RANBP17	64901	genome.wustl.edu	37	5	170380678	170380678	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr5:170380678G>A	ENST00000523189.1	+	13	1710	c.1546G>A	c.(1546-1548)Gat>Aat	p.D516N		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	516					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.D516N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGATGAGCATGATGCTATGGA	0.328			T	TRD@	ALL																																	dbGAP		Dom	yes		5	5q34	64901	RAN binding protein 17		L	1	Substitution - Missense(1)	breast(1)											161.0	155.0	157.0					5																	170380678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1546G>A	5.37:g.170380678G>A	ENSP00000427975:p.Asp516Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IU74	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.D516N	ENST00000523189.1	37	c.1546	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111705	0.77210	.	.	ENSG00000204764	ENST00000523189;ENST00000545246	T	0.67523	-0.27	5.65	5.65	0.86999	Armadillo-type fold (1);	0.000000	0.64402	D	0.000008	T	0.77525	0.4143	M	0.79123	2.44	0.48236	D	0.999611	D	0.64830	0.994	P	0.56648	0.803	T	0.78165	-0.2310	10	0.45353	T	0.12	-15.5978	13.9747	0.64265	0.0746:0.0:0.9254:0.0	.	516	Q9H2T7	RBP17_HUMAN	N	516;412	ENSP00000427975:D516N	ENSP00000373770:D516N	D	+	1	0	RANBP17	170313283	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.433000	0.73404	2.680000	0.91292	0.467000	0.42956	GAT	RANBP17	-	superfamily_ARM-type_fold	ENSG00000204764		0.328	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1	240	0.00	0	G	NM_022897		170380678	170380678	+1	no_errors	ENST00000523189	ensembl	human	known	69_37n	missense	159	20.90	42	SNP	1.000	A
RANBP17	64901	genome.wustl.edu	37	5	170380678	170380678	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr5:170380678G>A	ENST00000523189.1	+	13	1710	c.1546G>A	c.(1546-1548)Gat>Aat	p.D516N		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	516					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.D516N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGATGAGCATGATGCTATGGA	0.328			T	TRD@	ALL																																	dbGAP		Dom	yes		5	5q34	64901	RAN binding protein 17		L	1	Substitution - Missense(1)	breast(1)											161.0	155.0	157.0					5																	170380678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1546G>A	5.37:g.170380678G>A	ENSP00000427975:p.Asp516Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IU74	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.D516N	ENST00000523189.1	37	c.1546	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111705	0.77210	.	.	ENSG00000204764	ENST00000523189;ENST00000545246	T	0.67523	-0.27	5.65	5.65	0.86999	Armadillo-type fold (1);	0.000000	0.64402	D	0.000008	T	0.77525	0.4143	M	0.79123	2.44	0.48236	D	0.999611	D	0.64830	0.994	P	0.56648	0.803	T	0.78165	-0.2310	10	0.45353	T	0.12	-15.5978	13.9747	0.64265	0.0746:0.0:0.9254:0.0	.	516	Q9H2T7	RBP17_HUMAN	N	516;412	ENSP00000427975:D516N	ENSP00000373770:D516N	D	+	1	0	RANBP17	170313283	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.433000	0.73404	2.680000	0.91292	0.467000	0.42956	GAT	RANBP17	-	superfamily_ARM-type_fold	ENSG00000204764		0.328	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1	82	0.00	0	G	NM_022897		170380678	170380678	+1	no_errors	ENST00000523189	ensembl	human	known	69_37n	missense	159	20.90	42	SNP	1.000	A
RASAL1	8437	genome.wustl.edu	37	12	113552621	113552621	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr12:113552621C>G	ENST00000261729.5	-	13	1480	c.1165G>C	c.(1165-1167)Gac>Cac	p.D389H	RASAL1_ENST00000546530.1_Missense_Mutation_p.D389H|RASAL1_ENST00000548055.1_Missense_Mutation_p.D389H|RASAL1_ENST00000446861.3_Missense_Mutation_p.D389H|RASAL1_ENST00000418411.2_5'UTR			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	389	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.D389H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CGGCCCAGGTCCATCTTGCAG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											249.0	250.0	250.0					12																	113552621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1165G>C	12.37:g.113552621C>G	ENSP00000261729:p.Asp389His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP	p.D389H	ENST00000261729.5	37	c.1165	CCDS9165.1	12	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597059	0.66332	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3	4.43	4.43	0.53597	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.401206	0.27581	N	0.018725	D	0.87354	0.6156	M	0.65677	2.01	0.42222	D	0.99185	D;P;D;D;P;P;D	0.65815	0.995;0.842;0.994;0.995;0.917;0.933;0.994	D;P;P;D;P;P;P	0.63381	0.914;0.859;0.86;0.914;0.823;0.89;0.86	D	0.89297	0.3623	10	0.72032	D	0.01	.	15.8036	0.78473	0.0:1.0:0.0:0.0	.	389;389;389;401;389;389;389	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	H	389	ENSP00000450244:D389H;ENSP00000261729:D389H;ENSP00000395920:D389H;ENSP00000448510:D389H	ENSP00000261729:D389H	D	-	1	0	RASAL1	112037004	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.643000	0.67895	2.014000	0.59158	0.313000	0.20887	GAC	RASAL1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000111344		0.617	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL1	HGNC	protein_coding	OTTHUMT00000405522.2	173	0.00	0	C	NM_004658		113552621	113552621	-1	no_errors	ENST00000546530	ensembl	human	known	69_37n	missense	67	34.95	36	SNP	1.000	G
RASAL1	8437	genome.wustl.edu	37	12	113552621	113552621	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr12:113552621C>G	ENST00000261729.5	-	13	1480	c.1165G>C	c.(1165-1167)Gac>Cac	p.D389H	RASAL1_ENST00000546530.1_Missense_Mutation_p.D389H|RASAL1_ENST00000548055.1_Missense_Mutation_p.D389H|RASAL1_ENST00000446861.3_Missense_Mutation_p.D389H|RASAL1_ENST00000418411.2_5'UTR			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	389	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.D389H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CGGCCCAGGTCCATCTTGCAG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											249.0	250.0	250.0					12																	113552621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1165G>C	12.37:g.113552621C>G	ENSP00000261729:p.Asp389His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP	p.D389H	ENST00000261729.5	37	c.1165	CCDS9165.1	12	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597059	0.66332	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3	4.43	4.43	0.53597	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.401206	0.27581	N	0.018725	D	0.87354	0.6156	M	0.65677	2.01	0.42222	D	0.99185	D;P;D;D;P;P;D	0.65815	0.995;0.842;0.994;0.995;0.917;0.933;0.994	D;P;P;D;P;P;P	0.63381	0.914;0.859;0.86;0.914;0.823;0.89;0.86	D	0.89297	0.3623	10	0.72032	D	0.01	.	15.8036	0.78473	0.0:1.0:0.0:0.0	.	389;389;389;401;389;389;389	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	H	389	ENSP00000450244:D389H;ENSP00000261729:D389H;ENSP00000395920:D389H;ENSP00000448510:D389H	ENSP00000261729:D389H	D	-	1	0	RASAL1	112037004	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.643000	0.67895	2.014000	0.59158	0.313000	0.20887	GAC	RASAL1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000111344		0.617	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL1	HGNC	protein_coding	OTTHUMT00000405522.2	73	0.00	0	C	NM_004658		113552621	113552621	-1	no_errors	ENST00000546530	ensembl	human	known	69_37n	missense	67	34.95	36	SNP	1.000	G
REG1P	5969	genome.wustl.edu	37	2	79363132	79363132	+	RNA	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr2:79363132C>T	ENST00000444841.1	-	0	1206									regenerating islet-derived 1 pseudogene																		AGTATTGGCACAGCTTGGGGA	0.517																																						dbGAP											0																																										-	-	-			0					2p12	2008-06-04	2008-06-04	2008-06-04	ENSG00000204787	ENSG00000204787			9953	pseudogene	pseudogene			"""rat regenerating islet-derived-like, human homolog (pancreatic stone protein-like, pancreatic thread protein-like)"", ""regenerating islet-derived-like, pancreatic stone protein-like, pancreatic thread protein-like (rat)"""	REGL		8333731	Standard	NR_002714		Approved	RS	uc002soc.1		OTTHUMG00000152978		2.37:g.79363132C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000444841.1	37	NULL		2																																																																																			REG1P	-	-	ENSG00000204787		0.517	REG1P-002	KNOWN	basic	processed_transcript	REG1P	HGNC	pseudogene	OTTHUMT00000328851.1	54	0.00	0	C	NR_002714		79363132	79363132	-1	no_errors	ENST00000377435	ensembl	human	known	69_37n	rna	36	25.00	12	SNP	0.000	T
REG1P	5969	genome.wustl.edu	37	2	79363132	79363132	+	RNA	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr2:79363132C>T	ENST00000444841.1	-	0	1206									regenerating islet-derived 1 pseudogene																		AGTATTGGCACAGCTTGGGGA	0.517																																						dbGAP											0																																										-	-	-			0					2p12	2008-06-04	2008-06-04	2008-06-04	ENSG00000204787	ENSG00000204787			9953	pseudogene	pseudogene			"""rat regenerating islet-derived-like, human homolog (pancreatic stone protein-like, pancreatic thread protein-like)"", ""regenerating islet-derived-like, pancreatic stone protein-like, pancreatic thread protein-like (rat)"""	REGL		8333731	Standard	NR_002714		Approved	RS	uc002soc.1		OTTHUMG00000152978		2.37:g.79363132C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000444841.1	37	NULL		2																																																																																			REG1P	-	-	ENSG00000204787		0.517	REG1P-002	KNOWN	basic	processed_transcript	REG1P	HGNC	pseudogene	OTTHUMT00000328851.1	76	0.00	0	C	NR_002714		79363132	79363132	-1	no_errors	ENST00000377435	ensembl	human	known	69_37n	rna	36	25.00	12	SNP	0.000	T
RET	5979	genome.wustl.edu	37	10	43597801	43597801	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr10:43597801C>A	ENST00000355710.3	+	3	581	c.349C>A	c.(349-351)Ccc>Acc	p.P117T	RET_ENST00000340058.5_Missense_Mutation_p.P117T	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	117					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P117T(1)	CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCGCGGCTTTCCCCTGCTCAC	0.627		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	dbGAP	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	1	Substitution - Missense(1)	breast(1)											113.0	101.0	105.0					10																	43597801		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.349C>A	10.37:g.43597801C>A	ENSP00000347942:p.Pro117Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Cadherin	p.P117T	ENST00000355710.3	37	c.349	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	C	11.94	1.789225	0.31685	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.79247	-1.14;-1.25	5.09	4.19	0.49359	.	0.225919	0.47455	D	0.000236	T	0.74329	0.3702	L	0.56769	1.78	0.37270	D	0.907365	P;P	0.43352	0.804;0.768	B;B	0.42851	0.4;0.293	T	0.78540	-0.2165	10	0.72032	D	0.01	.	9.2043	0.37280	0.0:0.8997:0.0:0.1003	.	117;117	P07949;P07949-2	RET_HUMAN;.	T	117	ENSP00000347942:P117T;ENSP00000344798:P117T	ENSP00000344798:P117T	P	+	1	0	RET	42917807	0.932000	0.31603	0.988000	0.46212	0.046000	0.14306	1.559000	0.36320	1.135000	0.42183	0.655000	0.94253	CCC	RET	-	pirsf_Tyr_kinase_Ret_rcpt	ENSG00000165731		0.627	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	118	0.00	0	C	NM_020975		43597801	43597801	+1	no_errors	ENST00000355710	ensembl	human	known	69_37n	missense	41	12.50	6	SNP	0.993	A
RET	5979	genome.wustl.edu	37	10	43597801	43597801	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr10:43597801C>A	ENST00000355710.3	+	3	581	c.349C>A	c.(349-351)Ccc>Acc	p.P117T	RET_ENST00000340058.5_Missense_Mutation_p.P117T	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	117					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P117T(1)	CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCGCGGCTTTCCCCTGCTCAC	0.627		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	dbGAP	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	1	Substitution - Missense(1)	breast(1)											113.0	101.0	105.0					10																	43597801		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.349C>A	10.37:g.43597801C>A	ENSP00000347942:p.Pro117Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Cadherin	p.P117T	ENST00000355710.3	37	c.349	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	C	11.94	1.789225	0.31685	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.79247	-1.14;-1.25	5.09	4.19	0.49359	.	0.225919	0.47455	D	0.000236	T	0.74329	0.3702	L	0.56769	1.78	0.37270	D	0.907365	P;P	0.43352	0.804;0.768	B;B	0.42851	0.4;0.293	T	0.78540	-0.2165	10	0.72032	D	0.01	.	9.2043	0.37280	0.0:0.8997:0.0:0.1003	.	117;117	P07949;P07949-2	RET_HUMAN;.	T	117	ENSP00000347942:P117T;ENSP00000344798:P117T	ENSP00000344798:P117T	P	+	1	0	RET	42917807	0.932000	0.31603	0.988000	0.46212	0.046000	0.14306	1.559000	0.36320	1.135000	0.42183	0.655000	0.94253	CCC	RET	-	pirsf_Tyr_kinase_Ret_rcpt	ENSG00000165731		0.627	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	64	0.00	0	C	NM_020975		43597801	43597801	+1	no_errors	ENST00000355710	ensembl	human	known	69_37n	missense	41	12.50	6	SNP	0.993	A
RGS4	5999	genome.wustl.edu	37	1	163044344	163044344	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:163044344T>A	ENST00000367909.6	+	5	952	c.612T>A	c.(610-612)tgT>tgA	p.C204*	RGS4_ENST00000367908.4_3'UTR|RGS4_ENST00000527809.1_Nonsense_Mutation_p.C186*|RGS4_ENST00000421743.2_Nonsense_Mutation_p.C301*|RGS4_ENST00000531057.1_Intron|RGS4_ENST00000367906.3_Nonsense_Mutation_p.C186*|RGS4_ENST00000491263.1_3'UTR	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	204					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.C204*(1)|p.C301*(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TCCCTCAGTGTGCCTAATTCT	0.483																																					Ovarian(76;1257 1738 3039 6086)	dbGAP											2	Substitution - Nonsense(2)	breast(2)											103.0	109.0	107.0					1																	163044344		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.612T>A	1.37:g.163044344T>A	ENSP00000356885:p.Cys204*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.C301*	ENST00000367909.6	37	c.903	CCDS1243.1	1	.	.	.	.	.	.	.	.	.	.	T	37	6.164982	0.97338	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000527809;ENST00000367906	.	.	.	5.11	-9.03E-4	0.14036	.	2.736950	0.00669	N	0.000636	.	.	.	.	.	.	0.31318	N	0.686313	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4354	0.32784	0.0:0.3623:0.0:0.6377	.	.	.	.	X	301;204;186;186	.	ENSP00000356882:C186X	C	+	3	2	RGS4	161310968	0.091000	0.21658	0.987000	0.45799	0.767000	0.43475	-0.987000	0.03743	-0.154000	0.11118	0.533000	0.62120	TGT	RGS4	-	NULL	ENSG00000117152		0.483	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	328	0.00	0	T	NM_005613		163044344	163044344	+1	no_errors	ENST00000421743	ensembl	human	known	69_37n	nonsense	252	23.10	76	SNP	0.987	A
RGS4	5999	genome.wustl.edu	37	1	163044344	163044344	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:163044344T>A	ENST00000367909.6	+	5	952	c.612T>A	c.(610-612)tgT>tgA	p.C204*	RGS4_ENST00000367908.4_3'UTR|RGS4_ENST00000527809.1_Nonsense_Mutation_p.C186*|RGS4_ENST00000421743.2_Nonsense_Mutation_p.C301*|RGS4_ENST00000531057.1_Intron|RGS4_ENST00000367906.3_Nonsense_Mutation_p.C186*|RGS4_ENST00000491263.1_3'UTR	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	204					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.C204*(1)|p.C301*(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TCCCTCAGTGTGCCTAATTCT	0.483																																					Ovarian(76;1257 1738 3039 6086)	dbGAP											2	Substitution - Nonsense(2)	breast(2)											103.0	109.0	107.0					1																	163044344		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.612T>A	1.37:g.163044344T>A	ENSP00000356885:p.Cys204*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.C301*	ENST00000367909.6	37	c.903	CCDS1243.1	1	.	.	.	.	.	.	.	.	.	.	T	37	6.164982	0.97338	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000527809;ENST00000367906	.	.	.	5.11	-9.03E-4	0.14036	.	2.736950	0.00669	N	0.000636	.	.	.	.	.	.	0.31318	N	0.686313	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4354	0.32784	0.0:0.3623:0.0:0.6377	.	.	.	.	X	301;204;186;186	.	ENSP00000356882:C186X	C	+	3	2	RGS4	161310968	0.091000	0.21658	0.987000	0.45799	0.767000	0.43475	-0.987000	0.03743	-0.154000	0.11118	0.533000	0.62120	TGT	RGS4	-	NULL	ENSG00000117152		0.483	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	529	0.00	0	T	NM_005613		163044344	163044344	+1	no_errors	ENST00000421743	ensembl	human	known	69_37n	nonsense	252	23.10	76	SNP	0.987	A
SEMA5A	9037	genome.wustl.edu	37	5	9197331	9197331	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr5:9197331T>A	ENST00000382496.5	-	10	1682	c.1017A>T	c.(1015-1017)gaA>gaT	p.E339D		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	339	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.E339D(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						AGCGCGAGTTTTCTTGGTACT	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	90.0	90.0					5																	9197331		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1017A>T	5.37:g.9197331T>A	ENSP00000371936:p.Glu339Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.E339D	ENST00000382496.5	37	c.1017	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	t	25.0	4.587821	0.86851	.	.	ENSG00000112902	ENST00000382496	T	0.13089	2.62	5.28	1.4	0.22301	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	L	0.52364	1.645	0.53688	D	0.999972	D	0.89917	1.0	D	0.78314	0.991	T	0.00485	-1.1711	10	0.49607	T	0.09	.	9.9503	0.41634	0.0:0.6856:0.0:0.3144	.	339	Q13591	SEM5A_HUMAN	D	339	ENSP00000371936:E339D	ENSP00000371936:E339D	E	-	3	2	SEMA5A	9250331	0.998000	0.40836	1.000000	0.80357	0.982000	0.71751	0.665000	0.25083	0.293000	0.22520	-0.198000	0.12761	GAA	SEMA5A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000112902		0.597	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	88	0.00	0	T			9197331	9197331	-1	no_errors	ENST00000382496	ensembl	human	known	69_37n	missense	54	27.03	20	SNP	1.000	A
SEMA5A	9037	genome.wustl.edu	37	5	9197331	9197331	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr5:9197331T>A	ENST00000382496.5	-	10	1682	c.1017A>T	c.(1015-1017)gaA>gaT	p.E339D		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	339	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.E339D(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						AGCGCGAGTTTTCTTGGTACT	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	90.0	90.0					5																	9197331		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1017A>T	5.37:g.9197331T>A	ENSP00000371936:p.Glu339Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.E339D	ENST00000382496.5	37	c.1017	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	t	25.0	4.587821	0.86851	.	.	ENSG00000112902	ENST00000382496	T	0.13089	2.62	5.28	1.4	0.22301	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	L	0.52364	1.645	0.53688	D	0.999972	D	0.89917	1.0	D	0.78314	0.991	T	0.00485	-1.1711	10	0.49607	T	0.09	.	9.9503	0.41634	0.0:0.6856:0.0:0.3144	.	339	Q13591	SEM5A_HUMAN	D	339	ENSP00000371936:E339D	ENSP00000371936:E339D	E	-	3	2	SEMA5A	9250331	0.998000	0.40836	1.000000	0.80357	0.982000	0.71751	0.665000	0.25083	0.293000	0.22520	-0.198000	0.12761	GAA	SEMA5A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000112902		0.597	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	30	0.00	0	T			9197331	9197331	-1	no_errors	ENST00000382496	ensembl	human	known	69_37n	missense	54	27.03	20	SNP	1.000	A
SMYD4	114826	genome.wustl.edu	37	17	1703856	1703856	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr17:1703856G>C	ENST00000305513.7	-	5	999	c.832C>G	c.(832-834)Cat>Gat	p.H278D		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	278	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.H278D(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						AGGCCGTGATGCGGTGGTGGC	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	140.0	145.0					17																	1703856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.832C>G	17.37:g.1703856G>C	ENSP00000304360:p.His278Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.H278D	ENST00000305513.7	37	c.832	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	G	7.625	0.677538	0.14841	.	.	ENSG00000186532	ENST00000305513	T	0.10382	2.88	5.84	3.86	0.44501	SET domain (2);	0.847685	0.11358	N	0.572199	T	0.14700	0.0355	M	0.65975	2.015	0.09310	N	1	P	0.36282	0.546	B	0.39027	0.288	T	0.18618	-1.0331	10	0.39692	T	0.17	0.1644	7.0061	0.24838	0.1427:0.0:0.7184:0.1389	.	278	Q8IYR2	SMYD4_HUMAN	D	278	ENSP00000304360:H278D	ENSP00000304360:H278D	H	-	1	0	SMYD4	1650606	0.017000	0.18338	0.001000	0.08648	0.255000	0.26057	2.006000	0.40874	0.813000	0.34350	0.655000	0.94253	CAT	SMYD4	-	pfam_SET_dom	ENSG00000186532		0.537	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	103	0.00	0	G	XM_056082		1703856	1703856	-1	no_errors	ENST00000305513	ensembl	human	known	69_37n	missense	99	10.00	11	SNP	0.000	C
SMYD4	114826	genome.wustl.edu	37	17	1703856	1703856	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr17:1703856G>C	ENST00000305513.7	-	5	999	c.832C>G	c.(832-834)Cat>Gat	p.H278D		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	278	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.H278D(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						AGGCCGTGATGCGGTGGTGGC	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	140.0	145.0					17																	1703856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.832C>G	17.37:g.1703856G>C	ENSP00000304360:p.His278Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.H278D	ENST00000305513.7	37	c.832	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	G	7.625	0.677538	0.14841	.	.	ENSG00000186532	ENST00000305513	T	0.10382	2.88	5.84	3.86	0.44501	SET domain (2);	0.847685	0.11358	N	0.572199	T	0.14700	0.0355	M	0.65975	2.015	0.09310	N	1	P	0.36282	0.546	B	0.39027	0.288	T	0.18618	-1.0331	10	0.39692	T	0.17	0.1644	7.0061	0.24838	0.1427:0.0:0.7184:0.1389	.	278	Q8IYR2	SMYD4_HUMAN	D	278	ENSP00000304360:H278D	ENSP00000304360:H278D	H	-	1	0	SMYD4	1650606	0.017000	0.18338	0.001000	0.08648	0.255000	0.26057	2.006000	0.40874	0.813000	0.34350	0.655000	0.94253	CAT	SMYD4	-	pfam_SET_dom	ENSG00000186532		0.537	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	145	0.00	0	G	XM_056082		1703856	1703856	-1	no_errors	ENST00000305513	ensembl	human	known	69_37n	missense	99	10.00	11	SNP	0.000	C
SORBS3	10174	genome.wustl.edu	37	8	22419432	22419432	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr8:22419432C>A	ENST00000240123.7	+	7	955	c.572C>A	c.(571-573)aCa>aAa	p.T191K		NM_005775.4	NP_005766.3	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3	191					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of stress fiber assembly (GO:0051496)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.T191K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)	18		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GGCCCGGCAACATCTTCCAGT	0.687											OREG0018612	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	43.0	42.0					8																	22419432		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6031.1	8p21.3	2008-02-05			ENSG00000120896	ENSG00000120896			30907	protein-coding gene	gene with protein product		610795				9885244, 12510380	Standard	NM_001018003		Approved	SCAM-1, SH3D4, vinexin	uc003xbv.3	O60504	OTTHUMG00000131728	ENST00000240123.7:c.572C>A	8.37:g.22419432C>A	ENSP00000240123:p.Thr191Lys	Somatic	756	WXS	Illumina GAIIx	Phase_IV	Q5BJE4|Q6NX54|Q96FY4|Q9UQE4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.T191K	ENST00000240123.7	37	c.572	CCDS6031.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.847|8.847	0.943646|0.943646	0.18281|0.18281	.|.	.|.	ENSG00000120896|ENSG00000120896	ENST00000524057|ENST00000240123	.|T	.|0.05786	.|3.39	4.63|4.63	-0.591|-0.591	0.11675|0.11675	.|.	.|0.817581	.|0.10068	.|N	.|0.720073	T|T	0.02649|0.02649	0.0080|0.0080	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999996|0.999996	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.45659|0.45659	-0.9246|-0.9246	5|10	.|0.31617	.|T	.|0.26	0.0|0.0	1.5106|1.5106	0.02495|0.02495	0.1553:0.302:0.345:0.1977|0.1553:0.302:0.345:0.1977	.|.	.|191	.|O60504	.|VINEX_HUMAN	K|K	127|191	.|ENSP00000240123:T191K	.|ENSP00000240123:T191K	N|T	+|+	3|2	2|0	SORBS3|SORBS3	22475377|22475377	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	0.006000|0.006000	0.13152|0.13152	-0.026000|-0.026000	0.13895|0.13895	0.561000|0.561000	0.74099|0.74099	AAC|ACA	SORBS3	-	NULL	ENSG00000120896		0.687	SORBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORBS3	HGNC	protein_coding	OTTHUMT00000254647.3	24	0.00	0	C	NM_005775		22419432	22419432	+1	no_errors	ENST00000240123	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.000	A
SORBS3	10174	genome.wustl.edu	37	8	22419432	22419432	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr8:22419432C>A	ENST00000240123.7	+	7	955	c.572C>A	c.(571-573)aCa>aAa	p.T191K		NM_005775.4	NP_005766.3	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3	191					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of stress fiber assembly (GO:0051496)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.T191K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)	18		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GGCCCGGCAACATCTTCCAGT	0.687											OREG0018612	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	43.0	42.0					8																	22419432		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6031.1	8p21.3	2008-02-05			ENSG00000120896	ENSG00000120896			30907	protein-coding gene	gene with protein product		610795				9885244, 12510380	Standard	NM_001018003		Approved	SCAM-1, SH3D4, vinexin	uc003xbv.3	O60504	OTTHUMG00000131728	ENST00000240123.7:c.572C>A	8.37:g.22419432C>A	ENSP00000240123:p.Thr191Lys	Somatic	756	WXS	Illumina GAIIx	Phase_IV	Q5BJE4|Q6NX54|Q96FY4|Q9UQE4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.T191K	ENST00000240123.7	37	c.572	CCDS6031.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.847|8.847	0.943646|0.943646	0.18281|0.18281	.|.	.|.	ENSG00000120896|ENSG00000120896	ENST00000524057|ENST00000240123	.|T	.|0.05786	.|3.39	4.63|4.63	-0.591|-0.591	0.11675|0.11675	.|.	.|0.817581	.|0.10068	.|N	.|0.720073	T|T	0.02649|0.02649	0.0080|0.0080	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999996|0.999996	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.45659|0.45659	-0.9246|-0.9246	5|10	.|0.31617	.|T	.|0.26	0.0|0.0	1.5106|1.5106	0.02495|0.02495	0.1553:0.302:0.345:0.1977|0.1553:0.302:0.345:0.1977	.|.	.|191	.|O60504	.|VINEX_HUMAN	K|K	127|191	.|ENSP00000240123:T191K	.|ENSP00000240123:T191K	N|T	+|+	3|2	2|0	SORBS3|SORBS3	22475377|22475377	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	0.006000|0.006000	0.13152|0.13152	-0.026000|-0.026000	0.13895|0.13895	0.561000|0.561000	0.74099|0.74099	AAC|ACA	SORBS3	-	NULL	ENSG00000120896		0.687	SORBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORBS3	HGNC	protein_coding	OTTHUMT00000254647.3	11	0.00	0	C	NM_005775		22419432	22419432	+1	no_errors	ENST00000240123	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.000	A
SPPL3	121665	genome.wustl.edu	37	12	121248611	121248612	+	Splice_Site	DNP	CC	CC	AA			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr12:121248611_121248612CC>AA	ENST00000353487.2	-	2	604_605	c.101_102GG>TT	c.(100-102)aGG>aTT	p.R34I		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	34						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.R34K(1)				all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAATATCTTACCTGAAACTACC	0.391																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)																																								-	-	-	SO:0001630	splice_region_variant	0				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.101_102delinsAA	12.37:g.121248611_121248612delinsAA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJ04|Q8TAU4|Q96DD9	Splice_Site|Missense_Mutation	SNP	-|pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	e2+1|p.R34M	ENST00000353487.2	37	c.101+1|c.101	CCDS9208.1	12																																																																																			SPPL3	-	-|NULL	ENSG00000157837		0.391	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL3	HGNC	protein_coding	OTTHUMT00000402980.2	224|221	0.00	0	C	NM_139015	Missense_Mutation	121248611|121248612	121248611|121248612	-1	no_errors	ENST00000353487	ensembl	human	known	69_37n	splice_site|missense	168|169	23.98|24.22	53|54	SNP	1.000	A
SPPL3	121665	genome.wustl.edu	37	12	121248611	121248612	+	Splice_Site	DNP	CC	CC	AA			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr12:121248611_121248612CC>AA	ENST00000353487.2	-	2	604_605	c.101_102GG>TT	c.(100-102)aGG>aTT	p.R34I		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	34						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.R34K(1)				all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAATATCTTACCTGAAACTACC	0.391																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)																																								-	-	-	SO:0001630	splice_region_variant	0				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.101_102delinsAA	12.37:g.121248611_121248612delinsAA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJ04|Q8TAU4|Q96DD9	Splice_Site|Missense_Mutation	SNP	-|pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	e2+1|p.R34M	ENST00000353487.2	37	c.101+1|c.101	CCDS9208.1	12																																																																																			SPPL3	-	-|NULL	ENSG00000157837		0.391	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL3	HGNC	protein_coding	OTTHUMT00000402980.2	167|166	0.00	0	C	NM_139015	Missense_Mutation	121248611|121248612	121248611|121248612	-1	no_errors	ENST00000353487	ensembl	human	known	69_37n	splice_site|missense	168|169	23.98|24.22	53|54	SNP	1.000	A
STX11	8676	genome.wustl.edu	37	6	144507849	144507849	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr6:144507849C>A	ENST00000367568.4	+	2	268	c.85C>A	c.(85-87)Ccc>Acc	p.P29T		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	29					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)	p.P29T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		GTTTGACTCGCCCCACGAGGA	0.547									Familial Hemophagocytic Lymphohistiocytosis																													dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	58.0	60.0					6																	144507849		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.85C>A	6.37:g.144507849C>A	ENSP00000356540:p.Pro29Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P598|O75378|O95148|Q5TCL6	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.P29T	ENST00000367568.4	37	c.85	CCDS5205.1	6	.	.	.	.	.	.	.	.	.	.	C	3.456	-0.111069	0.06881	.	.	ENSG00000135604	ENST00000367568	T	0.41400	1.0	5.85	1.04	0.20106	.	0.803134	0.11708	N	0.537193	T	0.07324	0.0185	N	0.08118	0	0.09310	N	1	B	0.18310	0.027	B	0.17098	0.017	T	0.34354	-0.9832	10	0.30854	T	0.27	-24.1548	5.4243	0.16417	0.1074:0.4493:0.3305:0.1128	.	29	O75558	STX11_HUMAN	T	29	ENSP00000356540:P29T	ENSP00000356540:P29T	P	+	1	0	STX11	144549542	0.000000	0.05858	0.025000	0.17156	0.399000	0.30720	0.320000	0.19540	0.768000	0.33290	-0.311000	0.09066	CCC	STX11	-	NULL	ENSG00000135604		0.547	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX11	HGNC	protein_coding	OTTHUMT00000042544.1	77	0.00	0	C			144507849	144507849	+1	no_errors	ENST00000367568	ensembl	human	known	69_37n	missense	68	28.12	27	SNP	0.000	A
STX11	8676	genome.wustl.edu	37	6	144507849	144507849	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr6:144507849C>A	ENST00000367568.4	+	2	268	c.85C>A	c.(85-87)Ccc>Acc	p.P29T		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	29					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)	p.P29T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		GTTTGACTCGCCCCACGAGGA	0.547									Familial Hemophagocytic Lymphohistiocytosis																													dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	58.0	60.0					6																	144507849		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.85C>A	6.37:g.144507849C>A	ENSP00000356540:p.Pro29Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P598|O75378|O95148|Q5TCL6	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.P29T	ENST00000367568.4	37	c.85	CCDS5205.1	6	.	.	.	.	.	.	.	.	.	.	C	3.456	-0.111069	0.06881	.	.	ENSG00000135604	ENST00000367568	T	0.41400	1.0	5.85	1.04	0.20106	.	0.803134	0.11708	N	0.537193	T	0.07324	0.0185	N	0.08118	0	0.09310	N	1	B	0.18310	0.027	B	0.17098	0.017	T	0.34354	-0.9832	10	0.30854	T	0.27	-24.1548	5.4243	0.16417	0.1074:0.4493:0.3305:0.1128	.	29	O75558	STX11_HUMAN	T	29	ENSP00000356540:P29T	ENSP00000356540:P29T	P	+	1	0	STX11	144549542	0.000000	0.05858	0.025000	0.17156	0.399000	0.30720	0.320000	0.19540	0.768000	0.33290	-0.311000	0.09066	CCC	STX11	-	NULL	ENSG00000135604		0.547	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX11	HGNC	protein_coding	OTTHUMT00000042544.1	20	0.00	0	C			144507849	144507849	+1	no_errors	ENST00000367568	ensembl	human	known	69_37n	missense	68	28.12	27	SNP	0.000	A
TACC1	6867	genome.wustl.edu	37	8	38677317	38677317	+	Silent	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr8:38677317C>A	ENST00000317827.4	+	3	934	c.555C>A	c.(553-555)tcC>tcA	p.S185S	TACC1_ENST00000520340.1_Silent_p.S149S|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000518415.1_Silent_p.S140S|TACC1_ENST00000519416.1_5'UTR|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000443286.2_Silent_p.S201S|TACC1_ENST00000379931.3_Silent_p.S185S|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000520973.1_5'UTR|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000520615.1_5'UTR	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	185	Interaction with TDRD7.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.S185S(2)		breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			CTCTGCCTTCCAGCCCGCCAG	0.567																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											61.0	65.0	64.0					8																	38677317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.555C>A	8.37:g.38677317C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Silent	SNP	pfam_TACC	p.S185	ENST00000317827.4	37	c.555	CCDS6109.1	8																																																																																			TACC1	-	NULL	ENSG00000147526		0.567	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TACC1	HGNC	protein_coding	OTTHUMT00000376768.1	120	0.00	0	C	NM_006283		38677317	38677317	+1	no_errors	ENST00000379931	ensembl	human	known	69_37n	silent	70	23.91	22	SNP	0.001	A
TACC1	6867	genome.wustl.edu	37	8	38677317	38677317	+	Silent	SNP	C	C	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr8:38677317C>A	ENST00000317827.4	+	3	934	c.555C>A	c.(553-555)tcC>tcA	p.S185S	TACC1_ENST00000520340.1_Silent_p.S149S|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000518415.1_Silent_p.S140S|TACC1_ENST00000519416.1_5'UTR|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000443286.2_Silent_p.S201S|TACC1_ENST00000379931.3_Silent_p.S185S|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000520973.1_5'UTR|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000520615.1_5'UTR	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	185	Interaction with TDRD7.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.S185S(2)		breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			CTCTGCCTTCCAGCCCGCCAG	0.567																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											61.0	65.0	64.0					8																	38677317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.555C>A	8.37:g.38677317C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Silent	SNP	pfam_TACC	p.S185	ENST00000317827.4	37	c.555	CCDS6109.1	8																																																																																			TACC1	-	NULL	ENSG00000147526		0.567	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TACC1	HGNC	protein_coding	OTTHUMT00000376768.1	43	0.00	0	C	NM_006283		38677317	38677317	+1	no_errors	ENST00000379931	ensembl	human	known	69_37n	silent	70	23.91	22	SNP	0.001	A
TAF1L	138474	genome.wustl.edu	37	9	32633233	32633233	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr9:32633233A>T	ENST00000242310.4	-	1	2434	c.2345T>A	c.(2344-2346)cTg>cAg	p.L782Q	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	782					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.L782Q(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CCGAATGATCAGAAAATCAGT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											197.0	193.0	194.0					9																	32633233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2345T>A	9.37:g.32633233A>T	ENSP00000418379:p.Leu782Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L782Q	ENST00000242310.4	37	c.2345	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	A	11.56	1.676373	0.29783	.	.	ENSG00000122728	ENST00000242310	T	0.32515	1.45	1.19	1.19	0.21007	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.070422	0.64402	D	0.000016	T	0.59959	0.2232	H	0.95187	3.635	0.53688	D	0.999971	D	0.89917	1.0	D	0.79108	0.992	T	0.61544	-0.7041	10	0.87932	D	0	.	6.1457	0.20285	1.0:0.0:0.0:0.0	.	782	Q8IZX4	TAF1L_HUMAN	Q	782	ENSP00000418379:L782Q	ENSP00000418379:L782Q	L	-	2	0	TAF1L	32623233	1.000000	0.71417	0.644000	0.29465	0.365000	0.29674	5.824000	0.69279	0.530000	0.28619	0.164000	0.16699	CTG	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000122728		0.453	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	235	0.00	0	A			32633233	32633233	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	missense	214	15.08	38	SNP	1.000	T
TAF1L	138474	genome.wustl.edu	37	9	32633233	32633233	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr9:32633233A>T	ENST00000242310.4	-	1	2434	c.2345T>A	c.(2344-2346)cTg>cAg	p.L782Q	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	782					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.L782Q(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CCGAATGATCAGAAAATCAGT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											197.0	193.0	194.0					9																	32633233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2345T>A	9.37:g.32633233A>T	ENSP00000418379:p.Leu782Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L782Q	ENST00000242310.4	37	c.2345	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	A	11.56	1.676373	0.29783	.	.	ENSG00000122728	ENST00000242310	T	0.32515	1.45	1.19	1.19	0.21007	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.070422	0.64402	D	0.000016	T	0.59959	0.2232	H	0.95187	3.635	0.53688	D	0.999971	D	0.89917	1.0	D	0.79108	0.992	T	0.61544	-0.7041	10	0.87932	D	0	.	6.1457	0.20285	1.0:0.0:0.0:0.0	.	782	Q8IZX4	TAF1L_HUMAN	Q	782	ENSP00000418379:L782Q	ENSP00000418379:L782Q	L	-	2	0	TAF1L	32623233	1.000000	0.71417	0.644000	0.29465	0.365000	0.29674	5.824000	0.69279	0.530000	0.28619	0.164000	0.16699	CTG	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000122728		0.453	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	242	0.00	0	A			32633233	32633233	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	missense	214	15.08	38	SNP	1.000	T
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	36	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	45	18.18	10	SNP	0.994	A
THOC5	8563	genome.wustl.edu	37	22	29945112	29945112	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr22:29945112G>C	ENST00000490103.1	-	2	147	c.25C>G	c.(25-27)Cgg>Ggg	p.R9G	THOC5_ENST00000397871.1_Missense_Mutation_p.R9G|THOC5_ENST00000397873.2_Missense_Mutation_p.R9G|THOC5_ENST00000397872.1_Missense_Mutation_p.R9G	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	9	Interaction with CSF1R. {ECO:0000250}.|Interaction with THOC7.				blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)	p.R9G(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTGGGCTTCCGTTTTTTGCTC	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											223.0	163.0	183.0					22																	29945112		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.25C>G	22.37:g.29945112G>C	ENSP00000420306:p.Arg9Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O60839|Q9UPZ5	Missense_Mutation	SNP	pfam_THO_Thoc5	p.R9G	ENST00000490103.1	37	c.25	CCDS13859.1	22	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136577	0.77662	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873;ENST00000440771;ENST00000428374;ENST00000418021	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.71	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.52980	0.1768	M	0.74258	2.255	0.54753	D	0.999985	D	0.67145	0.996	D	0.64321	0.924	T	0.59064	-0.7524	10	0.87932	D	0	-16.3822	13.9278	0.63972	0.0:0.0:0.611:0.389	.	9	Q13769	THOC5_HUMAN	G	9	ENSP00000420306:R9G;ENSP00000380970:R9G;ENSP00000380969:R9G;ENSP00000380971:R9G	ENSP00000444493:R9G	R	-	1	2	THOC5	28275112	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.155000	0.42301	1.384000	0.46424	0.655000	0.94253	CGG	THOC5	-	NULL	ENSG00000100296		0.478	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC5	HGNC	protein_coding	OTTHUMT00000322097.1	152	0.00	0	G	NM_003678		29945112	29945112	-1	no_errors	ENST00000397871	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	1.000	C
THOC5	8563	genome.wustl.edu	37	22	29945112	29945112	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr22:29945112G>C	ENST00000490103.1	-	2	147	c.25C>G	c.(25-27)Cgg>Ggg	p.R9G	THOC5_ENST00000397871.1_Missense_Mutation_p.R9G|THOC5_ENST00000397873.2_Missense_Mutation_p.R9G|THOC5_ENST00000397872.1_Missense_Mutation_p.R9G	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	9	Interaction with CSF1R. {ECO:0000250}.|Interaction with THOC7.				blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)	p.R9G(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTGGGCTTCCGTTTTTTGCTC	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											223.0	163.0	183.0					22																	29945112		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.25C>G	22.37:g.29945112G>C	ENSP00000420306:p.Arg9Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O60839|Q9UPZ5	Missense_Mutation	SNP	pfam_THO_Thoc5	p.R9G	ENST00000490103.1	37	c.25	CCDS13859.1	22	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136577	0.77662	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873;ENST00000440771;ENST00000428374;ENST00000418021	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.71	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.52980	0.1768	M	0.74258	2.255	0.54753	D	0.999985	D	0.67145	0.996	D	0.64321	0.924	T	0.59064	-0.7524	10	0.87932	D	0	-16.3822	13.9278	0.63972	0.0:0.0:0.611:0.389	.	9	Q13769	THOC5_HUMAN	G	9	ENSP00000420306:R9G;ENSP00000380970:R9G;ENSP00000380969:R9G;ENSP00000380971:R9G	ENSP00000444493:R9G	R	-	1	2	THOC5	28275112	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.155000	0.42301	1.384000	0.46424	0.655000	0.94253	CGG	THOC5	-	NULL	ENSG00000100296		0.478	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC5	HGNC	protein_coding	OTTHUMT00000322097.1	75	0.00	0	G	NM_003678		29945112	29945112	-1	no_errors	ENST00000397871	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7579359	7579359	+	Frame_Shift_Del	DEL	G	G	-	rs587781371|rs587780066		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr17:7579359delG	ENST00000269305.4	-	4	517	c.328delC	c.(328-330)cgtfs	p.R110fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.R110fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.R110fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.R110fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.R110fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.R110fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	110	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|R -> P (in sporadic cancers; somatic mutation; dbSNP:rs11540654). {ECO:0000269|PubMed:17224074}.|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R110fs*13(9)|p.0?(8)|p.R110C(7)|p.G59fs*23(3)|p.F109_R110delFR(2)|p.V73fs*9(1)|p.F109_R110insXX(1)|p.G105_T125del21(1)|p.R110fs*18(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.R110S(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAGCCCAGACGGAAACCGTAG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	41	Deletion - Frameshift(17)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(3)|Insertion - Frameshift(2)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(11)|upper_aerodigestive_tract(4)|bone(4)|large_intestine(3)|lung(3)|NS(3)|prostate(3)|central_nervous_system(2)|liver(2)|skin(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|salivary_gland(1)|oesophagus(1)											62.0	59.0	60.0					17																	7579359		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.328delC	17.37:g.7579359delG	ENSP00000269305:p.Arg110fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R110fs	ENST00000269305.4	37	c.328	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	200	0.00	0	G	NM_000546		7579359	7579359	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	146	31.31	67	DEL	0.028	-
TP53	7157	genome.wustl.edu	37	17	7579359	7579359	+	Frame_Shift_Del	DEL	G	G	-	rs587781371|rs587780066		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr17:7579359delG	ENST00000269305.4	-	4	517	c.328delC	c.(328-330)cgtfs	p.R110fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.R110fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.R110fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.R110fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.R110fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.R110fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	110	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|R -> P (in sporadic cancers; somatic mutation; dbSNP:rs11540654). {ECO:0000269|PubMed:17224074}.|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R110fs*13(9)|p.0?(8)|p.R110C(7)|p.G59fs*23(3)|p.F109_R110delFR(2)|p.V73fs*9(1)|p.F109_R110insXX(1)|p.G105_T125del21(1)|p.R110fs*18(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.R110S(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAGCCCAGACGGAAACCGTAG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	41	Deletion - Frameshift(17)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(3)|Insertion - Frameshift(2)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(11)|upper_aerodigestive_tract(4)|bone(4)|large_intestine(3)|lung(3)|NS(3)|prostate(3)|central_nervous_system(2)|liver(2)|skin(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|salivary_gland(1)|oesophagus(1)											62.0	59.0	60.0					17																	7579359		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.328delC	17.37:g.7579359delG	ENSP00000269305:p.Arg110fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R110fs	ENST00000269305.4	37	c.328	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	212	0.00	0	G	NM_000546		7579359	7579359	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	146	31.31	67	DEL	0.028	-
TRAPPC10	7109	genome.wustl.edu	37	21	45499985	45499985	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr21:45499985C>T	ENST00000291574.4	+	13	1875	c.1700C>T	c.(1699-1701)gCc>gTc	p.A567V		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	567					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)	p.A567V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						CTTGACTTTGCCAGCCAGCCG	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	51.0	54.0					21																	45499985		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1700C>T	21.37:g.45499985C>T	ENSP00000291574:p.Ala567Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	NULL	p.A567V	ENST00000291574.4	37	c.1700	CCDS13704.1	21	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126968	0.56721	.	.	ENSG00000160218	ENST00000291574	T	0.45276	0.9	5.58	5.58	0.84498	.	0.101984	0.64402	D	0.000003	T	0.28732	0.0712	N	0.14661	0.345	0.58432	D	0.999997	B	0.31680	0.335	B	0.28139	0.086	T	0.06180	-1.0841	10	0.23302	T	0.38	.	19.1791	0.93615	0.0:1.0:0.0:0.0	.	567	P48553	TPC10_HUMAN	V	567	ENSP00000291574:A567V	ENSP00000291574:A567V	A	+	2	0	TRAPPC10	44324413	1.000000	0.71417	0.993000	0.49108	0.312000	0.27988	4.341000	0.59335	2.622000	0.88805	0.655000	0.94253	GCC	TRAPPC10	-	NULL	ENSG00000160218		0.473	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TRAPPC10	HGNC	protein_coding	OTTHUMT00000195737.1	141	0.00	0	C	NM_003274		45499985	45499985	+1	no_errors	ENST00000291574	ensembl	human	known	69_37n	missense	87	12.00	12	SNP	1.000	T
TRAPPC10	7109	genome.wustl.edu	37	21	45499985	45499985	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr21:45499985C>T	ENST00000291574.4	+	13	1875	c.1700C>T	c.(1699-1701)gCc>gTc	p.A567V		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	567					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)	p.A567V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						CTTGACTTTGCCAGCCAGCCG	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	51.0	54.0					21																	45499985		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1700C>T	21.37:g.45499985C>T	ENSP00000291574:p.Ala567Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	NULL	p.A567V	ENST00000291574.4	37	c.1700	CCDS13704.1	21	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126968	0.56721	.	.	ENSG00000160218	ENST00000291574	T	0.45276	0.9	5.58	5.58	0.84498	.	0.101984	0.64402	D	0.000003	T	0.28732	0.0712	N	0.14661	0.345	0.58432	D	0.999997	B	0.31680	0.335	B	0.28139	0.086	T	0.06180	-1.0841	10	0.23302	T	0.38	.	19.1791	0.93615	0.0:1.0:0.0:0.0	.	567	P48553	TPC10_HUMAN	V	567	ENSP00000291574:A567V	ENSP00000291574:A567V	A	+	2	0	TRAPPC10	44324413	1.000000	0.71417	0.993000	0.49108	0.312000	0.27988	4.341000	0.59335	2.622000	0.88805	0.655000	0.94253	GCC	TRAPPC10	-	NULL	ENSG00000160218		0.473	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TRAPPC10	HGNC	protein_coding	OTTHUMT00000195737.1	39	0.00	0	C	NM_003274		45499985	45499985	+1	no_errors	ENST00000291574	ensembl	human	known	69_37n	missense	87	12.00	12	SNP	1.000	T
TRPC4AP	26133	genome.wustl.edu	37	20	33600860	33600860	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr20:33600860A>T	ENST00000252015.2	-	11	1449	c.1360T>A	c.(1360-1362)Ttg>Atg	p.L454M	TRPC4AP_ENST00000539834.1_Missense_Mutation_p.L56M|TRPC4AP_ENST00000432634.2_Missense_Mutation_p.L415M|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.L446M			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	454					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)	p.L454M(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGTATCTTCAAGGTGATGTCC	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											204.0	166.0	179.0					20																	33600860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1360T>A	20.37:g.33600860A>T	ENSP00000252015:p.Leu454Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_DUF3689	p.L454M	ENST00000252015.2	37	c.1360	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	A	20.1	3.936734	0.73557	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.65	1.78	0.24846	.	0.062799	0.64402	D	0.000003	T	0.49795	0.1578	L	0.61218	1.895	0.42105	D	0.991352	D;D;D	0.62365	0.977;0.991;0.991	P;D;D	0.64877	0.9;0.93;0.93	T	0.48747	-0.9008	10	0.72032	D	0.01	.	8.7966	0.34883	0.7421:0.0:0.2579:0.0	.	415;446;454	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	M	454;446;56;415;439	ENSP00000252015:L454M;ENSP00000400614:L446M;ENSP00000446090:L56M;ENSP00000400497:L415M	ENSP00000252015:L454M	L	-	1	2	TRPC4AP	33064521	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.144000	0.42197	0.411000	0.25702	-0.256000	0.11100	TTG	TRPC4AP	-	pfam_DUF3689	ENSG00000100991		0.488	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	98	0.00	0	A	NM_015638		33600860	33600860	-1	no_errors	ENST00000252015	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	1.000	T
TRPC4AP	26133	genome.wustl.edu	37	20	33600860	33600860	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr20:33600860A>T	ENST00000252015.2	-	11	1449	c.1360T>A	c.(1360-1362)Ttg>Atg	p.L454M	TRPC4AP_ENST00000539834.1_Missense_Mutation_p.L56M|TRPC4AP_ENST00000432634.2_Missense_Mutation_p.L415M|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.L446M			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	454					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)	p.L454M(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGTATCTTCAAGGTGATGTCC	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											204.0	166.0	179.0					20																	33600860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1360T>A	20.37:g.33600860A>T	ENSP00000252015:p.Leu454Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_DUF3689	p.L454M	ENST00000252015.2	37	c.1360	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	A	20.1	3.936734	0.73557	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.65	1.78	0.24846	.	0.062799	0.64402	D	0.000003	T	0.49795	0.1578	L	0.61218	1.895	0.42105	D	0.991352	D;D;D	0.62365	0.977;0.991;0.991	P;D;D	0.64877	0.9;0.93;0.93	T	0.48747	-0.9008	10	0.72032	D	0.01	.	8.7966	0.34883	0.7421:0.0:0.2579:0.0	.	415;446;454	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	M	454;446;56;415;439	ENSP00000252015:L454M;ENSP00000400614:L446M;ENSP00000446090:L56M;ENSP00000400497:L415M	ENSP00000252015:L454M	L	-	1	2	TRPC4AP	33064521	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.144000	0.42197	0.411000	0.25702	-0.256000	0.11100	TTG	TRPC4AP	-	pfam_DUF3689	ENSG00000100991		0.488	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	44	0.00	0	A	NM_015638		33600860	33600860	-1	no_errors	ENST00000252015	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	1.000	T
TTLL6	284076	genome.wustl.edu	37	17	46862448	46862448	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr17:46862448G>T	ENST00000393382.3	-	13	2018	c.1877C>A	c.(1876-1878)gCc>gAc	p.A626D	TTLL6_ENST00000433608.2_Missense_Mutation_p.A319D	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						AACAGAGCTGGCCTCCTCCGT	0.507																																						dbGAP											0													136.0	137.0	137.0					17																	46862448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.1877C>A	17.37:g.46862448G>T	ENSP00000377043:p.Ala626Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.A626D	ENST00000393382.3	37	c.1877	CCDS45724.1	17	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659322	0.29515	.	.	ENSG00000170703	ENST00000440941;ENST00000305326;ENST00000433608;ENST00000393382	.	.	.	4.76	-2.77	0.05877	.	903.840000	0.00166	U	0.000001	T	0.34716	0.0907	L	0.55481	1.735	0.09310	N	1	B;B;B	0.20671	0.013;0.028;0.047	B;B;B	0.18263	0.007;0.014;0.021	T	0.22556	-1.0213	9	0.72032	D	0.01	.	0.5534	0.00666	0.2506:0.1353:0.3371:0.277	.	578;379;319	Q8N841;D3DTW0;G5E937	TTLL6_HUMAN;.;.	D	626;319;304;578	.	ENSP00000302547:A319D	A	-	2	0	TTLL6	44217447	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.153000	0.10144	-0.527000	0.06374	0.655000	0.94253	GCC	TTLL6	-	NULL	ENSG00000170703		0.507	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TTLL6	HGNC	protein_coding	OTTHUMT00000346939.3	308	0.00	0	G	NM_173623		46862448	46862448	-1	no_errors	ENST00000393382	ensembl	human	known	69_37n	missense	193	14.60	33	SNP	0.001	T
TTLL6	284076	genome.wustl.edu	37	17	46862448	46862448	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr17:46862448G>T	ENST00000393382.3	-	13	2018	c.1877C>A	c.(1876-1878)gCc>gAc	p.A626D	TTLL6_ENST00000433608.2_Missense_Mutation_p.A319D	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						AACAGAGCTGGCCTCCTCCGT	0.507																																						dbGAP											0													136.0	137.0	137.0					17																	46862448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.1877C>A	17.37:g.46862448G>T	ENSP00000377043:p.Ala626Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.A626D	ENST00000393382.3	37	c.1877	CCDS45724.1	17	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659322	0.29515	.	.	ENSG00000170703	ENST00000440941;ENST00000305326;ENST00000433608;ENST00000393382	.	.	.	4.76	-2.77	0.05877	.	903.840000	0.00166	U	0.000001	T	0.34716	0.0907	L	0.55481	1.735	0.09310	N	1	B;B;B	0.20671	0.013;0.028;0.047	B;B;B	0.18263	0.007;0.014;0.021	T	0.22556	-1.0213	9	0.72032	D	0.01	.	0.5534	0.00666	0.2506:0.1353:0.3371:0.277	.	578;379;319	Q8N841;D3DTW0;G5E937	TTLL6_HUMAN;.;.	D	626;319;304;578	.	ENSP00000302547:A319D	A	-	2	0	TTLL6	44217447	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.153000	0.10144	-0.527000	0.06374	0.655000	0.94253	GCC	TTLL6	-	NULL	ENSG00000170703		0.507	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TTLL6	HGNC	protein_coding	OTTHUMT00000346939.3	177	0.00	0	G	NM_173623		46862448	46862448	-1	no_errors	ENST00000393382	ensembl	human	known	69_37n	missense	193	14.60	33	SNP	0.001	T
UBE3A	7337	genome.wustl.edu	37	15	25601182	25601182	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr15:25601182delC	ENST00000397954.2	-	7	1989	c.1990delG	c.(1990-1992)gatfs	p.D664fs	UBE3A_ENST00000428984.2_Frame_Shift_Del_p.D641fs|UBE3A_ENST00000232165.3_Frame_Shift_Del_p.D661fs|UBE3A_ENST00000438097.1_Frame_Shift_Del_p.D641fs|UBE3A_ENST00000566215.1_Frame_Shift_Del_p.D641fs|SNHG14_ENST00000554726.1_RNA			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	664					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		TCCAATAAATCTTTTAAACTC	0.328																																						dbGAP											0													126.0	136.0	132.0					15																	25601182		2203	4298	6501	-	-	-	SO:0001589	frameshift_variant	0			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.1990delG	15.37:g.25601182delC	ENSP00000381045:p.Asp664fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Frame_Shift_Del	DEL	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	p.D664fs	ENST00000397954.2	37	c.1990	CCDS45192.1	15																																																																																			UBE3A	-	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	ENSG00000114062		0.328	UBE3A-003	KNOWN	basic|CCDS	protein_coding	UBE3A	HGNC	protein_coding	OTTHUMT00000434203.1	126	0.00	0	C	NM_000462		25601182	25601182	-1	no_errors	ENST00000397954	ensembl	human	known	69_37n	frame_shift_del	190	12.33	27	DEL	1.000	-
UBE3A	7337	genome.wustl.edu	37	15	25601182	25601182	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr15:25601182delC	ENST00000397954.2	-	7	1989	c.1990delG	c.(1990-1992)gatfs	p.D664fs	UBE3A_ENST00000428984.2_Frame_Shift_Del_p.D641fs|UBE3A_ENST00000232165.3_Frame_Shift_Del_p.D661fs|UBE3A_ENST00000438097.1_Frame_Shift_Del_p.D641fs|UBE3A_ENST00000566215.1_Frame_Shift_Del_p.D641fs|SNHG14_ENST00000554726.1_RNA			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	664					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		TCCAATAAATCTTTTAAACTC	0.328																																						dbGAP											0													126.0	136.0	132.0					15																	25601182		2203	4298	6501	-	-	-	SO:0001589	frameshift_variant	0			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.1990delG	15.37:g.25601182delC	ENSP00000381045:p.Asp664fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Frame_Shift_Del	DEL	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	p.D664fs	ENST00000397954.2	37	c.1990	CCDS45192.1	15																																																																																			UBE3A	-	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	ENSG00000114062		0.328	UBE3A-003	KNOWN	basic|CCDS	protein_coding	UBE3A	HGNC	protein_coding	OTTHUMT00000434203.1	205	0.00	0	C	NM_000462		25601182	25601182	-1	no_errors	ENST00000397954	ensembl	human	known	69_37n	frame_shift_del	190	12.33	27	DEL	1.000	-
USP1	7398	genome.wustl.edu	37	1	62916175	62916175	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:62916175G>T	ENST00000339950.4	+	9	2696	c.1881G>T	c.(1879-1881)ttG>ttT	p.L627F	USP1_ENST00000371146.1_Missense_Mutation_p.L627F	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	627	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L627F(1)		breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		CAGAACCATTGAATGAGGAGG	0.368																																					Ovarian(122;1846 2315 3982 19504)	dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	63.0	65.0					1																	62916175		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.1881G>T	1.37:g.62916175G>T	ENSP00000343526:p.Leu627Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L627F	ENST00000339950.4	37	c.1881	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447858	0.43429	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.19938	2.11;2.11	5.54	2.7	0.31948	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (1);	0.496244	0.20118	N	0.098877	T	0.20007	0.0481	L	0.50333	1.59	0.36684	D	0.879232	P	0.42203	0.773	B	0.42112	0.376	T	0.11203	-1.0597	10	0.29301	T	0.29	0.0	8.9008	0.35493	0.28:0.0:0.72:0.0	.	627	O94782	UBP1_HUMAN	F	627	ENSP00000360188:L627F;ENSP00000343526:L627F	ENSP00000343526:L627F	L	+	3	2	USP1	62688763	1.000000	0.71417	0.342000	0.25602	0.993000	0.82548	2.079000	0.41577	0.465000	0.27167	0.650000	0.86243	TTG	USP1	-	pfscan_Peptidase_C19	ENSG00000162607		0.368	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	98	0.00	0	G	NM_001017415		62916175	62916175	+1	no_errors	ENST00000339950	ensembl	human	known	69_37n	missense	152	14.12	25	SNP	0.762	T
USP1	7398	genome.wustl.edu	37	1	62916175	62916175	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:62916175G>T	ENST00000339950.4	+	9	2696	c.1881G>T	c.(1879-1881)ttG>ttT	p.L627F	USP1_ENST00000371146.1_Missense_Mutation_p.L627F	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	627	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L627F(1)		breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		CAGAACCATTGAATGAGGAGG	0.368																																					Ovarian(122;1846 2315 3982 19504)	dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	63.0	65.0					1																	62916175		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.1881G>T	1.37:g.62916175G>T	ENSP00000343526:p.Leu627Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L627F	ENST00000339950.4	37	c.1881	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447858	0.43429	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.19938	2.11;2.11	5.54	2.7	0.31948	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (1);	0.496244	0.20118	N	0.098877	T	0.20007	0.0481	L	0.50333	1.59	0.36684	D	0.879232	P	0.42203	0.773	B	0.42112	0.376	T	0.11203	-1.0597	10	0.29301	T	0.29	0.0	8.9008	0.35493	0.28:0.0:0.72:0.0	.	627	O94782	UBP1_HUMAN	F	627	ENSP00000360188:L627F;ENSP00000343526:L627F	ENSP00000343526:L627F	L	+	3	2	USP1	62688763	1.000000	0.71417	0.342000	0.25602	0.993000	0.82548	2.079000	0.41577	0.465000	0.27167	0.650000	0.86243	TTG	USP1	-	pfscan_Peptidase_C19	ENSG00000162607		0.368	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	184	0.00	0	G	NM_001017415		62916175	62916175	+1	no_errors	ENST00000339950	ensembl	human	known	69_37n	missense	152	14.12	25	SNP	0.762	T
UBQLN4	56893	genome.wustl.edu	37	1	156011319	156011319	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr1:156011319A>G	ENST00000368309.3	-	10	1702	c.1610T>C	c.(1609-1611)aTg>aCg	p.M537T		NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	537					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)	p.M537T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					CATCTGCTGCATGAGTTGCTG	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	54.0	54.0					1																	156011319		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.1610T>C	1.37:g.156011319A>G	ENSP00000357292:p.Met537Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_UBA/transl_elong_EF1B_N,pfam_SUMO,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.M537T	ENST00000368309.3	37	c.1610	CCDS1127.1	1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904402	0.52333	.	.	ENSG00000160803	ENST00000368309	T	0.58652	0.32	4.62	4.62	0.57501	.	0.039087	0.85682	D	0.000000	T	0.39064	0.1064	L	0.39245	1.2	0.80722	D	1	P;P	0.42248	0.774;0.774	B;B	0.43331	0.306;0.416	T	0.32455	-0.9906	10	0.35671	T	0.21	-44.1957	13.0305	0.58839	1.0:0.0:0.0:0.0	.	517;537	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	T	537	ENSP00000357292:M537T	ENSP00000357292:M537T	M	-	2	0	UBQLN4	154277943	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.657000	0.91106	1.952000	0.56665	0.533000	0.62120	ATG	UBQLN4	-	NULL	ENSG00000160803		0.607	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN4	HGNC	protein_coding	OTTHUMT00000046193.1	96	0.00	0	A	NM_020131		156011319	156011319	-1	no_errors	ENST00000368309	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	G
UBQLN4	56893	genome.wustl.edu	37	1	156011319	156011319	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr1:156011319A>G	ENST00000368309.3	-	10	1702	c.1610T>C	c.(1609-1611)aTg>aCg	p.M537T		NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	537					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)	p.M537T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					CATCTGCTGCATGAGTTGCTG	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	54.0	54.0					1																	156011319		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.1610T>C	1.37:g.156011319A>G	ENSP00000357292:p.Met537Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_UBA/transl_elong_EF1B_N,pfam_SUMO,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.M537T	ENST00000368309.3	37	c.1610	CCDS1127.1	1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904402	0.52333	.	.	ENSG00000160803	ENST00000368309	T	0.58652	0.32	4.62	4.62	0.57501	.	0.039087	0.85682	D	0.000000	T	0.39064	0.1064	L	0.39245	1.2	0.80722	D	1	P;P	0.42248	0.774;0.774	B;B	0.43331	0.306;0.416	T	0.32455	-0.9906	10	0.35671	T	0.21	-44.1957	13.0305	0.58839	1.0:0.0:0.0:0.0	.	517;537	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	T	537	ENSP00000357292:M537T	ENSP00000357292:M537T	M	-	2	0	UBQLN4	154277943	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.657000	0.91106	1.952000	0.56665	0.533000	0.62120	ATG	UBQLN4	-	NULL	ENSG00000160803		0.607	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN4	HGNC	protein_coding	OTTHUMT00000046193.1	70	0.00	0	A	NM_020131		156011319	156011319	-1	no_errors	ENST00000368309	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	G
VIT	5212	genome.wustl.edu	37	2	36994370	36994370	+	Silent	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr2:36994370T>C	ENST00000389975.3	+	7	923	c.621T>C	c.(619-621)gcT>gcC	p.A207A	VIT_ENST00000404084.1_Silent_p.A185A|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000401530.1_Silent_p.A207A|VIT_ENST00000379241.3_Silent_p.A207A|VIT_ENST00000379242.3_Silent_p.A207A	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	207					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.A207A(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CCCCTTCTGCTGCTTCTACCA	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											76.0	64.0	68.0					2																	36994370		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.621T>C	2.37:g.36994370T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Silent	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.A207	ENST00000389975.3	37	c.621	CCDS54347.1	2																																																																																			VIT	-	NULL	ENSG00000205221		0.577	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		120	0.00	0	T			36994370	36994370	+1	no_errors	ENST00000379242	ensembl	human	known	69_37n	silent	75	11.76	10	SNP	0.000	C
VIT	5212	genome.wustl.edu	37	2	36994370	36994370	+	Silent	SNP	T	T	C			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr2:36994370T>C	ENST00000389975.3	+	7	923	c.621T>C	c.(619-621)gcT>gcC	p.A207A	VIT_ENST00000404084.1_Silent_p.A185A|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000401530.1_Silent_p.A207A|VIT_ENST00000379241.3_Silent_p.A207A|VIT_ENST00000379242.3_Silent_p.A207A	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	207					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.A207A(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CCCCTTCTGCTGCTTCTACCA	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											76.0	64.0	68.0					2																	36994370		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.621T>C	2.37:g.36994370T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Silent	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.A207	ENST00000389975.3	37	c.621	CCDS54347.1	2																																																																																			VIT	-	NULL	ENSG00000205221		0.577	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		38	0.00	0	T			36994370	36994370	+1	no_errors	ENST00000379242	ensembl	human	known	69_37n	silent	75	11.76	10	SNP	0.000	C
ZFP64	55734	genome.wustl.edu	37	20	50769075	50769076	+	Frame_Shift_Ins	INS	-	-	G	rs535504707		TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr20:50769075_50769076insG	ENST00000216923.4	-	6	2004_2005	c.1655_1656insC	c.(1654-1656)cctfs	p.P552fs	ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Frame_Shift_Ins_p.P550fs|ZFP64_ENST00000346617.4_Frame_Shift_Ins_p.P498fs|ZFP64_ENST00000477786.1_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	552					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GCGAGGACTGAGGGGGGGCGAT	0.673																																						dbGAP											0									,,,	11,4249		0,11,2119					,,,	-3.3	0.0			34	3,8249		0,3,4123	no	intron,frameshift,frameshift,frameshift	ZFP64	NM_199427.2,NM_199426.1,NM_022088.4,NM_018197.2	,,,	0,14,6242	A1A1,A1R,RR		0.0364,0.2582,0.1119	,,,	,,,		14,12498				-	-	-	SO:0001589	frameshift_variant	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1656dupC	20.37:g.50769082_50769082dupG	ENSP00000216923:p.Pro552fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTS7|Q9NVH4	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q553fs	ENST00000216923.4	37	c.1656_1655	CCDS13440.1	20																																																																																			ZFP64	-	NULL	ENSG00000020256		0.673	ZFP64-003	KNOWN	basic|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079744.1	22	0.00	0	-	NM_018197		50769075	50769076	-1	no_errors	ENST00000216923	ensembl	human	known	69_37n	frame_shift_ins	41	14.58	7	INS	0.000:0.000	G
ZNF397	84307	genome.wustl.edu	37	18	32822449	32822449	+	Silent	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	c300b8f1-4a58-4c24-87ed-07654388f249	g.chr18:32822449T>A	ENST00000330501.7	+	2	168	c.15T>A	c.(13-15)tcT>tcA	p.S5S	ZNF397_ENST00000355632.4_Silent_p.S5S|ZNF397_ENST00000585800.1_Silent_p.S5S|ZNF397_ENST00000591206.1_Silent_p.S5S|ZNF397_ENST00000592264.1_Silent_p.S5S|ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000261333.6_Silent_p.S5S	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	5					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S5S(2)		breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						CTGTGGAATCTGGAGTGATTT	0.423																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											57.0	58.0	57.0					18																	32822449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.15T>A	18.37:g.32822449T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRM2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	p.W5R	ENST00000330501.7	37	c.13	CCDS45852.1	18																																																																																			ZNF397	-	NULL	ENSG00000186812		0.423	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF397	HGNC	protein_coding	OTTHUMT00000442398.1	105	0.00	0	T	NM_032347		32822449	32822449	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000588119	ensembl	human	putative	69_37n	missense	88	13.73	14	SNP	0.440	A
ZNF397	84307	genome.wustl.edu	37	18	32822449	32822449	+	Silent	SNP	T	T	A			TCGA-BH-A0C0-01A-21W-A071-09	TCGA-BH-A0C0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cb9d68dd-d159-4a7e-b914-18d2498b19d6	58a1d50c-1674-4db6-8ed7-d2aa04826142	g.chr18:32822449T>A	ENST00000330501.7	+	2	168	c.15T>A	c.(13-15)tcT>tcA	p.S5S	ZNF397_ENST00000355632.4_Silent_p.S5S|ZNF397_ENST00000585800.1_Silent_p.S5S|ZNF397_ENST00000591206.1_Silent_p.S5S|ZNF397_ENST00000592264.1_Silent_p.S5S|ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000261333.6_Silent_p.S5S	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	5					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S5S(2)		breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						CTGTGGAATCTGGAGTGATTT	0.423																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											57.0	58.0	57.0					18																	32822449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.15T>A	18.37:g.32822449T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRM2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	p.W5R	ENST00000330501.7	37	c.13	CCDS45852.1	18																																																																																			ZNF397	-	NULL	ENSG00000186812		0.423	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF397	HGNC	protein_coding	OTTHUMT00000442398.1	62	0.00	0	T	NM_032347		32822449	32822449	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000588119	ensembl	human	putative	69_37n	missense	88	13.73	14	SNP	0.440	A
