#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALOX12	239	genome.wustl.edu	37	17	6900318	6900318	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr17:6900318G>C	ENST00000251535.6	+	2	362	c.309G>C	c.(307-309)gaG>gaC	p.E103D	RP11-589P10.7_ENST00000572547.1_RNA|RP11-589P10.5_ENST00000573222.1_lincRNA|AC027763.2_ENST00000399541.2_Intron	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	103	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.E103D(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						TGCAGGGCGAGGACATCCTGA	0.697																																						dbGAP											1	Substitution - Missense(1)	breast(1)											19.0	14.0	16.0					17																	6900318		2187	4284	6471	-	-	-	SO:0001583	missense	0			M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.309G>C	17.37:g.6900318G>C	ENSP00000251535:p.Glu103Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C,pfscan_LipOase_LH2	p.E103D	ENST00000251535.6	37	c.309	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	G	0.336	-0.953363	0.02285	.	.	ENSG00000108839	ENST00000251535	T	0.67523	-0.27	4.46	-5.98	0.02220	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.521732	0.19543	N	0.111757	T	0.24586	0.0596	N	0.02247	-0.625	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.44143	-0.9347	10	0.02654	T	1	-9.8093	4.775	0.13175	0.1713:0.5275:0.1896:0.1115	.	103	P18054	LOX12_HUMAN	D	103	ENSP00000251535:E103D	ENSP00000251535:E103D	E	+	3	2	ALOX12	6841042	0.000000	0.05858	0.003000	0.11579	0.516000	0.34256	-1.679000	0.01940	-0.660000	0.05352	-0.499000	0.04595	GAG	ALOX12	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000108839		0.697	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12	HGNC	protein_coding	OTTHUMT00000219922.2	16	0.00	0	G			6900318	6900318	+1	no_errors	ENST00000251535	ensembl	human	known	69_37n	missense	17	28.00	7	SNP	0.010	C
AUTS2	26053	genome.wustl.edu	37	7	70252221	70252221	+	Missense_Mutation	SNP	G	G	T	rs147106727	byFrequency	TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr7:70252221G>T	ENST00000342771.4	+	18	2656	c.2335G>T	c.(2335-2337)Gat>Tat	p.D779Y	AUTS2_ENST00000406775.2_Missense_Mutation_p.D755Y	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	779								p.D779Y(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CGGCCACAAGGATGGCCCCAG	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	48.0	52.0					7																	70252221		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2335G>T	7.37:g.70252221G>T	ENSP00000344087:p.Asp779Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	prints_AUTS2	p.D779Y	ENST00000342771.4	37	c.2335	CCDS5539.1	7	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420732	0.83559	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000418686	T;T	0.41400	1.04;1.0	5.33	5.33	0.75918	.	0.140857	0.64402	D	0.000006	T	0.59945	0.2231	L	0.52011	1.625	0.80722	D	1	D;D;D	0.89917	0.988;1.0;1.0	P;D;D	0.74348	0.874;0.983;0.983	T	0.56056	-0.8042	9	.	.	.	-14.9932	19.0137	0.92884	0.0:0.0:1.0:0.0	.	231;755;779	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	Y	755;779;59	ENSP00000385263:D755Y;ENSP00000344087:D779Y	.	D	+	1	0	AUTS2	69890157	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.464000	0.97655	2.505000	0.84491	0.655000	0.94253	GAT	AUTS2	-	NULL	ENSG00000158321		0.517	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	59	0.00	0	G			70252221	70252221	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	missense	30	39.22	20	SNP	1.000	T
AUTS2	26053	genome.wustl.edu	37	7	70252221	70252221	+	Missense_Mutation	SNP	G	G	T	rs147106727	byFrequency	TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr7:70252221G>T	ENST00000342771.4	+	18	2656	c.2335G>T	c.(2335-2337)Gat>Tat	p.D779Y	AUTS2_ENST00000406775.2_Missense_Mutation_p.D755Y	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	779								p.D779Y(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CGGCCACAAGGATGGCCCCAG	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	48.0	52.0					7																	70252221		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2335G>T	7.37:g.70252221G>T	ENSP00000344087:p.Asp779Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	prints_AUTS2	p.D779Y	ENST00000342771.4	37	c.2335	CCDS5539.1	7	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420732	0.83559	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000418686	T;T	0.41400	1.04;1.0	5.33	5.33	0.75918	.	0.140857	0.64402	D	0.000006	T	0.59945	0.2231	L	0.52011	1.625	0.80722	D	1	D;D;D	0.89917	0.988;1.0;1.0	P;D;D	0.74348	0.874;0.983;0.983	T	0.56056	-0.8042	9	.	.	.	-14.9932	19.0137	0.92884	0.0:0.0:1.0:0.0	.	231;755;779	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	Y	755;779;59	ENSP00000385263:D755Y;ENSP00000344087:D779Y	.	D	+	1	0	AUTS2	69890157	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.464000	0.97655	2.505000	0.84491	0.655000	0.94253	GAT	AUTS2	-	NULL	ENSG00000158321		0.517	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	62	0.00	0	G			70252221	70252221	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	missense	30	39.22	20	SNP	1.000	T
CBX2	84733	genome.wustl.edu	37	17	77758181	77758181	+	Silent	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr17:77758181C>T	ENST00000310942.4	+	5	1043	c.939C>T	c.(937-939)agC>agT	p.S313S		NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	313					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S313S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			AGGCCCCCAGCGGTGGGGCTG	0.677																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											18.0	21.0	20.0					17																	77758181		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0			BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.939C>T	17.37:g.77758181C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VDA5|Q9BTB1	Silent	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.S313	ENST00000310942.4	37	c.939	CCDS32757.1	17																																																																																			CBX2	-	NULL	ENSG00000173894		0.677	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX2	HGNC	protein_coding	OTTHUMT00000437040.1	40	0.00	0	C	NM_032647		77758181	77758181	+1	no_errors	ENST00000310942	ensembl	human	known	69_37n	silent	13	51.85	14	SNP	0.013	T
CBX8	57332	genome.wustl.edu	37	17	77768660	77768660	+	Missense_Mutation	SNP	C	C	T	rs556082265		TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr17:77768660C>T	ENST00000269385.4	-	5	1061	c.944G>A	c.(943-945)aGc>aAc	p.S315N	CBX8_ENST00000485449.1_5'Flank	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	315					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)	p.S315N(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CCCCCCAGAGCTGGGGGGGCC	0.687																																						dbGAP											1	Substitution - Missense(1)	breast(1)											11.0	14.0	13.0					17																	77768660		2172	4242	6414	-	-	-	SO:0001583	missense	0			AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.944G>A	17.37:g.77768660C>T	ENSP00000269385:p.Ser315Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H39|Q9NR07	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.S315N	ENST00000269385.4	37	c.944	CCDS11765.1	17	.	.	.	.	.	.	.	.	.	.	c	1.656	-0.512653	0.04200	.	.	ENSG00000141570	ENST00000269385	T	0.44482	0.92	4.47	3.48	0.39840	.	1.492250	0.03809	N	0.265664	T	0.25568	0.0622	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.12837	0.008	T	0.18116	-1.0347	10	0.17369	T	0.5	-10.3892	8.5356	0.33362	0.0:0.7618:0.1552:0.083	.	315	Q9HC52	CBX8_HUMAN	N	315	ENSP00000269385:S315N	ENSP00000269385:S315N	S	-	2	0	CBX8	75383255	0.007000	0.16637	0.872000	0.34217	0.351000	0.29236	1.187000	0.32090	1.225000	0.43566	0.550000	0.68814	AGC	CBX8	-	NULL	ENSG00000141570		0.687	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	HGNC	protein_coding	OTTHUMT00000318011.1	27	0.00	0	C	NM_020649		77768660	77768660	-1	no_errors	ENST00000269385	ensembl	human	known	69_37n	missense	13	51.85	14	SNP	0.060	T
CBX8	57332	genome.wustl.edu	37	17	77768660	77768660	+	Missense_Mutation	SNP	C	C	T	rs556082265		TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr17:77768660C>T	ENST00000269385.4	-	5	1061	c.944G>A	c.(943-945)aGc>aAc	p.S315N	CBX8_ENST00000485449.1_5'Flank	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	315					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)	p.S315N(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CCCCCCAGAGCTGGGGGGGCC	0.687																																						dbGAP											1	Substitution - Missense(1)	breast(1)											11.0	14.0	13.0					17																	77768660		2172	4242	6414	-	-	-	SO:0001583	missense	0			AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.944G>A	17.37:g.77768660C>T	ENSP00000269385:p.Ser315Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H39|Q9NR07	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.S315N	ENST00000269385.4	37	c.944	CCDS11765.1	17	.	.	.	.	.	.	.	.	.	.	c	1.656	-0.512653	0.04200	.	.	ENSG00000141570	ENST00000269385	T	0.44482	0.92	4.47	3.48	0.39840	.	1.492250	0.03809	N	0.265664	T	0.25568	0.0622	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.12837	0.008	T	0.18116	-1.0347	10	0.17369	T	0.5	-10.3892	8.5356	0.33362	0.0:0.7618:0.1552:0.083	.	315	Q9HC52	CBX8_HUMAN	N	315	ENSP00000269385:S315N	ENSP00000269385:S315N	S	-	2	0	CBX8	75383255	0.007000	0.16637	0.872000	0.34217	0.351000	0.29236	1.187000	0.32090	1.225000	0.43566	0.550000	0.68814	AGC	CBX8	-	NULL	ENSG00000141570		0.687	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	HGNC	protein_coding	OTTHUMT00000318011.1	19	0.00	0	C	NM_020649		77768660	77768660	-1	no_errors	ENST00000269385	ensembl	human	known	69_37n	missense	13	51.85	14	SNP	0.060	T
CERKL	375298	genome.wustl.edu	37	2	182438569	182438569	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr2:182438569G>T	ENST00000339098.5	-	3	523	c.524C>A	c.(523-525)cCc>cAc	p.P175H	CERKL_ENST00000374969.2_Intron|CERKL_ENST00000409440.3_Intron|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000410087.3_Missense_Mutation_p.P175H|CERKL_ENST00000374970.2_Missense_Mutation_p.P175H			Q49MI3	CERKL_HUMAN	ceramide kinase-like	175	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.P175H(2)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GTGACTTTGGGGGTTAAGGAG	0.333																																						dbGAP											2	Substitution - Missense(2)	breast(2)											84.0	93.0	90.0					2																	182438569		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.524C>A	2.37:g.182438569G>T	ENSP00000341159:p.Pro175His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom	p.P175H	ENST00000339098.5	37	c.524	CCDS42789.1	2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580875	0.86748	.	.	ENSG00000188452	ENST00000410087;ENST00000339098;ENST00000374970	T;T;T	0.35605	1.3;1.3;1.9	5.94	5.94	0.96194	Diacylglycerol kinase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.75391	0.3843	H	0.96833	3.89	0.46564	D	0.999108	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	T	0.83125	-0.0116	10	0.87932	D	0	.	20.3593	0.98849	0.0:0.0:1.0:0.0	.	175;175;175	Q49MI3-3;Q49MI3-2;Q49MI3	.;.;CERKL_HUMAN	H	175	ENSP00000386725:P175H;ENSP00000341159:P175H;ENSP00000364109:P175H	ENSP00000341159:P175H	P	-	2	0	CERKL	182146814	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	7.562000	0.82300	2.822000	0.97130	0.557000	0.71058	CCC	CERKL	-	pfam_Diacylglycerol_kinase_cat_dom	ENSG00000188452		0.333	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERKL	HGNC	protein_coding	OTTHUMT00000334811.1	273	0.00	0	G			182438569	182438569	-1	no_errors	ENST00000339098	ensembl	human	known	69_37n	missense	112	37.22	67	SNP	1.000	T
CTCF	10664	genome.wustl.edu	37	16	67645922	67645922	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr16:67645922C>A	ENST00000264010.4	+	4	1294	c.850C>A	c.(850-852)Cac>Aac	p.H284N	CTCF_ENST00000401394.1_Intron|AC009095.4_ENST00000388909.4_RNA	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	284					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.H284N(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TTTGGATCGTCACATGAAAAG	0.463																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	123.0	132.0					16																	67645922		2198	4300	6498	-	-	-	SO:0001583	missense	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.850C>A	16.37:g.67645922C>A	ENSP00000264010:p.His284Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H284N	ENST00000264010.4	37	c.850	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406121	0.83230	.	.	ENSG00000102974	ENST00000264010	D	0.86865	-2.18	5.08	5.08	0.68730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	D	0.96247	0.8776	H	0.97829	4.085	0.80722	D	1	D	0.62365	0.991	D	0.74023	0.982	D	0.97709	1.0189	10	0.87932	D	0	.	18.6694	0.91506	0.0:1.0:0.0:0.0	.	284	P49711	CTCF_HUMAN	N	284	ENSP00000264010:H284N	ENSP00000264010:H284N	H	+	1	0	CTCF	66203423	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.651000	0.83577	2.641000	0.89580	0.655000	0.94253	CAC	CTCF	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000102974		0.463	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	112	0.00	0	C	NM_006565		67645922	67645922	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	missense	28	56.92	37	SNP	1.000	A
DNAH9	1770	genome.wustl.edu	37	17	11597194	11597194	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr17:11597194A>G	ENST00000262442.4	+	21	4692	c.4624A>G	c.(4624-4626)Agg>Ggg	p.R1542G	DNAH9_ENST00000454412.2_Missense_Mutation_p.R1542G	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1542	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R1542G(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGATTCTAAAAGGTTTGAAGG	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	101.0	102.0					17																	11597194		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4624A>G	17.37:g.11597194A>G	ENSP00000262442:p.Arg1542Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R1542G	ENST00000262442.4	37	c.4624	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	A	17.52	3.409327	0.62399	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.63580	-0.05;-0.05	4.72	2.31	0.28768	Dynein heavy chain, domain-2 (1);	0.140853	0.48767	D	0.000179	T	0.82162	0.4977	H	0.96970	3.915	0.80722	D	1	P	0.52577	0.954	P	0.59825	0.864	D	0.86319	0.1691	10	0.87932	D	0	.	11.3421	0.49539	0.4589:0.5411:0.0:0.0	.	1542	Q9NYC9	DYH9_HUMAN	G	1542;1542;124	ENSP00000262442:R1542G;ENSP00000414874:R1542G	ENSP00000262442:R1542G	R	+	1	2	DNAH9	11537919	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	3.891000	0.56227	0.927000	0.37143	0.533000	0.62120	AGG	DNAH9	-	pfam_Dynein_heavy_dom-2	ENSG00000007174		0.418	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	82	0.00	0	A	NM_001372		11597194	11597194	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	59	26.25	21	SNP	1.000	G
DNAH9	1770	genome.wustl.edu	37	17	11597194	11597194	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr17:11597194A>G	ENST00000262442.4	+	21	4692	c.4624A>G	c.(4624-4626)Agg>Ggg	p.R1542G	DNAH9_ENST00000454412.2_Missense_Mutation_p.R1542G	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1542	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R1542G(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGATTCTAAAAGGTTTGAAGG	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	101.0	102.0					17																	11597194		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4624A>G	17.37:g.11597194A>G	ENSP00000262442:p.Arg1542Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R1542G	ENST00000262442.4	37	c.4624	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	A	17.52	3.409327	0.62399	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.63580	-0.05;-0.05	4.72	2.31	0.28768	Dynein heavy chain, domain-2 (1);	0.140853	0.48767	D	0.000179	T	0.82162	0.4977	H	0.96970	3.915	0.80722	D	1	P	0.52577	0.954	P	0.59825	0.864	D	0.86319	0.1691	10	0.87932	D	0	.	11.3421	0.49539	0.4589:0.5411:0.0:0.0	.	1542	Q9NYC9	DYH9_HUMAN	G	1542;1542;124	ENSP00000262442:R1542G;ENSP00000414874:R1542G	ENSP00000262442:R1542G	R	+	1	2	DNAH9	11537919	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	3.891000	0.56227	0.927000	0.37143	0.533000	0.62120	AGG	DNAH9	-	pfam_Dynein_heavy_dom-2	ENSG00000007174		0.418	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	137	0.72	1	A	NM_001372		11597194	11597194	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	59	26.25	21	SNP	1.000	G
MT-ND2	4536	genome.wustl.edu	37	M	2819	2819	+	5'Flank	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chrM:2819G>A	ENST00000361453.3	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TTCGGTTGGGGCGACCTCGGA	0.438																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2819G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			J01415.4	-	-	ENSG00000210082		0.438	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000210082	Clone_based_ensembl_gene	protein_coding		10	0.00	0	G	YP_003024027		2819	2819	+1	no_errors	ENST00000387347	ensembl	human	known	69_37n	rna	22	76.34	71	SNP	NULL	A
MT-ND2	4536	genome.wustl.edu	37	M	2819	2819	+	5'Flank	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chrM:2819G>A	ENST00000361453.3	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TTCGGTTGGGGCGACCTCGGA	0.438																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2819G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			J01415.4	-	-	ENSG00000210082		0.438	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000210082	Clone_based_ensembl_gene	protein_coding		18	0.00	0	G	YP_003024027		2819	2819	+1	no_errors	ENST00000387347	ensembl	human	known	69_37n	rna	22	76.34	71	SNP	NULL	A
MTMR9	66036	genome.wustl.edu	37	8	11177526	11177526	+	Intron	DEL	T	T	-			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr8:11177526delT	ENST00000221086.3	+	9	1959				MTMR9_ENST00000526292.1_Intron|AF131216.6_ENST00000498997.2_RNA	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9							cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CTAGCCACACTTTTTTTTTTT	0.363																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1486+179T>-	8.37:g.11177526delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	RNA	DEL	-	NULL	ENST00000221086.3	37	NULL	CCDS5979.1	8																																																																																			AF131216.6	-	-	ENSG00000246477		0.363	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000246477	Clone_based_vega_gene	protein_coding	OTTHUMT00000207307.2	23	0.00	0	T	NM_015458		11177526	11177526	-1	no_errors	ENST00000498997	ensembl	human	known	69_37n	rna	26	13.33	4	DEL	0.005	-
FAM86B2	653333	genome.wustl.edu	37	8	12285132	12285132	+	Intron	SNP	C	C	G	rs201597864	byFrequency	TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr8:12285132C>G	ENST00000262365.4	-	7	892				FAM86B2_ENST00000393715.3_Missense_Mutation_p.C81S|FAM86B2_ENST00000309608.5_Intron|FAM86B2_ENST00000351291.4_Intron	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2									p.C81S(4)		endometrium(1)|kidney(2)	3						ACAGCTCGGGCACCATGTAGG	0.622													c|||	1566	0.3127	0.4448	0.2277	5008	,	,		8710	0.3423		0.2853	False		,,,				2504	0.1922					dbGAP											4	Substitution - Missense(4)	kidney(2)|endometrium(2)																																								-	-	-	SO:0001627	intron_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.892+33G>C	8.37:g.12285132C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C81S	ENST00000262365.4	37	c.242	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	g	0.012	-1.667406	0.00765	.	.	ENSG00000145002	ENST00000393715	T	0.30182	1.54	0.634	-0.466	0.12153	.	.	.	.	.	T	0.10551	0.0258	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.32214	-0.9915	4	0.08837	T	0.75	.	.	.	.	.	.	.	.	S	81	ENSP00000377318:C81S	ENSP00000377318:C81S	C	-	2	0	FAM86B2	12329503	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.600000	0.05693	-1.610000	0.01583	-1.920000	0.00515	TGC	FAM86B2	-	NULL	ENSG00000145002		0.622	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		15	0.00	0	C	XM_928336		12285132	12285132	-1	no_errors	ENST00000393715	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.001	G
FAT4	79633	genome.wustl.edu	37	4	126239428	126239428	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr4:126239428C>T	ENST00000394329.3	+	1	1875	c.1862C>T	c.(1861-1863)tCc>tTc	p.S621F		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	621	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S621F(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GTGCGCTTCTCCTTACAAGAG	0.537																																						dbGAP											2	Substitution - Missense(2)	breast(2)											87.0	87.0	87.0					4																	126239428		2037	4190	6227	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.1862C>T	4.37:g.126239428C>T	ENSP00000377862:p.Ser621Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S621F	ENST00000394329.3	37	c.1862	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	11.69	1.714868	0.30413	.	.	ENSG00000196159	ENST00000394329	T	0.55052	0.54	4.77	3.93	0.45458	Cadherin (4);Cadherin-like (1);	0.000000	0.34386	U	0.004017	T	0.53674	0.1811	L	0.45352	1.415	0.80722	D	1	P	0.49307	0.922	P	0.53861	0.736	T	0.53012	-0.8498	10	0.49607	T	0.09	.	8.224	0.31558	0.1548:0.7664:0.0:0.0787	.	621	Q6V0I7	FAT4_HUMAN	F	621	ENSP00000377862:S621F	ENSP00000377862:S621F	S	+	2	0	FAT4	126458878	0.999000	0.42202	0.986000	0.45419	0.844000	0.47949	2.847000	0.48270	1.242000	0.43836	0.561000	0.74099	TCC	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.537	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	59	0.00	0	C	NM_024582		126239428	126239428	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	49	31.94	23	SNP	1.000	T
FRG1B	284802	genome.wustl.edu	37	20	29632643	29632643	+	Missense_Mutation	SNP	T	T	C	rs143379667		TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr20:29632643T>C	ENST00000278882.3	+	8	838	c.458T>C	c.(457-459)cTt>cCt	p.L153P	FRG1B_ENST00000358464.4_Missense_Mutation_p.L153P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	153								p.L153P(10)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GACCACAAACTTAAAATAAGT	0.294																																						dbGAP											10	Substitution - Missense(10)	endometrium(6)|kidney(4)																																								-	-	-	SO:0001583	missense	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.458T>C	20.37:g.29632643T>C	ENSP00000278882:p.Leu153Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	Missense_Mutation	SNP	pfam_FRG1,superfamily_Actin_cross-linking	p.L153P	ENST00000278882.3	37	c.458		20	.	.	.	.	.	.	.	.	.	.	t	12.77	2.038665	0.35989	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.44	1.44	0.22558	.	0.000000	0.64402	U	0.000001	T	0.50463	0.1617	.	.	.	0.80722	D	1	P	0.35033	0.481	B	0.40038	0.317	T	0.53187	-0.8474	8	0.87932	D	0	.	6.9831	0.24713	0.0:0.0:0.0:1.0	.	153	Q9BZ01	FRG1B_HUMAN	P	153	.	ENSP00000278882:L153P	L	+	2	0	FRG1B	28246304	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.723000	0.74742	0.925000	0.37094	0.327000	0.21459	CTT	FRG1B	-	pfam_FRG1	ENSG00000149531		0.294	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	24	0.00	0	T	NR_003579		29632643	29632643	+1	no_errors	ENST00000278882	ensembl	human	known	69_37n	missense	67	12.99	10	SNP	1.000	C
GOLGA6L2	283685	genome.wustl.edu	37	15	23685144	23685144	+	Silent	SNP	T	T	C	rs369000188		TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr15:23685144T>C	ENST00000567107.1	-	8	2530	c.2478A>G	c.(2476-2478)ggA>ggG	p.G826G	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	599										breast(1)|endometrium(7)	8						ctcctcctgctcccgcatctt	0.612																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2478A>G	15.37:g.23685144T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	Silent	SNP	NULL	p.G826	ENST00000567107.1	37	c.2478		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.612	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	9	0.00	0	T	NM_182561		23685144	23685144	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	silent	6	50.00	6	SNP	0.003	C
GPR50	9248	genome.wustl.edu	37	X	150349192	150349192	+	Silent	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chrX:150349192C>T	ENST00000218316.3	+	2	1206	c.1137C>T	c.(1135-1137)ccC>ccT	p.P379P	AF003625.3_ENST00000602313.1_lincRNA|GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	379	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.P379P(2)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGCCACCCCGACCGTGCCT	0.577																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											94.0	105.0	102.0					X																	150349192		2147	4228	6375	-	-	-	SO:0001819	synonymous_variant	0			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1137C>T	X.37:g.150349192C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VGG3|Q3ZAR0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Mel_rcpt_1X,prints_7TM_GPCR_Rhodpsn,prints_Melatonin_rcpt,prints_NPY_rcpt	p.P379	ENST00000218316.3	37	c.1137	CCDS44012.1	X																																																																																			GPR50	-	NULL	ENSG00000102195		0.577	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR50	HGNC	protein_coding	OTTHUMT00000060874.1	114	0.00	0	C	NM_004224		150349192	150349192	+1	no_errors	ENST00000218316	ensembl	human	known	69_37n	silent	90	34.31	47	SNP	0.000	T
GPR50	9248	genome.wustl.edu	37	X	150349192	150349192	+	Silent	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chrX:150349192C>T	ENST00000218316.3	+	2	1206	c.1137C>T	c.(1135-1137)ccC>ccT	p.P379P	AF003625.3_ENST00000602313.1_lincRNA|GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	379	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.P379P(2)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGCCACCCCGACCGTGCCT	0.577																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											94.0	105.0	102.0					X																	150349192		2147	4228	6375	-	-	-	SO:0001819	synonymous_variant	0			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1137C>T	X.37:g.150349192C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VGG3|Q3ZAR0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Mel_rcpt_1X,prints_7TM_GPCR_Rhodpsn,prints_Melatonin_rcpt,prints_NPY_rcpt	p.P379	ENST00000218316.3	37	c.1137	CCDS44012.1	X																																																																																			GPR50	-	NULL	ENSG00000102195		0.577	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR50	HGNC	protein_coding	OTTHUMT00000060874.1	156	0.00	0	C	NM_004224		150349192	150349192	+1	no_errors	ENST00000218316	ensembl	human	known	69_37n	silent	90	34.31	47	SNP	0.000	T
HECW1	23072	genome.wustl.edu	37	7	43548644	43548645	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr7:43548644_43548645delTT	ENST00000395891.2	+	24	4548_4549	c.3943_3944delTT	c.(3943-3945)tttfs	p.F1315fs	HECW1_ENST00000453890.1_Frame_Shift_Del_p.F1281fs|AC011738.4_ENST00000436105.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1315	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.F1315fs*1(1)|p.F1294fs*1(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CTATGGACTCTTTGAGTACTCG	0.485																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3943_3944delTT	7.37:g.43548644_43548645delTT	ENSP00000379228:p.Phe1315fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Frame_Shift_Del	DEL	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.F1315fs	ENST00000395891.2	37	c.3943_3944	CCDS5469.2	7																																																																																			HECW1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000002746		0.485	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	157	0.00	0	TT	NM_015052		43548644	43548645	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	frame_shift_del	101	31.76	47	DEL	1.000:1.000	-
HMCN1	83872	genome.wustl.edu	37	1	186072719	186072719	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr1:186072719G>A	ENST00000271588.4	+	69	10918	c.10689G>A	c.(10687-10689)atG>atA	p.M3563I	HMCN1_ENST00000367492.2_Missense_Mutation_p.M3563I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3563	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.M3563I(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGACCTGGATGAAAGATGGCC	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	77.0	76.0					1																	186072719		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10689G>A	1.37:g.186072719G>A	ENSP00000271588:p.Met3563Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.M3563I	ENST00000271588.4	37	c.10689	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530781	0.64860	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.76578	-1.03;-1.03	5.7	5.7	0.88788	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.091323	0.85682	D	0.000000	T	0.77239	0.4101	N	0.16708	0.43	0.41839	D	0.990111	D	0.60160	0.987	D	0.69824	0.966	T	0.74456	-0.3659	10	0.24483	T	0.36	.	13.0828	0.59123	0.0729:0.0:0.9271:0.0	.	3563	Q96RW7	HMCN1_HUMAN	I	3563	ENSP00000271588:M3563I;ENSP00000356462:M3563I	ENSP00000271588:M3563I	M	+	3	0	HMCN1	184339342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.167000	0.58209	2.683000	0.91414	0.655000	0.94253	ATG	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.443	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	118	0.00	0	G	NM_031935		186072719	186072719	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	56	34.12	29	SNP	1.000	A
HMCN1	83872	genome.wustl.edu	37	1	186072719	186072719	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr1:186072719G>A	ENST00000271588.4	+	69	10918	c.10689G>A	c.(10687-10689)atG>atA	p.M3563I	HMCN1_ENST00000367492.2_Missense_Mutation_p.M3563I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3563	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.M3563I(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGACCTGGATGAAAGATGGCC	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	77.0	76.0					1																	186072719		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10689G>A	1.37:g.186072719G>A	ENSP00000271588:p.Met3563Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.M3563I	ENST00000271588.4	37	c.10689	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530781	0.64860	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.76578	-1.03;-1.03	5.7	5.7	0.88788	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.091323	0.85682	D	0.000000	T	0.77239	0.4101	N	0.16708	0.43	0.41839	D	0.990111	D	0.60160	0.987	D	0.69824	0.966	T	0.74456	-0.3659	10	0.24483	T	0.36	.	13.0828	0.59123	0.0729:0.0:0.9271:0.0	.	3563	Q96RW7	HMCN1_HUMAN	I	3563	ENSP00000271588:M3563I;ENSP00000356462:M3563I	ENSP00000271588:M3563I	M	+	3	0	HMCN1	184339342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.167000	0.58209	2.683000	0.91414	0.655000	0.94253	ATG	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.443	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	104	0.95	1	G	NM_031935		186072719	186072719	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	56	34.12	29	SNP	1.000	A
IGDCC3	9543	genome.wustl.edu	37	15	65621396	65621396	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr15:65621396C>T	ENST00000327987.4	-	14	2547	c.2296G>A	c.(2296-2298)Gag>Aag	p.E766K	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	766					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.E766K(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GTCTTCGCCTCCGTCGTCTTC	0.697																																						dbGAP											1	Substitution - Missense(1)	breast(1)											16.0	21.0	20.0					15																	65621396		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2296G>A	15.37:g.65621396C>T	ENSP00000332773:p.Glu766Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E766K	ENST00000327987.4	37	c.2296	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	15.22	2.767784	0.49574	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.66460	-0.21	5.41	2.44	0.29823	.	.	.	.	.	T	0.48169	0.1485	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38265	-0.9669	9	0.52906	T	0.07	.	4.5134	0.11923	0.1471:0.4879:0.2853:0.0797	.	766	Q8IVU1	IGDC3_HUMAN	K	766;589	ENSP00000332773:E766K	ENSP00000332773:E766K	E	-	1	0	IGDCC3	63408449	0.410000	0.25376	0.003000	0.11579	0.003000	0.03518	1.168000	0.31859	0.244000	0.21351	-0.157000	0.13467	GAG	IGDCC3	-	NULL	ENSG00000174498		0.697	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	30	0.00	0	C	NM_004884		65621396	65621396	-1	no_errors	ENST00000327987	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	0.002	T
LASP1	3927	genome.wustl.edu	37	17	37074895	37074895	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr17:37074895A>C	ENST00000318008.6	+	7	981	c.650A>C	c.(649-651)gAc>gCc	p.D217A	LASP1_ENST00000435347.3_Missense_Mutation_p.D217A|LASP1_ENST00000433206.2_Missense_Mutation_p.D161A|RP1-56K13.3_ENST00000580121.1_RNA	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	217	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)	p.D217A(1)		breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						AGCGCCGCCGACGAGGACGAG	0.647			T	MLL	AML																																	dbGAP		Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	1	Substitution - Missense(1)	breast(1)											108.0	96.0	100.0					17																	37074895		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.650A>C	17.37:g.37074895A>C	ENSP00000325240:p.Asp217Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Znf_LIM,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.D217A	ENST00000318008.6	37	c.650	CCDS11331.1	17	.	.	.	.	.	.	.	.	.	.	A	31	5.064211	0.93898	.	.	ENSG00000002834	ENST00000318008;ENST00000433206;ENST00000435347	T;T;T	0.52754	0.65;0.65;0.65	5.39	5.39	0.77823	Src homology-3 domain (4);	1.202140	0.06324	N	0.704942	T	0.67468	0.2896	L	0.51914	1.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.51624	-0.8682	10	0.66056	D	0.02	.	14.2322	0.65901	1.0:0.0:0.0:0.0	.	161;217	B4DGQ0;Q14847	.;LASP1_HUMAN	A	217;161;217	ENSP00000325240:D217A;ENSP00000401048:D161A;ENSP00000392853:D217A	ENSP00000325240:D217A	D	+	2	0	LASP1	34328421	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	9.255000	0.95524	2.054000	0.61138	0.379000	0.24179	GAC	LASP1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000002834		0.647	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LASP1	HGNC	protein_coding	OTTHUMT00000256890.3	30	0.00	0	A	NM_006148		37074895	37074895	+1	no_errors	ENST00000318008	ensembl	human	known	69_37n	missense	34	33.96	18	SNP	1.000	C
LETM1	3954	genome.wustl.edu	37	4	1838164	1838164	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr4:1838164A>T	ENST00000302787.2	-	4	1026	c.730T>A	c.(730-732)Tca>Aca	p.S244T		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	244	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.S244T(1)		breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			ACCTTGAGTGACTGAGTCTCA	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	131.0	138.0					4																	1838164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.730T>A	4.37:g.1838164A>T	ENSP00000305653:p.Ser244Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DED2|Q9UF65	Missense_Mutation	SNP	pfam_LETM1,pfscan_EF_HAND_2	p.S244T	ENST00000302787.2	37	c.730	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163167	0.57476	.	.	ENSG00000168924	ENST00000302787;ENST00000417150	T	0.41400	1.0	4.14	4.14	0.48551	LETM1-like (1);	0.000000	0.85682	D	0.000000	T	0.49729	0.1574	L	0.39085	1.19	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.995;0.994;0.996	T	0.35895	-0.9770	10	0.12430	T	0.62	-25.0427	13.3191	0.60423	1.0:0.0:0.0:0.0	.	244;204;244	O95202-3;O95202-2;O95202	.;.;LETM1_HUMAN	T	244;204	ENSP00000305653:S244T	ENSP00000305653:S244T	S	-	1	0	LETM1	1807962	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	7.145000	0.77365	1.743000	0.51761	0.533000	0.62120	TCA	LETM1	-	pfam_LETM1	ENSG00000168924		0.468	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	102	0.00	0	A			1838164	1838164	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	missense	78	28.44	31	SNP	1.000	T
LETM1	3954	genome.wustl.edu	37	4	1838164	1838164	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr4:1838164A>T	ENST00000302787.2	-	4	1026	c.730T>A	c.(730-732)Tca>Aca	p.S244T		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	244	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.S244T(1)		breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			ACCTTGAGTGACTGAGTCTCA	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	131.0	138.0					4																	1838164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.730T>A	4.37:g.1838164A>T	ENSP00000305653:p.Ser244Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DED2|Q9UF65	Missense_Mutation	SNP	pfam_LETM1,pfscan_EF_HAND_2	p.S244T	ENST00000302787.2	37	c.730	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163167	0.57476	.	.	ENSG00000168924	ENST00000302787;ENST00000417150	T	0.41400	1.0	4.14	4.14	0.48551	LETM1-like (1);	0.000000	0.85682	D	0.000000	T	0.49729	0.1574	L	0.39085	1.19	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.995;0.994;0.996	T	0.35895	-0.9770	10	0.12430	T	0.62	-25.0427	13.3191	0.60423	1.0:0.0:0.0:0.0	.	244;204;244	O95202-3;O95202-2;O95202	.;.;LETM1_HUMAN	T	244;204	ENSP00000305653:S244T	ENSP00000305653:S244T	S	-	1	0	LETM1	1807962	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	7.145000	0.77365	1.743000	0.51761	0.533000	0.62120	TCA	LETM1	-	pfam_LETM1	ENSG00000168924		0.468	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	98	0.00	0	A			1838164	1838164	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	missense	78	28.44	31	SNP	1.000	T
LPA	4018	genome.wustl.edu	37	6	161015051	161015051	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr6:161015051G>A	ENST00000316300.5	-	22	3612	c.3568C>T	c.(3568-3570)Cag>Tag	p.Q1190*	LPA_ENST00000447678.1_Nonsense_Mutation_p.Q1190*			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3698	Kringle 11. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.Q1190*(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GACCAAGACTGACATGTCCTT	0.498																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											156.0	157.0	156.0					6																	161015051		2068	4242	6310	-	-	-	SO:0001587	stop_gained	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3568C>T	6.37:g.161015051G>A	ENSP00000321334:p.Gln1190*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTD7|Q9UD88	Nonsense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.Q1190*	ENST00000316300.5	37	c.3568	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	37	6.475743	0.97598	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.56	2.56	0.30785	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.6141	0.33820	0.0:0.0:1.0:0.0	.	.	.	.	X	1190	.	ENSP00000321334:Q1190X	Q	-	1	0	LPA	160935041	1.000000	0.71417	0.282000	0.24776	0.250000	0.25880	5.176000	0.65026	1.415000	0.47037	0.436000	0.28706	CAG	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.498	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	240	0.00	0	G	NM_005577		161015051	161015051	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	nonsense	71	43.65	55	SNP	0.402	A
LPA	4018	genome.wustl.edu	37	6	161015051	161015051	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr6:161015051G>A	ENST00000316300.5	-	22	3612	c.3568C>T	c.(3568-3570)Cag>Tag	p.Q1190*	LPA_ENST00000447678.1_Nonsense_Mutation_p.Q1190*			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3698	Kringle 11. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.Q1190*(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GACCAAGACTGACATGTCCTT	0.498																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											156.0	157.0	156.0					6																	161015051		2068	4242	6310	-	-	-	SO:0001587	stop_gained	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3568C>T	6.37:g.161015051G>A	ENSP00000321334:p.Gln1190*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTD7|Q9UD88	Nonsense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.Q1190*	ENST00000316300.5	37	c.3568	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	37	6.475743	0.97598	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.56	2.56	0.30785	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.6141	0.33820	0.0:0.0:1.0:0.0	.	.	.	.	X	1190	.	ENSP00000321334:Q1190X	Q	-	1	0	LPA	160935041	1.000000	0.71417	0.282000	0.24776	0.250000	0.25880	5.176000	0.65026	1.415000	0.47037	0.436000	0.28706	CAG	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.498	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	258	0.00	0	G	NM_005577		161015051	161015051	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	nonsense	71	43.65	55	SNP	0.402	A
MAGEC1	9947	genome.wustl.edu	37	X	140995480	140995480	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chrX:140995480C>G	ENST00000285879.4	+	4	2576	c.2290C>G	c.(2290-2292)Cag>Gag	p.Q764E	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	764								p.Q764E(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGAGTCCTCAGAGTCCTCC	0.542										HNSCC(15;0.026)																												dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	142.0	138.0					X																	140995480		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2290C>G	X.37:g.140995480C>G	ENSP00000285879:p.Gln764Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.Q764E	ENST00000285879.4	37	c.2290	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	c	4.468	0.086692	0.08583	.	.	ENSG00000155495	ENST00000285879	T	0.02197	4.4	1.2	-2.4	0.06583	.	.	.	.	.	T	0.01661	0.0053	N	0.24115	0.695	0.09310	N	1	B	0.22080	0.064	B	0.22880	0.042	T	0.46205	-0.9208	9	0.62326	D	0.03	.	3.7342	0.08504	0.0:0.2754:0.5067:0.2179	.	764	O60732	MAGC1_HUMAN	E	764	ENSP00000285879:Q764E	ENSP00000285879:Q764E	Q	+	1	0	MAGEC1	140823146	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.354000	0.02614	-0.364000	0.08088	-0.764000	0.03450	CAG	MAGEC1	-	NULL	ENSG00000155495		0.542	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	115	0.00	0	C	NM_005462		140995480	140995480	+1	no_errors	ENST00000285879	ensembl	human	known	69_37n	missense	76	28.30	30	SNP	0.000	G
MAGEC1	9947	genome.wustl.edu	37	X	140995480	140995480	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chrX:140995480C>G	ENST00000285879.4	+	4	2576	c.2290C>G	c.(2290-2292)Cag>Gag	p.Q764E	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	764								p.Q764E(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGAGTCCTCAGAGTCCTCC	0.542										HNSCC(15;0.026)																												dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	142.0	138.0					X																	140995480		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2290C>G	X.37:g.140995480C>G	ENSP00000285879:p.Gln764Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.Q764E	ENST00000285879.4	37	c.2290	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	c	4.468	0.086692	0.08583	.	.	ENSG00000155495	ENST00000285879	T	0.02197	4.4	1.2	-2.4	0.06583	.	.	.	.	.	T	0.01661	0.0053	N	0.24115	0.695	0.09310	N	1	B	0.22080	0.064	B	0.22880	0.042	T	0.46205	-0.9208	9	0.62326	D	0.03	.	3.7342	0.08504	0.0:0.2754:0.5067:0.2179	.	764	O60732	MAGC1_HUMAN	E	764	ENSP00000285879:Q764E	ENSP00000285879:Q764E	Q	+	1	0	MAGEC1	140823146	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.354000	0.02614	-0.364000	0.08088	-0.764000	0.03450	CAG	MAGEC1	-	NULL	ENSG00000155495		0.542	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	99	0.00	0	C	NM_005462		140995480	140995480	+1	no_errors	ENST00000285879	ensembl	human	known	69_37n	missense	76	28.30	30	SNP	0.000	G
MELK	9833	genome.wustl.edu	37	9	36651752	36651752	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr9:36651752G>A	ENST00000298048.2	+	12	1115	c.931G>A	c.(931-933)Gat>Aat	p.D311N	MELK_ENST00000545008.1_Missense_Mutation_p.D240N|MELK_ENST00000541717.1_Missense_Mutation_p.D311N|MELK_ENST00000536329.1_Missense_Mutation_p.D240N|MELK_ENST00000536987.1_Missense_Mutation_p.D180N|MELK_ENST00000538311.1_Missense_Mutation_p.D117N|MELK_ENST00000543751.1_Missense_Mutation_p.D279N|MELK_ENST00000536860.1_Missense_Mutation_p.D263N	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	311	UBA-like.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)	p.D311N(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GTGGCAGTATGATCACCTCAC	0.393																																					Ovarian(82;980 1317 7225 14391 18624)	dbGAP											1	Substitution - Missense(1)	breast(1)											232.0	232.0	232.0					9																	36651752		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.931G>A	9.37:g.36651752G>A	ENSP00000298048:p.Asp311Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D311N	ENST00000298048.2	37	c.931	CCDS6606.1	9	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661980	0.88251	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.72835	-0.49;0.44;0.31;0.83;0.21;-0.69;-0.37;-0.5	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.84124	0.5403	M	0.82323	2.585	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.998;0.996;0.998	T	0.82345	-0.0503	10	0.27785	T	0.31	-18.6686	15.2097	0.73209	0.0:0.0:1.0:0.0	.	231;240;263;311;240;279;311	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	N	311;117;180;240;263;240;311;279	ENSP00000298048:D311N;ENSP00000438226:D117N;ENSP00000439184:D180N;ENSP00000445452:D240N;ENSP00000439792:D263N;ENSP00000443550:D240N;ENSP00000437804:D311N;ENSP00000441596:D279N	ENSP00000298048:D311N	D	+	1	0	MELK	36641752	1.000000	0.71417	0.992000	0.48379	0.971000	0.66376	5.315000	0.65810	2.652000	0.90054	0.655000	0.94253	GAT	MELK	-	NULL	ENSG00000165304		0.393	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MELK	HGNC	protein_coding	OTTHUMT00000052428.3	160	0.00	0	G	NM_014791		36651752	36651752	+1	no_errors	ENST00000298048	ensembl	human	known	69_37n	missense	99	35.29	54	SNP	1.000	A
MPC2	25874	genome.wustl.edu	37	1	167889845	167889845	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr1:167889845C>T	ENST00000367846.4	-	3	373	c.175G>A	c.(175-177)Gat>Aat	p.D59N	MPC2_ENST00000271373.4_Missense_Mutation_p.D59N	NM_015415.3	NP_056230.1	O95563	MPC2_HUMAN	mitochondrial pyruvate carrier 2	59					cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate transmembrane transporter activity (GO:0050833)	p.D59N(1)									CTGGCCATATCAGCCAATCCA	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	70.0	72.0					1																	167889845		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1266.1	1q24	2012-07-30	2012-07-30	2012-07-30	ENSG00000143158	ENSG00000143158			24515	protein-coding gene	gene with protein product		614737	"""brain protein 44"""	BRP44		3022128, 22628558	Standard	NM_015415		Approved	DKFZP564B167	uc001get.3	O95563	OTTHUMG00000034570	ENST00000367846.4:c.175G>A	1.37:g.167889845C>T	ENSP00000356820:p.Asp59Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K261|Q3SXR6|Q6FIF3	Missense_Mutation	SNP	pfam_UPF0041	p.D59N	ENST00000367846.4	37	c.175	CCDS1266.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.544947	0.96488	.	.	ENSG00000143158	ENST00000367846;ENST00000271373;ENST00000458574	D;D;D	0.84516	-1.86;-1.86;-1.86	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.95348	0.8490	H	0.96861	3.895	0.58432	D	0.999990	D	0.89917	1.0	D	0.91635	0.999	D	0.95878	0.8896	9	0.87932	D	0	-7.8089	19.6313	0.95704	0.0:1.0:0.0:0.0	.	59	O95563	BR44_HUMAN	N	59	ENSP00000356820:D59N;ENSP00000271373:D59N;ENSP00000392874:D59N	ENSP00000271373:D59N	D	-	1	0	BRP44	166156469	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.737000	0.74816	2.937000	0.99478	0.650000	0.86243	GAT	MPC2	-	pfam_UPF0041	ENSG00000143158		0.363	MPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPC2	HGNC	protein_coding	OTTHUMT00000083652.1	112	0.00	0	C	NM_015415		167889845	167889845	-1	no_errors	ENST00000271373	ensembl	human	known	69_37n	missense	44	42.86	33	SNP	1.000	T
MUC12	10071	genome.wustl.edu	37	7	100646235	100646235	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr7:100646235G>A	ENST00000379442.3	+	5	12820	c.12820G>A	c.(12820-12822)Gaa>Aaa	p.E4274K	MUC12_ENST00000536621.1_Missense_Mutation_p.E4131K			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4274	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CCGTAGTGAGGAATCAACAAC	0.537																																						dbGAP											0													8.0	7.0	7.0					7																	100646235		488	1060	1548	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12820G>A	7.37:g.100646235G>A	ENSP00000368755:p.Glu4274Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.E4274K	ENST00000379442.3	37	c.12820		7	.	.	.	.	.	.	.	.	.	.	g	3.850	-0.031993	0.07543	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12569	2.67;2.67	0.53	0.53	0.17102	.	.	.	.	.	T	0.05593	0.0147	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.44360	-0.9333	6	0.13108	T	0.6	.	.	.	.	.	.	.	.	K	4274;4131	ENSP00000368755:E4274K;ENSP00000441929:E4131K	ENSP00000368755:E4274K	E	+	1	0	MUC12	100432955	0.017000	0.18338	0.006000	0.13384	0.023000	0.10783	-0.270000	0.08584	0.519000	0.28406	0.195000	0.17529	GAA	MUC12	-	NULL	ENSG00000205277		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	39	0.00	0	G	XM_379904		100646235	100646235	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	98	13.27	15	SNP	0.013	A
MUC12	10071	genome.wustl.edu	37	7	100661916	100661916	+	Silent	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr7:100661916G>A	ENST00000379442.3	+	15	16436	c.16436G>A	c.(16435-16437)tGa>tAa	p.*5479*	RP11-395B7.4_ENST00000441882.1_RNA|MUC17_ENST00000306151.4_5'Flank|RP11-395B7.4_ENST00000448513.1_RNA|MUC12_ENST00000536621.1_Silent_p.*5336*|MUC12_ENST00000467414.1_3'UTR			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	0					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.*5336*(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TCCACTGTGTGAGCCAACGGG	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											32.0	34.0	33.0					7																	100661916		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.16436G>A	7.37:g.100661916G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.*5479	ENST00000379442.3	37	c.16436		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.642	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	41	0.00	0	G	XM_379904		100661916	100661916	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	0.002	A
MUC12	10071	genome.wustl.edu	37	7	100661916	100661916	+	Silent	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr7:100661916G>A	ENST00000379442.3	+	15	16436	c.16436G>A	c.(16435-16437)tGa>tAa	p.*5479*	RP11-395B7.4_ENST00000441882.1_RNA|MUC17_ENST00000306151.4_5'Flank|RP11-395B7.4_ENST00000448513.1_RNA|MUC12_ENST00000536621.1_Silent_p.*5336*|MUC12_ENST00000467414.1_3'UTR			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	0					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.*5336*(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TCCACTGTGTGAGCCAACGGG	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											32.0	34.0	33.0					7																	100661916		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.16436G>A	7.37:g.100661916G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.*5479	ENST00000379442.3	37	c.16436		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.642	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	79	0.00	0	G	XM_379904		100661916	100661916	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	0.002	A
MUC4	4585	genome.wustl.edu	37	3	195506117	195506117	+	Missense_Mutation	SNP	G	G	T	rs200320052		TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr3:195506117G>T	ENST00000463781.3	-	2	12793	c.12334C>A	c.(12334-12336)Cct>Act	p.P4112T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4112T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGCGTGGTGTCA	0.587																																						dbGAP											0													10.0	7.0	8.0					3																	195506117		560	1435	1995	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12334C>A	3.37:g.195506117G>T	ENSP00000417498:p.Pro4112Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.P4112T	ENST00000463781.3	37	c.12334	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	3.981	-0.006331	0.07773	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28666	1.6;1.63	.	.	.	.	.	.	.	.	T	0.12689	0.0308	N	0.19112	0.55	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.14062	-1.0486	7	.	.	.	.	3.4548	0.07511	1.0E-4:1.0E-4:0.5523:0.4476	.	3984	E7ESK3	.	T	4112	ENSP00000417498:P4112T;ENSP00000420243:P4112T	.	P	-	1	0	MUC4	196990896	0.002000	0.14202	0.017000	0.16124	0.033000	0.12548	0.019000	0.13444	0.489000	0.27749	0.074000	0.15403	CCT	MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	17	0.00	0	G	NM_018406		195506117	195506117	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	64	27.27	24	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195513168	195513168	+	Silent	SNP	A	A	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr3:195513168A>T	ENST00000463781.3	-	2	5742	c.5283T>A	c.(5281-5283)ctT>ctA	p.L1761L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.L1761L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGACAGGAAGAGGGGTGG	0.582																																						dbGAP											0													54.0	49.0	51.0					3																	195513168		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5283T>A	3.37:g.195513168A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.L1761	ENST00000463781.3	37	c.5283	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	565	0.00	0	A	NM_018406		195513168	195513168	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	714	12.64	104	SNP	0.008	T
MUC4	4585	genome.wustl.edu	37	3	195513168	195513168	+	Silent	SNP	A	A	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr3:195513168A>T	ENST00000463781.3	-	2	5742	c.5283T>A	c.(5281-5283)ctT>ctA	p.L1761L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.L1761L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGACAGGAAGAGGGGTGG	0.582																																						dbGAP											0													54.0	49.0	51.0					3																	195513168		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5283T>A	3.37:g.195513168A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.L1761	ENST00000463781.3	37	c.5283	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	210	0.94	2	A	NM_018406		195513168	195513168	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	714	12.64	104	SNP	0.008	T
NEK1	4750	genome.wustl.edu	37	4	170476976	170476976	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr4:170476976delC	ENST00000439128.2	-	17	2097	c.1457delG	c.(1456-1458)ggafs	p.G486fs	NEK1_ENST00000507142.1_Frame_Shift_Del_p.G486fs|NEK1_ENST00000512193.1_Intron|NEK1_ENST00000511633.1_Intron|NEK1_ENST00000510533.1_Intron	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	486					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.G486fs*22(2)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		ATAAGGAAATCCTGGACGAAC	0.408																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)											104.0	99.0	101.0					4																	170476976		1852	4095	5947	-	-	-	SO:0001589	frameshift_variant	0			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1457delG	4.37:g.170476976delC	ENSP00000408020:p.Gly486fs	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G486fs	ENST00000439128.2	37	c.1457	CCDS47162.1	4																																																																																			NEK1	-	NULL	ENSG00000137601		0.408	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	HGNC	protein_coding	OTTHUMT00000363157.3	134	0.00	0	C			170476976	170476976	-1	no_errors	ENST00000507142	ensembl	human	known	69_37n	frame_shift_del	89	28.23	35	DEL	1.000	-
ODF2	4957	genome.wustl.edu	37	9	131256860	131256860	+	Silent	SNP	G	G	A	rs376502871		TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr9:131256860G>A	ENST00000434106.3	+	17	2187	c.1824G>A	c.(1822-1824)gcG>gcA	p.A608A	ODF2_ENST00000444119.2_Silent_p.A584A|ODF2_ENST00000372791.3_Silent_p.A589A|ODF2_ENST00000604420.1_Silent_p.A608A|ODF2_ENST00000393533.2_Silent_p.A608A|ODF2_ENST00000546203.1_Silent_p.A589A|ODF2_ENST00000351030.3_Silent_p.A603A|ODF2_ENST00000372814.3_Silent_p.A652A|ODF2_ENST00000448249.3_Silent_p.A527A|ODF2_ENST00000372807.5_Silent_p.A603A|ODF2_ENST00000393527.3_Silent_p.A584A	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	608					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.A584A(3)|p.A652A(2)|p.A608A(2)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						TCACGGAGGCGAAGCTGGCTG	0.577																																						dbGAP											7	Substitution - coding silent(7)	breast(6)|upper_aerodigestive_tract(1)											71.0	62.0	65.0					9																	131256860		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1824G>A	9.37:g.131256860G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Silent	SNP	NULL	p.A608	ENST00000434106.3	37	c.1824	CCDS56588.1	9																																																																																			ODF2	-	NULL	ENSG00000136811		0.577	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3	64	0.00	0	G			131256860	131256860	+1	no_errors	ENST00000372796	ensembl	human	known	69_37n	silent	39	33.90	20	SNP	0.657	A
PGAP2	27315	genome.wustl.edu	37	11	3819319	3819319	+	3'UTR	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr11:3819319C>T	ENST00000532017.1	+	0	101				NUP98_ENST00000397004.4_5'Flank|NUP98_ENST00000355260.3_5'Flank|NUP98_ENST00000359171.4_5'Flank|NUP98_ENST00000397007.4_5'Flank|NUP98_ENST00000324932.7_5'Flank|PGAP2_ENST00000396993.4_Intron|PGAP2_ENST00000396991.2_Intron|PGAP2_ENST00000300730.6_Intron|PGAP2_ENST00000396986.2_Intron	NR_027017.2		Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2						GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						AGCCTGAGGGCCCTCTTGGAA	0.622																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000532017.1:c.*98C>T	11.37:g.3819319C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	RNA	SNP	-	NULL	ENST00000532017.1	37	NULL		11																																																																																			PGAP2	-	-	ENSG00000148985		0.622	PGAP2-040	KNOWN	basic	processed_transcript	PGAP2	HGNC	protein_coding	OTTHUMT00000383184.2	33	0.00	0	C			3819319	3819319	+1	no_errors	ENST00000489571	ensembl	human	known	69_37n	rna	16	33.33	8	SNP	0.000	T
PGAP2	27315	genome.wustl.edu	37	11	3819319	3819319	+	3'UTR	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr11:3819319C>T	ENST00000532017.1	+	0	101				NUP98_ENST00000397004.4_5'Flank|NUP98_ENST00000355260.3_5'Flank|NUP98_ENST00000359171.4_5'Flank|NUP98_ENST00000397007.4_5'Flank|NUP98_ENST00000324932.7_5'Flank|PGAP2_ENST00000396993.4_Intron|PGAP2_ENST00000396991.2_Intron|PGAP2_ENST00000300730.6_Intron|PGAP2_ENST00000396986.2_Intron	NR_027017.2		Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2						GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						AGCCTGAGGGCCCTCTTGGAA	0.622																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000532017.1:c.*98C>T	11.37:g.3819319C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	RNA	SNP	-	NULL	ENST00000532017.1	37	NULL		11																																																																																			PGAP2	-	-	ENSG00000148985		0.622	PGAP2-040	KNOWN	basic	processed_transcript	PGAP2	HGNC	protein_coding	OTTHUMT00000383184.2	13	0.00	0	C			3819319	3819319	+1	no_errors	ENST00000489571	ensembl	human	known	69_37n	rna	16	33.33	8	SNP	0.000	T
PLCG1	5335	genome.wustl.edu	37	20	39796490	39796490	+	Splice_Site	SNP	A	A	G			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr20:39796490A>G	ENST00000373271.1	+	20	2706		c.e20-1		PLCG1_ENST00000244007.3_Splice_Site|PLCG1_ENST00000373272.2_Splice_Site	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1						activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)	p.?(1)		breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				TCCTGTTTCCAGGAGCCTGAC	0.547																																						dbGAP											1	Unknown(1)	breast(1)											69.0	62.0	65.0					20																	39796490		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.2302-1A>G	20.37:g.39796490A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Splice_Site	SNP	-	e20-2	ENST00000373271.1	37	c.2302-2	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	A	18.27	3.587590	0.66105	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3067	0.73998	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLCG1	39229904	1.000000	0.71417	0.993000	0.49108	0.770000	0.43624	8.509000	0.90529	2.205000	0.71048	0.533000	0.62120	.	PLCG1	-	-	ENSG00000124181		0.547	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3	99	0.00	0	A	NM_182811	Intron	39796490	39796490	+1	no_errors	ENST00000244007	ensembl	human	known	69_37n	splice_site	63	37.62	38	SNP	1.000	G
PLXNB2	23654	genome.wustl.edu	37	22	50720382	50720382	+	Silent	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr22:50720382G>A	ENST00000449103.1	-	20	3386	c.3246C>T	c.(3244-3246)ctC>ctT	p.L1082L	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_Silent_p.L1082L			O15031	PLXB2_HUMAN	plexin B2	1082	IPT/TIG 3.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.L1125L(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCTCTGTTCTGAGCAGGGCAC	0.617																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											51.0	56.0	54.0					22																	50720382		2038	4166	6204	-	-	-	SO:0001819	synonymous_variant	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3246C>T	22.37:g.50720382G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	NULL	p.S100L	ENST00000449103.1	37	c.299	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	G	2.601	-0.293008	0.05568	.	.	ENSG00000196576	ENST00000427829	.	.	.	4.63	-0.721	0.11189	.	.	.	.	.	T	0.18173	0.0436	.	.	.	0.20307	N	0.999912	.	.	.	.	.	.	T	0.22138	-1.0225	4	.	.	.	.	0.0624	0.00016	0.2697:0.1892:0.2413:0.2999	.	.	.	.	L	100	.	.	S	-	2	0	PLXNB2	49062509	0.001000	0.12720	0.988000	0.46212	0.298000	0.27526	-0.526000	0.06207	-0.056000	0.13221	0.313000	0.20887	TCA	PLXNB2	-	NULL	ENSG00000196576		0.617	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	40	0.00	0	G	NM_012401		50720382	50720382	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000427829	ensembl	human	putative	69_37n	missense	17	41.94	13	SNP	0.270	A
PTPN4	5775	genome.wustl.edu	37	2	120702704	120702705	+	Missense_Mutation	DNP	AA	AA	CC			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr2:120702704_120702705AA>CC	ENST00000263708.2	+	16	2174_2175	c.1403_1404AA>CC	c.(1402-1404)aAA>aCC	p.K468T	PTPN4_ENST00000544261.1_Missense_Mutation_p.K101T	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	468					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TTACCACCCAAACAGTCAAAGA	0.356																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	Exception_encountered	2.37:g.120702704_120702705delinsCC	ENSP00000263708:p.Lys468Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV8|Q9UDA7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin	p.K468T|p.K468N	ENST00000263708.2	37	c.1403|c.1404	CCDS2129.1	2																																																																																			PTPN4	-	pirsf_Tyr_Pase_non-rcpt_typ-3/4	ENSG00000088179		0.356	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	95	0.00	0	A			120702704|120702705	120702704|120702705	+1	no_errors	ENST00000263708	ensembl	human	known	69_37n	missense	50	42.53|43.18	37|38	SNP	1.000	C
PTPN4	5775	genome.wustl.edu	37	2	120702704	120702705	+	Missense_Mutation	DNP	AA	AA	CC			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr2:120702704_120702705AA>CC	ENST00000263708.2	+	16	2174_2175	c.1403_1404AA>CC	c.(1402-1404)aAA>aCC	p.K468T	PTPN4_ENST00000544261.1_Missense_Mutation_p.K101T	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	468					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TTACCACCCAAACAGTCAAAGA	0.356																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	Exception_encountered	2.37:g.120702704_120702705delinsCC	ENSP00000263708:p.Lys468Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV8|Q9UDA7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin	p.K468T|p.K468N	ENST00000263708.2	37	c.1403|c.1404	CCDS2129.1	2																																																																																			PTPN4	-	pirsf_Tyr_Pase_non-rcpt_typ-3/4	ENSG00000088179		0.356	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	101|104	0.98|0.95	1	A			120702704|120702705	120702704|120702705	+1	no_errors	ENST00000263708	ensembl	human	known	69_37n	missense	50	42.53|43.18	37|38	SNP	1.000	C
RAD54L	8438	genome.wustl.edu	37	1	46738424	46738424	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr1:46738424T>C	ENST00000371975.4	+	12	1999	c.1325T>C	c.(1324-1326)aTg>aCg	p.M442T	RAD54L_ENST00000473251.1_3'UTR|RAD54L_ENST00000442598.1_Missense_Mutation_p.M442T	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	442					chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.M442T(1)		breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		GAGGGCAAGATGAGTGTGTCT	0.498								Direct reversal of damage;Homologous recombination																														dbGAP											1	Substitution - Missense(1)	breast(1)											181.0	153.0	162.0					1																	46738424		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.1325T>C	1.37:g.46738424T>C	ENSP00000361043:p.Met442Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TE31|Q6IUY3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_Rad54_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M442T	ENST00000371975.4	37	c.1325	CCDS532.1	1	.	.	.	.	.	.	.	.	.	.	T	8.930	0.963203	0.18583	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	T;T	0.74842	-0.88;-0.88	5.01	5.01	0.66863	SNF2-related (1);	0.185180	0.64402	D	0.000008	T	0.56202	0.1969	N	0.12569	0.235	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.13407	0.003;0.009	T	0.52719	-0.8538	10	0.13470	T	0.59	-14.4643	14.9272	0.70887	0.0:0.0:0.0:1.0	.	262;442	G3V1N0;Q92698	.;RAD54_HUMAN	T	442;442;262	ENSP00000396113:M442T;ENSP00000361043:M442T	ENSP00000361043:M442T	M	+	2	0	RAD54L	46511011	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.895000	0.69814	2.115000	0.64714	0.529000	0.55759	ATG	RAD54L	-	pfam_SNF2_N	ENSG00000085999		0.498	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L	HGNC	protein_coding	OTTHUMT00000021272.1	189	0.00	0	T	NM_003579		46738424	46738424	+1	no_errors	ENST00000371975	ensembl	human	known	69_37n	missense	117	32.76	57	SNP	1.000	C
RAD54L	8438	genome.wustl.edu	37	1	46738424	46738424	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr1:46738424T>C	ENST00000371975.4	+	12	1999	c.1325T>C	c.(1324-1326)aTg>aCg	p.M442T	RAD54L_ENST00000473251.1_3'UTR|RAD54L_ENST00000442598.1_Missense_Mutation_p.M442T	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	442					chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.M442T(1)		breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		GAGGGCAAGATGAGTGTGTCT	0.498								Direct reversal of damage;Homologous recombination																														dbGAP											1	Substitution - Missense(1)	breast(1)											181.0	153.0	162.0					1																	46738424		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.1325T>C	1.37:g.46738424T>C	ENSP00000361043:p.Met442Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TE31|Q6IUY3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_Rad54_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M442T	ENST00000371975.4	37	c.1325	CCDS532.1	1	.	.	.	.	.	.	.	.	.	.	T	8.930	0.963203	0.18583	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	T;T	0.74842	-0.88;-0.88	5.01	5.01	0.66863	SNF2-related (1);	0.185180	0.64402	D	0.000008	T	0.56202	0.1969	N	0.12569	0.235	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.13407	0.003;0.009	T	0.52719	-0.8538	10	0.13470	T	0.59	-14.4643	14.9272	0.70887	0.0:0.0:0.0:1.0	.	262;442	G3V1N0;Q92698	.;RAD54_HUMAN	T	442;442;262	ENSP00000396113:M442T;ENSP00000361043:M442T	ENSP00000361043:M442T	M	+	2	0	RAD54L	46511011	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.895000	0.69814	2.115000	0.64714	0.529000	0.55759	ATG	RAD54L	-	pfam_SNF2_N	ENSG00000085999		0.498	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L	HGNC	protein_coding	OTTHUMT00000021272.1	226	0.44	1	T	NM_003579		46738424	46738424	+1	no_errors	ENST00000371975	ensembl	human	known	69_37n	missense	117	32.76	57	SNP	1.000	C
RASGRP2	10235	genome.wustl.edu	37	11	64497587	64497587	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr11:64497587C>T	ENST00000354024.3	-	13	1744	c.1492G>A	c.(1492-1494)Gta>Ata	p.V498I	RASGRP2_ENST00000394432.3_Missense_Mutation_p.V498I|RASGRP2_ENST00000377494.1_Missense_Mutation_p.V498I|RASGRP2_ENST00000377497.3_Missense_Mutation_p.V498I	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	498					blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.V560I(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAGTTGTGTACGAAGCCCATG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	25.0	26.0					11																	64497587		2060	4054	6114	-	-	-	SO:0001583	missense	0			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.1492G>A	11.37:g.64497587C>T	ENSP00000338864:p.Val498Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.V498I	ENST00000354024.3	37	c.1492	CCDS31598.1	11	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829241	0.32329	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	4.46	4.46	0.54185	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.187290	0.43579	D	0.000553	T	0.64864	0.2637	N	0.04297	-0.235	0.80722	D	1	B;B	0.18166	0.026;0.026	B;B	0.08055	0.003;0.001	T	0.60616	-0.7228	10	0.15499	T	0.54	-19.9114	8.5641	0.33530	0.0:0.8955:0.0:0.1045	.	498;498	Q7LDG7;A6NDC7	GRP2_HUMAN;.	I	498	ENSP00000366714:V498I;ENSP00000377953:V498I;ENSP00000366717:V498I;ENSP00000338864:V498I	ENSP00000338864:V498I	V	-	1	0	RASGRP2	64254163	0.944000	0.32072	1.000000	0.80357	0.997000	0.91878	0.080000	0.14802	2.471000	0.83476	0.561000	0.74099	GTA	RASGRP2	-	pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000068831		0.647	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1	31	0.00	0	C	NM_153819		64497587	64497587	-1	no_errors	ENST00000377494	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	1.000	T
RASGRP2	10235	genome.wustl.edu	37	11	64497587	64497587	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr11:64497587C>T	ENST00000354024.3	-	13	1744	c.1492G>A	c.(1492-1494)Gta>Ata	p.V498I	RASGRP2_ENST00000394432.3_Missense_Mutation_p.V498I|RASGRP2_ENST00000377494.1_Missense_Mutation_p.V498I|RASGRP2_ENST00000377497.3_Missense_Mutation_p.V498I	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	498					blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.V560I(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAGTTGTGTACGAAGCCCATG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	25.0	26.0					11																	64497587		2060	4054	6114	-	-	-	SO:0001583	missense	0			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.1492G>A	11.37:g.64497587C>T	ENSP00000338864:p.Val498Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.V498I	ENST00000354024.3	37	c.1492	CCDS31598.1	11	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829241	0.32329	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	4.46	4.46	0.54185	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.187290	0.43579	D	0.000553	T	0.64864	0.2637	N	0.04297	-0.235	0.80722	D	1	B;B	0.18166	0.026;0.026	B;B	0.08055	0.003;0.001	T	0.60616	-0.7228	10	0.15499	T	0.54	-19.9114	8.5641	0.33530	0.0:0.8955:0.0:0.1045	.	498;498	Q7LDG7;A6NDC7	GRP2_HUMAN;.	I	498	ENSP00000366714:V498I;ENSP00000377953:V498I;ENSP00000366717:V498I;ENSP00000338864:V498I	ENSP00000338864:V498I	V	-	1	0	RASGRP2	64254163	0.944000	0.32072	1.000000	0.80357	0.997000	0.91878	0.080000	0.14802	2.471000	0.83476	0.561000	0.74099	GTA	RASGRP2	-	pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000068831		0.647	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1	28	0.00	0	C	NM_153819		64497587	64497587	-1	no_errors	ENST00000377494	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	1.000	T
REV3L	5980	genome.wustl.edu	37	6	111697571	111697571	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr6:111697571C>T	ENST00000358835.3	-	14	2441	c.1987G>A	c.(1987-1989)Gaa>Aaa	p.E663K	REV3L_ENST00000368805.1_Missense_Mutation_p.E663K|REV3L_ENST00000368802.3_Missense_Mutation_p.E663K|REV3L_ENST00000435970.1_Missense_Mutation_p.E585K			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	663					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.E585K(1)|p.E663K(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ATATCTTCTTCATAATCAAAA	0.318								DNA polymerases (catalytic subunits)																														dbGAP											2	Substitution - Missense(2)	breast(2)											56.0	58.0	57.0					6																	111697571		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.1987G>A	6.37:g.111697571C>T	ENSP00000351697:p.Glu663Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.E663K	ENST00000358835.3	37	c.1987	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799627	0.31869	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01538	4.88;4.88;4.88;4.79	5.31	5.31	0.75309	Ribonuclease H-like (1);	0.462884	0.22995	N	0.053148	T	0.00967	0.0032	L	0.32530	0.975	0.31223	N	0.697263	P	0.38922	0.651	B	0.33521	0.165	T	0.53676	-0.8405	10	0.52906	T	0.07	-26.242	17.9754	0.89126	0.0:1.0:0.0:0.0	.	663	O60673	DPOLZ_HUMAN	K	663;663;663;585	ENSP00000357792:E663K;ENSP00000357795:E663K;ENSP00000351697:E663K;ENSP00000402003:E585K	ENSP00000351697:E663K	E	-	1	0	REV3L	111804264	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.136000	0.71703	2.491000	0.84063	0.563000	0.77884	GAA	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.318	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	97	0.00	0	C	NM_002912		111697571	111697571	-1	no_errors	ENST00000358835	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	1.000	T
REV3L	5980	genome.wustl.edu	37	6	111697571	111697571	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr6:111697571C>T	ENST00000358835.3	-	14	2441	c.1987G>A	c.(1987-1989)Gaa>Aaa	p.E663K	REV3L_ENST00000368805.1_Missense_Mutation_p.E663K|REV3L_ENST00000368802.3_Missense_Mutation_p.E663K|REV3L_ENST00000435970.1_Missense_Mutation_p.E585K			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	663					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.E585K(1)|p.E663K(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ATATCTTCTTCATAATCAAAA	0.318								DNA polymerases (catalytic subunits)																														dbGAP											2	Substitution - Missense(2)	breast(2)											56.0	58.0	57.0					6																	111697571		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.1987G>A	6.37:g.111697571C>T	ENSP00000351697:p.Glu663Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.E663K	ENST00000358835.3	37	c.1987	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799627	0.31869	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01538	4.88;4.88;4.88;4.79	5.31	5.31	0.75309	Ribonuclease H-like (1);	0.462884	0.22995	N	0.053148	T	0.00967	0.0032	L	0.32530	0.975	0.31223	N	0.697263	P	0.38922	0.651	B	0.33521	0.165	T	0.53676	-0.8405	10	0.52906	T	0.07	-26.242	17.9754	0.89126	0.0:1.0:0.0:0.0	.	663	O60673	DPOLZ_HUMAN	K	663;663;663;585	ENSP00000357792:E663K;ENSP00000357795:E663K;ENSP00000351697:E663K;ENSP00000402003:E585K	ENSP00000351697:E663K	E	-	1	0	REV3L	111804264	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.136000	0.71703	2.491000	0.84063	0.563000	0.77884	GAA	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.318	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	57	0.00	0	C	NM_002912		111697571	111697571	-1	no_errors	ENST00000358835	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	1.000	T
SEC24C	9632	genome.wustl.edu	37	10	75527697	75527697	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr10:75527697G>A	ENST00000339365.2	+	16	2275	c.2113G>A	c.(2113-2115)Gat>Aat	p.D705N	SEC24C_ENST00000411652.2_Missense_Mutation_p.D586N|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000496827.1_Intron|SEC24C_ENST00000345254.4_Missense_Mutation_p.D705N	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	705					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.D705N(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					CCAGTATGTGGATGTGGCCAC	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											166.0	147.0	153.0					10																	75527697		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.2113G>A	10.37:g.75527697G>A	ENSP00000343405:p.Asp705Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZT4|Q8WV25	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.D705N	ENST00000339365.2	37	c.2113	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.689973	0.96784	.	.	ENSG00000176986	ENST00000345254;ENST00000339365;ENST00000411652	D;D;D	0.81579	-1.51;-1.51;-1.51	5.98	5.98	0.97165	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	D	0.93446	0.7909	H	0.95780	3.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.94389	0.7612	10	0.87932	D	0	-15.6719	20.4561	0.99145	0.0:0.0:1.0:0.0	.	586;705;705	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	N	705;705;586	ENSP00000321845:D705N;ENSP00000343405:D705N;ENSP00000402913:D586N	ENSP00000343405:D705N	D	+	1	0	SEC24C	75197703	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.760000	0.98935	2.847000	0.97988	0.591000	0.81541	GAT	SEC24C	-	pfam_Sec23/24_trunk_dom	ENSG00000176986		0.537	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	125	0.00	0	G			75527697	75527697	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	missense	61	37.76	37	SNP	1.000	A
SEC24C	9632	genome.wustl.edu	37	10	75527697	75527697	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr10:75527697G>A	ENST00000339365.2	+	16	2275	c.2113G>A	c.(2113-2115)Gat>Aat	p.D705N	SEC24C_ENST00000411652.2_Missense_Mutation_p.D586N|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000496827.1_Intron|SEC24C_ENST00000345254.4_Missense_Mutation_p.D705N	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	705					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.D705N(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					CCAGTATGTGGATGTGGCCAC	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											166.0	147.0	153.0					10																	75527697		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.2113G>A	10.37:g.75527697G>A	ENSP00000343405:p.Asp705Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZT4|Q8WV25	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.D705N	ENST00000339365.2	37	c.2113	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.689973	0.96784	.	.	ENSG00000176986	ENST00000345254;ENST00000339365;ENST00000411652	D;D;D	0.81579	-1.51;-1.51;-1.51	5.98	5.98	0.97165	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	D	0.93446	0.7909	H	0.95780	3.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.94389	0.7612	10	0.87932	D	0	-15.6719	20.4561	0.99145	0.0:0.0:1.0:0.0	.	586;705;705	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	N	705;705;586	ENSP00000321845:D705N;ENSP00000343405:D705N;ENSP00000402913:D586N	ENSP00000343405:D705N	D	+	1	0	SEC24C	75197703	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.760000	0.98935	2.847000	0.97988	0.591000	0.81541	GAT	SEC24C	-	pfam_Sec23/24_trunk_dom	ENSG00000176986		0.537	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	211	0.94	2	G			75527697	75527697	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	missense	61	37.76	37	SNP	1.000	A
STAU1	6780	genome.wustl.edu	37	20	47736592	47736592	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr20:47736592T>G	ENST00000371856.2	-	9	1450	c.1040A>C	c.(1039-1041)aAc>aCc	p.N347T	STAU1_ENST00000347458.5_Missense_Mutation_p.N266T|STAU1_ENST00000371828.3_Missense_Mutation_p.N272T|STAU1_ENST00000340954.7_Missense_Mutation_p.N266T|STAU1_ENST00000371802.1_Missense_Mutation_p.N272T|STAU1_ENST00000371792.1_Missense_Mutation_p.N264T|STAU1_ENST00000360426.4_Missense_Mutation_p.N266T	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	347	DRBM 3. {ECO:0000255|PROSITE- ProRule:PRU00266}.				intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.N347T(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			CTCCAGCATGTTCTCGGCTGC	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											139.0	97.0	112.0					20																	47736592		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.1040A>C	20.37:g.47736592T>G	ENSP00000360922:p.Asn347Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	p.N347T	ENST00000371856.2	37	c.1040	CCDS13414.1	20	.	.	.	.	.	.	.	.	.	.	T	16.19	3.052475	0.55218	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792	T;T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	5.81	5.81	0.92471	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.042605	0.85682	D	0.000000	T	0.77638	0.4160	L	0.53729	1.69	0.54753	D	0.99998	B;B	0.25312	0.091;0.123	B;B	0.34346	0.18;0.134	T	0.74414	-0.3673	10	0.42905	T	0.14	-15.2417	16.1678	0.81782	0.0:0.0:0.0:1.0	.	347;272	O95793;Q5JW29	STAU1_HUMAN;.	T	272;266;347;266;266;266;272;264	ENSP00000360893:N272T;ENSP00000345425:N266T;ENSP00000360922:N347T;ENSP00000353604:N266T;ENSP00000323443:N266T;ENSP00000360867:N272T;ENSP00000360857:N264T	ENSP00000345425:N266T	N	-	2	0	STAU1	47169999	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.995000	0.63908	2.218000	0.71995	0.528000	0.53228	AAC	STAU1	-	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	ENSG00000124214		0.547	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAU1	HGNC	protein_coding	OTTHUMT00000079633.1	73	0.00	0	T	NM_017453		47736592	47736592	-1	no_errors	ENST00000371856	ensembl	human	known	69_37n	missense	54	25.68	19	SNP	1.000	G
TAF1B	9014	genome.wustl.edu	37	2	9989571	9989571	+	Frame_Shift_Del	DEL	A	A	-	rs528368939		TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr2:9989571delA	ENST00000263663.5	+	3	375	c.187delA	c.(187-189)aaafs	p.K65fs	TAF1B_ENST00000396242.3_5'UTR|TAF1B_ENST00000402170.1_3'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	65	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCGGGGGCTTAAAAAAAAAAA	0.333																																						dbGAP											0										139,495,3606		1,2,135,2,489,1491	20.0	22.0	21.0			1.7	0.9	2		23	207,946,7081		0,0,207,0,946,2964	no	codingComplex	TAF1B	NM_005680.2		1,2,342,2,1435,4455	A1A1,A1A2,A1R,A2A2,A2R,RR		14.0029,14.9528,14.3258			9989571	346,1441,10687	2194	4292	6486	-	-	-	SO:0001589	frameshift_variant	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.187delA	2.37:g.9989571delA	ENSP00000263663:p.Lys65fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	pfam_TF_Rrn7	p.N66fs	ENST00000263663.5	37	c.187	CCDS33143.1	2																																																																																			TAF1B	-	NULL	ENSG00000115750		0.333	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2	37	0.00	0	A	NM_005680		9989571	9989571	+1	no_errors	ENST00000263663	ensembl	human	known	69_37n	frame_shift_del	65	12.00	9	DEL	0.991	-
TBCD	6904	genome.wustl.edu	37	17	80878479	80878479	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr17:80878479G>A	ENST00000355528.4	+	24	2216	c.2086G>A	c.(2086-2088)Ggt>Agt	p.G696S	RP11-497H17.1_ENST00000571113.1_lincRNA|TBCD_ENST00000539345.2_Missense_Mutation_p.G696S	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	696					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)	p.G696S(1)				Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCCCTTTAGAGGTGACACCGT	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)																																								-	-	-	SO:0001583	missense	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.2086G>A	17.37:g.80878479G>A	ENSP00000347719:p.Gly696Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.G696S	ENST00000355528.4	37	c.2086	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	G	11.50	1.656337	0.29425	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000536182	T	0.64618	-0.11	5.44	4.46	0.54185	Armadillo-type fold (1);	0.181404	0.49305	D	0.000141	T	0.64670	0.2619	L	0.52364	1.645	0.80722	D	1	P;P;B;B	0.51449	0.945;0.5;0.313;0.005	P;B;B;B	0.52909	0.713;0.143;0.276;0.01	T	0.62487	-0.6844	9	.	.	.	.	11.5621	0.50782	0.0867:0.0:0.9133:0.0	.	696;696;696;696	B4DE53;Q9BTW9;Q9BTW9-4;F5H8C7	.;TBCD_HUMAN;.;.	S	696;447;696	ENSP00000347719:G696S	.	G	+	1	0	TBCD	78471768	1.000000	0.71417	0.968000	0.41197	0.316000	0.28119	3.680000	0.54641	2.732000	0.93576	0.591000	0.81541	GGT	TBCD	-	superfamily_ARM-type_fold	ENSG00000141556		0.333	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	234	0.00	0	G	NM_005993		80878479	80878479	+1	no_errors	ENST00000355528	ensembl	human	known	69_37n	missense	175	27.69	67	SNP	0.984	A
TDRD3	81550	genome.wustl.edu	37	13	61083925	61083925	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr13:61083925delC	ENST00000196169.3	+	9	1396	c.608delC	c.(607-609)acgfs	p.T203fs	TDRD3_ENST00000535286.1_Frame_Shift_Del_p.T296fs|TDRD3_ENST00000377881.2_Frame_Shift_Del_p.T203fs|TDRD3_ENST00000377894.2_Frame_Shift_Del_p.T203fs	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	203	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.T203fs*21(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		AAGCACATAACGGAAATGGGC	0.418																																					Colon(36;164 906 35820 50723)	dbGAP											1	Deletion - Frameshift(1)	breast(1)											147.0	147.0	147.0					13																	61083925		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.608delC	13.37:g.61083925delC	ENSP00000196169:p.Thr203fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2MWP9|Q53XA6|Q6P992	Frame_Shift_Del	DEL	pfam_DUF1767,pfam_Tudor,pfam_Survival_motor_neuron,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_Tudor,pfscan_Tudor,pfscan_UBA/transl_elong_EF1B_N_euk	p.T296fs	ENST00000196169.3	37	c.887	CCDS9441.1	13																																																																																			TDRD3	-	pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	ENSG00000083544		0.418	TDRD3-201	KNOWN	basic|CCDS	protein_coding	TDRD3	HGNC	protein_coding	OTTHUMT00000045175.2	114	0.00	0	C	NM_030794		61083925	61083925	+1	no_errors	ENST00000535286	ensembl	human	known	69_37n	frame_shift_del	22	61.19	41	DEL	1.000	-
TDRD3	81550	genome.wustl.edu	37	13	61083925	61083925	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-11A-31D-A10E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	f6c39a94-160d-4231-b12f-33c28ebbacf9	g.chr13:61083925delC	ENST00000196169.3	+	9	1396	c.608delC	c.(607-609)acgfs	p.T203fs	TDRD3_ENST00000535286.1_Frame_Shift_Del_p.T296fs|TDRD3_ENST00000377881.2_Frame_Shift_Del_p.T203fs|TDRD3_ENST00000377894.2_Frame_Shift_Del_p.T203fs	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	203	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.T203fs*21(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		AAGCACATAACGGAAATGGGC	0.418																																					Colon(36;164 906 35820 50723)	dbGAP											1	Deletion - Frameshift(1)	breast(1)											147.0	147.0	147.0					13																	61083925		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.608delC	13.37:g.61083925delC	ENSP00000196169:p.Thr203fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2MWP9|Q53XA6|Q6P992	Frame_Shift_Del	DEL	pfam_DUF1767,pfam_Tudor,pfam_Survival_motor_neuron,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_Tudor,pfscan_Tudor,pfscan_UBA/transl_elong_EF1B_N_euk	p.T296fs	ENST00000196169.3	37	c.887	CCDS9441.1	13																																																																																			TDRD3	-	pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	ENSG00000083544		0.418	TDRD3-201	KNOWN	basic|CCDS	protein_coding	TDRD3	HGNC	protein_coding	OTTHUMT00000045175.2	123	0.80	1	C	NM_030794		61083925	61083925	+1	no_errors	ENST00000535286	ensembl	human	known	69_37n	frame_shift_del	22	61.19	41	DEL	1.000	-
TMCO6	55374	genome.wustl.edu	37	5	140023514	140023514	+	Silent	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr5:140023514G>A	ENST00000394671.3	+	9	1169	c.1068G>A	c.(1066-1068)ctG>ctA	p.L356L	TMCO6_ENST00000252100.6_Silent_p.L362L|NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000537378.1_Silent_p.L116L	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	356					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)	p.L356L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCCAGTCTGCTCCCTGAGG	0.517																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	98.0	96.0					5																	140023514		1954	4150	6104	-	-	-	SO:0001819	synonymous_variant	0			BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.1068G>A	5.37:g.140023514G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUU0|Q9P198	Silent	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.L362	ENST00000394671.3	37	c.1086	CCDS4233.2	5																																																																																			TMCO6	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000113119		0.517	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	HGNC	protein_coding	OTTHUMT00000251666.2	145	0.00	0	G	NM_018502		140023514	140023514	+1	no_errors	ENST00000252100	ensembl	human	known	69_37n	silent	96	39.75	64	SNP	0.983	A
UBR3	130507	genome.wustl.edu	37	2	170897490	170897490	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DH-01A-11D-A099-09	TCGA-BH-A0DH-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7aa19e23-48fe-4ce9-89f8-dd7513e4cb62	2bb52edf-252d-480f-ad2b-afc9c890fdfe	g.chr2:170897490G>A	ENST00000272793.5	+	32	4705	c.4655G>A	c.(4654-4656)cGc>cAc	p.R1552H	UBR3_ENST00000392631.1_Missense_Mutation_p.R373H|UBR3_ENST00000418381.1_Missense_Mutation_p.R1552H			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1552					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R405H(1)|p.R1552H(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						CAACCCTTACGCAAAGGTATG	0.368																																						dbGAP											2	Substitution - Missense(2)	breast(2)											105.0	95.0	99.0					2																	170897490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4655G>A	2.37:g.170897490G>A	ENSP00000272793:p.Arg1552His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R1552H	ENST00000272793.5	37	c.4655		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.68|12.68	2.009899|2.009899	0.35415|0.35415	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000392632|ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681	.|T;T;T;T	.|0.46819	.|0.86;0.86;0.86;0.86	5.28|5.28	-3.07|-3.07	0.05363|0.05363	.|.	.|0.527727	.|0.22630	.|N	.|0.057595	T|T	0.28366|0.28366	0.0701|0.0701	N|N	0.19112|0.19112	0.55|0.55	0.23126|0.23126	N|N	0.998251|0.998251	.|B;B;B	.|0.10296	.|0.001;0.003;0.002	.|B;B;B	.|0.10450	.|0.0;0.005;0.0	T|T	0.15292|0.15292	-1.0442|-1.0442	5|10	.|0.42905	.|T	.|0.14	.|.	12.0079|12.0079	0.53270|0.53270	0.5167:0.0:0.4833:0.0|0.5167:0.0:0.4833:0.0	.|.	.|1552;373;1581	.|Q6ZT12;Q6ZT12-2;E7EVK3	.|UBR3_HUMAN;.;.	T|H	614|1552;1581;1552;373;252	.|ENSP00000272793:R1552H;ENSP00000396068:R1552H;ENSP00000376408:R373H;ENSP00000389097:R252H	.|ENSP00000272793:R1552H	A|R	+|+	1|2	0|0	UBR3|UBR3	170605736|170605736	0.043000|0.043000	0.20138|0.20138	0.902000|0.902000	0.35471|0.35471	0.941000|0.941000	0.58515|0.58515	-0.407000|-0.407000	0.07178|0.07178	-0.553000|-0.553000	0.06158|0.06158	-0.218000|-0.218000	0.12543|0.12543	GCA|CGC	UBR3	-	NULL	ENSG00000144357		0.368	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	99	0.00	0	G	NM_172070		170897490	170897490	+1	no_errors	ENST00000272793	ensembl	human	known	69_37n	missense	50	37.50	30	SNP	0.956	A
