#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSL5	51703	genome.wustl.edu	37	10	114168281	114168281	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr10:114168281T>C	ENST00000393081.1	+	6	839		c.e6+2		RP11-324O2.3_ENST00000594870.2_RNA|ACSL5_ENST00000354273.4_Splice_Site|ACSL5_ENST00000354655.4_Splice_Site|RP11-324O2.3_ENST00000449782.2_RNA|ACSL5_ENST00000369410.3_5'Flank|RP11-324O2.3_ENST00000598447.1_RNA|ACSL5_ENST00000433418.1_Splice_Site|ACSL5_ENST00000356116.1_Splice_Site	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5						cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.?(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		TCAACAAGGGTAAAATTTTGC	0.363																																						dbGAP											1	Unknown(1)	breast(1)											180.0	153.0	162.0					10																	114168281		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.532+2T>C	10.37:g.114168281T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Splice_Site	SNP	-	e6+2	ENST00000393081.1	37	c.700+2	CCDS7573.1	10	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682006	0.68042	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.336	0.74255	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSL5	114158271	1.000000	0.71417	0.999000	0.59377	0.738000	0.42128	7.693000	0.84214	2.258000	0.74832	0.523000	0.50628	.	ACSL5	-	-	ENSG00000197142		0.363	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL5	HGNC	protein_coding	OTTHUMT00000050386.1	123	0.00	0	T	NM_016234	Intron	114168281	114168281	+1	no_errors	ENST00000356116	ensembl	human	known	69_37n	splice_site	116	26.88	43	SNP	1.000	C
ACSL5	51703	genome.wustl.edu	37	10	114168281	114168281	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr10:114168281T>C	ENST00000393081.1	+	6	839		c.e6+2		RP11-324O2.3_ENST00000594870.2_RNA|ACSL5_ENST00000354273.4_Splice_Site|ACSL5_ENST00000354655.4_Splice_Site|RP11-324O2.3_ENST00000449782.2_RNA|ACSL5_ENST00000369410.3_5'Flank|RP11-324O2.3_ENST00000598447.1_RNA|ACSL5_ENST00000433418.1_Splice_Site|ACSL5_ENST00000356116.1_Splice_Site	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5						cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.?(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		TCAACAAGGGTAAAATTTTGC	0.363																																						dbGAP											1	Unknown(1)	breast(1)											180.0	153.0	162.0					10																	114168281		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.532+2T>C	10.37:g.114168281T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Splice_Site	SNP	-	e6+2	ENST00000393081.1	37	c.700+2	CCDS7573.1	10	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682006	0.68042	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.336	0.74255	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSL5	114158271	1.000000	0.71417	0.999000	0.59377	0.738000	0.42128	7.693000	0.84214	2.258000	0.74832	0.523000	0.50628	.	ACSL5	-	-	ENSG00000197142		0.363	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL5	HGNC	protein_coding	OTTHUMT00000050386.1	100	0.00	0	T	NM_016234	Intron	114168281	114168281	+1	no_errors	ENST00000356116	ensembl	human	known	69_37n	splice_site	116	26.88	43	SNP	1.000	C
AP3B1	8546	genome.wustl.edu	37	5	77385315	77385315	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr5:77385315C>A	ENST00000255194.6	-	22	2654	c.2479G>T	c.(2479-2481)Gta>Tta	p.V827L	AP3B1_ENST00000519295.1_Missense_Mutation_p.V778L	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	827					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)	p.V827L(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GGAGTGGATACTGGGTTAACT	0.353									Hermansky-Pudlak syndrome																													dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	115.0	118.0					5																	77385315		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2479G>T	5.37:g.77385315C>A	ENSP00000255194:p.Val827Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	p.V827L	ENST00000255194.6	37	c.2479	CCDS4041.1	5	.	.	.	.	.	.	.	.	.	.	C	11.28	1.593528	0.28357	.	.	ENSG00000132842	ENST00000255194;ENST00000519295	T;T	0.05786	3.39;3.39	4.5	2.7	0.31948	.	0.190269	0.34676	N	0.003773	T	0.05502	0.0145	L	0.37630	1.12	0.32825	D	0.503204	B	0.15719	0.014	B	0.17098	0.017	T	0.17684	-1.0361	10	0.27082	T	0.32	-8.6442	8.5868	0.33664	0.0:0.8388:0.0:0.1612	.	827	O00203	AP3B1_HUMAN	L	827;778	ENSP00000255194:V827L;ENSP00000430597:V778L	ENSP00000255194:V827L	V	-	1	0	AP3B1	77421071	0.202000	0.23423	0.933000	0.37362	0.920000	0.55202	0.617000	0.24359	0.452000	0.26830	0.467000	0.42956	GTA	AP3B1	-	pirsf_AP3_complex_bsu	ENSG00000132842		0.353	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	162	0.00	0	C			77385315	77385315	-1	no_errors	ENST00000255194	ensembl	human	known	69_37n	missense	104	39.31	68	SNP	0.982	A
AP3B1	8546	genome.wustl.edu	37	5	77385315	77385315	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr5:77385315C>A	ENST00000255194.6	-	22	2654	c.2479G>T	c.(2479-2481)Gta>Tta	p.V827L	AP3B1_ENST00000519295.1_Missense_Mutation_p.V778L	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	827					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)	p.V827L(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GGAGTGGATACTGGGTTAACT	0.353									Hermansky-Pudlak syndrome																													dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	115.0	118.0					5																	77385315		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2479G>T	5.37:g.77385315C>A	ENSP00000255194:p.Val827Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	p.V827L	ENST00000255194.6	37	c.2479	CCDS4041.1	5	.	.	.	.	.	.	.	.	.	.	C	11.28	1.593528	0.28357	.	.	ENSG00000132842	ENST00000255194;ENST00000519295	T;T	0.05786	3.39;3.39	4.5	2.7	0.31948	.	0.190269	0.34676	N	0.003773	T	0.05502	0.0145	L	0.37630	1.12	0.32825	D	0.503204	B	0.15719	0.014	B	0.17098	0.017	T	0.17684	-1.0361	10	0.27082	T	0.32	-8.6442	8.5868	0.33664	0.0:0.8388:0.0:0.1612	.	827	O00203	AP3B1_HUMAN	L	827;778	ENSP00000255194:V827L;ENSP00000430597:V778L	ENSP00000255194:V827L	V	-	1	0	AP3B1	77421071	0.202000	0.23423	0.933000	0.37362	0.920000	0.55202	0.617000	0.24359	0.452000	0.26830	0.467000	0.42956	GTA	AP3B1	-	pirsf_AP3_complex_bsu	ENSG00000132842		0.353	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	149	0.00	0	C			77385315	77385315	-1	no_errors	ENST00000255194	ensembl	human	known	69_37n	missense	104	39.31	68	SNP	0.982	A
BZRAP1	9256	genome.wustl.edu	37	17	56386383	56386384	+	Frame_Shift_Ins	INS	-	-	T	rs373235874		TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr17:56386383_56386384insT	ENST00000343736.4	-	22	4412_4413	c.4249_4250insA	c.(4249-4251)agcfs	p.S1417fs	BZRAP1_ENST00000268893.6_Frame_Shift_Ins_p.S1357fs|BZRAP1_ENST00000355701.3_Frame_Shift_Ins_p.S1417fs			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1417						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCGCCTGCGGCTTGGGGGCTTC	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4250dupA	17.37:g.56386385_56386385dupT	ENSP00000345824:p.Ser1417fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75111|Q8N5W3	Frame_Shift_Ins	INS	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.S1417fs	ENST00000343736.4	37	c.4250_4249	CCDS11605.1	17																																																																																			BZRAP1	-	NULL	ENSG00000005379		0.653	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	40	0.00	0	-	NM_004758		56386383	56386384	-1	no_errors	ENST00000355701	ensembl	human	known	69_37n	frame_shift_ins	10	16.67	2	INS	0.000:0.001	T
CDYL	9425	genome.wustl.edu	37	6	4892446	4892446	+	Missense_Mutation	SNP	A	A	G	rs368633486	byFrequency	TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr6:4892446A>G	ENST00000328908.5	+	4	817	c.686A>G	c.(685-687)gAc>gGc	p.D229G	CDYL_ENST00000343762.5_Missense_Mutation_p.D43G|CDYL_ENST00000449732.2_Missense_Mutation_p.D43G|CDYL_ENST00000397588.3_Missense_Mutation_p.D175G|CDYL_ENST00000472453.1_Intron			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	229	Interaction with EZH2.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)	p.D229G(1)		breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GGTCAGGAGGACACAGTGGCA	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											46.0	54.0	51.0					6																	4892446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.686A>G	6.37:g.4892446A>G	ENSP00000330512:p.Asp229Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	pfam_Crotonase_core,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.D229G	ENST00000328908.5	37	c.686		6	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579574	0.86645	.	.	ENSG00000153046	ENST00000328908;ENST00000397588;ENST00000449732;ENST00000343762	T;T;T;T	0.60299	0.77;0.39;0.2;0.2	5.55	5.55	0.83447	.	0.069862	0.53938	U	0.000043	T	0.57110	0.2031	M	0.63843	1.955	0.80722	D	1	D;D	0.56287	0.975;0.968	P;P	0.53185	0.72;0.585	T	0.59402	-0.7461	9	.	.	.	.	14.892	0.70617	1.0:0.0:0.0:0.0	.	175;229	Q9Y232-2;Q9Y232	.;CDYL1_HUMAN	G	229;175;43;43	ENSP00000330512:D229G;ENSP00000380718:D175G;ENSP00000394076:D43G;ENSP00000340908:D43G	.	D	+	2	0	CDYL	4837445	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.075000	0.76798	2.115000	0.64714	0.528000	0.53228	GAC	CDYL	-	NULL	ENSG00000153046		0.632	CDYL-001	KNOWN	basic	protein_coding	CDYL	HGNC	protein_coding	OTTHUMT00000039736.1	163	0.00	0	A	NM_004824		4892446	4892446	+1	no_errors	ENST00000328908	ensembl	human	known	69_37n	missense	52	42.39	39	SNP	1.000	G
CDYL	9425	genome.wustl.edu	37	6	4892446	4892446	+	Missense_Mutation	SNP	A	A	G	rs368633486	byFrequency	TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr6:4892446A>G	ENST00000328908.5	+	4	817	c.686A>G	c.(685-687)gAc>gGc	p.D229G	CDYL_ENST00000343762.5_Missense_Mutation_p.D43G|CDYL_ENST00000449732.2_Missense_Mutation_p.D43G|CDYL_ENST00000397588.3_Missense_Mutation_p.D175G|CDYL_ENST00000472453.1_Intron			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	229	Interaction with EZH2.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)	p.D229G(1)		breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GGTCAGGAGGACACAGTGGCA	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											46.0	54.0	51.0					6																	4892446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.686A>G	6.37:g.4892446A>G	ENSP00000330512:p.Asp229Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	pfam_Crotonase_core,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.D229G	ENST00000328908.5	37	c.686		6	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579574	0.86645	.	.	ENSG00000153046	ENST00000328908;ENST00000397588;ENST00000449732;ENST00000343762	T;T;T;T	0.60299	0.77;0.39;0.2;0.2	5.55	5.55	0.83447	.	0.069862	0.53938	U	0.000043	T	0.57110	0.2031	M	0.63843	1.955	0.80722	D	1	D;D	0.56287	0.975;0.968	P;P	0.53185	0.72;0.585	T	0.59402	-0.7461	9	.	.	.	.	14.892	0.70617	1.0:0.0:0.0:0.0	.	175;229	Q9Y232-2;Q9Y232	.;CDYL1_HUMAN	G	229;175;43;43	ENSP00000330512:D229G;ENSP00000380718:D175G;ENSP00000394076:D43G;ENSP00000340908:D43G	.	D	+	2	0	CDYL	4837445	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.075000	0.76798	2.115000	0.64714	0.528000	0.53228	GAC	CDYL	-	NULL	ENSG00000153046		0.632	CDYL-001	KNOWN	basic	protein_coding	CDYL	HGNC	protein_coding	OTTHUMT00000039736.1	133	0.00	0	A	NM_004824		4892446	4892446	+1	no_errors	ENST00000328908	ensembl	human	known	69_37n	missense	52	42.39	39	SNP	1.000	G
COL16A1	1307	genome.wustl.edu	37	1	32127285	32127285	+	Silent	SNP	G	G	A	rs555831255	byFrequency	TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr1:32127285G>A	ENST00000373672.3	-	59	4218	c.3702C>T	c.(3700-3702)ggC>ggT	p.G1234G	RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000591929.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|COL16A1_ENST00000271069.6_Silent_p.G1234G|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1234	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.G1234G(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GTCCAGGGGGGCCAGCAGGAC	0.567													G|||	3	0.000599042	0.0	0.0	5008	,	,		18693	0.0		0.0	False		,,,				2504	0.0031				Colon(143;498 1786 21362 25193 36625)	dbGAP											1	Substitution - coding silent(1)	breast(1)											51.0	55.0	54.0					1																	32127285		1898	4111	6009	-	-	-	SO:0001819	synonymous_variant	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3702C>T	1.37:g.32127285G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16593|Q59F89|Q71RG9	Silent	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.G1234	ENST00000373672.3	37	c.3702	CCDS41297.1	1																																																																																			COL16A1	-	NULL	ENSG00000084636		0.567	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2	131	0.00	0	G	NM_001856		32127285	32127285	-1	no_errors	ENST00000271069	ensembl	human	known	69_37n	silent	54	27.03	20	SNP	0.922	A
COL16A1	1307	genome.wustl.edu	37	1	32127285	32127285	+	Silent	SNP	G	G	A	rs555831255	byFrequency	TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr1:32127285G>A	ENST00000373672.3	-	59	4218	c.3702C>T	c.(3700-3702)ggC>ggT	p.G1234G	RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000591929.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|COL16A1_ENST00000271069.6_Silent_p.G1234G|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1234	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.G1234G(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GTCCAGGGGGGCCAGCAGGAC	0.567													G|||	3	0.000599042	0.0	0.0	5008	,	,		18693	0.0		0.0	False		,,,				2504	0.0031				Colon(143;498 1786 21362 25193 36625)	dbGAP											1	Substitution - coding silent(1)	breast(1)											51.0	55.0	54.0					1																	32127285		1898	4111	6009	-	-	-	SO:0001819	synonymous_variant	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3702C>T	1.37:g.32127285G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16593|Q59F89|Q71RG9	Silent	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.G1234	ENST00000373672.3	37	c.3702	CCDS41297.1	1																																																																																			COL16A1	-	NULL	ENSG00000084636		0.567	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2	105	0.00	0	G	NM_001856		32127285	32127285	-1	no_errors	ENST00000271069	ensembl	human	known	69_37n	silent	54	27.03	20	SNP	0.922	A
CSMD3	114788	genome.wustl.edu	37	8	113564901	113564901	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr8:113564901G>C	ENST00000297405.5	-	26	4527	c.4283C>G	c.(4282-4284)tCt>tGt	p.S1428C	CSMD3_ENST00000455883.2_Missense_Mutation_p.S1324C|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1388C|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1428C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1428	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1388C(1)|p.S1428C(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATAGCCAGGAGATAAGATTCT	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											2	Substitution - Missense(2)	breast(2)											90.0	85.0	87.0					8																	113564901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4283C>G	8.37:g.113564901G>C	ENSP00000297405:p.Ser1428Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.S1428C	ENST00000297405.5	37	c.4283	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522111	0.85600	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	4.74	4.74	0.60224	CUB (5);	0.000000	0.64402	D	0.000001	T	0.74943	0.3783	H	0.99391	4.545	0.46241	D	0.99894	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.87578	0.996;0.998;0.916	D	0.86946	0.2082	10	0.87932	D	0	.	18.2856	0.90113	0.0:0.0:1.0:0.0	.	1324;1428;1388	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1388;1428;768;1324;1428	ENSP00000345799:S1388C;ENSP00000297405:S1428C;ENSP00000341558:S768C;ENSP00000412263:S1324C;ENSP00000343124:S1428C	ENSP00000297405:S1428C	S	-	2	0	CSMD3	113634077	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.601000	0.98297	2.617000	0.88574	0.655000	0.94253	TCT	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	111	0.00	0	G	NM_052900		113564901	113564901	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	80	36.00	45	SNP	1.000	C
CSMD3	114788	genome.wustl.edu	37	8	113564901	113564901	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr8:113564901G>C	ENST00000297405.5	-	26	4527	c.4283C>G	c.(4282-4284)tCt>tGt	p.S1428C	CSMD3_ENST00000455883.2_Missense_Mutation_p.S1324C|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1388C|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1428C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1428	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1388C(1)|p.S1428C(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATAGCCAGGAGATAAGATTCT	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											2	Substitution - Missense(2)	breast(2)											90.0	85.0	87.0					8																	113564901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4283C>G	8.37:g.113564901G>C	ENSP00000297405:p.Ser1428Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.S1428C	ENST00000297405.5	37	c.4283	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522111	0.85600	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	4.74	4.74	0.60224	CUB (5);	0.000000	0.64402	D	0.000001	T	0.74943	0.3783	H	0.99391	4.545	0.46241	D	0.99894	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.87578	0.996;0.998;0.916	D	0.86946	0.2082	10	0.87932	D	0	.	18.2856	0.90113	0.0:0.0:1.0:0.0	.	1324;1428;1388	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1388;1428;768;1324;1428	ENSP00000345799:S1388C;ENSP00000297405:S1428C;ENSP00000341558:S768C;ENSP00000412263:S1324C;ENSP00000343124:S1428C	ENSP00000297405:S1428C	S	-	2	0	CSMD3	113634077	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.601000	0.98297	2.617000	0.88574	0.655000	0.94253	TCT	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	95	0.00	0	G	NM_052900		113564901	113564901	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	80	36.00	45	SNP	1.000	C
FAM127C	441518	genome.wustl.edu	37	X	134156265	134156265	+	Silent	SNP	G	G	A	rs185780449		TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chrX:134156265G>A	ENST00000391440.1	-	1	294	c.225C>T	c.(223-225)ccC>ccT	p.P75P		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	75								p.P75P(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					ACTGCAGGGCGGGCCCCGTGA	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											51.0	55.0	54.0					X																	134156265		2119	4209	6328	-	-	-	SO:0001819	synonymous_variant	0			BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.225C>T	X.37:g.134156265G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.P75	ENST00000391440.1	37	c.225	CCDS43996.1	X																																																																																			FAM127C	-	NULL	ENSG00000212747		0.597	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127C	HGNC	protein_coding	OTTHUMT00000058389.2	118	0.00	0	G	NM_001078173		134156265	134156265	-1	no_errors	ENST00000391440	ensembl	human	known	69_37n	silent	102	22.73	30	SNP	0.394	A
FAM127C	441518	genome.wustl.edu	37	X	134156265	134156265	+	Silent	SNP	G	G	A	rs185780449		TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chrX:134156265G>A	ENST00000391440.1	-	1	294	c.225C>T	c.(223-225)ccC>ccT	p.P75P		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	75								p.P75P(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					ACTGCAGGGCGGGCCCCGTGA	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											51.0	55.0	54.0					X																	134156265		2119	4209	6328	-	-	-	SO:0001819	synonymous_variant	0			BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.225C>T	X.37:g.134156265G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.P75	ENST00000391440.1	37	c.225	CCDS43996.1	X																																																																																			FAM127C	-	NULL	ENSG00000212747		0.597	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127C	HGNC	protein_coding	OTTHUMT00000058389.2	142	0.00	0	G	NM_001078173		134156265	134156265	-1	no_errors	ENST00000391440	ensembl	human	known	69_37n	silent	102	22.73	30	SNP	0.394	A
GDPGP1	390637	genome.wustl.edu	37	15	90784678	90784678	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr15:90784678C>T	ENST00000558017.1	+	4	958	c.538C>T	c.(538-540)Cgc>Tgc	p.R180C	GDPGP1_ENST00000329600.6_Missense_Mutation_p.R180C	NM_001013657.2	NP_001013679.2	Q6ZNW5	GDPP1_HUMAN	GDP-D-glucose phosphorylase 1	180					glucose metabolic process (GO:0006006)	cytoplasm (GO:0005737)	GDP-D-glucose phosphorylase activity (GO:0080048)|guanyl-nucleotide exchange factor activity (GO:0005085)|hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|nucleotidyltransferase activity (GO:0016779)	p.R180C(1)									GCTCCCCCAGCGCCTGCTGCC	0.662																																						dbGAP											1	Substitution - Missense(1)	breast(1)											36.0	41.0	39.0					15																	90784678		2199	4298	6497	-	-	-	SO:0001583	missense	0				CCDS32327.1	15q26.1	2012-05-04	2012-05-04	2012-05-04	ENSG00000183208	ENSG00000183208	2.7.7.78		34360	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 58"""	C15orf58		21507950	Standard	NM_001013657		Approved		uc002bpc.3	Q6ZNW5		ENST00000558017.1:c.538C>T	15.37:g.90784678C>T	ENSP00000452793:p.Arg180Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R180C	ENST00000558017.1	37	c.538	CCDS32327.1	15	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703984	0.68501	.	.	ENSG00000183208	ENST00000329600	T	0.26373	1.74	5.95	3.88	0.44766	.	0.291939	0.32218	N	0.006414	T	0.43831	0.1265	M	0.87547	2.89	0.50039	D	0.99984	D	0.64830	0.994	P	0.53649	0.731	T	0.46911	-0.9157	10	0.37606	T	0.19	-9.815	10.042	0.42164	0.3436:0.5455:0.1109:0.0	.	180	Q6ZNW5	VTC2_HUMAN	C	180	ENSP00000368405:R180C	ENSP00000368405:R180C	R	+	1	0	C15orf58	88585682	0.997000	0.39634	1.000000	0.80357	0.853000	0.48598	0.522000	0.22909	1.500000	0.48636	0.655000	0.94253	CGC	GDPGP1	-	NULL	ENSG00000183208		0.662	GDPGP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPGP1	HGNC	protein_coding	OTTHUMT00000416973.1	51	0.00	0	C	NM_001013657		90784678	90784678	+1	no_errors	ENST00000329600	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	T
GDPGP1	390637	genome.wustl.edu	37	15	90784678	90784678	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr15:90784678C>T	ENST00000558017.1	+	4	958	c.538C>T	c.(538-540)Cgc>Tgc	p.R180C	GDPGP1_ENST00000329600.6_Missense_Mutation_p.R180C	NM_001013657.2	NP_001013679.2	Q6ZNW5	GDPP1_HUMAN	GDP-D-glucose phosphorylase 1	180					glucose metabolic process (GO:0006006)	cytoplasm (GO:0005737)	GDP-D-glucose phosphorylase activity (GO:0080048)|guanyl-nucleotide exchange factor activity (GO:0005085)|hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|nucleotidyltransferase activity (GO:0016779)	p.R180C(1)									GCTCCCCCAGCGCCTGCTGCC	0.662																																						dbGAP											1	Substitution - Missense(1)	breast(1)											36.0	41.0	39.0					15																	90784678		2199	4298	6497	-	-	-	SO:0001583	missense	0				CCDS32327.1	15q26.1	2012-05-04	2012-05-04	2012-05-04	ENSG00000183208	ENSG00000183208	2.7.7.78		34360	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 58"""	C15orf58		21507950	Standard	NM_001013657		Approved		uc002bpc.3	Q6ZNW5		ENST00000558017.1:c.538C>T	15.37:g.90784678C>T	ENSP00000452793:p.Arg180Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R180C	ENST00000558017.1	37	c.538	CCDS32327.1	15	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703984	0.68501	.	.	ENSG00000183208	ENST00000329600	T	0.26373	1.74	5.95	3.88	0.44766	.	0.291939	0.32218	N	0.006414	T	0.43831	0.1265	M	0.87547	2.89	0.50039	D	0.99984	D	0.64830	0.994	P	0.53649	0.731	T	0.46911	-0.9157	10	0.37606	T	0.19	-9.815	10.042	0.42164	0.3436:0.5455:0.1109:0.0	.	180	Q6ZNW5	VTC2_HUMAN	C	180	ENSP00000368405:R180C	ENSP00000368405:R180C	R	+	1	0	C15orf58	88585682	0.997000	0.39634	1.000000	0.80357	0.853000	0.48598	0.522000	0.22909	1.500000	0.48636	0.655000	0.94253	CGC	GDPGP1	-	NULL	ENSG00000183208		0.662	GDPGP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPGP1	HGNC	protein_coding	OTTHUMT00000416973.1	60	0.00	0	C	NM_001013657		90784678	90784678	+1	no_errors	ENST00000329600	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	T
GTF2H3	2967	genome.wustl.edu	37	12	124144342	124144342	+	Splice_Site	SNP	T	T	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr12:124144342T>A	ENST00000543341.2	+	11	716	c.685T>A	c.(685-687)Tgg>Agg	p.W229R	GTF2H3_ENST00000228955.7_Splice_Site_p.W188R	NM_001271867.1|NM_001516.3	NP_001258796.1|NP_001507.2	Q13889	TF2H3_HUMAN	general transcription factor IIH, polypeptide 3, 34kDa	229					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|translation (GO:0006412)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation factor activity, nucleic acid binding (GO:0008135)	p.W229R(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.1e-05)|Epithelial(86;0.000388)|all cancers(50;0.00362)		TGTTTTACAGTGGGTGTTTCT	0.418								Nucleotide excision repair (NER)																													Melanoma(176;111 2022 3038 14733 36962)	dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	71.0	72.0					12																	124144342		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Z30093	CCDS9252.1, CCDS61275.1, CCDS73544.1	12q24.31	2012-11-05	2002-08-29		ENSG00000111358	ENSG00000111358		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4657	protein-coding gene	gene with protein product		601750	"""general transcription factor IIH, polypeptide 3 (34kD subunit)"""			8194529	Standard	NM_001516		Approved	BTF2, TFIIH, P34	uc001ufo.2	Q13889	OTTHUMG00000168697	ENST00000543341.2:c.685-1T>A	12.37:g.124144342T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R819|B4DNZ6|Q7L0G0|Q96AT7	Missense_Mutation	SNP	pfam_TF_Tfb4,tigrfam_TF_Tfb4	p.W229R	ENST00000543341.2	37	c.685	CCDS9252.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.28|16.28	3.078414|3.078414	0.55753|0.55753	.|.	.|.	ENSG00000111358|ENSG00000111358	ENST00000538533|ENST00000228955;ENST00000543341;ENST00000536375;ENST00000542231;ENST00000543154	.|.	.|.	.|.	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78368|0.78368	0.4272|0.4272	M|M	0.79805|0.79805	2.47|2.47	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.68621	.|0.959	T|T	0.80520|0.80520	-0.1346|-0.1346	5|8	.|.	.|.	.|.	.|.	13.6786|13.6786	0.62469|0.62469	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|229	.|Q13889	.|TF2H3_HUMAN	E|R	137|188;229;186;179;115	.|.	.|.	V|W	+|+	2|1	0|0	GTF2H3|GTF2H3	122710295|122710295	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.668000|0.668000	0.39293|0.39293	7.945000|7.945000	0.87732|0.87732	1.969000|1.969000	0.57287|0.57287	0.529000|0.529000	0.55759|0.55759	GTG|TGG	GTF2H3	-	pfam_TF_Tfb4,tigrfam_TF_Tfb4	ENSG00000111358		0.418	GTF2H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2H3	HGNC	protein_coding	OTTHUMT00000400641.2	112	0.00	0	T	NM_001516	Missense_Mutation	124144342	124144342	+1	no_errors	ENST00000543341	ensembl	human	known	69_37n	missense	72	41.13	51	SNP	1.000	A
GTF2H3	2967	genome.wustl.edu	37	12	124144342	124144342	+	Splice_Site	SNP	T	T	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr12:124144342T>A	ENST00000543341.2	+	11	716	c.685T>A	c.(685-687)Tgg>Agg	p.W229R	GTF2H3_ENST00000228955.7_Splice_Site_p.W188R	NM_001271867.1|NM_001516.3	NP_001258796.1|NP_001507.2	Q13889	TF2H3_HUMAN	general transcription factor IIH, polypeptide 3, 34kDa	229					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|translation (GO:0006412)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation factor activity, nucleic acid binding (GO:0008135)	p.W229R(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.1e-05)|Epithelial(86;0.000388)|all cancers(50;0.00362)		TGTTTTACAGTGGGTGTTTCT	0.418								Nucleotide excision repair (NER)																													Melanoma(176;111 2022 3038 14733 36962)	dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	71.0	72.0					12																	124144342		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Z30093	CCDS9252.1, CCDS61275.1, CCDS73544.1	12q24.31	2012-11-05	2002-08-29		ENSG00000111358	ENSG00000111358		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4657	protein-coding gene	gene with protein product		601750	"""general transcription factor IIH, polypeptide 3 (34kD subunit)"""			8194529	Standard	NM_001516		Approved	BTF2, TFIIH, P34	uc001ufo.2	Q13889	OTTHUMG00000168697	ENST00000543341.2:c.685-1T>A	12.37:g.124144342T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R819|B4DNZ6|Q7L0G0|Q96AT7	Missense_Mutation	SNP	pfam_TF_Tfb4,tigrfam_TF_Tfb4	p.W229R	ENST00000543341.2	37	c.685	CCDS9252.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.28|16.28	3.078414|3.078414	0.55753|0.55753	.|.	.|.	ENSG00000111358|ENSG00000111358	ENST00000538533|ENST00000228955;ENST00000543341;ENST00000536375;ENST00000542231;ENST00000543154	.|.	.|.	.|.	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78368|0.78368	0.4272|0.4272	M|M	0.79805|0.79805	2.47|2.47	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.68621	.|0.959	T|T	0.80520|0.80520	-0.1346|-0.1346	5|8	.|.	.|.	.|.	.|.	13.6786|13.6786	0.62469|0.62469	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|229	.|Q13889	.|TF2H3_HUMAN	E|R	137|188;229;186;179;115	.|.	.|.	V|W	+|+	2|1	0|0	GTF2H3|GTF2H3	122710295|122710295	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.668000|0.668000	0.39293|0.39293	7.945000|7.945000	0.87732|0.87732	1.969000|1.969000	0.57287|0.57287	0.529000|0.529000	0.55759|0.55759	GTG|TGG	GTF2H3	-	pfam_TF_Tfb4,tigrfam_TF_Tfb4	ENSG00000111358		0.418	GTF2H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2H3	HGNC	protein_coding	OTTHUMT00000400641.2	154	0.00	0	T	NM_001516	Missense_Mutation	124144342	124144342	+1	no_errors	ENST00000543341	ensembl	human	known	69_37n	missense	72	41.13	51	SNP	1.000	A
INPP4B	8821	genome.wustl.edu	37	4	143067052	143067052	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr4:143067052C>T	ENST00000513000.1	-	19	2094	c.1661G>A	c.(1660-1662)gGc>gAc	p.G554D	INPP4B_ENST00000509777.1_Missense_Mutation_p.G554D|INPP4B_ENST00000308502.4_Missense_Mutation_p.G554D|INPP4B_ENST00000262992.4_Missense_Mutation_p.G554D|INPP4B_ENST00000508116.1_Missense_Mutation_p.G554D	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	554					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ATCATTGTTGCCGCCACTGCC	0.448																																						dbGAP											0													192.0	161.0	171.0					4																	143067052		2203	4300	6503	-	-	-	SO:0001583	missense	0			U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1661G>A	4.37:g.143067052C>T	ENSP00000425487:p.Gly554Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.G554D	ENST00000513000.1	37	c.1661	CCDS3757.1	4	.	.	.	.	.	.	.	.	.	.	C	5.772	0.326789	0.10900	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	5.91	5.07	0.68467	.	0.521903	0.23095	N	0.051996	T	0.10594	0.0259	N	0.01352	-0.895	0.09310	N	1	B;B	0.22983	0.078;0.006	B;B	0.23852	0.049;0.014	T	0.25117	-1.0141	10	0.15499	T	0.54	.	10.0112	0.41988	0.0:0.9108:0.0:0.0892	.	425;554	B7Z6T2;O15327	.;INP4B_HUMAN	D	554;554;554;425;554;554;369;369;554;425	ENSP00000425487:G554D;ENSP00000262992:G554D;ENSP00000308441:G554D;ENSP00000423954:G554D;ENSP00000422793:G554D;ENSP00000426207:G369D;ENSP00000427250:G554D;ENSP00000421065:G425D	ENSP00000262992:G554D	G	-	2	0	INPP4B	143286502	0.000000	0.05858	0.140000	0.22221	0.008000	0.06430	-0.216000	0.09266	2.814000	0.96858	0.650000	0.86243	GGC	INPP4B	-	NULL	ENSG00000109452		0.448	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	HGNC	protein_coding	OTTHUMT00000364587.1	122	0.00	0	C	NM_003866		143067052	143067052	-1	no_errors	ENST00000509777	ensembl	human	known	69_37n	missense	169	11.05	21	SNP	0.216	T
INPP4B	8821	genome.wustl.edu	37	4	143067052	143067052	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr4:143067052C>T	ENST00000513000.1	-	19	2094	c.1661G>A	c.(1660-1662)gGc>gAc	p.G554D	INPP4B_ENST00000509777.1_Missense_Mutation_p.G554D|INPP4B_ENST00000308502.4_Missense_Mutation_p.G554D|INPP4B_ENST00000262992.4_Missense_Mutation_p.G554D|INPP4B_ENST00000508116.1_Missense_Mutation_p.G554D	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	554					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ATCATTGTTGCCGCCACTGCC	0.448																																						dbGAP											0													192.0	161.0	171.0					4																	143067052		2203	4300	6503	-	-	-	SO:0001583	missense	0			U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1661G>A	4.37:g.143067052C>T	ENSP00000425487:p.Gly554Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.G554D	ENST00000513000.1	37	c.1661	CCDS3757.1	4	.	.	.	.	.	.	.	.	.	.	C	5.772	0.326789	0.10900	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	5.91	5.07	0.68467	.	0.521903	0.23095	N	0.051996	T	0.10594	0.0259	N	0.01352	-0.895	0.09310	N	1	B;B	0.22983	0.078;0.006	B;B	0.23852	0.049;0.014	T	0.25117	-1.0141	10	0.15499	T	0.54	.	10.0112	0.41988	0.0:0.9108:0.0:0.0892	.	425;554	B7Z6T2;O15327	.;INP4B_HUMAN	D	554;554;554;425;554;554;369;369;554;425	ENSP00000425487:G554D;ENSP00000262992:G554D;ENSP00000308441:G554D;ENSP00000423954:G554D;ENSP00000422793:G554D;ENSP00000426207:G369D;ENSP00000427250:G554D;ENSP00000421065:G425D	ENSP00000262992:G554D	G	-	2	0	INPP4B	143286502	0.000000	0.05858	0.140000	0.22221	0.008000	0.06430	-0.216000	0.09266	2.814000	0.96858	0.650000	0.86243	GGC	INPP4B	-	NULL	ENSG00000109452		0.448	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	HGNC	protein_coding	OTTHUMT00000364587.1	99	0.00	0	C	NM_003866		143067052	143067052	-1	no_errors	ENST00000509777	ensembl	human	known	69_37n	missense	169	11.05	21	SNP	0.216	T
ZSWIM8	23053	genome.wustl.edu	37	10	75560085	75560085	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr10:75560085delA	ENST00000605216.1	+	23	5083	c.4866delA	c.(4864-4866)ccafs	p.P1622fs	ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_Intron|ZSWIM8_ENST00000604729.1_Frame_Shift_Del_p.P1619fs|ZSWIM8_ENST00000603114.1_Frame_Shift_Del_p.P1581fs|ZSWIM8_ENST00000398706.2_Frame_Shift_Del_p.P1627fs|ZSWIM8_ENST00000604524.1_Frame_Shift_Del_p.P1440fs	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1622	Pro-rich.						zinc ion binding (GO:0008270)	p.A1008fs*10(1)|p.A1628fs*10(1)|p.A1615fs*10(1)									CCACGTTTCCAGCCATCCAAG	0.592																																						dbGAP											3	Deletion - Frameshift(3)	breast(3)											82.0	87.0	85.0					10																	75560085		2180	4277	6457	-	-	-	SO:0001589	frameshift_variant	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.4866delA	10.37:g.75560085delA	ENSP00000474748:p.Pro1622fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Frame_Shift_Del	DEL	pfscan_Znf_SWIM	p.A1628fs	ENST00000605216.1	37	c.4881		10																																																																																			KIAA0913	-	NULL	ENSG00000214655		0.592	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	53	0.00	0	A	NM_001242487		75560085	75560085	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	frame_shift_del	38	30.00	18	DEL	0.990	-
ZSWIM8	23053	genome.wustl.edu	37	10	75560085	75560085	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr10:75560085delA	ENST00000605216.1	+	23	5083	c.4866delA	c.(4864-4866)ccafs	p.P1622fs	ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_Intron|ZSWIM8_ENST00000604729.1_Frame_Shift_Del_p.P1619fs|ZSWIM8_ENST00000603114.1_Frame_Shift_Del_p.P1581fs|ZSWIM8_ENST00000398706.2_Frame_Shift_Del_p.P1627fs|ZSWIM8_ENST00000604524.1_Frame_Shift_Del_p.P1440fs	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1622	Pro-rich.						zinc ion binding (GO:0008270)	p.A1008fs*10(1)|p.A1628fs*10(1)|p.A1615fs*10(1)									CCACGTTTCCAGCCATCCAAG	0.592																																						dbGAP											3	Deletion - Frameshift(3)	breast(3)											82.0	87.0	85.0					10																	75560085		2180	4277	6457	-	-	-	SO:0001589	frameshift_variant	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.4866delA	10.37:g.75560085delA	ENSP00000474748:p.Pro1622fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Frame_Shift_Del	DEL	pfscan_Znf_SWIM	p.A1628fs	ENST00000605216.1	37	c.4881		10																																																																																			KIAA0913	-	NULL	ENSG00000214655		0.592	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	74	0.00	0	A	NM_001242487		75560085	75560085	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	frame_shift_del	38	30.00	18	DEL	0.990	-
LAMA1	284217	genome.wustl.edu	37	18	7040119	7040119	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr18:7040119C>T	ENST00000389658.3	-	10	1471	c.1378G>A	c.(1378-1380)Ggc>Agc	p.G460S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	460	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.G460S(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTGGCACTGCCCACTGGGTTG	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											99.0	91.0	94.0					18																	7040119		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1378G>A	18.37:g.7040119C>T	ENSP00000374309:p.Gly460Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G460S	ENST00000389658.3	37	c.1378	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113801	0.77210	.	.	ENSG00000101680	ENST00000389658	T	0.58358	0.34	5.32	5.32	0.75619	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.82536	0.5058	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86942	0.2080	10	0.51188	T	0.08	.	19.1901	0.93663	0.0:1.0:0.0:0.0	.	460	P25391	LAMA1_HUMAN	S	460	ENSP00000374309:G460S	ENSP00000374309:G460S	G	-	1	0	LAMA1	7030119	1.000000	0.71417	0.929000	0.37066	0.010000	0.07245	7.409000	0.80053	2.775000	0.95449	0.655000	0.94253	GGC	LAMA1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000101680		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	155	0.00	0	C	NM_005559		7040119	7040119	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	201	21.48	55	SNP	1.000	T
LAMA1	284217	genome.wustl.edu	37	18	7040119	7040119	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr18:7040119C>T	ENST00000389658.3	-	10	1471	c.1378G>A	c.(1378-1380)Ggc>Agc	p.G460S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	460	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.G460S(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTGGCACTGCCCACTGGGTTG	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											99.0	91.0	94.0					18																	7040119		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1378G>A	18.37:g.7040119C>T	ENSP00000374309:p.Gly460Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G460S	ENST00000389658.3	37	c.1378	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113801	0.77210	.	.	ENSG00000101680	ENST00000389658	T	0.58358	0.34	5.32	5.32	0.75619	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.82536	0.5058	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86942	0.2080	10	0.51188	T	0.08	.	19.1901	0.93663	0.0:1.0:0.0:0.0	.	460	P25391	LAMA1_HUMAN	S	460	ENSP00000374309:G460S	ENSP00000374309:G460S	G	-	1	0	LAMA1	7030119	1.000000	0.71417	0.929000	0.37066	0.010000	0.07245	7.409000	0.80053	2.775000	0.95449	0.655000	0.94253	GGC	LAMA1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000101680		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	149	0.00	0	C	NM_005559		7040119	7040119	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	201	21.48	55	SNP	1.000	T
MAP2K7	5609	genome.wustl.edu	37	19	7974955	7974956	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr19:7974955_7974956insTT	ENST00000397979.3	+	3	328_329	c.274_275insTT	c.(274-276)attfs	p.I92fs	CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000397981.3_Frame_Shift_Ins_p.I92fs|MAP2K7_ENST00000545011.1_Frame_Shift_Ins_p.I92fs|MAP2K7_ENST00000397983.3_Frame_Shift_Ins_p.I108fs	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	92					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.D93fs*9(1)		breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						CAGCATTGAGATTGACCAGAAG	0.629																																						dbGAP											1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.275_276dupTT	19.37:g.7974956_7974957dupTT	ENSP00000381066:p.Ile92fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D93fs	ENST00000397979.3	37	c.274_275	CCDS42491.1	19																																																																																			MAP2K7	-	NULL	ENSG00000076984		0.629	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	MAP2K7	HGNC	protein_coding	OTTHUMT00000267980.1	52	0.00	0	-			7974955	7974956	+1	no_errors	ENST00000545011	ensembl	human	known	69_37n	frame_shift_ins	15	34.78	8	INS	1.000:1.000	TT
MAP2K7	5609	genome.wustl.edu	37	19	7974955	7974956	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr19:7974955_7974956insTT	ENST00000397979.3	+	3	328_329	c.274_275insTT	c.(274-276)attfs	p.I92fs	CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000397981.3_Frame_Shift_Ins_p.I92fs|MAP2K7_ENST00000545011.1_Frame_Shift_Ins_p.I92fs|MAP2K7_ENST00000397983.3_Frame_Shift_Ins_p.I108fs	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	92					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.D93fs*9(1)		breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						CAGCATTGAGATTGACCAGAAG	0.629																																						dbGAP											1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.275_276dupTT	19.37:g.7974956_7974957dupTT	ENSP00000381066:p.Ile92fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D93fs	ENST00000397979.3	37	c.274_275	CCDS42491.1	19																																																																																			MAP2K7	-	NULL	ENSG00000076984		0.629	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	MAP2K7	HGNC	protein_coding	OTTHUMT00000267980.1	48	0.00	0	-			7974955	7974956	+1	no_errors	ENST00000545011	ensembl	human	known	69_37n	frame_shift_ins	15	34.78	8	INS	1.000:1.000	TT
MINK1	50488	genome.wustl.edu	37	17	4796018	4796018	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr17:4796018G>A	ENST00000355280.6	+	19	2462	c.2266G>A	c.(2266-2268)Ggg>Agg	p.G756R	MINK1_ENST00000347992.7_Missense_Mutation_p.G719R|MINK1_ENST00000453408.3_Missense_Mutation_p.G736R	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1									p.G719R(1)|p.G756R(1)		central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						AGCCTCTCACGGGCACCTCCC	0.682																																						dbGAP											2	Substitution - Missense(2)	breast(2)											23.0	26.0	25.0					17																	4796018		1990	4163	6153	-	-	-	SO:0001583	missense	0			AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.2266G>A	17.37:g.4796018G>A	ENSP00000347427:p.Gly756Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.G756R	ENST00000355280.6	37	c.2266	CCDS45588.1	17	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344562	0.41498	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.76448	-0.76;-0.78;-1.02	5.1	4.13	0.48395	.	0.213631	0.42420	D	0.000716	T	0.73799	0.3633	L	0.43923	1.385	0.09310	N	1	D;D;D;D	0.69078	0.997;0.997;0.994;0.997	P;P;P;P	0.54544	0.755;0.755;0.573;0.755	T	0.62167	-0.6911	10	0.12430	T	0.62	.	6.9184	0.24374	0.0924:0.1765:0.7311:0.0	.	719;736;756;719	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	R	756;736;719	ENSP00000347427:G756R;ENSP00000406487:G736R;ENSP00000269296:G719R	ENSP00000269296:G719R	G	+	1	0	MINK1	4736794	0.599000	0.26891	0.679000	0.29978	0.947000	0.59692	1.489000	0.35562	1.382000	0.46385	0.655000	0.94253	GGG	MINK1	-	NULL	ENSG00000141503		0.682	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000439801.1	33	0.00	0	G	NM_015716		4796018	4796018	+1	no_errors	ENST00000355280	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.107	A
MINK1	50488	genome.wustl.edu	37	17	4796018	4796018	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr17:4796018G>A	ENST00000355280.6	+	19	2462	c.2266G>A	c.(2266-2268)Ggg>Agg	p.G756R	MINK1_ENST00000347992.7_Missense_Mutation_p.G719R|MINK1_ENST00000453408.3_Missense_Mutation_p.G736R	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1									p.G719R(1)|p.G756R(1)		central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						AGCCTCTCACGGGCACCTCCC	0.682																																						dbGAP											2	Substitution - Missense(2)	breast(2)											23.0	26.0	25.0					17																	4796018		1990	4163	6153	-	-	-	SO:0001583	missense	0			AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.2266G>A	17.37:g.4796018G>A	ENSP00000347427:p.Gly756Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.G756R	ENST00000355280.6	37	c.2266	CCDS45588.1	17	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344562	0.41498	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.76448	-0.76;-0.78;-1.02	5.1	4.13	0.48395	.	0.213631	0.42420	D	0.000716	T	0.73799	0.3633	L	0.43923	1.385	0.09310	N	1	D;D;D;D	0.69078	0.997;0.997;0.994;0.997	P;P;P;P	0.54544	0.755;0.755;0.573;0.755	T	0.62167	-0.6911	10	0.12430	T	0.62	.	6.9184	0.24374	0.0924:0.1765:0.7311:0.0	.	719;736;756;719	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	R	756;736;719	ENSP00000347427:G756R;ENSP00000406487:G736R;ENSP00000269296:G719R	ENSP00000269296:G719R	G	+	1	0	MINK1	4736794	0.599000	0.26891	0.679000	0.29978	0.947000	0.59692	1.489000	0.35562	1.382000	0.46385	0.655000	0.94253	GGG	MINK1	-	NULL	ENSG00000141503		0.682	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000439801.1	38	0.00	0	G	NM_015716		4796018	4796018	+1	no_errors	ENST00000355280	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.107	A
MIS18BP1	55320	genome.wustl.edu	37	14	45687625	45687625	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr14:45687625C>A	ENST00000310806.4	-	12	3160	c.2702G>T	c.(2701-2703)gGt>gTt	p.G901V		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	901	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G901V(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TGACCAGAAACCAGGTTTGTG	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	66.0	66.0					14																	45687625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2702G>T	14.37:g.45687625C>A	ENSP00000309790:p.Gly901Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.G901V	ENST00000310806.4	37	c.2702	CCDS9684.1	14	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222517	0.79464	.	.	ENSG00000129534	ENST00000310806	T	0.46063	0.88	5.37	5.37	0.77165	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.091521	0.85682	D	0.000000	T	0.64918	0.2642	M	0.76002	2.32	0.80722	D	1	D	0.71674	0.998	D	0.71656	0.974	T	0.68588	-0.5369	10	0.87932	D	0	-14.9626	16.5997	0.84810	0.0:1.0:0.0:0.0	.	901	Q6P0N0	M18BP_HUMAN	V	901	ENSP00000309790:G901V	ENSP00000309790:G901V	G	-	2	0	MIS18BP1	44757375	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.130000	0.64745	2.540000	0.85666	0.591000	0.81541	GGT	MIS18BP1	-	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000129534		0.403	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	88	0.00	0	C			45687625	45687625	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	missense	85	25.44	29	SNP	1.000	A
MIS18BP1	55320	genome.wustl.edu	37	14	45687625	45687625	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr14:45687625C>A	ENST00000310806.4	-	12	3160	c.2702G>T	c.(2701-2703)gGt>gTt	p.G901V		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	901	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G901V(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TGACCAGAAACCAGGTTTGTG	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	66.0	66.0					14																	45687625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2702G>T	14.37:g.45687625C>A	ENSP00000309790:p.Gly901Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.G901V	ENST00000310806.4	37	c.2702	CCDS9684.1	14	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222517	0.79464	.	.	ENSG00000129534	ENST00000310806	T	0.46063	0.88	5.37	5.37	0.77165	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.091521	0.85682	D	0.000000	T	0.64918	0.2642	M	0.76002	2.32	0.80722	D	1	D	0.71674	0.998	D	0.71656	0.974	T	0.68588	-0.5369	10	0.87932	D	0	-14.9626	16.5997	0.84810	0.0:1.0:0.0:0.0	.	901	Q6P0N0	M18BP_HUMAN	V	901	ENSP00000309790:G901V	ENSP00000309790:G901V	G	-	2	0	MIS18BP1	44757375	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.130000	0.64745	2.540000	0.85666	0.591000	0.81541	GGT	MIS18BP1	-	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000129534		0.403	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	75	0.00	0	C			45687625	45687625	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	missense	85	25.44	29	SNP	1.000	A
NOD1	10392	genome.wustl.edu	37	7	30491714	30491714	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr7:30491714C>T	ENST00000222823.4	-	6	1844	c.1319G>A	c.(1318-1320)aGc>aAc	p.S440N		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	440	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)	p.S440N(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						CTGCACCAGGCTGCTGGGCTG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	53.0	54.0					7																	30491714		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1319G>A	7.37:g.30491714C>T	ENSP00000222823:p.Ser440Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.S440N	ENST00000222823.4	37	c.1319	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691535	0.48097	.	.	ENSG00000106100	ENST00000222823	T	0.71341	-0.56	5.71	5.71	0.89125	NACHT nucleoside triphosphatase (1);	0.196107	0.56097	D	0.000029	T	0.58666	0.2138	L	0.43152	1.355	0.80722	D	1	B	0.29909	0.261	B	0.20184	0.028	T	0.54977	-0.8212	10	0.11794	T	0.64	.	13.7818	0.63087	0.1532:0.8468:0.0:0.0	.	440	Q9Y239	NOD1_HUMAN	N	440	ENSP00000222823:S440N	ENSP00000222823:S440N	S	-	2	0	NOD1	30458239	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.059000	0.41384	2.691000	0.91804	0.563000	0.77884	AGC	NOD1	-	pfscan_NACHT_NTPase	ENSG00000106100		0.647	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	45	0.00	0	C			30491714	30491714	-1	no_errors	ENST00000222823	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	1.000	T
NOD1	10392	genome.wustl.edu	37	7	30491714	30491714	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr7:30491714C>T	ENST00000222823.4	-	6	1844	c.1319G>A	c.(1318-1320)aGc>aAc	p.S440N		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	440	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)	p.S440N(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						CTGCACCAGGCTGCTGGGCTG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	53.0	54.0					7																	30491714		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1319G>A	7.37:g.30491714C>T	ENSP00000222823:p.Ser440Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.S440N	ENST00000222823.4	37	c.1319	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691535	0.48097	.	.	ENSG00000106100	ENST00000222823	T	0.71341	-0.56	5.71	5.71	0.89125	NACHT nucleoside triphosphatase (1);	0.196107	0.56097	D	0.000029	T	0.58666	0.2138	L	0.43152	1.355	0.80722	D	1	B	0.29909	0.261	B	0.20184	0.028	T	0.54977	-0.8212	10	0.11794	T	0.64	.	13.7818	0.63087	0.1532:0.8468:0.0:0.0	.	440	Q9Y239	NOD1_HUMAN	N	440	ENSP00000222823:S440N	ENSP00000222823:S440N	S	-	2	0	NOD1	30458239	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.059000	0.41384	2.691000	0.91804	0.563000	0.77884	AGC	NOD1	-	pfscan_NACHT_NTPase	ENSG00000106100		0.647	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	33	0.00	0	C			30491714	30491714	-1	no_errors	ENST00000222823	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	1.000	T
PGAP1	80055	genome.wustl.edu	37	2	197709249	197709249	+	Splice_Site	SNP	A	A	G			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr2:197709249A>G	ENST00000354764.4	-	24	2450	c.2336T>C	c.(2335-2337)gTg>gCg	p.V779A		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	779					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.V779A(1)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						AAAACTTACCACAGGCTGGCT	0.264																																						dbGAP											1	Substitution - Missense(1)	breast(1)											19.0	22.0	21.0					2																	197709249		2189	4262	6451	-	-	-	SO:0001630	splice_region_variant	0				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2337+1T>C	2.37:g.197709249A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	pfam_PGAP1-like	p.V779A	ENST00000354764.4	37	c.2336	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	A	10.49	1.365108	0.24684	.	.	ENSG00000197121	ENST00000354764;ENST00000422444	T;T	0.42900	0.96;0.96	4.8	3.64	0.41730	.	0.846249	0.10496	N	0.667789	T	0.21631	0.0521	N	0.14661	0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10337	-1.0634	10	0.11485	T	0.65	-2.1371	4.4874	0.11797	0.7376:0.0:0.0925:0.1698	.	605;779	Q75T13-2;Q75T13	.;PGAP1_HUMAN	A	779;51	ENSP00000346809:V779A;ENSP00000390555:V51A	ENSP00000346809:V779A	V	-	2	0	PGAP1	197417494	0.983000	0.35010	1.000000	0.80357	0.663000	0.39108	1.075000	0.30716	0.950000	0.37743	0.477000	0.44152	GTG	PGAP1	-	NULL	ENSG00000197121		0.264	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	HGNC	protein_coding	OTTHUMT00000256103.5	28	0.00	0	A	NM_024989	Missense_Mutation	197709249	197709249	-1	no_errors	ENST00000354764	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	0.986	G
PGAP1	80055	genome.wustl.edu	37	2	197709249	197709249	+	Splice_Site	SNP	A	A	G			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr2:197709249A>G	ENST00000354764.4	-	24	2450	c.2336T>C	c.(2335-2337)gTg>gCg	p.V779A		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	779					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.V779A(1)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						AAAACTTACCACAGGCTGGCT	0.264																																						dbGAP											1	Substitution - Missense(1)	breast(1)											19.0	22.0	21.0					2																	197709249		2189	4262	6451	-	-	-	SO:0001630	splice_region_variant	0				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2337+1T>C	2.37:g.197709249A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	pfam_PGAP1-like	p.V779A	ENST00000354764.4	37	c.2336	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	A	10.49	1.365108	0.24684	.	.	ENSG00000197121	ENST00000354764;ENST00000422444	T;T	0.42900	0.96;0.96	4.8	3.64	0.41730	.	0.846249	0.10496	N	0.667789	T	0.21631	0.0521	N	0.14661	0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10337	-1.0634	10	0.11485	T	0.65	-2.1371	4.4874	0.11797	0.7376:0.0:0.0925:0.1698	.	605;779	Q75T13-2;Q75T13	.;PGAP1_HUMAN	A	779;51	ENSP00000346809:V779A;ENSP00000390555:V51A	ENSP00000346809:V779A	V	-	2	0	PGAP1	197417494	0.983000	0.35010	1.000000	0.80357	0.663000	0.39108	1.075000	0.30716	0.950000	0.37743	0.477000	0.44152	GTG	PGAP1	-	NULL	ENSG00000197121		0.264	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	HGNC	protein_coding	OTTHUMT00000256103.5	32	0.00	0	A	NM_024989	Missense_Mutation	197709249	197709249	-1	no_errors	ENST00000354764	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	0.986	G
NRP2	8828	genome.wustl.edu	37	2	206610543	206610543	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr2:206610543G>A	ENST00000357785.5	+	10	1746	c.1715G>A	c.(1714-1716)cGg>cAg	p.R572Q	NRP2_ENST00000412873.2_Missense_Mutation_p.R572Q|NRP2_ENST00000272849.3_Missense_Mutation_p.R572Q|NRP2_ENST00000540178.1_Missense_Mutation_p.R572Q|NRP2_ENST00000360409.3_Missense_Mutation_p.R572Q|NRP2_ENST00000357118.4_Missense_Mutation_p.R572Q|NRP2_ENST00000540841.1_Missense_Mutation_p.R572Q			Q99435	NELL2_HUMAN	neuropilin 2	0	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R572Q(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CAGTATGTGCGGGTATACCCG	0.587																																						dbGAP											2	Substitution - Missense(2)	breast(2)											95.0	84.0	88.0					2																	206610543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1715G>A	2.37:g.206610543G>A	ENSP00000350432:p.Arg572Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.R572Q	ENST00000357785.5	37	c.1715	CCDS46496.1	2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719444	0.89205	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	D;D;D;D;D;D;D	0.99773	-6.72;-6.72;-6.72;-6.72;-6.72;-6.72;-6.72	5.84	5.84	0.93424	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.91561	3.22	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.995;0.999;0.999	D	0.97199	0.9863	10	0.87932	D	0	-27.2692	20.1342	0.98015	0.0:0.0:1.0:0.0	.	572;572;572;572;572	O60462-2;O60462-3;O60462;O60462-4;O60462-5	.;.;NRP2_HUMAN;.;.	Q	572	ENSP00000353582:R572Q;ENSP00000439658:R572Q;ENSP00000439261:R572Q;ENSP00000349632:R572Q;ENSP00000350432:R572Q;ENSP00000407626:R572Q;ENSP00000272849:R572Q	ENSP00000272849:R572Q	R	+	2	0	NRP2	206318788	1.000000	0.71417	0.991000	0.47740	0.062000	0.15995	9.842000	0.99487	2.754000	0.94517	0.655000	0.94253	CGG	NRP2	-	pirsf_Neuropilin,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000118257		0.587	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	158	0.00	0	G			206610543	206610543	+1	no_errors	ENST00000360409	ensembl	human	known	69_37n	missense	91	40.13	63	SNP	1.000	A
NRP2	8828	genome.wustl.edu	37	2	206610543	206610543	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr2:206610543G>A	ENST00000357785.5	+	10	1746	c.1715G>A	c.(1714-1716)cGg>cAg	p.R572Q	NRP2_ENST00000412873.2_Missense_Mutation_p.R572Q|NRP2_ENST00000272849.3_Missense_Mutation_p.R572Q|NRP2_ENST00000540178.1_Missense_Mutation_p.R572Q|NRP2_ENST00000360409.3_Missense_Mutation_p.R572Q|NRP2_ENST00000357118.4_Missense_Mutation_p.R572Q|NRP2_ENST00000540841.1_Missense_Mutation_p.R572Q			Q99435	NELL2_HUMAN	neuropilin 2	0	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R572Q(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CAGTATGTGCGGGTATACCCG	0.587																																						dbGAP											2	Substitution - Missense(2)	breast(2)											95.0	84.0	88.0					2																	206610543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1715G>A	2.37:g.206610543G>A	ENSP00000350432:p.Arg572Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.R572Q	ENST00000357785.5	37	c.1715	CCDS46496.1	2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719444	0.89205	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	D;D;D;D;D;D;D	0.99773	-6.72;-6.72;-6.72;-6.72;-6.72;-6.72;-6.72	5.84	5.84	0.93424	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.91561	3.22	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.995;0.999;0.999	D	0.97199	0.9863	10	0.87932	D	0	-27.2692	20.1342	0.98015	0.0:0.0:1.0:0.0	.	572;572;572;572;572	O60462-2;O60462-3;O60462;O60462-4;O60462-5	.;.;NRP2_HUMAN;.;.	Q	572	ENSP00000353582:R572Q;ENSP00000439658:R572Q;ENSP00000439261:R572Q;ENSP00000349632:R572Q;ENSP00000350432:R572Q;ENSP00000407626:R572Q;ENSP00000272849:R572Q	ENSP00000272849:R572Q	R	+	2	0	NRP2	206318788	1.000000	0.71417	0.991000	0.47740	0.062000	0.15995	9.842000	0.99487	2.754000	0.94517	0.655000	0.94253	CGG	NRP2	-	pirsf_Neuropilin,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000118257		0.587	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	176	0.00	0	G			206610543	206610543	+1	no_errors	ENST00000360409	ensembl	human	known	69_37n	missense	91	40.13	63	SNP	1.000	A
RNF44	22838	genome.wustl.edu	37	5	175957174	175957174	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr5:175957174T>G	ENST00000274811.4	-	7	1359	c.835A>C	c.(835-837)Acc>Ccc	p.T279P	RNF44_ENST00000509404.1_5'Flank|RNF44_ENST00000537487.1_Missense_Mutation_p.T198P	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	279	Pro-rich.						zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TATCTCTGGGTGCTCAGTCTC	0.667																																						dbGAP											0													30.0	26.0	28.0					5																	175957174		1508	2649	4157	-	-	-	SO:0001583	missense	0			AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.835A>C	5.37:g.175957174T>G	ENSP00000274811:p.Thr279Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.T279P	ENST00000274811.4	37	c.835	CCDS4404.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.03|17.03	3.285493|3.285493	0.59867|0.59867	.|.	.|.	ENSG00000146083|ENSG00000146083	ENST00000506378|ENST00000274811;ENST00000537487	.|T;T	.|0.30448	.|1.53;1.53	4.78|4.78	2.44|2.44	0.29823|0.29823	.|.	.|0.251177	.|0.40144	.|N	.|0.001169	T|T	0.25568|0.25568	0.0622|0.0622	L|L	0.34521|0.34521	1.04|1.04	0.33160|0.33160	D|D	0.5468|0.5468	.|B	.|0.31009	.|0.303	.|B	.|0.39562	.|0.303	T|T	0.30621|0.30621	-0.9972|-0.9972	5|10	.|0.49607	.|T	.|0.09	-13.3|-13.3	7.1768|7.1768	0.25749|0.25749	0.0:0.252:0.0:0.748|0.0:0.252:0.0:0.748	.|.	.|279	.|Q7L0R7	.|RNF44_HUMAN	P|P	33|279;198	.|ENSP00000274811:T279P;ENSP00000440352:T198P	.|ENSP00000274811:T279P	H|T	-|-	2|1	0|0	RNF44|RNF44	175889780|175889780	0.974000|0.974000	0.33945|0.33945	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	0.973000|0.973000	0.29422|0.29422	0.366000|0.366000	0.24427|0.24427	0.448000|0.448000	0.29417|0.29417	CAC|ACC	RNF44	-	NULL	ENSG00000146083		0.667	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF44	HGNC	protein_coding	OTTHUMT00000253156.2	25	0.00	0	T			175957174	175957174	-1	no_errors	ENST00000274811	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	G
SBF2	81846	genome.wustl.edu	37	11	9853808	9853808	+	Silent	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr11:9853808G>A	ENST00000256190.8	-	27	3752	c.3615C>T	c.(3613-3615)gtC>gtT	p.V1205V		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1205	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		AAAGACCAACGACTCCCTTCC	0.478																																						dbGAP											0													92.0	88.0	90.0					11																	9853808		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.3615C>T	11.37:g.9853808G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	pfam_Myotub-related	p.S89L	ENST00000256190.8	37	c.266	CCDS31427.1	11	.	.	.	.	.	.	.	.	.	.	G	10.39	1.335953	0.24253	.	.	ENSG00000133812	ENST00000530741	.	.	.	5.76	-7.28	0.01456	.	.	.	.	.	T	0.36248	0.0960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45145	-0.9281	4	.	.	.	.	3.0937	0.06302	0.461:0.2619:0.1858:0.0913	.	.	.	.	L	89	.	.	S	-	2	0	SBF2	9810384	0.155000	0.22806	0.972000	0.41901	0.995000	0.86356	-0.388000	0.07352	-0.737000	0.04824	-0.345000	0.07892	TCG	SBF2	-	NULL	ENSG00000133812		0.478	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBF2	HGNC	protein_coding	OTTHUMT00000386911.2	126	0.00	0	G	NM_030962		9853808	9853808	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000530741	ensembl	human	novel	69_37n	missense	112	30.67	50	SNP	0.859	A
SF3B1	23451	genome.wustl.edu	37	2	198266834	198266834	+	Missense_Mutation	SNP	T	T	C	rs559063155		TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr2:198266834T>C	ENST00000335508.6	-	15	2189	c.2098A>G	c.(2098-2100)Aaa>Gaa	p.K700E	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'UTR	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K700E(179)|p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTCCGAACTTTCTGCTGCTCA	0.408			Mis		myelodysplastic syndrome								T|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	181	Substitution - Missense(179)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(153)|NS(20)|breast(5)|pancreas(2)|central_nervous_system(1)																																								-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2098A>G	2.37:g.198266834T>C	ENSP00000335321:p.Lys700Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K700E	ENST00000335508.6	37	c.2098	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.243295	0.95272	.	.	ENSG00000115524	ENST00000335508	T	0.63580	-0.05	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89820	0.3988	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	E	700	ENSP00000335321:K700E	ENSP00000335321:K700E	K	-	1	0	SF3B1	197975079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.408	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	43	0.00	0	T			198266834	198266834	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	32	39.62	21	SNP	1.000	C
SF3B1	23451	genome.wustl.edu	37	2	198266834	198266834	+	Missense_Mutation	SNP	T	T	C	rs559063155		TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr2:198266834T>C	ENST00000335508.6	-	15	2189	c.2098A>G	c.(2098-2100)Aaa>Gaa	p.K700E	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'UTR	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K700E(179)|p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTCCGAACTTTCTGCTGCTCA	0.408			Mis		myelodysplastic syndrome								T|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	181	Substitution - Missense(179)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(153)|NS(20)|breast(5)|pancreas(2)|central_nervous_system(1)																																								-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2098A>G	2.37:g.198266834T>C	ENSP00000335321:p.Lys700Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K700E	ENST00000335508.6	37	c.2098	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.243295	0.95272	.	.	ENSG00000115524	ENST00000335508	T	0.63580	-0.05	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89820	0.3988	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	E	700	ENSP00000335321:K700E	ENSP00000335321:K700E	K	-	1	0	SF3B1	197975079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.408	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	50	0.00	0	T			198266834	198266834	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	32	39.62	21	SNP	1.000	C
SLC8B1	80024	genome.wustl.edu	37	12	113737727	113737727	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr12:113737727C>T	ENST00000552014.1	-	17	2125	c.1610G>A	c.(1609-1611)aGc>aAc	p.S537N	SLC8B1_ENST00000550047.1_Missense_Mutation_p.S52N|SLC8B1_ENST00000549069.1_Missense_Mutation_p.S96N|SLC8B1_ENST00000202831.3_Missense_Mutation_p.S537N|SLC8B1_ENST00000546737.1_Missense_Mutation_p.S481N			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	537					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)	p.S537N(1)									GAAGACGAGGCTGAGCCCCAG	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	67.0	68.0					12																	113737727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.1610G>A	12.37:g.113737727C>T	ENSP00000447091:p.Ser537Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Missense_Mutation	SNP	pfam_NaCa_Exmemb	p.S537N	ENST00000552014.1	37	c.1610	CCDS31909.1	12	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816141	0.90790	.	.	ENSG00000089060	ENST00000552014;ENST00000202831;ENST00000377458;ENST00000550047;ENST00000549069;ENST00000546737	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.59	4.69	0.59074	Sodium/calcium exchanger membrane region (1);	0.176829	0.52532	D	0.000076	T	0.77164	0.4090	M	0.62016	1.91	0.58432	D	0.999991	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.985	T	0.79838	-0.1634	10	0.66056	D	0.02	.	16.5838	0.84722	0.0:0.8696:0.1304:0.0	.	537;242	Q6J4K2;B3KSP6	NCKX6_HUMAN;.	N	537;537;481;52;96;481	ENSP00000447091:S537N;ENSP00000202831:S537N;ENSP00000447585:S52N;ENSP00000449519:S96N;ENSP00000450081:S481N	ENSP00000202831:S537N	S	-	2	0	SLC24A6	112222110	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.874000	0.69652	1.357000	0.45904	0.555000	0.69702	AGC	SLC24A6	-	pfam_NaCa_Exmemb	ENSG00000089060		0.607	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SLC24A6	HGNC	protein_coding	OTTHUMT00000404830.3	111	0.00	0	C	NM_024959		113737727	113737727	-1	no_errors	ENST00000202831	ensembl	human	known	69_37n	missense	67	23.86	21	SNP	1.000	T
SLC8B1	80024	genome.wustl.edu	37	12	113737727	113737727	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr12:113737727C>T	ENST00000552014.1	-	17	2125	c.1610G>A	c.(1609-1611)aGc>aAc	p.S537N	SLC8B1_ENST00000550047.1_Missense_Mutation_p.S52N|SLC8B1_ENST00000549069.1_Missense_Mutation_p.S96N|SLC8B1_ENST00000202831.3_Missense_Mutation_p.S537N|SLC8B1_ENST00000546737.1_Missense_Mutation_p.S481N			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	537					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)	p.S537N(1)									GAAGACGAGGCTGAGCCCCAG	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	67.0	68.0					12																	113737727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.1610G>A	12.37:g.113737727C>T	ENSP00000447091:p.Ser537Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Missense_Mutation	SNP	pfam_NaCa_Exmemb	p.S537N	ENST00000552014.1	37	c.1610	CCDS31909.1	12	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816141	0.90790	.	.	ENSG00000089060	ENST00000552014;ENST00000202831;ENST00000377458;ENST00000550047;ENST00000549069;ENST00000546737	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.59	4.69	0.59074	Sodium/calcium exchanger membrane region (1);	0.176829	0.52532	D	0.000076	T	0.77164	0.4090	M	0.62016	1.91	0.58432	D	0.999991	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.985	T	0.79838	-0.1634	10	0.66056	D	0.02	.	16.5838	0.84722	0.0:0.8696:0.1304:0.0	.	537;242	Q6J4K2;B3KSP6	NCKX6_HUMAN;.	N	537;537;481;52;96;481	ENSP00000447091:S537N;ENSP00000202831:S537N;ENSP00000447585:S52N;ENSP00000449519:S96N;ENSP00000450081:S481N	ENSP00000202831:S537N	S	-	2	0	SLC24A6	112222110	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.874000	0.69652	1.357000	0.45904	0.555000	0.69702	AGC	SLC24A6	-	pfam_NaCa_Exmemb	ENSG00000089060		0.607	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SLC24A6	HGNC	protein_coding	OTTHUMT00000404830.3	95	0.00	0	C	NM_024959		113737727	113737727	-1	no_errors	ENST00000202831	ensembl	human	known	69_37n	missense	67	23.86	21	SNP	1.000	T
SMYD2	56950	genome.wustl.edu	37	1	214504346	214504346	+	Silent	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr1:214504346C>T	ENST00000366957.5	+	9	892	c.870C>T	c.(868-870)gcC>gcT	p.A290A	SMYD2_ENST00000491455.1_3'UTR|SMYD2_ENST00000415093.2_Intron	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	290					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)	p.A290A(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		AGGCAGAAGCCATCCGAGACA	0.502																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											134.0	134.0	134.0					1																	214504346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.870C>T	1.37:g.214504346C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.A290	ENST00000366957.5	37	c.870	CCDS31022.1	1																																																																																			SMYD2	-	NULL	ENSG00000143499		0.502	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD2	HGNC	protein_coding	OTTHUMT00000089998.1	137	0.00	0	C	NM_020197		214504346	214504346	+1	no_errors	ENST00000366957	ensembl	human	known	69_37n	silent	117	10.00	13	SNP	0.928	T
SMYD2	56950	genome.wustl.edu	37	1	214504346	214504346	+	Silent	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr1:214504346C>T	ENST00000366957.5	+	9	892	c.870C>T	c.(868-870)gcC>gcT	p.A290A	SMYD2_ENST00000491455.1_3'UTR|SMYD2_ENST00000415093.2_Intron	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	290					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)	p.A290A(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		AGGCAGAAGCCATCCGAGACA	0.502																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											134.0	134.0	134.0					1																	214504346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.870C>T	1.37:g.214504346C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.A290	ENST00000366957.5	37	c.870	CCDS31022.1	1																																																																																			SMYD2	-	NULL	ENSG00000143499		0.502	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD2	HGNC	protein_coding	OTTHUMT00000089998.1	131	0.00	0	C	NM_020197		214504346	214504346	+1	no_errors	ENST00000366957	ensembl	human	known	69_37n	silent	117	10.00	13	SNP	0.928	T
TECTA	7007	genome.wustl.edu	37	11	121030932	121030933	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr11:121030932_121030933insC	ENST00000392793.1	+	15	5049_5050	c.4778_4779insC	c.(4777-4782)agcccafs	p.SP1593fs	TECTA_ENST00000264037.2_Frame_Shift_Ins_p.SP1593fs			O75443	TECTA_HUMAN	tectorin alpha	1593	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.D1595fs*13(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ATTGACACCAGCCCAGACATCC	0.455																																						dbGAP											1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4781dupC	11.37:g.121030935_121030935dupC	ENSP00000376543:p.Ser1593fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.D1595fs	ENST00000392793.1	37	c.4778_4779	CCDS8434.1	11																																																																																			TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.455	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	73	0.00	0	-	NM_005422		121030932	121030933	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	frame_shift_ins	51	40.70	35	INS	1.000:1.000	C
TECTA	7007	genome.wustl.edu	37	11	121030932	121030933	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr11:121030932_121030933insC	ENST00000392793.1	+	15	5049_5050	c.4778_4779insC	c.(4777-4782)agcccafs	p.SP1593fs	TECTA_ENST00000264037.2_Frame_Shift_Ins_p.SP1593fs			O75443	TECTA_HUMAN	tectorin alpha	1593	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.D1595fs*13(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ATTGACACCAGCCCAGACATCC	0.455																																						dbGAP											1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4781dupC	11.37:g.121030935_121030935dupC	ENSP00000376543:p.Ser1593fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.D1595fs	ENST00000392793.1	37	c.4778_4779	CCDS8434.1	11																																																																																			TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.455	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	94	0.00	0	-	NM_005422		121030932	121030933	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	frame_shift_ins	51	40.70	35	INS	1.000:1.000	C
TSGA10	80705	genome.wustl.edu	37	2	99634761	99634761	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr2:99634761A>T	ENST00000393483.3	-	20	2818	c.1974T>A	c.(1972-1974)taT>taA	p.Y658*	TSGA10_ENST00000410001.1_Nonsense_Mutation_p.Y658*|TSGA10_ENST00000539964.1_Nonsense_Mutation_p.Y658*|TSGA10_ENST00000355053.4_Nonsense_Mutation_p.Y658*	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	658	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Y658*(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						AACTCATATGATAAGCATTAC	0.383																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											134.0	130.0	131.0					2																	99634761		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1974T>A	2.37:g.99634761A>T	ENSP00000377123:p.Tyr658*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Nonsense_Mutation	SNP	NULL	p.Y658*	ENST00000393483.3	37	c.1974	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	A	41	8.932591	0.99008	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	.	.	.	5.04	1.05	0.20165	.	0.192237	0.36200	N	0.002728	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4293	8.9357	0.35697	0.7436:0.0:0.2564:0.0	.	.	.	.	X	658;658;658;658;588;658	.	ENSP00000347161:Y658X	Y	-	3	2	TSGA10	99001193	1.000000	0.71417	0.994000	0.49952	0.868000	0.49771	0.692000	0.25482	0.382000	0.24878	0.533000	0.62120	TAT	TSGA10	-	NULL	ENSG00000135951		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	160	0.62	1	A	NM_182911		99634761	99634761	-1	no_errors	ENST00000355053	ensembl	human	known	69_37n	nonsense	158	33.33	79	SNP	0.995	T
TSGA10	80705	genome.wustl.edu	37	2	99634761	99634761	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr2:99634761A>T	ENST00000393483.3	-	20	2818	c.1974T>A	c.(1972-1974)taT>taA	p.Y658*	TSGA10_ENST00000410001.1_Nonsense_Mutation_p.Y658*|TSGA10_ENST00000539964.1_Nonsense_Mutation_p.Y658*|TSGA10_ENST00000355053.4_Nonsense_Mutation_p.Y658*	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	658	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Y658*(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						AACTCATATGATAAGCATTAC	0.383																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											134.0	130.0	131.0					2																	99634761		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1974T>A	2.37:g.99634761A>T	ENSP00000377123:p.Tyr658*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Nonsense_Mutation	SNP	NULL	p.Y658*	ENST00000393483.3	37	c.1974	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	A	41	8.932591	0.99008	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	.	.	.	5.04	1.05	0.20165	.	0.192237	0.36200	N	0.002728	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4293	8.9357	0.35697	0.7436:0.0:0.2564:0.0	.	.	.	.	X	658;658;658;658;588;658	.	ENSP00000347161:Y658X	Y	-	3	2	TSGA10	99001193	1.000000	0.71417	0.994000	0.49952	0.868000	0.49771	0.692000	0.25482	0.382000	0.24878	0.533000	0.62120	TAT	TSGA10	-	NULL	ENSG00000135951		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	136	0.00	0	A	NM_182911		99634761	99634761	-1	no_errors	ENST00000355053	ensembl	human	known	69_37n	nonsense	158	33.33	79	SNP	0.995	T
WNK3	65267	genome.wustl.edu	37	X	54335680	54335680	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chrX:54335680C>T	ENST00000375159.2	-	3	778	c.779G>A	c.(778-780)gGg>gAg	p.G260E	WNK3_ENST00000354646.2_Missense_Mutation_p.G260E|WNK3_ENST00000375169.3_Missense_Mutation_p.G260E			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	260	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G260E(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GAACTGCAACCCCTTTAAAAT	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	72.0	78.0					X																	54335680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.779G>A	X.37:g.54335680C>T	ENSP00000364301:p.Gly260Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G260E	ENST00000375159.2	37	c.779	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554013	0.86231	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.38560	1.13;1.13;1.13	4.93	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000099	T	0.75664	0.3880	H	0.95850	3.73	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.84688	0.0721	10	0.87932	D	0	-9.1467	16.24	0.82402	0.0:1.0:0.0:0.0	.	260;260	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	E	260	ENSP00000364312:G260E;ENSP00000346667:G260E;ENSP00000364301:G260E	ENSP00000346667:G260E	G	-	2	0	WNK3	54352405	1.000000	0.71417	0.964000	0.40570	0.994000	0.84299	7.688000	0.84153	2.175000	0.68902	0.422000	0.28245	GGG	WNK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196632		0.408	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	166	0.00	0	C	NM_020922		54335680	54335680	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	missense	96	27.27	36	SNP	1.000	T
WNK3	65267	genome.wustl.edu	37	X	54335680	54335680	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chrX:54335680C>T	ENST00000375159.2	-	3	778	c.779G>A	c.(778-780)gGg>gAg	p.G260E	WNK3_ENST00000354646.2_Missense_Mutation_p.G260E|WNK3_ENST00000375169.3_Missense_Mutation_p.G260E			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	260	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G260E(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GAACTGCAACCCCTTTAAAAT	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	72.0	78.0					X																	54335680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.779G>A	X.37:g.54335680C>T	ENSP00000364301:p.Gly260Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G260E	ENST00000375159.2	37	c.779	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554013	0.86231	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.38560	1.13;1.13;1.13	4.93	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000099	T	0.75664	0.3880	H	0.95850	3.73	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.84688	0.0721	10	0.87932	D	0	-9.1467	16.24	0.82402	0.0:1.0:0.0:0.0	.	260;260	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	E	260	ENSP00000364312:G260E;ENSP00000346667:G260E;ENSP00000364301:G260E	ENSP00000346667:G260E	G	-	2	0	WNK3	54352405	1.000000	0.71417	0.964000	0.40570	0.994000	0.84299	7.688000	0.84153	2.175000	0.68902	0.422000	0.28245	GGG	WNK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196632		0.408	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	144	0.00	0	C	NM_020922		54335680	54335680	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	missense	96	27.27	36	SNP	1.000	T
VSIG4	11326	genome.wustl.edu	37	X	65244946	65244946	+	Silent	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chrX:65244946G>A	ENST00000374737.4	-	6	969	c.861C>T	c.(859-861)atC>atT	p.I287I	VSIG4_ENST00000412866.2_Silent_p.I193I|VSIG4_ENST00000455586.2_Silent_p.I287I	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	287					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.I287I(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGATGAGGATGATGGCAAAGA	0.413																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											117.0	84.0	95.0					X																	65244946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.861C>T	X.37:g.65244946G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXI4	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.H214Y	ENST00000374737.4	37	c.640	CCDS14383.1	X	.	.	.	.	.	.	.	.	.	.	G	0.358	-0.941249	0.02322	.	.	ENSG00000155659	ENST00000427538	.	.	.	4.29	0.162	0.14981	.	.	.	.	.	T	0.50922	0.1644	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.33471	-0.9867	4	.	.	.	-18.6673	5.3917	0.16247	0.1066:0.0:0.3331:0.5604	.	.	.	.	Y	214	.	.	H	-	1	0	VSIG4	65161671	0.997000	0.39634	0.546000	0.28166	0.031000	0.12232	0.094000	0.15107	-0.336000	0.08438	0.600000	0.82982	CAT	VSIG4	-	NULL	ENSG00000155659		0.413	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VSIG4	HGNC	protein_coding	OTTHUMT00000056986.1	189	0.00	0	G	NM_007268		65244946	65244946	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427538	ensembl	human	known	69_37n	missense	126	28.25	50	SNP	0.862	A
VSIG4	11326	genome.wustl.edu	37	X	65244946	65244946	+	Silent	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chrX:65244946G>A	ENST00000374737.4	-	6	969	c.861C>T	c.(859-861)atC>atT	p.I287I	VSIG4_ENST00000412866.2_Silent_p.I193I|VSIG4_ENST00000455586.2_Silent_p.I287I	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	287					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.I287I(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGATGAGGATGATGGCAAAGA	0.413																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											117.0	84.0	95.0					X																	65244946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.861C>T	X.37:g.65244946G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXI4	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.H214Y	ENST00000374737.4	37	c.640	CCDS14383.1	X	.	.	.	.	.	.	.	.	.	.	G	0.358	-0.941249	0.02322	.	.	ENSG00000155659	ENST00000427538	.	.	.	4.29	0.162	0.14981	.	.	.	.	.	T	0.50922	0.1644	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.33471	-0.9867	4	.	.	.	-18.6673	5.3917	0.16247	0.1066:0.0:0.3331:0.5604	.	.	.	.	Y	214	.	.	H	-	1	0	VSIG4	65161671	0.997000	0.39634	0.546000	0.28166	0.031000	0.12232	0.094000	0.15107	-0.336000	0.08438	0.600000	0.82982	CAT	VSIG4	-	NULL	ENSG00000155659		0.413	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VSIG4	HGNC	protein_coding	OTTHUMT00000056986.1	151	0.00	0	G	NM_007268		65244946	65244946	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427538	ensembl	human	known	69_37n	missense	126	28.25	50	SNP	0.862	A
ZNF460	10794	genome.wustl.edu	37	19	57802202	57802202	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-11A-12D-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	aa3710e7-1b27-4a66-996d-d716171d7f6d	g.chr19:57802202G>A	ENST00000360338.3	+	3	615	c.293G>A	c.(292-294)gGg>gAg	p.G98E	ZNF460_ENST00000537645.1_Missense_Mutation_p.G57E	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	98	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G98E(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GATCAAGATGGGCCATCTGAA	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	81.0	82.0					19																	57802202		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.293G>A	19.37:g.57802202G>A	ENSP00000353491:p.Gly98Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G98E	ENST00000360338.3	37	c.293	CCDS12949.1	19	.	.	.	.	.	.	.	.	.	.	G	9.839	1.190509	0.21954	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.32753	1.44;1.44	1.68	-2.36	0.06663	Krueppel-associated box (1);	.	.	.	.	T	0.11067	0.0270	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33266	-0.9875	9	0.02654	T	1	.	2.5879	0.04835	0.4695:0.0:0.3067:0.2239	.	98	Q14592	ZN460_HUMAN	E	57;98	ENSP00000446167:G57E;ENSP00000353491:G98E	ENSP00000353491:G98E	G	+	2	0	ZNF460	62494014	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.760000	0.04756	-0.550000	0.06183	-0.188000	0.12872	GGG	ZNF460	-	pfscan_Krueppel-associated_box	ENSG00000197714		0.517	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF460	HGNC	protein_coding	OTTHUMT00000465727.1	64	0.00	0	G	NM_006635		57802202	57802202	+1	no_errors	ENST00000360338	ensembl	human	known	69_37n	missense	44	27.87	17	SNP	0.002	A
ZNF460	10794	genome.wustl.edu	37	19	57802202	57802202	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DQ-01A-11D-A099-09	TCGA-BH-A0DQ-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	50da0300-124c-429e-8627-47b8ff640ea5	05825f2e-ce2f-45b6-a04a-a0c144120407	g.chr19:57802202G>A	ENST00000360338.3	+	3	615	c.293G>A	c.(292-294)gGg>gAg	p.G98E	ZNF460_ENST00000537645.1_Missense_Mutation_p.G57E	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	98	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G98E(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GATCAAGATGGGCCATCTGAA	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	81.0	82.0					19																	57802202		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.293G>A	19.37:g.57802202G>A	ENSP00000353491:p.Gly98Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G98E	ENST00000360338.3	37	c.293	CCDS12949.1	19	.	.	.	.	.	.	.	.	.	.	G	9.839	1.190509	0.21954	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.32753	1.44;1.44	1.68	-2.36	0.06663	Krueppel-associated box (1);	.	.	.	.	T	0.11067	0.0270	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33266	-0.9875	9	0.02654	T	1	.	2.5879	0.04835	0.4695:0.0:0.3067:0.2239	.	98	Q14592	ZN460_HUMAN	E	57;98	ENSP00000446167:G57E;ENSP00000353491:G98E	ENSP00000353491:G98E	G	+	2	0	ZNF460	62494014	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.760000	0.04756	-0.550000	0.06183	-0.188000	0.12872	GGG	ZNF460	-	pfscan_Krueppel-associated_box	ENSG00000197714		0.517	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF460	HGNC	protein_coding	OTTHUMT00000465727.1	72	0.00	0	G	NM_006635		57802202	57802202	+1	no_errors	ENST00000360338	ensembl	human	known	69_37n	missense	44	27.87	17	SNP	0.002	A
