#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCY7	113	genome.wustl.edu	37	16	50345963	50345963	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr16:50345963G>A	ENST00000394697.2	+	21	2805	c.2465G>A	c.(2464-2466)cGc>cAc	p.R822H	ADCY7_ENST00000254235.3_Missense_Mutation_p.R822H			P51828	ADCY7_HUMAN	adenylate cyclase 7	822					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		TATTACTGCCGCTTGGACTGC	0.552																																						dbGAP											0													107.0	101.0	103.0					16																	50345963		2198	4300	6498	-	-	-	SO:0001583	missense	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.2465G>A	16.37:g.50345963G>A	ENSP00000378187:p.Arg822His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVA6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R822H	ENST00000394697.2	37	c.2465	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.138529	0.94560	.	.	ENSG00000121281	ENST00000394697;ENST00000254235	D;D	0.86562	-2.14;-2.14	4.77	4.77	0.60923	.	0.000000	0.43416	U	0.000564	D	0.95233	0.8454	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96451	0.9334	10	0.87932	D	0	.	17.9745	0.89123	0.0:0.0:1.0:0.0	.	822	P51828	ADCY7_HUMAN	H	822	ENSP00000378187:R822H;ENSP00000254235:R822H	ENSP00000254235:R822H	R	+	2	0	ADCY7	48903464	1.000000	0.71417	0.992000	0.48379	0.924000	0.55760	9.657000	0.98554	2.470000	0.83445	0.462000	0.41574	CGC	ADCY7	-	NULL	ENSG00000121281		0.552	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3	202	0.00	0	G			50345963	50345963	+1	no_errors	ENST00000254235	ensembl	human	known	69_37n	missense	141	13.50	22	SNP	1.000	A
ADRA1A	148	genome.wustl.edu	37	8	26623598	26623598	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr8:26623598C>A	ENST00000354550.4	-	3	1537	c.1338G>T	c.(1336-1338)atG>atT	p.M446I	ADRA1A_ENST00000519229.1_Intron|ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380586.1_Intron|ADRA1A_ENST00000380582.3_Intron	NM_033304.2	NP_150647.2	P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	0					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TCCACGGTGGCATCATAAAAT	0.428																																						dbGAP											0													151.0	139.0	143.0					8																	26623598		2203	4300	6503	-	-	-	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000354550.4:c.1338G>T	8.37:g.26623598C>A	ENSP00000346557:p.Met446Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPY0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adrene_rcpt_A1Cs,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.M446I	ENST00000354550.4	37	c.1338	CCDS6053.1	8	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502855	0.26949	.	.	ENSG00000120907	ENST00000354550	T	0.60548	0.18	4.46	0.477	0.16784	.	.	.	.	.	T	0.25005	0.0607	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25606	-1.0127	8	0.02654	T	1	.	3.0692	0.06225	0.1889:0.4812:0.0:0.3299	.	446	P35348-4	.	I	446	ENSP00000346557:M446I	ENSP00000346557:M446I	M	-	3	0	ADRA1A	26679515	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.659000	0.05323	0.068000	0.16574	0.655000	0.94253	ATG	ADRA1A	-	NULL	ENSG00000120907		0.428	ADRA1A-002	KNOWN	basic|CCDS	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000216928.1	210	0.00	0	C	NM_033303		26623598	26623598	-1	no_errors	ENST00000354550	ensembl	human	known	69_37n	missense	102	15.70	19	SNP	0.000	A
AFF2	2334	genome.wustl.edu	37	X	148037760	148037760	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chrX:148037760C>A	ENST00000370460.2	+	11	2664	c.2185C>A	c.(2185-2187)Caa>Aaa	p.Q729K	AFF2_ENST00000370457.5_Missense_Mutation_p.Q696K|AFF2_ENST00000286437.5_Missense_Mutation_p.Q370K|AFF2_ENST00000342251.3_Missense_Mutation_p.Q696K	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	729					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGACCCTGCAAATCAAAGT	0.473																																						dbGAP											0													94.0	94.0	94.0					X																	148037760		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2185C>A	X.37:g.148037760C>A	ENSP00000359489:p.Gln729Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.Q729K	ENST00000370460.2	37	c.2185	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726147	0.48833	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.71579	0.02;-0.25;-0.25;-0.58	5.93	5.93	0.95920	.	0.207319	0.42294	D	0.000726	T	0.66665	0.2812	L	0.55103	1.725	0.48087	D	0.999589	B;B;B;B;B;B	0.31459	0.324;0.277;0.277;0.277;0.277;0.324	B;B;B;B;B;B	0.30943	0.122;0.074;0.074;0.074;0.074;0.122	T	0.63323	-0.6663	10	0.11485	T	0.65	.	19.251	0.93925	0.0:1.0:0.0:0.0	.	370;694;696;690;719;729	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	K	729;696;696;370	ENSP00000359489:Q729K;ENSP00000359486:Q696K;ENSP00000345459:Q696K;ENSP00000286437:Q370K	ENSP00000286437:Q370K	Q	+	1	0	AFF2	147845460	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	2.759000	0.47573	2.498000	0.84270	0.600000	0.82982	CAA	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.473	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	89	0.00	0	C	NM_002025		148037760	148037760	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	missense	64	29.35	27	SNP	1.000	A
ANO5	203859	genome.wustl.edu	37	11	22272388	22272388	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr11:22272388C>T	ENST00000324559.8	+	11	1432	c.1115C>T	c.(1114-1116)tCa>tTa	p.S372L		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	372					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGTTTGGCTTCAAAGGTATGT	0.343																																						dbGAP											0													247.0	210.0	223.0					11																	22272388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1115C>T	11.37:g.22272388C>T	ENSP00000315371:p.Ser372Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Anoctamin	p.S372L	ENST00000324559.8	37	c.1115	CCDS31444.1	11	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612988	0.66672	.	.	ENSG00000171714	ENST00000324559	T	0.72282	-0.64	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.85843	0.5791	M	0.84433	2.695	0.80722	D	1	D	0.63046	0.992	D	0.68353	0.957	D	0.86458	0.1777	10	0.49607	T	0.09	.	19.3645	0.94456	0.0:1.0:0.0:0.0	.	372	Q75V66	ANO5_HUMAN	L	372	ENSP00000315371:S372L	ENSP00000315371:S372L	S	+	2	0	ANO5	22228964	1.000000	0.71417	0.989000	0.46669	0.040000	0.13550	5.578000	0.67450	2.565000	0.86533	0.557000	0.71058	TCA	ANO5	-	pfam_Anoctamin	ENSG00000171714		0.343	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO5	HGNC	protein_coding	OTTHUMT00000387615.1	474	0.00	0	C	NM_213599		22272388	22272388	+1	no_errors	ENST00000324559	ensembl	human	known	69_37n	missense	276	21.75	77	SNP	1.000	T
BCL9L	283149	genome.wustl.edu	37	11	118772067	118772067	+	Silent	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr11:118772067C>T	ENST00000334801.3	-	6	3349	c.2385G>A	c.(2383-2385)ctG>ctA	p.L795L	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	795	Met-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TCTGCGACATCAGCATCTGCT	0.597																																						dbGAP											0													113.0	73.0	87.0					11																	118772067		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2385G>A	11.37:g.118772067C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	pfam_BCL9_beta-catenin-bd_dom	p.L795	ENST00000334801.3	37	c.2385	CCDS8403.1	11																																																																																			BCL9L	-	NULL	ENSG00000186174		0.597	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1	169	0.00	0	C	NM_182557		118772067	118772067	-1	no_errors	ENST00000334801	ensembl	human	known	69_37n	silent	95	20.17	24	SNP	1.000	T
CCDC87	55231	genome.wustl.edu	37	11	66358631	66358633	+	In_Frame_Del	DEL	TCT	TCT	-	rs535066162		TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr11:66358631_66358633delTCT	ENST00000333861.3	-	1	1921_1923	c.1854_1856delAGA	c.(1852-1857)gaagag>gag	p.618_619EE>E	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	618					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CACAGGAACCTCTTCTTCATGCA	0.473																																						dbGAP											0										3,4259		0,3,2128						-1.9	0.2			112	18,8232		0,18,4107	no	coding	CCDC87	NM_018219.2		0,21,6235	A1A1,A1R,RR		0.2182,0.0704,0.1678				21,12491				-	-	-	SO:0001651	inframe_deletion	0			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1854_1856delAGA	11.37:g.66358634_66358636delTCT	ENSP00000328487:p.Glu619del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NE76	In_Frame_Del	DEL	pfam_Microtubule-assoc_MAP65_ASE1	p.E619in_frame_del	ENST00000333861.3	37	c.1856_1854	CCDS8145.1	11																																																																																			CCDC87	-	NULL	ENSG00000182791		0.473	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	HGNC	protein_coding	OTTHUMT00000393825.1	184	0.00	0	TCT	NM_018219		66358631	66358633	-1	no_errors	ENST00000333861	ensembl	human	known	69_37n	in_frame_del	120	18.37	27	DEL	0.736:0.765:0.754	-
CCDC15	80071	genome.wustl.edu	37	11	124856675	124856675	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr11:124856675C>T	ENST00000344762.5	+	7	1050	c.791C>T	c.(790-792)tCa>tTa	p.S264L	CCDC15_ENST00000529051.1_Missense_Mutation_p.S264L	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	264						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		GAGGAATCTTCATCTCTTGTA	0.458																																						dbGAP											0													40.0	41.0	40.0					11																	124856675		1831	4031	5862	-	-	-	SO:0001583	missense	0			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.791C>T	11.37:g.124856675C>T	ENSP00000341684:p.Ser264Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H8U7	Missense_Mutation	SNP	NULL	p.S264L	ENST00000344762.5	37	c.791	CCDS44756.1	11	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029032	0.54790	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.39787	1.07;1.06	3.97	0.978	0.19740	.	4.789910	0.00775	N	0.001226	T	0.41743	0.1172	L	0.56769	1.78	0.09310	N	1	B	0.17667	0.023	B	0.16289	0.015	T	0.28933	-1.0028	10	0.62326	D	0.03	0.8801	5.7566	0.18176	0.0:0.6341:0.0:0.3659	.	264	Q0P6D6	CCD15_HUMAN	L	264	ENSP00000435403:S264L;ENSP00000341684:S264L	ENSP00000341684:S264L	S	+	2	0	CCDC15	124361885	0.015000	0.18098	0.008000	0.14137	0.077000	0.17291	0.060000	0.14342	0.231000	0.21079	0.467000	0.42956	TCA	CCDC15	-	NULL	ENSG00000149548		0.458	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	HGNC	protein_coding	OTTHUMT00000387131.1	112	0.00	0	C	NM_025004		124856675	124856675	+1	no_errors	ENST00000344762	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	0.011	T
CLASRP	11129	genome.wustl.edu	37	19	45574072	45574072	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr19:45574072C>T	ENST00000221455.3	+	21	2092	c.1994C>T	c.(1993-1995)tCc>tTc	p.S665F	CLASRP_ENST00000391953.4_Missense_Mutation_p.S603F|CLASRP_ENST00000544944.2_Missense_Mutation_p.S646F	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	665	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						CGCTCAAGGTCCCGATCCCGA	0.597																																						dbGAP											0													86.0	77.0	80.0					19																	45574072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1994C>T	19.37:g.45574072C>T	ENSP00000221455:p.Ser665Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	pfam_SWAP_N_domain	p.S665F	ENST00000221455.3	37	c.1994	CCDS12652.2	19	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222560	0.58668	.	.	ENSG00000104859	ENST00000221455;ENST00000391953;ENST00000544944	T;T;T	0.54279	1.23;0.58;1.2	5.77	3.65	0.41850	.	0.269676	0.20312	U	0.094811	T	0.44371	0.1290	L	0.44542	1.39	0.44677	D	0.997667	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.38520	-0.9657	10	0.87932	D	0	-17.0091	10.5516	0.45092	0.0:0.8423:0.0:0.1577	.	603;646;665	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	F	665;603;646	ENSP00000221455:S665F;ENSP00000375815:S603F;ENSP00000438702:S646F	ENSP00000221455:S665F	S	+	2	0	CLASRP	50265912	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.547000	0.45786	0.794000	0.33899	0.655000	0.94253	TCC	CLASRP	-	NULL	ENSG00000104859		0.597	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLASRP	HGNC	protein_coding	OTTHUMT00000316749.1	191	0.00	0	C	NM_007056		45574072	45574072	+1	no_errors	ENST00000221455	ensembl	human	known	69_37n	missense	153	13.56	24	SNP	1.000	T
CROCC	9696	genome.wustl.edu	37	1	17273343	17273343	+	Missense_Mutation	SNP	G	G	C	rs549027353	byFrequency	TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr1:17273343G>C	ENST00000375541.5	+	17	2440	c.2371G>C	c.(2371-2373)Gag>Cag	p.E791Q	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGAACGGCTAGAGGAGCTGCG	0.692																																						dbGAP											0													18.0	18.0	18.0					1																	17273343		2139	4193	6332	-	-	-	SO:0001583	missense	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2371G>C	1.37:g.17273343G>C	ENSP00000364691:p.Glu791Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.E791Q	ENST00000375541.5	37	c.2371	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.982020	0.34942	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.14144	2.53	3.5	2.57	0.30868	.	.	.	.	.	T	0.12347	0.0300	L	0.45698	1.435	0.45005	D	0.998023	P;B;B	0.42556	0.783;0.11;0.181	B;B;B	0.39771	0.309;0.097;0.097	T	0.13469	-1.0508	9	0.23891	T	0.37	.	11.0465	0.47861	0.0:0.1906:0.8094:0.0	.	654;94;791	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	Q	791;672	ENSP00000364691:E791Q	ENSP00000364691:E791Q	E	+	1	0	CROCC	17145930	1.000000	0.71417	1.000000	0.80357	0.257000	0.26127	5.091000	0.64505	1.027000	0.39758	0.462000	0.41574	GAG	CROCC	-	NULL	ENSG00000058453		0.692	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	65	0.00	0	G	NM_014675		17273343	17273343	+1	no_errors	ENST00000375541	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	1.000	C
CSF3R	1441	genome.wustl.edu	37	1	36933504	36933504	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr1:36933504G>C	ENST00000373106.1	-	14	2330	c.1783C>G	c.(1783-1785)Ctg>Gtg	p.L595V	CSF3R_ENST00000361632.4_Missense_Mutation_p.L595V|CSF3R_ENST00000331941.5_Missense_Mutation_p.L595V|CSF3R_ENST00000487540.2_5'UTR|CSF3R_ENST00000440588.2_Missense_Mutation_p.L595V|CSF3R_ENST00000338937.5_Missense_Mutation_p.L595V|CSF3R_ENST00000373104.1_Missense_Mutation_p.L595V|CSF3R_ENST00000373103.1_Missense_Mutation_p.L595V|CSF3R_ENST00000418048.2_Missense_Mutation_p.L595V	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	595	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	ATGTGATACAGACTGGCGGGC	0.622																																						dbGAP											0													57.0	68.0	64.0					1																	36933504		2203	4300	6503	-	-	-	SO:0001583	missense	0			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.1783C>G	1.37:g.36933504G>C	ENSP00000362198:p.Leu595Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L595V	ENST00000373106.1	37	c.1783	CCDS413.1	1	.	.	.	.	.	.	.	.	.	.	G	6.377	0.437737	0.12104	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.33	-4.74	0.03249	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.622287	0.15600	N	0.253949	T	0.31575	0.0801	L	0.55103	1.725	0.09310	N	0.999994	B;P;B;B;B;B	0.36974	0.1;0.576;0.082;0.1;0.027;0.251	B;B;B;B;B;B	0.34242	0.066;0.178;0.039;0.066;0.041;0.07	T	0.30937	-0.9961	10	0.15952	T	0.53	-1.1949	1.3396	0.02152	0.316:0.1111:0.3315:0.2415	.	595;595;595;595;595;595	Q1ZYL6;E1B6W6;Q99062-3;Q99062;Q99062-4;Q99062-2	.;.;.;CSF3R_HUMAN;.;.	V	595	ENSP00000362198:L595V;ENSP00000362196:L595V;ENSP00000362195:L595V;ENSP00000355406:L595V;ENSP00000332180:L595V;ENSP00000401588:L595V;ENSP00000345013:L595V;ENSP00000397568:L595V	ENSP00000332180:L595V	L	-	1	2	CSF3R	36706091	0.064000	0.20934	0.704000	0.30370	0.029000	0.11900	-0.318000	0.08050	-0.548000	0.06199	-0.302000	0.09304	CTG	CSF3R	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000119535		0.622	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	217	0.46	1	G	NM_156039		36933504	36933504	-1	no_errors	ENST00000373103	ensembl	human	known	69_37n	missense	120	16.67	24	SNP	0.057	C
CYP20A1	57404	genome.wustl.edu	37	2	204116801	204116801	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr2:204116801C>T	ENST00000356079.4	+	4	524	c.401C>T	c.(400-402)tCt>tTt	p.S134F	CYP20A1_ENST00000429815.2_Missense_Mutation_p.S134F|CYP20A1_ENST00000461371.1_3'UTR	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	134						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.S134F(1)		cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						GTGACTGATTCTCTGAAGAGT	0.358																																						dbGAP											1	Substitution - Missense(1)	skin(1)											119.0	107.0	111.0					2																	204116801		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.401C>T	2.37:g.204116801C>T	ENSP00000348380:p.Ser134Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	p.S134F	ENST00000356079.4	37	c.401	CCDS2357.1	2	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589945	0.66105	.	.	ENSG00000119004	ENST00000356079;ENST00000421618;ENST00000429815;ENST00000443941	T;T;T	0.69435	-0.4;-0.4;-0.4	5.64	2.73	0.32206	.	0.882556	0.08747	U	0.899736	T	0.63331	0.2502	L	0.40543	1.245	0.33737	D	0.61901	B;B	0.16396	0.008;0.017	B;B	0.21360	0.034;0.034	T	0.61332	-0.7084	10	0.66056	D	0.02	-1.103	16.5913	0.84766	0.0:0.6325:0.3675:0.0	.	134;134	E9PHG5;Q6UW02	.;CP20A_HUMAN	F	134	ENSP00000348380:S134F;ENSP00000407860:S134F;ENSP00000411341:S134F	ENSP00000348380:S134F	S	+	2	0	CYP20A1	203825046	0.119000	0.22226	0.342000	0.25602	0.952000	0.60782	1.782000	0.38654	0.273000	0.22049	0.655000	0.94253	TCT	CYP20A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000119004		0.358	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP20A1	HGNC	protein_coding	OTTHUMT00000256328.3	247	0.00	0	C	NM_020674		204116801	204116801	+1	no_errors	ENST00000356079	ensembl	human	known	69_37n	missense	131	17.61	28	SNP	0.903	T
DDX31	64794	genome.wustl.edu	37	9	135537878	135537878	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr9:135537878T>G	ENST00000372159.3	-	2	746	c.595A>C	c.(595-597)Att>Ctt	p.I199L	DDX31_ENST00000544003.1_Missense_Mutation_p.I103L|DDX31_ENST00000310532.2_Missense_Mutation_p.I199L|DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000372153.1_Missense_Mutation_p.I199L|DDX31_ENST00000438527.3_Missense_Mutation_p.I70L	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	199						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GAAGTCTTAATGCACTGTCTC	0.433																																						dbGAP											0													186.0	178.0	180.0					9																	135537878		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.595A>C	9.37:g.135537878T>G	ENSP00000361232:p.Ile199Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.I199L	ENST00000372159.3	37	c.595	CCDS6951.1	9	.	.	.	.	.	.	.	.	.	.	T	9.662	1.144440	0.21288	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000438527;ENST00000310532;ENST00000544003	T;T;T;T;T	0.50001	4.4;3.96;4.38;3.54;0.76	5.6	-11.2	0.00127	.	0.637015	0.15944	N	0.237036	T	0.25791	0.0628	N	0.24115	0.695	0.20403	N	0.999906	B;B;B	0.27013	0.141;0.166;0.025	B;B;B	0.26693	0.072;0.045;0.008	T	0.10337	-1.0634	10	0.27785	T	0.31	-0.243	15.0267	0.71674	0.0786:0.6104:0.0:0.311	.	199;199;199	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	L	199;199;199;70;199;103	ENSP00000361232:I199L;ENSP00000361226:I199L;ENSP00000387730:I70L;ENSP00000310539:I199L;ENSP00000442425:I103L	ENSP00000310539:I199L	I	-	1	0	DDX31	134527699	0.001000	0.12720	0.000000	0.03702	0.117000	0.20001	-1.054000	0.03496	-3.329000	0.00186	-0.993000	0.02533	ATT	DDX31	-	NULL	ENSG00000125485		0.433	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DDX31	HGNC	protein_coding	OTTHUMT00000054794.1	478	0.00	0	T	NM_138620		135537878	135537878	-1	no_errors	ENST00000372159	ensembl	human	known	69_37n	missense	257	15.18	46	SNP	0.001	G
DHDDS	79947	genome.wustl.edu	37	1	26784375	26784375	+	Silent	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr1:26784375G>A	ENST00000236342.7	+	7	729	c.636G>A	c.(634-636)ctG>ctA	p.L212L	DHDDS_ENST00000526219.1_Silent_p.L173L|DHDDS_ENST00000360009.2_Silent_p.L212L|DHDDS_ENST00000525682.2_Silent_p.L178L			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase	212					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		AAGTGCGGCTGAGTGACTTCT	0.453																																						dbGAP											0													195.0	175.0	182.0					1																	26784375		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.636G>A	1.37:g.26784375G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	Missense_Mutation	SNP	pfam_UPP_synth-like,superfamily_UPP_synth-like,tigrfam_UPP_synth-like	p.E89K	ENST00000236342.7	37	c.265	CCDS282.1	1	.	.	.	.	.	.	.	.	.	.	G	9.898	1.206174	0.22205	.	.	ENSG00000117682	ENST00000416052	.	.	.	5.57	-0.181	0.13291	.	.	.	.	.	T	0.51295	0.1666	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39603	-0.9606	4	.	.	.	-11.4424	6.0265	0.19658	0.0856:0.4695:0.337:0.1079	.	.	.	.	K	89	.	.	E	+	1	0	DHDDS	26656962	0.925000	0.31364	0.998000	0.56505	0.998000	0.95712	0.005000	0.13129	0.060000	0.16281	0.655000	0.94253	GAG	DHDDS	-	pfam_UPP_synth-like,superfamily_UPP_synth-like,tigrfam_UPP_synth-like	ENSG00000117682		0.453	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHDDS	HGNC	protein_coding	OTTHUMT00000392504.1	403	0.00	0	G	NM_024887		26784375	26784375	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416052	ensembl	human	putative	69_37n	missense	216	21.66	60	SNP	1.000	A
DIS3	22894	genome.wustl.edu	37	13	73348184	73348184	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr13:73348184A>G	ENST00000377767.4	-	7	1101	c.1001T>C	c.(1000-1002)gTa>gCa	p.V334A	DIS3_ENST00000377780.4_Missense_Mutation_p.V304A|DIS3_ENST00000545453.1_Missense_Mutation_p.V172A	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	334					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TTTCTCGCTTACAGCAGTCTT	0.338										Multiple Myeloma(4;0.011)																												dbGAP											0													93.0	93.0	93.0					13																	73348184		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1001T>C	13.37:g.73348184A>G	ENSP00000366997:p.Val334Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	pfam_RNase_II/R,smart_PINc_nuc-bd,smart_RNase_II/R	p.V334A	ENST00000377767.4	37	c.1001	CCDS9447.1	13	.	.	.	.	.	.	.	.	.	.	A	9.523	1.108732	0.20714	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.28255	1.62;1.62;1.62	5.8	4.62	0.57501	.	0.457461	0.24217	N	0.040463	T	0.20981	0.0505	L	0.33189	0.99	0.35277	D	0.781005	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.16482	-1.0401	10	0.08599	T	0.76	.	11.7217	0.51685	0.9311:0.0:0.0689:0.0	.	304;334	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	A	334;304;172	ENSP00000366997:V334A;ENSP00000367011:V304A;ENSP00000440058:V172A	ENSP00000366997:V334A	V	-	2	0	DIS3	72246185	0.929000	0.31497	0.632000	0.29296	0.912000	0.54170	2.343000	0.44001	1.024000	0.39682	0.460000	0.39030	GTA	DIS3	-	NULL	ENSG00000083520		0.338	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3	HGNC	protein_coding	OTTHUMT00000045250.2	151	0.00	0	A	NM_014953		73348184	73348184	-1	no_errors	ENST00000377767	ensembl	human	known	69_37n	missense	100	23.66	31	SNP	0.839	G
DNAH1	25981	genome.wustl.edu	37	3	52396484	52396484	+	Silent	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:52396484C>T	ENST00000420323.2	+	31	5322	c.5061C>T	c.(5059-5061)taC>taT	p.Y1687Y	DNAH1_ENST00000466628.1_3'UTR	NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1687	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACCCGGGCTACGCTGGCCGCA	0.592																																						dbGAP											0													45.0	51.0	49.0					3																	52396484		2152	4282	6434	-	-	-	SO:0001819	synonymous_variant	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5061C>T	3.37:g.52396484C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.Y1687	ENST00000420323.2	37	c.5061	CCDS46842.1	3																																																																																			DNAH1	-	NULL	ENSG00000114841		0.592	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	118	0.00	0	C	NM_015512		52396484	52396484	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	silent	53	26.39	19	SNP	0.421	T
DPP4	1803	genome.wustl.edu	37	2	162890159	162890159	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr2:162890159C>G	ENST00000360534.3	-	10	1339	c.779G>C	c.(778-780)gGa>gCa	p.G260A		NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	260					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	ATTCACAGCTCCTGCCTAGGA	0.368																																						dbGAP											0													77.0	72.0	74.0					2																	162890159		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.779G>C	2.37:g.162890159C>G	ENSP00000353731:p.Gly260Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TN1	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.G260A	ENST00000360534.3	37	c.779	CCDS2216.1	2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.884235	0.91814	.	.	ENSG00000197635	ENST00000360534	T	0.64260	-0.09	5.49	5.49	0.81192	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82499	0.5050	M	0.89287	3.02	0.80722	D	1	D	0.67145	0.996	D	0.66497	0.944	D	0.85135	0.0977	10	0.87932	D	0	0.366	19.5755	0.95441	0.0:1.0:0.0:0.0	.	260	P27487	DPP4_HUMAN	A	260	ENSP00000353731:G260A	ENSP00000353731:G260A	G	-	2	0	DPP4	162598405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.779000	0.68948	2.865000	0.98341	0.655000	0.94253	GGA	DPP4	-	pfam_Peptidase_S9B	ENSG00000197635		0.368	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP4	HGNC	protein_coding	OTTHUMT00000255079.2	140	0.00	0	C			162890159	162890159	-1	no_errors	ENST00000360534	ensembl	human	known	69_37n	missense	98	22.22	28	SNP	1.000	G
DUS3L	56931	genome.wustl.edu	37	19	5787632	5787632	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr19:5787632C>A	ENST00000309061.7	-	6	1276	c.1180G>T	c.(1180-1182)Gtc>Ttc	p.V394F	DUS3L_ENST00000320699.8_Missense_Mutation_p.V152F|DUS3L_ENST00000590681.1_5'Flank|PRR22_ENST00000419421.2_5'Flank|CTB-54O9.9_ENST00000586012.1_5'Flank	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	394							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						GGGCAGCCGACGTTGATGTCC	0.642																																						dbGAP											0													150.0	129.0	136.0					19																	5787632		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.1180G>T	19.37:g.5787632C>A	ENSP00000311977:p.Val394Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	pfam_tRNA_hU_synthase	p.V394F	ENST00000309061.7	37	c.1180	CCDS32880.1	19	.	.	.	.	.	.	.	.	.	.	C	14.37	2.516360	0.44763	.	.	ENSG00000141994	ENST00000309061;ENST00000320699	T;T	0.29917	1.55;1.55	3.61	3.61	0.41365	Aldolase-type TIM barrel (1);tRNA-dihydrouridine synthase, conserved site (1);	0.151540	0.44688	U	0.000439	T	0.12603	0.0306	N	0.00996	-1.065	0.45676	D	0.998592	B;P	0.35774	0.048;0.519	B;B	0.37304	0.055;0.246	T	0.30995	-0.9959	10	0.62326	D	0.03	-28.6018	12.9273	0.58266	0.0:1.0:0.0:0.0	.	152;394	Q96G46-3;Q96G46	.;DUS3L_HUMAN	F	394;152	ENSP00000311977:V394F;ENSP00000315558:V152F	ENSP00000311977:V394F	V	-	1	0	DUS3L	5738632	0.996000	0.38824	0.994000	0.49952	0.969000	0.65631	4.534000	0.60622	1.615000	0.50252	0.449000	0.29647	GTC	DUS3L	-	pfam_tRNA_hU_synthase	ENSG00000141994		0.642	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS3L	HGNC	protein_coding	OTTHUMT00000451870.2	152	0.00	0	C	NM_020175		5787632	5787632	-1	no_errors	ENST00000309061	ensembl	human	known	69_37n	missense	77	23.00	23	SNP	1.000	A
EPAS1	2034	genome.wustl.edu	37	2	46574149	46574149	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr2:46574149C>T	ENST00000263734.3	+	2	674	c.164C>T	c.(163-165)tCc>tTc	p.S55F	EPAS1_ENST00000467888.1_3'UTR	NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	55	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			GACAAGGCCTCCATCATGCGA	0.622																																						dbGAP											0													135.0	120.0	125.0					2																	46574149		2203	4300	6503	-	-	-	SO:0001583	missense	0			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.164C>T	2.37:g.46574149C>T	ENSP00000263734:p.Ser55Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VA2|Q99630	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.S55F	ENST00000263734.3	37	c.164	CCDS1825.1	2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585305	0.86748	.	.	ENSG00000116016	ENST00000449347;ENST00000263734	T;T	0.21932	1.98;1.98	4.86	3.98	0.46160	Helix-loop-helix DNA-binding (3);	0.113037	0.64402	D	0.000007	T	0.55800	0.1943	H	0.94582	3.555	0.80722	D	1	D	0.69078	0.997	D	0.64776	0.929	T	0.71945	-0.4439	9	.	.	.	.	15.3216	0.74126	0.0:0.8598:0.1401:0.0	.	55	Q99814	EPAS1_HUMAN	F	55	ENSP00000406137:S55F;ENSP00000263734:S55F	.	S	+	2	0	EPAS1	46427653	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.827000	0.69300	1.253000	0.44018	0.561000	0.74099	TCC	EPAS1	-	superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,prints_Nuc_translocat,pfscan_HLH_DNA-bd	ENSG00000116016		0.622	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2	146	0.00	0	C	NM_001430		46574149	46574149	+1	no_errors	ENST00000263734	ensembl	human	known	69_37n	missense	73	18.89	17	SNP	1.000	T
EXT2	2132	genome.wustl.edu	37	11	44228348	44228348	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr11:44228348C>T	ENST00000343631.3	+	10	1630	c.1501C>T	c.(1501-1503)Ctc>Ttc	p.L501F	EXT2_ENST00000395673.3_Missense_Mutation_p.L534F|EXT2_ENST00000533608.1_Missense_Mutation_p.L501F|EXT2_ENST00000358681.4_Missense_Mutation_p.L511F			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	501					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						TCCAGATTCTCTCTGGCCCAA	0.383			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																													dbGAP	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	0													89.0	91.0	90.0					11																	44228348		2203	4299	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.1501C>T	11.37:g.44228348C>T	ENSP00000342656:p.Leu501Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.L534F	ENST00000343631.3	37	c.1600	CCDS7908.1	11	.	.	.	.	.	.	.	.	.	.	C	8.649	0.897762	0.17686	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.81	5.81	0.92471	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.133777	0.51477	D	0.000089	T	0.81678	0.4873	L	0.60455	1.87	0.58432	D	0.999994	P;B;B;B;B	0.45672	0.864;0.001;0.001;0.001;0.002	P;B;B;B;B	0.56434	0.798;0.01;0.007;0.004;0.01	T	0.75728	-0.3216	10	0.09843	T	0.71	-12.5179	14.8755	0.70491	0.0:0.7383:0.2616:0.0	.	501;511;511;501;514	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	F	501;511;534;501	ENSP00000431173:L501F;ENSP00000351509:L511F;ENSP00000379032:L534F;ENSP00000342656:L501F	ENSP00000342656:L501F	L	+	1	0	EXT2	44184924	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.502000	0.45398	2.746000	0.94184	0.655000	0.94253	CTC	EXT2	-	pfam_HexNAc_Trfase_a	ENSG00000151348		0.383	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXT2	HGNC	protein_coding	OTTHUMT00000390074.1	257	0.00	0	C	NM_000401		44228348	44228348	+1	no_errors	ENST00000395673	ensembl	human	known	69_37n	missense	176	15.79	33	SNP	1.000	T
FAT1	2195	genome.wustl.edu	37	4	187519128	187519128	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr4:187519128C>G	ENST00000441802.2	-	23	12464	c.12255G>C	c.(12253-12255)caG>caC	p.Q4085H	FAT1_ENST00000512347.1_5'UTR	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4085	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ACACATACCTCTGACCAGTAT	0.388										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	dbGAP											0													59.0	57.0	58.0					4																	187519128		1852	4094	5946	-	-	-	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.12255G>C	4.37:g.187519128C>G	ENSP00000406229:p.Gln4085His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.Q4085H	ENST00000441802.2	37	c.12255	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	12.42	1.932837	0.34096	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000507105	D	0.98419	-4.92	5.31	3.6	0.41247	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.119193	0.64402	D	0.000017	D	0.94958	0.8369	N	0.20445	0.575	0.48901	D	0.999729	P	0.52061	0.95	P	0.46076	0.503	D	0.93029	0.6447	10	0.52906	T	0.07	.	8.0478	0.30559	0.0:0.6829:0.0:0.3171	.	4085	Q14517	FAT1_HUMAN	H	4085;4087;17	ENSP00000406229:Q4085H	ENSP00000260147:Q4087H	Q	-	3	2	FAT1	187756122	0.999000	0.42202	1.000000	0.80357	0.968000	0.65278	0.676000	0.25247	0.834000	0.34852	0.655000	0.94253	CAG	FAT1	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000083857		0.388	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	44	0.00	0	C	NM_005245		187519128	187519128	-1	no_errors	ENST00000441802	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	G
GRIN3A	116443	genome.wustl.edu	37	9	104499768	104499768	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr9:104499768G>A	ENST00000361820.3	-	1	1094	c.494C>T	c.(493-495)cCc>cTc	p.P165L		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	165					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GGAGGAGAAGGGCAAAAGTGG	0.597																																						dbGAP											0													114.0	107.0	109.0					9																	104499768		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.494C>T	9.37:g.104499768G>A	ENSP00000355155:p.Pro165Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.P165L	ENST00000361820.3	37	c.494	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250709	0.80135	.	.	ENSG00000198785	ENST00000361820	T	0.12569	2.67	5.08	5.08	0.68730	.	0.198587	0.44688	N	0.000422	T	0.24774	0.0601	L	0.50333	1.59	0.80722	D	1	D	0.63880	0.993	P	0.53954	0.738	T	0.01305	-1.1390	10	0.23302	T	0.38	.	18.4798	0.90807	0.0:0.0:1.0:0.0	.	165	Q8TCU5	NMD3A_HUMAN	L	165	ENSP00000355155:P165L	ENSP00000355155:P165L	P	-	2	0	GRIN3A	103539589	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.110000	0.94302	2.361000	0.80049	0.655000	0.94253	CCC	GRIN3A	-	NULL	ENSG00000198785		0.597	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	170	0.58	1	G			104499768	104499768	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	missense	71	11.25	9	SNP	1.000	A
GUCY1A2	2977	genome.wustl.edu	37	11	106680934	106680934	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr11:106680934G>A	ENST00000526355.2	-	5	1945	c.1477C>T	c.(1477-1479)Ctt>Ttt	p.L493F	GUCY1A2_ENST00000282249.2_Missense_Mutation_p.L493F|GUCY1A2_ENST00000347596.2_Missense_Mutation_p.L514F	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	493					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	GAATATAGAAGATCCACTGTC	0.423																																						dbGAP											0													119.0	121.0	121.0					11																	106680934		2201	4298	6499	-	-	-	SO:0001583	missense	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1477C>T	11.37:g.106680934G>A	ENSP00000431245:p.Leu493Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4C4|B7ZLT5	Missense_Mutation	SNP	pfam_Haem_no_assoc-bd,pfam_A/G_cyclase,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.L493F	ENST00000526355.2	37	c.1477	CCDS8335.1	11	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592246	0.86953	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.95205	-3.64;-3.64;-3.64	5.47	5.47	0.80525	Haem NO binding associated (1);Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.000000	0.40469	U	0.001092	D	0.98058	0.9360	M	0.93939	3.475	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.994	D	0.99053	1.0828	10	0.87932	D	0	.	18.315	0.90217	0.0:0.0:1.0:0.0	.	514;493;493	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	F	493;493;514	ENSP00000431245:L493F;ENSP00000282249:L493F;ENSP00000344874:L514F	ENSP00000282249:L493F	L	-	1	0	GUCY1A2	106186144	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.561000	0.86390	0.650000	0.86243	CTT	GUCY1A2	-	pfam_Haem_no_assoc-bd,smart_A/G_cyclase	ENSG00000152402		0.423	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	HGNC	protein_coding	OTTHUMT00000389003.2	296	0.00	0	G			106680934	106680934	-1	no_errors	ENST00000282249	ensembl	human	known	69_37n	missense	203	18.15	45	SNP	1.000	A
IL18R1	8809	genome.wustl.edu	37	2	102988423	102988423	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr2:102988423C>G	ENST00000409599.1	+	5	669	c.313C>G	c.(313-315)Cag>Gag	p.Q105E	IL18R1_ENST00000233957.1_Missense_Mutation_p.Q105E|IL18R1_ENST00000334376.3_Missense_Mutation_p.Q105E			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	105	Ig-like C2-type 1.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						AAATTATACTCAGAAATGGAA	0.279																																						dbGAP											0													22.0	23.0	23.0					2																	102988423		2192	4283	6475	-	-	-	SO:0001583	missense	0			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.313C>G	2.37:g.102988423C>G	ENSP00000387211:p.Gln105Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Y5|Q52LC9	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.Q105E	ENST00000409599.1	37	c.313	CCDS2060.1	2	.	.	.	.	.	.	.	.	.	.	C	9.025	0.985768	0.18889	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957;ENST00000334376	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.15	-4.28	0.03732	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.750340	0.02748	N	0.117095	T	0.28400	0.0702	L	0.43152	1.355	0.09310	N	1	B;B;B	0.33103	0.255;0.397;0.255	B;B;B	0.25759	0.038;0.063;0.038	T	0.13953	-1.0490	10	0.34782	T	0.22	.	3.9856	0.09514	0.3841:0.1988:0.0:0.4171	.	105;105;105	B7ZKV7;Q86YL8;Q13478	.;.;IL18R_HUMAN	E	105	ENSP00000386663:Q105E;ENSP00000387211:Q105E;ENSP00000233957:Q105E;ENSP00000334030:Q105E	ENSP00000233957:Q105E	Q	+	1	0	IL18R1	102354855	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-1.959000	0.01518	-0.501000	0.06605	0.561000	0.74099	CAG	IL18R1	-	smart_Ig_sub,prints_IL1_rcpt_I/II	ENSG00000115604		0.279	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL18R1	HGNC	protein_coding	OTTHUMT00000253294.2	32	0.00	0	C	NM_003855		102988423	102988423	+1	no_errors	ENST00000233957	ensembl	human	known	69_37n	missense	38	26.92	14	SNP	0.000	G
IFNL3	282617	genome.wustl.edu	37	19	39734315	39734315	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr19:39734315G>A	ENST00000413851.2	-	5	586	c.548C>T	c.(547-549)aCg>aTg	p.T183M		NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	183					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											CAGGTCTCGCGTGAGGAGGCG	0.567																																						dbGAP											0													37.0	37.0	37.0					19																	39734315		2203	4298	6501	-	-	-	SO:0001583	missense	0			AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.548C>T	19.37:g.39734315G>A	ENSP00000409000:p.Thr183Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Missense_Mutation	SNP	NULL	p.T183M	ENST00000413851.2	37	c.548	CCDS12530.1	19	.	.	.	.	.	.	.	.	.	.	G	14.52	2.561289	0.45590	.	.	ENSG00000197110	ENST00000413851	T	0.33438	1.41	3.95	-6.06	0.02165	.	0.827058	0.10623	N	0.653095	T	0.45115	0.1326	M	0.84511	2.7	0.09310	N	1	D	0.89917	1.0	D	0.70935	0.971	T	0.42413	-0.9453	10	0.66056	D	0.02	-1.025	0.4206	0.00455	0.2907:0.1342:0.3035:0.2716	.	183	Q8IZI9	IL28B_HUMAN	M	183	ENSP00000409000:T183M	ENSP00000409000:T183M	T	-	2	0	IL28B	44426155	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.799000	0.04560	-0.733000	0.04850	0.205000	0.17691	ACG	IL28B	-	NULL	ENSG00000197110		0.567	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL28B	HGNC	protein_coding	OTTHUMT00000463832.1	274	0.00	0	G	NM_172139		39734315	39734315	-1	no_errors	ENST00000413851	ensembl	human	known	69_37n	missense	104	19.23	25	SNP	0.000	A
ITGB2	3689	genome.wustl.edu	37	21	46319038	46319038	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr21:46319038C>A	ENST00000397850.2	-	9	1389	c.937G>T	c.(937-939)Gaa>Taa	p.E313*	ITGB2_ENST00000397854.3_Nonsense_Mutation_p.E256*|ITGB2_ENST00000302347.5_Nonsense_Mutation_p.E313*|ITGB2_ENST00000355153.4_Nonsense_Mutation_p.E313*|ITGB2_ENST00000397857.1_Nonsense_Mutation_p.E313*|ITGB2_ENST00000397852.1_Nonsense_Mutation_p.E313*			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	313	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	ATGTTGTTTTCAGCCAGCTTG	0.607																																						dbGAP											0													164.0	113.0	130.0					21																	46319038		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.937G>T	21.37:g.46319038C>A	ENSP00000380948:p.Glu313*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Nonsense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.E313*	ENST00000397850.2	37	c.937	CCDS13716.1	21	.	.	.	.	.	.	.	.	.	.	C	40	8.451263	0.98817	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414;ENST00000320216	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	15.9907	0.80202	0.0:1.0:0.0:0.0	.	.	.	.	X	313;313;256;313;313;313;256;304	.	ENSP00000303242:E313X	E	-	1	0	ITGB2	45143466	1.000000	0.71417	0.120000	0.21714	0.838000	0.47535	5.497000	0.66924	2.462000	0.83206	0.561000	0.74099	GAA	ITGB2	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu	ENSG00000160255		0.607	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	246	0.00	0	C	NM_000211		46319038	46319038	-1	no_errors	ENST00000302347	ensembl	human	known	69_37n	nonsense	97	21.14	26	SNP	0.996	A
KIF15	56992	genome.wustl.edu	37	3	44893829	44893829	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:44893829G>A	ENST00000326047.4	+	34	4251	c.4102G>A	c.(4102-4104)Gag>Aag	p.E1368K	KIF15_ENST00000425755.1_Missense_Mutation_p.E1003K	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	1368					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		CAGGCTTGCTGAGGTAAACCT	0.323																																						dbGAP											0													76.0	76.0	76.0					3																	44893829		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.4102G>A	3.37:g.44893829G>A	ENSP00000324020:p.Glu1368Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1368K	ENST00000326047.4	37	c.4102	CCDS33744.1	3	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532154	0.85812	.	.	ENSG00000163808	ENST00000326047;ENST00000425755	T;T	0.30981	1.51;1.51	5.86	4.97	0.65823	.	0.000000	0.52532	D	0.000077	T	0.57373	0.2049	M	0.73598	2.24	0.45718	D	0.99862	D	0.89917	1.0	D	0.87578	0.998	T	0.63024	-0.6729	10	0.66056	D	0.02	.	16.839	0.85963	0.0:0.1286:0.8714:0.0	.	1368	Q9NS87	KIF15_HUMAN	K	1368;1003	ENSP00000324020:E1368K;ENSP00000389982:E1003K	ENSP00000324020:E1368K	E	+	1	0	KIF15	44868833	1.000000	0.71417	0.867000	0.34043	0.803000	0.45373	6.787000	0.75099	1.443000	0.47586	0.655000	0.94253	GAG	KIF15	-	NULL	ENSG00000163808		0.323	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	HGNC	protein_coding	OTTHUMT00000343831.2	146	0.68	1	G			44893829	44893829	+1	no_errors	ENST00000326047	ensembl	human	known	69_37n	missense	99	16.10	19	SNP	0.989	A
KIRREL	55243	genome.wustl.edu	37	1	158058164	158058164	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr1:158058164G>A	ENST00000359209.6	+	8	1031	c.964G>A	c.(964-966)Ggc>Agc	p.G322S	KIRREL_ENST00000368172.1_Missense_Mutation_p.G120S|KIRREL_ENST00000416935.2_Missense_Mutation_p.G222S|KIRREL_ENST00000368173.3_Missense_Mutation_p.G322S|KIRREL_ENST00000360089.4_Missense_Mutation_p.G158S|KIRREL_ENST00000392272.2_Missense_Mutation_p.G219S			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	322	Ig-like C2-type 4.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CACAGACATTGGCTCTGATGT	0.512																																						dbGAP											0													153.0	144.0	147.0					1																	158058164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.964G>A	1.37:g.158058164G>A	ENSP00000352138:p.Gly322Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G322S	ENST00000359209.6	37	c.964	CCDS1172.2	1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.967789	0.92855	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56	5.37	5.37	0.77165	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40818	N	0.001007	T	0.69223	0.3087	M	0.81942	2.565	0.58432	D	0.999997	D;D;D;D	0.69078	0.997;0.997;0.992;0.982	D;D;P;P	0.73708	0.981;0.945;0.889;0.832	T	0.74006	-0.3803	10	0.87932	D	0	-32.0597	16.5909	0.84765	0.0:0.0:1.0:0.0	.	222;158;120;322	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	S	158;322;219;322;222;120	ENSP00000353202:G158S;ENSP00000357155:G322S;ENSP00000376098:G219S;ENSP00000352138:G322S;ENSP00000389674:G222S;ENSP00000357154:G120S	ENSP00000352138:G322S	G	+	1	0	KIRREL	156324788	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.939000	0.87685	2.515000	0.84797	0.557000	0.71058	GGC	KIRREL	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000183853		0.512	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	249	0.00	0	G	NM_018240		158058164	158058164	+1	no_errors	ENST00000368173	ensembl	human	known	69_37n	missense	152	16.02	29	SNP	1.000	A
LRR1	122769	genome.wustl.edu	37	14	50065856	50065856	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr14:50065856C>T	ENST00000298288.6	+	1	442	c.118C>T	c.(118-120)Cag>Tag	p.Q40*	AL139099.1_ENST00000539688.1_5'UTR|LRR1_ENST00000318317.4_Nonsense_Mutation_p.Q40*|RPS29_ENST00000557111.1_5'Flank	NM_152329.3	NP_689542.2	Q96L50	LLR1_HUMAN	leucine rich repeat protein 1	40					protein ubiquitination (GO:0016567)					kidney(2)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TTCCAGGAGTCAGCCGCCGGT	0.657																																						dbGAP											0													41.0	33.0	36.0					14																	50065856		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			BC030142	CCDS9686.1, CCDS9687.1	14q21.3	2011-02-02	2011-02-02	2011-02-02	ENSG00000165501	ENSG00000165501			19742	protein-coding gene	gene with protein product	"""LRR-repeat protein 1"""	609193	"""peptidylprolyl isomerase (cyclophilin)-like 5"""	PPIL5		11804328, 21074724	Standard	NR_037792		Approved	MGC20689, LRR-1	uc001wwn.3	Q96L50	OTTHUMG00000140273	ENST00000298288.6:c.118C>T	14.37:g.50065856C>T	ENSP00000298288:p.Gln40*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6X3|B4DDE0|Q52M24|Q86SZ1|Q8N6H9	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q40*	ENST00000298288.6	37	c.118	CCDS9686.1	14	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378719	0.82682	.	.	ENSG00000165501	ENST00000298288;ENST00000361579;ENST00000318317	.	.	.	5.18	0.926	0.19430	.	3.471080	0.00481	N	0.000132	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	24.1266	12.0952	0.53750	0.0727:0.2958:0.6315:0.0	.	.	.	.	X	40	.	ENSP00000298288:Q40X	Q	+	1	0	LRR1	49135606	0.002000	0.14202	0.001000	0.08648	0.025000	0.11179	0.341000	0.19909	0.310000	0.22990	-0.311000	0.09066	CAG	LRR1	-	NULL	ENSG00000165501		0.657	LRR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRR1	HGNC	protein_coding	OTTHUMT00000410790.1	50	0.00	0	C	NM_203467		50065856	50065856	+1	no_errors	ENST00000298288	ensembl	human	known	69_37n	nonsense	33	19.51	8	SNP	0.009	T
MAP3K13	9175	genome.wustl.edu	37	3	185198193	185198193	+	Missense_Mutation	SNP	C	C	T	rs544421900		TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:185198193C>T	ENST00000265026.3	+	13	3009	c.2675C>T	c.(2674-2676)aCg>aTg	p.T892M	MAP3K13_ENST00000535426.1_Missense_Mutation_p.T748M|MAP3K13_ENST00000443863.1_Missense_Mutation_p.T748M|TMEM41A_ENST00000475480.1_5'UTR|MAP3K13_ENST00000446828.1_Missense_Mutation_p.T685M|MAP3K13_ENST00000424227.1_Missense_Mutation_p.T892M	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CTGTCCCAGACGCCAGAGATT	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19595	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													116.0	103.0	107.0					3																	185198193		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.2675C>T	3.37:g.185198193C>T	ENSP00000265026:p.Thr892Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T892M	ENST00000265026.3	37	c.2675	CCDS3270.1	3	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534749	0.85812	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026	T;T;T;T;T	0.79141	-1.24;-1.18;-1.11;-1.11;-1.18	5.86	4.98	0.66077	.	0.055536	0.64402	D	0.000001	T	0.81380	0.4810	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72982	0.979;0.963;0.92	T	0.83113	-0.0122	10	0.52906	T	0.07	.	16.2393	0.82399	0.1341:0.8659:0.0:0.0	.	748;685;892	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	M	685;892;748;748;892	ENSP00000411483:T685M;ENSP00000399910:T892M;ENSP00000409325:T748M;ENSP00000439257:T748M;ENSP00000265026:T892M	ENSP00000265026:T892M	T	+	2	0	MAP3K13	186680887	1.000000	0.71417	0.975000	0.42487	0.989000	0.77384	7.769000	0.85360	1.445000	0.47624	0.655000	0.94253	ACG	MAP3K13	-	pirsf_MAP3K12_MAP3K13	ENSG00000073803		0.527	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K13	HGNC	protein_coding	OTTHUMT00000345268.1	127	0.00	0	C	NM_004721		185198193	185198193	+1	no_errors	ENST00000265026	ensembl	human	known	69_37n	missense	77	16.30	15	SNP	1.000	T
MBIP	51562	genome.wustl.edu	37	14	36781172	36781172	+	Silent	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr14:36781172G>A	ENST00000416007.4	-	5	717	c.630C>T	c.(628-630)caC>caT	p.H210H	MBIP_ENST00000359527.7_Silent_p.H210H|MBIP_ENST00000318473.7_Silent_p.H210H|MBIP_ENST00000603913.1_5'UTR	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	210	Interaction with MAP3K12.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		TACCTTTTACGTGACTTTTAA	0.313																																						dbGAP											0													62.0	63.0	63.0					14																	36781172		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.630C>T	14.37:g.36781172G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Missense_Mutation	SNP	NULL	p.R207C	ENST00000416007.4	37	c.619	CCDS9658.1	14	.	.	.	.	.	.	.	.	.	.	G	8.860	0.946712	0.18356	.	.	ENSG00000151332	ENST00000553977	.	.	.	6.17	-1.96	0.07525	.	.	.	.	.	T	0.57403	0.2051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55153	-0.8185	4	.	.	.	-6.3616	11.3768	0.49733	0.6697:0.0:0.3303:0.0	.	.	.	.	C	207	.	.	R	-	1	0	MBIP	35850923	0.995000	0.38212	0.993000	0.49108	0.939000	0.58152	0.452000	0.21795	-0.275000	0.09219	-0.126000	0.14955	CGT	MBIP	-	NULL	ENSG00000151332		0.313	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBIP	HGNC	protein_coding	OTTHUMT00000276685.2	59	0.00	0	G	NM_016586		36781172	36781172	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553977	ensembl	human	putative	69_37n	missense	34	20.93	9	SNP	0.996	A
MTUS2	23281	genome.wustl.edu	37	13	29933532	29933532	+	Silent	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr13:29933532C>T	ENST00000431530.3	+	6	3127	c.3069C>T	c.(3067-3069)ggC>ggT	p.G1023G		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1013	Localization to the growing distal tip of microtubules.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						GACAGCTGGGCGTTGCGCAAG	0.642																																						dbGAP											0													22.0	25.0	24.0					13																	29933532		2087	4221	6308	-	-	-	SO:0001819	synonymous_variant	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.3069C>T	13.37:g.29933532C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	NULL	p.G1023	ENST00000431530.3	37	c.3069	CCDS45022.1	13																																																																																			MTUS2	-	NULL	ENSG00000132938		0.642	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	33	0.00	0	C	XM_166270		29933532	29933532	+1	no_errors	ENST00000431530	ensembl	human	known	69_37n	silent	30	20.51	8	SNP	0.000	T
NEK5	341676	genome.wustl.edu	37	13	52667302	52667302	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr13:52667302C>A	ENST00000355568.4	-	13	1235	c.1096G>T	c.(1096-1098)Gat>Tat	p.D366Y		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	366					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		CTCAGCATATCAAGTTGAGCA	0.393																																						dbGAP											0													152.0	135.0	140.0					13																	52667302		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1096G>T	13.37:g.52667302C>A	ENSP00000347767:p.Asp366Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D366Y	ENST00000355568.4	37	c.1096	CCDS31979.1	13	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495008	0.26774	.	.	ENSG00000197168	ENST00000355568	T	0.75154	-0.91	5.0	4.15	0.48705	.	0.261912	0.24715	N	0.036186	T	0.80226	0.4584	L	0.51422	1.61	0.29276	N	0.870333	D	0.89917	1.0	D	0.68765	0.96	T	0.75210	-0.3398	10	0.87932	D	0	.	9.7094	0.40236	0.0:0.8409:0.0:0.1591	.	366	Q6P3R8	NEK5_HUMAN	Y	366	ENSP00000347767:D366Y	ENSP00000347767:D366Y	D	-	1	0	NEK5	51565303	1.000000	0.71417	0.524000	0.27887	0.005000	0.04900	2.612000	0.46343	1.114000	0.41781	-0.192000	0.12808	GAT	NEK5	-	NULL	ENSG00000197168		0.393	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK5	HGNC	protein_coding	OTTHUMT00000045045.3	308	0.00	0	C	NM_199289		52667302	52667302	-1	no_errors	ENST00000355568	ensembl	human	known	69_37n	missense	186	18.06	41	SNP	0.992	A
NLRC5	84166	genome.wustl.edu	37	16	57060870	57060870	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr16:57060870G>A	ENST00000262510.6	+	6	2240	c.2015G>A	c.(2014-2016)tGt>tAt	p.C672Y	NLRC5_ENST00000436936.1_Missense_Mutation_p.C672Y|NLRC5_ENST00000308149.7_Missense_Mutation_p.C672Y|NLRC5_ENST00000539144.1_Missense_Mutation_p.C672Y	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	672					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				TTTGATGGCTGTCCCCTGGAG	0.607																																						dbGAP											0													59.0	55.0	56.0					16																	57060870		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2015G>A	16.37:g.57060870G>A	ENSP00000262510:p.Cys672Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.C672Y	ENST00000262510.6	37	c.2015	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998534	0.74818	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030	T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61	5.37	5.37	0.77165	.	0.000000	0.37577	N	0.002034	T	0.66036	0.2749	M	0.79475	2.455	0.43095	D	0.994777	D;D;D;D	0.89917	1.0;1.0;0.997;0.988	D;D;D;D	0.91635	0.999;0.999;0.991;0.98	T	0.64257	-0.6450	10	0.02654	T	1	.	18.0752	0.89425	0.0:0.0:1.0:0.0	.	672;672;672;672	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.;.;.;NLRC5_HUMAN	Y	672;672;672;146;672;179;27	ENSP00000262510:C672Y;ENSP00000308886:C672Y;ENSP00000389739:C672Y;ENSP00000441727:C672Y;ENSP00000441597:C179Y;ENSP00000440153:C27Y	ENSP00000262510:C672Y	C	+	2	0	NLRC5	55618371	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.818000	0.86416	2.524000	0.85096	0.561000	0.74099	TGT	NLRC5	-	NULL	ENSG00000140853		0.607	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	75	0.00	0	G	NM_032206		57060870	57060870	+1	no_errors	ENST00000262510	ensembl	human	known	69_37n	missense	70	13.58	11	SNP	1.000	A
NLRP2	55655	genome.wustl.edu	37	19	55505775	55505775	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr19:55505775G>C	ENST00000543010.1	+	11	2990	c.2847G>C	c.(2845-2847)ttG>ttC	p.L949F	NLRP2_ENST00000537859.1_Missense_Mutation_p.L927F|NLRP2_ENST00000391721.4_Missense_Mutation_p.L925F|NLRP2_ENST00000448584.2_Missense_Mutation_p.L949F|NLRP2_ENST00000339757.7_Missense_Mutation_p.L927F|NLRP2_ENST00000427260.2_Missense_Mutation_p.L926F|NLRP2_ENST00000263437.6_Missense_Mutation_p.L946F|NLRP2_ENST00000538819.1_Missense_Mutation_p.L925F	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	949					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GTGAGGCTTTGAGGAAACCAC	0.403																																						dbGAP											0													191.0	159.0	170.0					19																	55505775		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2847G>C	19.37:g.55505775G>C	ENSP00000445135:p.Leu949Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L949F	ENST00000543010.1	37	c.2847	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571956	0.28092	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05	2.47	1.41	0.22369	.	.	.	.	.	T	0.79251	0.4414	M	0.90922	3.16	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.83275	0.994;0.996;0.992;0.996;0.986	T	0.64149	-0.6475	9	0.54805	T	0.06	.	5.4771	0.16702	0.1644:0.0:0.8356:0.0	.	926;927;946;925;949	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	F	949;925;927;949;927;926;925;946	ENSP00000445135:L949F;ENSP00000375601:L925F;ENSP00000344074:L927F;ENSP00000409370:L949F;ENSP00000440601:L927F;ENSP00000402474:L926F;ENSP00000441133:L925F;ENSP00000263437:L946F	ENSP00000263437:L946F	L	+	3	2	NLRP2	60197587	0.947000	0.32204	0.016000	0.15963	0.054000	0.15201	1.844000	0.39269	0.583000	0.29574	0.555000	0.69702	TTG	NLRP2	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000022556		0.403	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	362	0.00	0	G	NM_017852		55505775	55505775	+1	no_errors	ENST00000448584	ensembl	human	known	69_37n	missense	177	16.51	35	SNP	0.021	C
NRXN1	9378	genome.wustl.edu	37	2	51254720	51254720	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr2:51254720C>T	ENST00000406316.2	-	2	2168	c.692G>A	c.(691-693)gGa>gAa	p.G231E	NRXN1_ENST00000405472.3_Missense_Mutation_p.G231E|NRXN1_ENST00000404971.1_Missense_Mutation_p.G231E|NRXN1_ENST00000406859.3_Missense_Mutation_p.G231E|NRXN1_ENST00000401669.2_Missense_Mutation_p.G231E|NRXN1_ENST00000402717.3_Missense_Mutation_p.G231E|NRXN1_ENST00000405581.1_Missense_Mutation_p.G231E	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	231	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCACACACCTCCGTTGAGGCA	0.716																																						dbGAP											0													16.0	21.0	19.0					2																	51254720		2137	4216	6353	-	-	-	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.692G>A	2.37:g.51254720C>T	ENSP00000384311:p.Gly231Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.G231E	ENST00000406316.2	37	c.692	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436694	0.83885	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	T;T;T;T;T;T;T	0.79653	0.4;0.4;-1.29;0.4;-1.29;0.4;0.4	5.69	5.69	0.88448	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38272	U	0.001757	D	0.92815	0.7715	M	0.93898	3.47	0.58432	D	0.999999	D;D;B	0.89917	0.998;1.0;0.274	D;D;B	0.97110	0.984;1.0;0.117	D	0.93850	0.7144	10	0.66056	D	0.02	.	19.8145	0.96560	0.0:1.0:0.0:0.0	.	231;231;231	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	E	231	ENSP00000385142:G231E;ENSP00000384311:G231E;ENSP00000434015:G231E;ENSP00000385017:G231E;ENSP00000385434:G231E;ENSP00000385681:G231E;ENSP00000385310:G231E	ENSP00000385017:G231E	G	-	2	0	NRXN1	51108224	1.000000	0.71417	0.965000	0.40720	0.530000	0.34684	7.716000	0.84723	2.683000	0.91414	0.563000	0.77884	GGA	NRXN1	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000179915		0.716	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	20	0.00	0	C			51254720	51254720	-1	no_errors	ENST00000402717	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	1.000	T
NUCKS1	64710	genome.wustl.edu	37	1	205689755	205689755	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr1:205689755G>A	ENST00000367142.4	-	5	558	c.256C>T	c.(256-258)Cat>Tat	p.H86Y	NUCKS1_ENST00000464938.1_5'Flank	NM_022731.4	NP_073568.2	Q9H1E3	NUCKS_HUMAN	nuclear casein kinase and cyclin-dependent kinase substrate 1	86						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(1)|lung(9)	14	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			ACATTTTTATGATCTTCTTTT	0.363																																						dbGAP											0													117.0	109.0	111.0					1																	205689755		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30987.1	1q32.1	2008-02-05			ENSG00000069275	ENSG00000069275			29923	protein-coding gene	gene with protein product		611912				11298763	Standard	NM_022731		Approved	NUCKS	uc001hdb.3	Q9H1E3	OTTHUMG00000035996	ENST00000367142.4:c.256C>T	1.37:g.205689755G>A	ENSP00000356110:p.His86Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q54AC0|Q5PXE7|Q9H1D6|Q9H723	Missense_Mutation	SNP	NULL	p.H86Y	ENST00000367142.4	37	c.256	CCDS30987.1	1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176349	0.57692	.	.	ENSG00000069275	ENST00000367142;ENST00000264531	T	0.21543	2.0	5.27	5.27	0.74061	.	0.090648	0.85682	D	0.000000	T	0.14787	0.0357	N	0.14661	0.345	0.42351	D	0.992378	P	0.34462	0.454	B	0.28553	0.091	T	0.08973	-1.0696	10	0.87932	D	0	-19.1011	18.8371	0.92167	0.0:0.0:1.0:0.0	.	86	Q9H1E3	NUCKS_HUMAN	Y	86;66	ENSP00000356110:H86Y	ENSP00000264531:H66Y	H	-	1	0	NUCKS1	203956378	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.708000	0.74660	2.621000	0.88768	0.650000	0.86243	CAT	NUCKS1	-	NULL	ENSG00000069275		0.363	NUCKS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUCKS1	HGNC	protein_coding	OTTHUMT00000087729.1	398	0.00	0	G	NM_022731		205689755	205689755	-1	no_errors	ENST00000367142	ensembl	human	known	69_37n	missense	211	30.36	92	SNP	1.000	A
NXNL2	158046	genome.wustl.edu	37	9	91159324	91159324	+	Silent	SNP	C	C	G			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr9:91159324C>G	ENST00000375854.3	+	2	667	c.333C>G	c.(331-333)gcC>gcG	p.A111A	NXNL2_ENST00000487646.2_3'UTR|NXNL2_ENST00000375855.3_Intron	NM_001161625.1	NP_001155097.1	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2	111	Thioredoxin.				photoreceptor cell maintenance (GO:0045494)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)					lung(3)	3						ACGTCACAGCCATCCCCAAGC	0.567																																						dbGAP											0													78.0	81.0	80.0					9																	91159324		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC022521	CCDS6679.1, CCDS55325.1	9q22.2	2008-02-05	2007-08-16	2007-08-16	ENSG00000130045	ENSG00000130045			30482	protein-coding gene	gene with protein product		615299	"""chromosome 9 open reading frame 121"""	C9orf121		12477932	Standard	NM_001161625		Approved		uc011ltj.2	Q5VZ03	OTTHUMG00000020170	ENST00000375854.3:c.333C>G	9.37:g.91159324C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMD0|Q8TBG6	Silent	SNP	superfamily_Thioredoxin-like_fold	p.A111	ENST00000375854.3	37	c.333	CCDS55325.1	9																																																																																			NXNL2	-	superfamily_Thioredoxin-like_fold	ENSG00000130045		0.567	NXNL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NXNL2	HGNC	protein_coding		121	0.00	0	C	NM_145283		91159324	91159324	+1	no_errors	ENST00000375854	ensembl	human	known	69_37n	silent	66	19.51	16	SNP	0.998	G
PACS2	23241	genome.wustl.edu	37	14	105843115	105843115	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr14:105843115C>T	ENST00000325438.8	+	9	1316	c.812C>T	c.(811-813)tCg>tTg	p.S271L	PACS2_ENST00000447393.1_Missense_Mutation_p.S271L|PACS2_ENST00000430725.2_Missense_Mutation_p.S196L|PACS2_ENST00000458164.2_Missense_Mutation_p.S271L|PACS2_ENST00000547217.1_Missense_Mutation_p.S241L			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	271					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		GTCCTGGACTCGGAGCAGGAC	0.682																																						dbGAP											0													50.0	44.0	46.0					14																	105843115		2200	4299	6499	-	-	-	SO:0001583	missense	0			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.812C>T	14.37:g.105843115C>T	ENSP00000321834:p.Ser271Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.S271L	ENST00000325438.8	37	c.812	CCDS32168.1	14	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518019	0.27211	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	4.5	3.61	0.41365	.	0.069032	0.64402	D	0.000011	T	0.28699	0.0711	L	0.39245	1.2	0.58432	D	0.999997	B;B;P;D	0.76494	0.005;0.016;0.573;0.999	B;B;B;D	0.77557	0.001;0.006;0.038;0.99	T	0.01298	-1.1392	10	0.26408	T	0.33	-7.135	11.4506	0.50149	0.0:0.9094:0.0:0.0906	.	271;271;271;272	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	L	196;271;271;271;241	ENSP00000393524:S196L;ENSP00000321834:S271L;ENSP00000399732:S271L;ENSP00000393559:S271L;ENSP00000449525:S241L	ENSP00000321834:S271L	S	+	2	0	PACS2	104914160	1.000000	0.71417	0.818000	0.32626	0.962000	0.63368	5.899000	0.69846	1.010000	0.39314	0.467000	0.42956	TCG	PACS2	-	NULL	ENSG00000179364		0.682	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PACS2	HGNC	protein_coding	OTTHUMT00000409209.1	24	0.00	0	C	XM_377355		105843115	105843115	+1	no_errors	ENST00000458164	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	0.992	T
PARK2	5071	genome.wustl.edu	37	6	161969999	161969999	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr6:161969999C>A	ENST00000366898.1	-	9	1072	c.970G>T	c.(970-972)Gtc>Ttc	p.V324F	PARK2_ENST00000366894.1_Missense_Mutation_p.V133F|PARK2_ENST00000366892.1_Missense_Mutation_p.V324F|PARK2_ENST00000366896.1_Missense_Mutation_p.V175F|PARK2_ENST00000338468.3_Missense_Mutation_p.V133F|PARK2_ENST00000366897.1_Missense_Mutation_p.V296F	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	324					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		ATCTGCAGGACACACTCCTCT	0.572																																						dbGAP											0													70.0	60.0	63.0					6																	161969999		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.970G>T	6.37:g.161969999C>A	ENSP00000355865:p.Val324Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_Znf_C6HC,pfam_SUMO,smart_Ubiquitin,smart_Znf_C6HC,pirsf_Parkin,prints_Parkin,prints_Ubiquitin_subgr,pfscan_Ubiquitin_supergroup	p.V324F	ENST00000366898.1	37	c.970	CCDS5281.1	6	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591974	0.66219	.	.	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366894;ENST00000338468;ENST00000392134;ENST00000366892	D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	5.72	5.72	0.89469	Zinc finger, C6HC-type (1);	0.079471	0.49916	D	0.000129	D	0.93792	0.8015	M	0.81802	2.56	0.41086	D	0.985569	D;D;D;D;D	0.89917	0.997;1.0;0.993;0.993;0.975	D;D;D;D;P	0.91635	0.945;0.999;0.951;0.951;0.886	D	0.92446	0.5966	10	0.38643	T	0.18	.	18.0673	0.89395	0.0:1.0:0.0:0.0	.	343;175;296;324;133	O60260-5;Q5VVX3;Q5VVX4;O60260;Q8NI42	.;.;.;PRKN2_HUMAN;.	F	324;296;175;133;133;133;324	ENSP00000355865:V324F;ENSP00000355863:V296F;ENSP00000355862:V175F;ENSP00000355860:V133F;ENSP00000343589:V133F;ENSP00000355858:V324F	ENSP00000343589:V133F	V	-	1	0	PARK2	161889989	0.993000	0.37304	0.681000	0.30009	0.369000	0.29798	3.096000	0.50243	2.689000	0.91719	0.650000	0.86243	GTC	PARK2	-	smart_Znf_C6HC,pirsf_Parkin	ENSG00000185345		0.572	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PARK2	HGNC	protein_coding	OTTHUMT00000042995.1	51	0.00	0	C			161969999	161969999	-1	no_errors	ENST00000366898	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.623	A
PCDHA10	56139	genome.wustl.edu	37	5	140236913	140236913	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr5:140236913G>A	ENST00000307360.5	+	1	1280	c.1280G>A	c.(1279-1281)cGg>cAg	p.R427Q	PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.R427Q|PCDHA4_ENST00000512229.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	427	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGACCGCGCGGGACGGGGGC	0.647																																						dbGAP											0													107.0	103.0	105.0					5																	140236913		2197	4274	6471	-	-	-	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1280G>A	5.37:g.140236913G>A	ENSP00000304234:p.Arg427Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R427Q	ENST00000307360.5	37	c.1280	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	G	2.206	-0.381915	0.04966	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.52754	4.67;0.65	3.96	2.16	0.27623	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.21227	0.0511	N	0.10733	0.035	0.09310	N	1	P;P;B	0.35872	0.514;0.525;0.106	B;B;B	0.28232	0.061;0.087;0.041	T	0.09975	-1.0650	9	0.51188	T	0.08	.	3.904	0.09174	0.4266:0.1786:0.3949:0.0	.	427;427;427	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	Q	427	ENSP00000421030:R427Q;ENSP00000304234:R427Q	ENSP00000304234:R427Q	R	+	2	0	PCDHA10	140217097	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	-1.591000	0.02100	0.450000	0.26774	-0.265000	0.10407	CGG	PCDHA10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000250120		0.647	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2	200	0.00	0	G	NM_018901		140236913	140236913	+1	no_errors	ENST00000307360	ensembl	human	known	69_37n	missense	89	37.32	53	SNP	0.000	A
PDYN	5173	genome.wustl.edu	37	20	1961312	1961312	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr20:1961312G>T	ENST00000217305.2	-	4	647	c.422C>A	c.(421-423)gCa>gAa	p.A141E	PDYN_ENST00000540134.1_Missense_Mutation_p.A141E|PDYN_ENST00000539905.1_Missense_Mutation_p.A141E|RP4-684O24.5_ENST00000446562.1_RNA	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	141					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.A141V(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTCAGACTCTGCTCCCTCCCT	0.547																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											116.0	109.0	111.0					20																	1961312		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.422C>A	20.37:g.1961312G>T	ENSP00000217305:p.Ala141Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Q3	Missense_Mutation	SNP	pfam_Opioid_neupept,prints_Proenkphlin_B,prints_Opioid_neupept	p.A141E	ENST00000217305.2	37	c.422	CCDS13023.1	20	.	.	.	.	.	.	.	.	.	.	G	0.708	-0.788336	0.02884	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	T;T;T	0.80393	-1.37;-1.37;-1.37	4.71	-3.95	0.04118	.	1.069720	0.07158	N	0.850281	T	0.54615	0.1869	N	0.20685	0.6	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.50233	-0.8852	10	0.02654	T	1	8.4254	0.1935	0.00137	0.3113:0.2496:0.2033:0.2357	.	141	P01213	PDYN_HUMAN	E	141	ENSP00000440185:A141E;ENSP00000442259:A141E;ENSP00000217305:A141E	ENSP00000217305:A141E	A	-	2	0	PDYN	1909312	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.225000	0.09151	-1.008000	0.03404	0.491000	0.48974	GCA	PDYN	-	NULL	ENSG00000101327		0.547	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDYN	HGNC	protein_coding	OTTHUMT00000077569.2	211	0.00	0	G			1961312	1961312	-1	no_errors	ENST00000217305	ensembl	human	known	69_37n	missense	124	15.07	22	SNP	0.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	128	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	75	20.21	19	SNP	1.000	A
PPP6R1	22870	genome.wustl.edu	37	19	55743172	55743172	+	Silent	SNP	G	G	A	rs568344377	byFrequency	TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr19:55743172G>A	ENST00000412770.2	-	19	2870	c.2304C>T	c.(2302-2304)ctC>ctT	p.L768L	AC010327.1_ENST00000581390.1_RNA|TMEM86B_ENST00000327042.4_5'Flank|PPP6R1_ENST00000587283.1_Silent_p.L768L	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	768	Pro-rich.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						GTTCTCACCTGAGCTGCAGGG	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		16285	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													11.0	14.0	13.0					19																	55743172		1981	4148	6129	-	-	-	SO:0001819	synonymous_variant	0			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.2304C>T	19.37:g.55743172G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Silent	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.L768	ENST00000412770.2	37	c.2304	CCDS46186.1	19																																																																																			PPP6R1	-	NULL	ENSG00000105063		0.672	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP6R1	HGNC	protein_coding	OTTHUMT00000452663.1	48	0.00	0	G	NM_014931		55743172	55743172	-1	no_errors	ENST00000412770	ensembl	human	known	69_37n	silent	27	25.00	9	SNP	1.000	A
PRRC2B	84726	genome.wustl.edu	37	9	134351790	134351790	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr9:134351790G>A	ENST00000357304.4	+	15	4329	c.4274G>A	c.(4273-4275)aGa>aAa	p.R1425K	PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1425							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TCCAGTCAGAGACCCGTGGTT	0.637											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													15.0	17.0	16.0					9																	134351790		1937	4116	6053	-	-	-	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.4274G>A	9.37:g.134351790G>A	ENSP00000349856:p.Arg1425Lys	Somatic	1610	WXS	Illumina GAIIx	Phase_IV	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.R1425K	ENST00000357304.4	37	c.4274	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917282	0.92249	.	.	ENSG00000130723	ENST00000357304;ENST00000418650	T	0.15834	2.39	5.93	5.93	0.95920	.	.	.	.	.	T	0.42854	0.1221	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.997	D;D;D	0.83275	0.996;0.99;0.978	T	0.09378	-1.0677	9	0.66056	D	0.02	.	19.3291	0.94278	0.0:0.0:1.0:0.0	.	721;158;1425	Q5H9R5;Q5JSZ8;Q5JSZ5	.;.;PRC2B_HUMAN	K	1425;721	ENSP00000349856:R1425K	ENSP00000349856:R1425K	R	+	2	0	PRRC2B	133341611	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.476000	0.97823	2.814000	0.96858	0.655000	0.94253	AGA	PRRC2B	-	NULL	ENSG00000130723		0.637	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		29	0.00	0	G			134351790	134351790	+1	no_errors	ENST00000357304	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	A
RUVBL1	8607	genome.wustl.edu	37	3	127816231	127816231	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:127816231C>T	ENST00000322623.5	-	8	1027	c.928G>A	c.(928-930)Gag>Aag	p.E310K	RUVBL1_ENST00000417360.1_Missense_Mutation_p.E310K|RUVBL1_ENST00000464873.1_Missense_Mutation_p.E250K	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	310					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)			endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		GTGAAGCACTCAATGTCCAGC	0.537																																						dbGAP											0													168.0	139.0	149.0					3																	127816231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.928G>A	3.37:g.127816231C>T	ENSP00000318297:p.Glu310Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Missense_Mutation	SNP	pfam_TIP49_C,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA_core,superfamily_NA-bd_OB-fold-like,smart_AAA+_ATPase	p.E310K	ENST00000322623.5	37	c.928	CCDS3047.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.821926	0.96989	.	.	ENSG00000175792	ENST00000464873;ENST00000322623;ENST00000417360;ENST00000478892	T;T;T	0.72615	-0.67;-0.33;-0.32	5.57	5.57	0.84162	TIP49, C-terminal (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.90800	0.7111	H	0.98089	4.145	0.80722	D	1	D;D;D;D	0.89917	0.995;1.0;0.999;0.987	D;D;D;D	0.87578	0.971;0.998;0.993;0.972	D	0.93879	0.7169	10	0.87932	D	0	-9.7686	19.5555	0.95345	0.0:1.0:0.0:0.0	.	310;310;250;250	Q9Y265-2;Q9Y265;E7ETR0;B3KRS7	.;RUVB1_HUMAN;.;.	K	250;310;310;109	ENSP00000420738:E250K;ENSP00000318297:E310K;ENSP00000393755:E310K	ENSP00000318297:E310K	E	-	1	0	RUVBL1	129298921	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.585000	0.67497	2.619000	0.88677	0.491000	0.48974	GAG	RUVBL1	-	pfam_TIP49_C,smart_AAA+_ATPase	ENSG00000175792		0.537	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL1	HGNC	protein_coding	OTTHUMT00000356728.2	321	0.31	1	C			127816231	127816231	-1	no_errors	ENST00000322623	ensembl	human	known	69_37n	missense	162	15.62	30	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	34032055	34032055	+	Missense_Mutation	SNP	G	G	C	rs376062318		TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr15:34032055G>C	ENST00000389232.4	+	51	7749	c.7679G>C	c.(7678-7680)cGa>cCa	p.R2560P	RYR3_ENST00000415757.3_Missense_Mutation_p.R2560P	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2560	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GATCTTTTCCGAATGGCCCTG	0.463																																						dbGAP											0													80.0	73.0	75.0					15																	34032055		1896	4109	6005	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7679G>C	15.37:g.34032055G>C	ENSP00000373884:p.Arg2560Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.R2560P	ENST00000389232.4	37	c.7679	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881712	0.51908	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.92858	-3.12;-3.12	5.4	4.47	0.54385	.	0.070016	0.56097	D	0.000033	D	0.89206	0.6649	L	0.40543	1.245	0.41222	D	0.986515	P;P	0.46621	0.881;0.872	B;P	0.47346	0.408;0.544	D	0.87987	0.2747	10	0.45353	T	0.12	.	8.9714	0.35908	0.0732:0.0:0.7775:0.1492	.	2560;2560	Q15413-2;Q15413	.;RYR3_HUMAN	P	2560	ENSP00000373884:R2560P;ENSP00000399610:R2560P	ENSP00000354735:R2560P	R	+	2	0	RYR3	31819347	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	4.682000	0.61671	1.467000	0.48044	0.655000	0.94253	CGA	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.463	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	253	0.00	0	G			34032055	34032055	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	112	23.81	35	SNP	0.995	C
SCAMP3	10067	genome.wustl.edu	37	1	155228722	155228722	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr1:155228722G>C	ENST00000302631.3	-	5	519	c.412C>G	c.(412-414)Cta>Gta	p.L138V	SCAMP3_ENST00000355379.3_Missense_Mutation_p.L112V|SCAMP3_ENST00000472397.1_5'UTR	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	138					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AAAGAAGGTAGAGGGGGCCAA	0.478																																						dbGAP											0													116.0	122.0	120.0					1																	155228722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.412C>G	1.37:g.155228722G>C	ENSP00000307275:p.Leu138Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	pfam_SCAMP	p.L138V	ENST00000302631.3	37	c.412	CCDS1105.1	1	.	.	.	.	.	.	.	.	.	.	.	18.00	3.524477	0.64747	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	T;T	0.21031	2.03;2.03	4.83	2.91	0.33838	.	0.000000	0.64402	D	0.000010	T	0.35856	0.0946	M	0.86028	2.79	0.49687	D	0.999814	D;D	0.76494	0.994;0.999	D;D	0.87578	0.95;0.998	T	0.27938	-1.0059	9	.	.	.	-12.1631	9.2077	0.37300	0.183:0.0:0.817:0.0	.	112;138	O14828-2;O14828	.;SCAM3_HUMAN	V	138;112	ENSP00000307275:L138V;ENSP00000347540:L112V	.	L	-	1	2	SCAMP3	153495346	0.969000	0.33509	0.894000	0.35097	0.996000	0.88848	1.693000	0.37742	1.257000	0.44085	0.655000	0.94253	CTA	SCAMP3	-	pfam_SCAMP	ENSG00000116521		0.478	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP3	HGNC	protein_coding	OTTHUMT00000087399.1	103	0.00	0	G	NM_005698		155228722	155228722	-1	no_errors	ENST00000302631	ensembl	human	known	69_37n	missense	80	20.00	20	SNP	0.864	C
SCN11A	11280	genome.wustl.edu	37	3	38962717	38962717	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:38962717G>A	ENST00000302328.3	-	6	940	c.742C>T	c.(742-744)Cgc>Tgc	p.R248C	SCN11A_ENST00000450244.1_Missense_Mutation_p.R248C|SCN11A_ENST00000444237.2_Missense_Mutation_p.R248C|SCN11A_ENST00000456224.3_Missense_Mutation_p.R248C	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	248					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCACAGAGCGTAGCAAGGCC	0.537																																						dbGAP											0													113.0	109.0	110.0					3																	38962717		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.742C>T	3.37:g.38962717G>A	ENSP00000307599:p.Arg248Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.R248C	ENST00000302328.3	37	c.742	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617954	0.87359	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98747	-5.11;-5.11;-5.11;-5.11	4.67	4.67	0.58626	Ion transport (1);	0.217778	0.42964	D	0.000631	D	0.98804	0.9597	M	0.74389	2.26	0.49582	D	0.999803	D	0.76494	0.999	D	0.63597	0.916	D	0.99301	1.0901	10	0.54805	T	0.06	.	15.1097	0.72346	0.0:0.0:1.0:0.0	.	248	Q9UI33	SCNBA_HUMAN	C	248	ENSP00000307599:R248C;ENSP00000400945:R248C;ENSP00000416757:R248C;ENSP00000408028:R248C	ENSP00000307599:R248C	R	-	1	0	SCN11A	38937721	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.423000	0.80229	2.147000	0.66899	0.585000	0.79938	CGC	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.537	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	106	0.00	0	G	NM_014139		38962717	38962717	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	72	15.29	13	SNP	1.000	A
SPIN2B	474343	genome.wustl.edu	37	X	57146372	57146372	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chrX:57146372G>C	ENST00000333933.3	-	2	1001	c.691C>G	c.(691-693)Caa>Gaa	p.Q231E	SPIN2B_ENST00000374912.5_Missense_Mutation_p.Q231E|SPIN2B_ENST00000460948.1_Intron|RP3-323P24.3_ENST00000439622.1_RNA|SPIN2B_ENST00000374910.3_Missense_Mutation_p.Q130E|SPIN2B_ENST00000275988.5_Missense_Mutation_p.Q231E	NM_001006681.1	NP_001006682.1	Q9BPZ2	SPI2B_HUMAN	spindlin family, member 2B	231					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|skin(1)	5						GCTTCCACTTGGTGAATGACC	0.418																																						dbGAP											0													160.0	132.0	142.0					X																	57146372		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF356353	CCDS35311.1, CCDS65274.1	Xp11.1	2014-02-12	2006-12-05		ENSG00000186787	ENSG00000186787			33147	protein-coding gene	gene with protein product		300517				12145692	Standard	XM_005262010		Approved	SPIN-2	uc004dva.3	Q9BPZ2	OTTHUMG00000021680	ENST00000333933.3:c.691C>G	X.37:g.57146372G>C	ENSP00000335008:p.Gln231Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z2M0	Missense_Mutation	SNP	pfam_Spin_Ssty	p.Q231E	ENST00000333933.3	37	c.691	CCDS35311.1	X	.	.	.	.	.	.	.	.	.	.	.	13.10	2.137073	0.37728	.	.	ENSG00000186787	ENST00000275988;ENST00000374912;ENST00000374910;ENST00000333933;ENST00000434397	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	2.37	2.37	0.29283	.	0.000000	0.64402	D	0.000001	T	0.73853	0.3640	M	0.79926	2.475	0.42198	D	0.991759	P	0.39391	0.671	P	0.54238	0.746	T	0.77763	-0.2466	10	0.87932	D	0	-11.7564	10.1693	0.42900	0.0:0.0:1.0:0.0	.	231	Q9BPZ2	SPI2B_HUMAN	E	231;231;130;231;231	ENSP00000275988:Q231E;ENSP00000364047:Q231E;ENSP00000364045:Q130E;ENSP00000335008:Q231E;ENSP00000404314:Q231E	ENSP00000275988:Q231E	Q	-	1	0	SPIN2B	57163097	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	8.015000	0.88690	1.500000	0.48636	0.171000	0.16805	CAA	SPIN2B	-	pfam_Spin_Ssty	ENSG00000186787		0.418	SPIN2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN2B	HGNC	protein_coding	OTTHUMT00000056912.1	339	0.00	0	G	NM_001006681		57146372	57146372	-1	no_errors	ENST00000275988	ensembl	human	known	69_37n	missense	205	17.00	42	SNP	1.000	C
TBC1D9	23158	genome.wustl.edu	37	4	141598222	141598222	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr4:141598222G>T	ENST00000442267.2	-	6	959	c.885C>A	c.(883-885)taC>taA	p.Y295*		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	295	GRAM 2.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				AAAGTGCACGGTATCTCTCAC	0.418																																						dbGAP											0													151.0	144.0	146.0					4																	141598222		1912	4141	6053	-	-	-	SO:0001587	stop_gained	0			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.885C>A	4.37:g.141598222G>T	ENSP00000411197:p.Tyr295*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U8|D3DNZ1|O94958	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.Y295*	ENST00000442267.2	37	c.885	CCDS47136.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.500586	0.98322	.	.	ENSG00000109436	ENST00000442267	.	.	.	5.48	4.63	0.57726	.	0.115109	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-6.9806	11.8406	0.52353	0.1379:0.0:0.8621:0.0	.	.	.	.	X	295	.	ENSP00000411197:Y295X	Y	-	3	2	TBC1D9	141817672	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.403000	0.52615	2.579000	0.87056	0.555000	0.69702	TAC	TBC1D9	-	pfam_GRAM,smart_GRAM	ENSG00000109436		0.418	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	HGNC	protein_coding	OTTHUMT00000364806.1	241	0.00	0	G	NM_015130		141598222	141598222	-1	no_errors	ENST00000442267	ensembl	human	known	69_37n	nonsense	126	21.74	35	SNP	1.000	T
THBS2	7058	genome.wustl.edu	37	6	169626349	169626349	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr6:169626349C>T	ENST00000366787.3	-	17	2713	c.2464G>A	c.(2464-2466)Gac>Aac	p.D822N	XXyac-YX65C7_A.2_ENST00000444188.1_RNA|THBS2_ENST00000488355.1_5'Flank	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	822					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TCCCTCTGGTCAGTGTTGTAG	0.532																																					Esophageal Squamous(91;219 1934 18562 44706)	dbGAP											0													116.0	107.0	110.0					6																	169626349		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.2464G>A	6.37:g.169626349C>T	ENSP00000355751:p.Asp822Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.D822N	ENST00000366787.3	37	c.2464	CCDS34574.1	6	.	.	.	.	.	.	.	.	.	.	C	28.4	4.919359	0.92249	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	D	0.98512	-4.97	4.75	4.75	0.60458	.	0.000000	0.42821	U	0.000644	D	0.97542	0.9195	M	0.64170	1.965	0.53005	D	0.999966	P	0.43633	0.813	P	0.49829	0.623	D	0.97504	1.0062	10	0.39692	T	0.17	-56.9142	18.1162	0.89556	0.0:1.0:0.0:0.0	.	822	P35442	TSP2_HUMAN	N	822;80	ENSP00000355751:D822N	ENSP00000355751:D822N	D	-	1	0	THBS2	169368274	1.000000	0.71417	0.977000	0.42913	0.956000	0.61745	7.276000	0.78559	2.328000	0.79073	0.579000	0.79373	GAC	THBS2	-	NULL	ENSG00000186340		0.532	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	HGNC	protein_coding	OTTHUMT00000105439.1	257	0.00	0	C	NM_003247		169626349	169626349	-1	no_errors	ENST00000366787	ensembl	human	known	69_37n	missense	121	30.46	53	SNP	1.000	T
TOPBP1	11073	genome.wustl.edu	37	3	133335748	133335748	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:133335748G>A	ENST00000260810.5	-	23	3912	c.3781C>T	c.(3781-3783)Cat>Tat	p.H1261Y		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1261	BRCT 7. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						AATTCTTCATGAGTCTCCTCT	0.289								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	dbGAP											0													68.0	60.0	63.0					3																	133335748		1791	4047	5838	-	-	-	SO:0001583	missense	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3781C>T	3.37:g.133335748G>A	ENSP00000260810:p.His1261Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.H1261Y	ENST00000260810.5	37	c.3781	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570527	0.28003	.	.	ENSG00000163781	ENST00000260810	T	0.12361	2.69	5.86	3.11	0.35812	BRCT (1);	0.672379	0.16276	N	0.221577	T	0.07818	0.0196	N	0.22421	0.69	0.09310	N	1	P	0.47253	0.892	B	0.42138	0.377	T	0.18366	-1.0339	10	0.27785	T	0.31	.	1.9678	0.03399	0.2254:0.1474:0.4922:0.135	.	1261	Q92547	TOPB1_HUMAN	Y	1261	ENSP00000260810:H1261Y	ENSP00000260810:H1261Y	H	-	1	0	TOPBP1	134818438	0.019000	0.18553	0.023000	0.16930	0.912000	0.54170	1.313000	0.33585	0.390000	0.25115	0.655000	0.94253	CAT	TOPBP1	-	pfscan_BRCT_dom	ENSG00000163781		0.289	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	149	0.00	0	G	NM_007027		133335748	133335748	-1	no_errors	ENST00000260810	ensembl	human	known	69_37n	missense	97	16.38	19	SNP	0.000	A
TRAPPC8	22878	genome.wustl.edu	37	18	29470718	29470718	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr18:29470718G>A	ENST00000283351.4	-	12	2043	c.1708C>T	c.(1708-1710)Cga>Tga	p.R570*	TRAPPC8_ENST00000582539.1_Nonsense_Mutation_p.R516*|TRAPPC8_ENST00000582513.1_Nonsense_Mutation_p.R570*	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	570					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTACTAAATCGATGGCCTGCC	0.333																																						dbGAP											0													119.0	117.0	118.0					18																	29470718		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1708C>T	18.37:g.29470718G>A	ENSP00000283351:p.Arg570*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP15|B3KME5|Q9H0L2	Nonsense_Mutation	SNP	NULL	p.R570*	ENST00000283351.4	37	c.1708	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	G	40	8.306048	0.98752	.	.	ENSG00000153339	ENST00000283351	.	.	.	5.98	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2848	0.66240	0.0:0.0:0.6762:0.3238	.	.	.	.	X	570	.	ENSP00000283351:R570X	R	-	1	2	TRAPPC8	27724716	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.559000	0.60796	1.497000	0.48584	0.585000	0.79938	CGA	TRAPPC8	-	NULL	ENSG00000153339		0.333	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	249	0.00	0	G	NM_014939		29470718	29470718	-1	no_errors	ENST00000283351	ensembl	human	known	69_37n	nonsense	152	17.39	32	SNP	1.000	A
TTC5	91875	genome.wustl.edu	37	14	20757805	20757805	+	Missense_Mutation	SNP	G	G	A	rs201731132		TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr14:20757805G>A	ENST00000258821.3	-	10	1360	c.1304C>T	c.(1303-1305)tCg>tTg	p.S435L	TTC5_ENST00000556592.1_5'Flank	NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	435					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S435*(1)|p.S435W(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		CTGTGGTCGCGATGCCACTGT	0.567													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19153	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|lung(1)											90.0	67.0	75.0					14																	20757805		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.1304C>T	14.37:g.20757805G>A	ENSP00000258821:p.Ser435Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ18|Q96HF9	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S435L	ENST00000258821.3	37	c.1304	CCDS9546.1	14	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	11.55	1.673190	0.29693	.	.	ENSG00000136319	ENST00000258821	T	0.29397	1.57	5.48	4.53	0.55603	.	0.127565	0.53938	D	0.000056	T	0.13457	0.0326	N	0.14661	0.345	0.34444	D	0.699904	B	0.33073	0.396	B	0.22753	0.041	T	0.15037	-1.0451	10	0.09084	T	0.74	.	10.7886	0.46419	0.0:0.0:0.7543:0.2457	.	435	Q8N0Z6	TTC5_HUMAN	L	435	ENSP00000258821:S435L	ENSP00000258821:S435L	S	-	2	0	TTC5	19827645	0.999000	0.42202	0.337000	0.25536	0.157000	0.22087	4.295000	0.59049	2.861000	0.98227	0.650000	0.86243	TCG	TTC5	-	NULL	ENSG00000136319		0.567	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC5	HGNC	protein_coding	OTTHUMT00000073529.4	141	0.00	0	G	NM_138376		20757805	20757805	-1	no_errors	ENST00000258821	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	0.738	A
TTN	7273	genome.wustl.edu	37	2	179471955	179471955	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr2:179471955C>T	ENST00000591111.1	-	228	48675	c.48451G>A	c.(48451-48453)Gga>Aga	p.G16151R	TTN_ENST00000342992.6_Missense_Mutation_p.G15224R|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G8919R|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G8852R|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G8727R|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G17792R|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16151	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACTTCCTCCATCATCTTCT	0.378																																						dbGAP											0													158.0	148.0	151.0					2																	179471955		1866	4109	5975	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48451G>A	2.37:g.179471955C>T	ENSP00000465570:p.Gly16151Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.G15224R	ENST00000591111.1	37	c.45670		2	.	.	.	.	.	.	.	.	.	.	C	14.43	2.534013	0.45073	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.99	5.99	0.97316	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77890	0.4198	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.79676	-0.1704	9	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	8727;8852;8919;16151	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	15224;8727;8919;8852;8727	ENSP00000343764:G15224R;ENSP00000434586:G8727R;ENSP00000340554:G8919R;ENSP00000352154:G8852R	ENSP00000340554:G8919R	G	-	1	0	TTN	179180200	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.770000	0.85390	2.840000	0.97914	0.655000	0.94253	GGA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	278	0.00	0	C	NM_133378		179471955	179471955	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	165	20.67	43	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179615735	179615735	+	Intron	SNP	C	C	G			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr2:179615735C>G	ENST00000591111.1	-	45	10585				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.D3798H|TTN_ENST00000589042.1_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTCTTCATCAACAATAGTT	0.348																																						dbGAP											0													124.0	133.0	130.0					2																	179615735		2200	4295	6495	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+2115G>C	2.37:g.179615735C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D3798H	ENST00000591111.1	37	c.11392		2	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797789	0.70567	.	.	ENSG00000155657	ENST00000360870	T	0.61742	0.08	5.11	2.35	0.29111	.	.	.	.	.	T	0.48750	0.1517	N	0.19112	0.55	0.80722	D	1	P	0.48764	0.915	P	0.50617	0.646	T	0.38866	-0.9641	9	0.45353	T	0.12	.	9.6125	0.39672	0.0:0.7662:0.0:0.2338	.	3798	Q8WZ42-6	.	H	3798	ENSP00000354117:D3798H	ENSP00000354117:D3798H	D	-	1	0	TTN	179323980	0.626000	0.27120	0.258000	0.24420	0.444000	0.32077	1.037000	0.30241	0.273000	0.22049	0.655000	0.94253	GAT	TTN	-	NULL	ENSG00000155657		0.348	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	122	0.00	0	C	NM_133378		179615735	179615735	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	missense	99	16.81	20	SNP	0.800	G
UBN1	29855	genome.wustl.edu	37	16	4923065	4923065	+	Silent	SNP	C	C	T			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr16:4923065C>T	ENST00000396658.4	+	13	2494	c.1791C>T	c.(1789-1791)atC>atT	p.I597I	UBN1_ENST00000590769.1_Silent_p.I597I|UBN1_ENST00000262376.6_Silent_p.I597I|UBN1_ENST00000545171.1_Silent_p.I597I	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	597					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						CTTCTAAAATCAAGGTGAAGG	0.448																																						dbGAP											0													152.0	142.0	146.0					16																	4923065		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1791C>T	16.37:g.4923065C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	NULL	p.S57L	ENST00000396658.4	37	c.170	CCDS10525.1	16																																																																																			UBN1	-	NULL	ENSG00000118900		0.448	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBN1	HGNC	protein_coding	OTTHUMT00000251719.1	398	0.00	0	C	NM_016936		4923065	4923065	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000586716	ensembl	human	novel	69_37n	missense	251	14.92	44	SNP	1.000	T
WASH6P	653440	genome.wustl.edu	37	X	155252868	155252868	+	RNA	SNP	T	T	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chrX:155252868T>A	ENST00000461007.1	+	0	1876				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.P304P(5)									TAGCCGAGCCTCTCAAGGCAG	0.632																																						dbGAP											5	Substitution - coding silent(5)	kidney(3)|endometrium(2)																																								-	-	-			0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252868T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGF1|Q8N305	Silent	SNP	pfam_WASH_WASD	p.P304	ENST00000461007.1	37	c.912		X																																																																																			WASH6P	-	NULL	ENSG00000182484		0.632	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	14	0.00	0	T	NG_008380		155252868	155252868	+1	no_errors	ENST00000359512	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	0.228	A
WDR63	126820	genome.wustl.edu	37	1	85560164	85560164	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr1:85560164C>A	ENST00000294664.6	+	10	1279	c.1099C>A	c.(1099-1101)Cac>Aac	p.H367N	WDR63_ENST00000326813.8_Missense_Mutation_p.H328N|WDR63_ENST00000370596.1_Missense_Mutation_p.H328N	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	367										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		AGACAGAGTTCACTTTTCTGG	0.423																																						dbGAP											0													235.0	231.0	233.0					1																	85560164		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1099C>A	1.37:g.85560164C>A	ENSP00000294664:p.His367Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.H367N	ENST00000294664.6	37	c.1099	CCDS702.1	1	.	.	.	.	.	.	.	.	.	.	C	0.515	-0.864838	0.02590	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664	T;T;T	0.27890	1.64;1.64;1.64	5.69	3.84	0.44239	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.842694	0.11036	N	0.606679	T	0.08313	0.0207	L	0.38838	1.175	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34625	-0.9821	10	0.22706	T	0.39	-19.741	6.7158	0.23302	0.2315:0.6263:0.0:0.1423	.	328;367	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	N	328;328;367	ENSP00000359628:H328N;ENSP00000317463:H328N;ENSP00000294664:H367N	ENSP00000294664:H367N	H	+	1	0	WDR63	85332752	0.212000	0.23540	0.286000	0.24833	0.109000	0.19521	0.772000	0.26647	0.770000	0.33336	-0.143000	0.13931	CAC	WDR63	-	superfamily_WD40_repeat_dom	ENSG00000162643		0.423	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR63	HGNC	protein_coding	OTTHUMT00000027565.2	396	0.00	0	C	NM_145172		85560164	85560164	+1	no_errors	ENST00000294664	ensembl	human	known	69_37n	missense	167	25.45	57	SNP	0.072	A
ZNF621	285268	genome.wustl.edu	37	3	40573701	40573701	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:40573701G>A	ENST00000339296.5	+	5	892	c.440G>A	c.(439-441)gGa>gAa	p.G147E	ZNF621_ENST00000490457.1_Intron|ZNF621_ENST00000431278.1_Missense_Mutation_p.G36E|ZNF621_ENST00000403205.2_Missense_Mutation_p.G147E|ZNF621_ENST00000310898.1_Intron	NM_198484.3	NP_940886.1	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		CTTCGAGGTGGAATGAAGTTC	0.393																																						dbGAP											0													82.0	81.0	82.0					3																	40573701		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127181	CCDS2693.1, CCDS74920.1	3p21.33	2013-01-08			ENSG00000172888	ENSG00000172888		"""Zinc fingers, C2H2-type"", ""-"""	24787	protein-coding gene	gene with protein product							Standard	XM_005265079		Approved	FLJ45246	uc003ckm.2	Q6ZSS3	OTTHUMG00000131389	ENST00000339296.5:c.440G>A	3.37:g.40573701G>A	ENSP00000340841:p.Gly147Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14DC7|Q8TE91	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G147E	ENST00000339296.5	37	c.440	CCDS2693.1	3	.	.	.	.	.	.	.	.	.	.	g	20.9	4.062979	0.76187	.	.	ENSG00000172888	ENST00000403205;ENST00000339296;ENST00000431278;ENST00000453351	T;T;T;T	0.08282	3.31;3.31;3.11;5.32	4.03	4.03	0.46877	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41294	D	0.000915	T	0.26376	0.0644	M	0.73430	2.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.997;0.986	T	0.00389	-1.1770	10	0.51188	T	0.08	.	12.0172	0.53321	0.0:0.0:1.0:0.0	.	147;36;147	C9JM43;C9JZC2;Q6ZSS3	.;.;ZN621_HUMAN	E	147;147;36;147	ENSP00000386051:G147E;ENSP00000340841:G147E;ENSP00000413236:G36E;ENSP00000408779:G147E	ENSP00000340841:G147E	G	+	2	0	ZNF621	40548705	1.000000	0.71417	0.795000	0.32087	0.994000	0.84299	6.420000	0.73349	2.554000	0.86153	0.650000	0.86243	GGA	ZNF621	-	NULL	ENSG00000172888		0.393	ZNF621-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF621	HGNC	protein_coding	OTTHUMT00000254178.2	105	0.00	0	G	NM_198484		40573701	40573701	+1	no_errors	ENST00000339296	ensembl	human	known	69_37n	missense	76	14.61	13	SNP	0.998	A
ZNF445	353274	genome.wustl.edu	37	3	44489889	44489889	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DX-01A-11D-A10Y-09	TCGA-BH-A0DX-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bca403d9-48ff-4534-ba33-94b8fb9fee0f	edc2ac11-3828-41d0-abf8-976ea7c5b348	g.chr3:44489889G>A	ENST00000396077.2	-	8	1621	c.1274C>T	c.(1273-1275)tCa>tTa	p.S425L	ZNF445_ENST00000425708.2_Missense_Mutation_p.S425L	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	425					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		ATAGTGGTGTGAACTCATTCT	0.408																																						dbGAP											0													129.0	129.0	129.0					3																	44489889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1274C>T	3.37:g.44489889G>A	ENSP00000379387:p.Ser425Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJD1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S425L	ENST00000396077.2	37	c.1274	CCDS2713.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190414	0.78789	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.05925	3.37;3.37	4.14	4.14	0.48551	.	0.175710	0.27912	N	0.017349	T	0.06917	0.0176	L	0.59436	1.845	0.35457	D	0.796174	P;P	0.46987	0.734;0.888	B;B	0.37601	0.254;0.254	T	0.10776	-1.0615	10	0.62326	D	0.03	.	8.0385	0.30508	0.1074:0.0:0.8926:0.0	.	413;425	B7ZKX2;P59923	.;ZN445_HUMAN	L	425	ENSP00000413073:S425L;ENSP00000379387:S425L	ENSP00000379387:S425L	S	-	2	0	ZNF445	44464893	0.074000	0.21230	0.974000	0.42286	0.841000	0.47740	1.299000	0.33424	2.599000	0.87857	0.591000	0.81541	TCA	ZNF445	-	NULL	ENSG00000185219		0.408	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2	295	0.00	0	G	NM_181489		44489889	44489889	-1	no_errors	ENST00000396077	ensembl	human	known	69_37n	missense	158	12.22	22	SNP	0.997	A
