#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APOB	338	genome.wustl.edu	37	2	21236250	21236250	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr2:21236250C>T	ENST00000233242.1	-	25	4125	c.3998G>A	c.(3997-3999)cGa>cAa	p.R1333Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1333					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGAACTCTCGAGATGGCAG	0.478																																						dbGAP											0													138.0	135.0	136.0					2																	21236250		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3998G>A	2.37:g.21236250C>T	ENSP00000233242:p.Arg1333Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.R1333Q	ENST00000233242.1	37	c.3998	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	0.308	-0.969445	0.02232	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00678	5.87	5.53	-10.6	0.00265	.	0.595809	0.15923	N	0.238037	T	0.00384	0.0012	N	0.03948	-0.315	0.19945	N	0.999945	B	0.06786	0.001	B	0.04013	0.001	T	0.48139	-0.9061	10	0.07482	T	0.82	.	17.8403	0.88713	0.0:0.5712:0.0:0.4288	.	1333	P04114	APOB_HUMAN	Q	1333	ENSP00000233242:R1333Q	ENSP00000233242:R1333Q	R	-	2	0	APOB	21089755	0.000000	0.05858	0.036000	0.18154	0.135000	0.20990	-0.487000	0.06505	-1.828000	0.01202	-1.012000	0.02466	CGA	APOB	-	NULL	ENSG00000084674		0.478	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	213	0.00	0	C			21236250	21236250	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	198	34.54	105	SNP	0.007	T
APOB	338	genome.wustl.edu	37	2	21236250	21236250	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr2:21236250C>T	ENST00000233242.1	-	25	4125	c.3998G>A	c.(3997-3999)cGa>cAa	p.R1333Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1333					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGAACTCTCGAGATGGCAG	0.478																																						dbGAP											0													138.0	135.0	136.0					2																	21236250		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3998G>A	2.37:g.21236250C>T	ENSP00000233242:p.Arg1333Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.R1333Q	ENST00000233242.1	37	c.3998	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	0.308	-0.969445	0.02232	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00678	5.87	5.53	-10.6	0.00265	.	0.595809	0.15923	N	0.238037	T	0.00384	0.0012	N	0.03948	-0.315	0.19945	N	0.999945	B	0.06786	0.001	B	0.04013	0.001	T	0.48139	-0.9061	10	0.07482	T	0.82	.	17.8403	0.88713	0.0:0.5712:0.0:0.4288	.	1333	P04114	APOB_HUMAN	Q	1333	ENSP00000233242:R1333Q	ENSP00000233242:R1333Q	R	-	2	0	APOB	21089755	0.000000	0.05858	0.036000	0.18154	0.135000	0.20990	-0.487000	0.06505	-1.828000	0.01202	-1.012000	0.02466	CGA	APOB	-	NULL	ENSG00000084674		0.478	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	263	0.38	1	C			21236250	21236250	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	198	34.54	105	SNP	0.007	T
ALK	238	genome.wustl.edu	37	2	29917810	29917810	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr2:29917810C>T	ENST00000389048.3	-	3	1764	c.858G>A	c.(856-858)caG>caA	p.Q286Q	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	286	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	AGGACCAGCTCTGGTTCCTGA	0.582			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													99.0	96.0	97.0					2																	29917810		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.858G>A	2.37:g.29917810C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q286	ENST00000389048.3	37	c.858	CCDS33172.1	2																																																																																			ALK	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,pfscan_MAM_dom	ENSG00000171094		0.582	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	98	0.00	0	C	NM_004304		29917810	29917810	-1	no_errors	ENST00000389048	ensembl	human	known	69_37n	silent	99	25.56	34	SNP	1.000	T
ALK	238	genome.wustl.edu	37	2	29917810	29917810	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr2:29917810C>T	ENST00000389048.3	-	3	1764	c.858G>A	c.(856-858)caG>caA	p.Q286Q	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	286	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	AGGACCAGCTCTGGTTCCTGA	0.582			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													99.0	96.0	97.0					2																	29917810		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.858G>A	2.37:g.29917810C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q286	ENST00000389048.3	37	c.858	CCDS33172.1	2																																																																																			ALK	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,pfscan_MAM_dom	ENSG00000171094		0.582	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	187	0.00	0	C	NM_004304		29917810	29917810	-1	no_errors	ENST00000389048	ensembl	human	known	69_37n	silent	99	25.56	34	SNP	1.000	T
ARHGAP1	392	genome.wustl.edu	37	11	46709754	46709755	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr11:46709754_46709755insG	ENST00000311956.4	-	4	382_383	c.285_286insC	c.(283-288)cccagcfs	p.S96fs		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	96	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		AGCTGGTGGCTGGGGGGCATTC	0.55																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.286dupC	11.37:g.46709760_46709760dupG	ENSP00000310491:p.Ser96fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQQ6	Frame_Shift_Ins	INS	pfam_RhoGAP_dom,pfam_CRAL-TRIO_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_RhoGAP_dom,pfscan_CRAL-TRIO_dom,pfscan_RhoGAP_dom	p.S95fs	ENST00000311956.4	37	c.286_285	CCDS7922.1	11																																																																																			ARHGAP1	-	superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000175220		0.550	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP1	HGNC	protein_coding	OTTHUMT00000390472.1	19	0.00	0	-	NM_004308		46709754	46709755	-1	no_errors	ENST00000311956	ensembl	human	known	69_37n	frame_shift_ins	13	18.75	3	INS	0.881:0.320	G
ARHGAP1	392	genome.wustl.edu	37	11	46709754	46709755	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr11:46709754_46709755insG	ENST00000311956.4	-	4	382_383	c.285_286insC	c.(283-288)cccagcfs	p.S96fs		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	96	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		AGCTGGTGGCTGGGGGGCATTC	0.55																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.286dupC	11.37:g.46709760_46709760dupG	ENSP00000310491:p.Ser96fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQQ6	Frame_Shift_Ins	INS	pfam_RhoGAP_dom,pfam_CRAL-TRIO_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_RhoGAP_dom,pfscan_CRAL-TRIO_dom,pfscan_RhoGAP_dom	p.S95fs	ENST00000311956.4	37	c.286_285	CCDS7922.1	11																																																																																			ARHGAP1	-	superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000175220		0.550	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP1	HGNC	protein_coding	OTTHUMT00000390472.1	30	0.00	0	-	NM_004308		46709754	46709755	-1	no_errors	ENST00000311956	ensembl	human	known	69_37n	frame_shift_ins	13	18.75	3	INS	0.881:0.320	G
CHD4	1108	genome.wustl.edu	37	12	6702280	6702280	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr12:6702280G>A	ENST00000357008.2	-	17	2792	c.2629C>T	c.(2629-2631)Cgg>Tgg	p.R877W	CHD4_ENST00000309577.6_Missense_Mutation_p.R877W|CHD4_ENST00000544040.1_Missense_Mutation_p.R870W|CHD4_ENST00000544484.1_Missense_Mutation_p.R874W	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	877	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TTCTTCAGCCGATGGGCTTCA	0.468																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													95.0	88.0	90.0					12																	6702280		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2629C>T	12.37:g.6702280G>A	ENSP00000349508:p.Arg877Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R877W	ENST00000357008.2	37	c.2629	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030807	0.54790	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	5.3	3.27	0.37495	DEAD-like helicase (2);DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	H	0.97732	4.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	D	0.99709	1.1006	10	0.87932	D	0	-4.9516	19.0658	0.93110	0.0:0.0:0.7401:0.2598	.	877;877;870	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	W	874;870;877;877;851	ENSP00000440392:R874W;ENSP00000440542:R870W;ENSP00000312419:R877W;ENSP00000349508:R877W	ENSP00000312419:R877W	R	-	1	2	CHD4	6572541	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.298000	0.43602	0.633000	0.30452	-2.051000	0.00406	CGG	CHD4	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111642		0.468	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		198	0.50	1	G	NM_001273		6702280	6702280	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	184	30.57	81	SNP	0.999	A
CHD4	1108	genome.wustl.edu	37	12	6702280	6702280	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr12:6702280G>A	ENST00000357008.2	-	17	2792	c.2629C>T	c.(2629-2631)Cgg>Tgg	p.R877W	CHD4_ENST00000309577.6_Missense_Mutation_p.R877W|CHD4_ENST00000544040.1_Missense_Mutation_p.R870W|CHD4_ENST00000544484.1_Missense_Mutation_p.R874W	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	877	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TTCTTCAGCCGATGGGCTTCA	0.468																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													95.0	88.0	90.0					12																	6702280		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2629C>T	12.37:g.6702280G>A	ENSP00000349508:p.Arg877Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R877W	ENST00000357008.2	37	c.2629	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030807	0.54790	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	5.3	3.27	0.37495	DEAD-like helicase (2);DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	H	0.97732	4.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	D	0.99709	1.1006	10	0.87932	D	0	-4.9516	19.0658	0.93110	0.0:0.0:0.7401:0.2598	.	877;877;870	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	W	874;870;877;877;851	ENSP00000440392:R874W;ENSP00000440542:R870W;ENSP00000312419:R877W;ENSP00000349508:R877W	ENSP00000312419:R877W	R	-	1	2	CHD4	6572541	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.298000	0.43602	0.633000	0.30452	-2.051000	0.00406	CGG	CHD4	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111642		0.468	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		453	0.00	0	G	NM_001273		6702280	6702280	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	184	30.57	81	SNP	0.999	A
DCAF8L2	347442	genome.wustl.edu	37	X	27765579	27765579	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chrX:27765579C>T	ENST00000451261.2	+	5	966	c.567C>T	c.(565-567)gtC>gtT	p.V189V		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	189										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GCTGGCAGGTCGTTACTGCTC	0.592																																						dbGAP											0													41.0	40.0	40.0					X																	27765579		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.567C>T	X.37:g.27765579C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXH9|J3KT06	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V189	ENST00000451261.2	37	c.567	CCDS59162.1	X																																																																																			DCAF8L2	-	NULL	ENSG00000189186		0.592	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	53	0.00	0	C	XM_293354		27765579	27765579	+1	no_errors	ENST00000451261	ensembl	human	known	69_37n	silent	6	45.45	5	SNP	0.007	T
DDR2	4921	genome.wustl.edu	37	1	162731228	162731228	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr1:162731228G>C	ENST00000367922.3	+	10	1521	c.1083G>C	c.(1081-1083)gaG>gaC	p.E361D	DDR2_ENST00000367921.3_Missense_Mutation_p.E361D	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	361					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TGTTCAGTGAGATCACCTTCC	0.517																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													97.0	78.0	85.0					1																	162731228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1083G>C	1.37:g.162731228G>C	ENSP00000356899:p.Glu361Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E361D	ENST00000367922.3	37	c.1083	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055142	0.75960	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	T;T	0.57273	0.41;0.41	5.89	2.99	0.34606	.	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	M	0.89968	3.075	0.36433	D	0.865004	D	0.89917	1.0	D	0.74348	0.983	T	0.74166	-0.3753	9	0.72032	D	0.01	.	10.6364	0.45567	0.2139:0.0:0.7861:0.0	.	361	Q16832	DDR2_HUMAN	D	361	ENSP00000356899:E361D;ENSP00000356898:E361D	ENSP00000356898:E361D	E	+	3	2	DDR2	160997852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.866000	0.48420	0.812000	0.34326	0.655000	0.94253	GAG	DDR2	-	NULL	ENSG00000162733		0.517	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	70	0.00	0	G	NM_006182		162731228	162731228	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	missense	183	17.94	40	SNP	1.000	C
DDR2	4921	genome.wustl.edu	37	1	162731228	162731228	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr1:162731228G>C	ENST00000367922.3	+	10	1521	c.1083G>C	c.(1081-1083)gaG>gaC	p.E361D	DDR2_ENST00000367921.3_Missense_Mutation_p.E361D	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	361					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TGTTCAGTGAGATCACCTTCC	0.517																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													97.0	78.0	85.0					1																	162731228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1083G>C	1.37:g.162731228G>C	ENSP00000356899:p.Glu361Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E361D	ENST00000367922.3	37	c.1083	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055142	0.75960	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	T;T	0.57273	0.41;0.41	5.89	2.99	0.34606	.	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	M	0.89968	3.075	0.36433	D	0.865004	D	0.89917	1.0	D	0.74348	0.983	T	0.74166	-0.3753	9	0.72032	D	0.01	.	10.6364	0.45567	0.2139:0.0:0.7861:0.0	.	361	Q16832	DDR2_HUMAN	D	361	ENSP00000356899:E361D;ENSP00000356898:E361D	ENSP00000356898:E361D	E	+	3	2	DDR2	160997852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.866000	0.48420	0.812000	0.34326	0.655000	0.94253	GAG	DDR2	-	NULL	ENSG00000162733		0.517	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	129	0.00	0	G	NM_006182		162731228	162731228	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	missense	183	17.94	40	SNP	1.000	C
DDX49	54555	genome.wustl.edu	37	19	19031392	19031392	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr19:19031392G>A	ENST00000247003.4	+	2	186	c.119G>A	c.(118-120)cGa>cAa	p.R40Q	COPE_ENST00000351079.4_5'Flank|DDX49_ENST00000438170.2_5'UTR|COPE_ENST00000600932.1_5'Flank|COPE_ENST00000349893.4_5'Flank|COPE_ENST00000262812.4_5'Flank|AC002985.3_ENST00000596918.1_Intron	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	40	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			AACCCAGGTCGAGACTGCTTG	0.567																																						dbGAP											0													183.0	138.0	153.0					19																	19031392		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.119G>A	19.37:g.19031392G>A	ENSP00000247003:p.Arg40Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R40Q	ENST00000247003.4	37	c.119	CCDS12390.1	19	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794764	0.31777	.	.	ENSG00000105671	ENST00000247003	T	0.15603	2.41	5.22	4.18	0.49190	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.058897	0.64402	D	0.000001	T	0.14270	0.0345	L	0.48935	1.535	0.80722	D	1	B	0.33964	0.434	B	0.26094	0.066	T	0.04565	-1.0942	10	0.37606	T	0.19	-25.6874	11.6116	0.51062	0.0881:0.0:0.9119:0.0	.	40	Q9Y6V7	DDX49_HUMAN	Q	40	ENSP00000247003:R40Q	ENSP00000247003:R40Q	R	+	2	0	DDX49	18892392	1.000000	0.71417	1.000000	0.80357	0.249000	0.25844	6.116000	0.71571	1.197000	0.43143	-0.258000	0.10820	CGA	DDX49	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000105671		0.567	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX49	HGNC	protein_coding	OTTHUMT00000464593.1	24	0.00	0	G	NM_019070		19031392	19031392	+1	no_errors	ENST00000247003	ensembl	human	known	69_37n	missense	18	29.63	8	SNP	1.000	A
DDX49	54555	genome.wustl.edu	37	19	19031392	19031392	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr19:19031392G>A	ENST00000247003.4	+	2	186	c.119G>A	c.(118-120)cGa>cAa	p.R40Q	COPE_ENST00000351079.4_5'Flank|DDX49_ENST00000438170.2_5'UTR|COPE_ENST00000600932.1_5'Flank|COPE_ENST00000349893.4_5'Flank|COPE_ENST00000262812.4_5'Flank|AC002985.3_ENST00000596918.1_Intron	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	40	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			AACCCAGGTCGAGACTGCTTG	0.567																																						dbGAP											0													183.0	138.0	153.0					19																	19031392		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.119G>A	19.37:g.19031392G>A	ENSP00000247003:p.Arg40Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R40Q	ENST00000247003.4	37	c.119	CCDS12390.1	19	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794764	0.31777	.	.	ENSG00000105671	ENST00000247003	T	0.15603	2.41	5.22	4.18	0.49190	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.058897	0.64402	D	0.000001	T	0.14270	0.0345	L	0.48935	1.535	0.80722	D	1	B	0.33964	0.434	B	0.26094	0.066	T	0.04565	-1.0942	10	0.37606	T	0.19	-25.6874	11.6116	0.51062	0.0881:0.0:0.9119:0.0	.	40	Q9Y6V7	DDX49_HUMAN	Q	40	ENSP00000247003:R40Q	ENSP00000247003:R40Q	R	+	2	0	DDX49	18892392	1.000000	0.71417	1.000000	0.80357	0.249000	0.25844	6.116000	0.71571	1.197000	0.43143	-0.258000	0.10820	CGA	DDX49	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000105671		0.567	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX49	HGNC	protein_coding	OTTHUMT00000464593.1	52	0.00	0	G	NM_019070		19031392	19031392	+1	no_errors	ENST00000247003	ensembl	human	known	69_37n	missense	18	29.63	8	SNP	1.000	A
DGKG	1608	genome.wustl.edu	37	3	185985540	185985540	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr3:185985540C>T	ENST00000265022.3	-	13	1682	c.1143G>A	c.(1141-1143)acG>acA	p.T381T	DGKG_ENST00000544847.1_Silent_p.T342T|DGKG_ENST00000382164.4_Silent_p.T342T|DGKG_ENST00000344484.4_Silent_p.T381T	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	381					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CGTCACACAACGTTGATAATT	0.507																																						dbGAP											0													116.0	112.0	113.0					3																	185985540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1143G>A	3.37:g.185985540C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.T381	ENST00000265022.3	37	c.1143	CCDS3274.1	3																																																																																			DGKG	-	smart_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000058866		0.507	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	HGNC	protein_coding	OTTHUMT00000344800.3	106	0.00	0	C			185985540	185985540	-1	no_errors	ENST00000265022	ensembl	human	known	69_37n	silent	69	29.29	29	SNP	0.005	T
DGKG	1608	genome.wustl.edu	37	3	185985540	185985540	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr3:185985540C>T	ENST00000265022.3	-	13	1682	c.1143G>A	c.(1141-1143)acG>acA	p.T381T	DGKG_ENST00000544847.1_Silent_p.T342T|DGKG_ENST00000382164.4_Silent_p.T342T|DGKG_ENST00000344484.4_Silent_p.T381T	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	381					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CGTCACACAACGTTGATAATT	0.507																																						dbGAP											0													116.0	112.0	113.0					3																	185985540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1143G>A	3.37:g.185985540C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.T381	ENST00000265022.3	37	c.1143	CCDS3274.1	3																																																																																			DGKG	-	smart_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000058866		0.507	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	HGNC	protein_coding	OTTHUMT00000344800.3	123	0.81	1	C			185985540	185985540	-1	no_errors	ENST00000265022	ensembl	human	known	69_37n	silent	69	29.29	29	SNP	0.005	T
ESYT2	57488	genome.wustl.edu	37	7	158552764	158552764	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr7:158552764C>T	ENST00000251527.5	-	12	1517	c.1452G>A	c.(1450-1452)gcG>gcA	p.A484A		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	512					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)	p.A484A(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						CGAGGTTTGACGCATTTGGCA	0.458																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											169.0	137.0	148.0					7																	158552764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1452G>A	7.37:g.158552764C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A484	ENST00000251527.5	37	c.1452	CCDS34791.1	7																																																																																			ESYT2	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000117868		0.458	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT2	HGNC	protein_coding	OTTHUMT00000322647.1	107	0.00	0	C	NM_020728		158552764	158552764	-1	no_errors	ENST00000251527	ensembl	human	known	69_37n	silent	108	28.95	44	SNP	0.000	T
ESYT2	57488	genome.wustl.edu	37	7	158552764	158552764	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr7:158552764C>T	ENST00000251527.5	-	12	1517	c.1452G>A	c.(1450-1452)gcG>gcA	p.A484A		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	512					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)	p.A484A(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						CGAGGTTTGACGCATTTGGCA	0.458																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											169.0	137.0	148.0					7																	158552764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1452G>A	7.37:g.158552764C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A484	ENST00000251527.5	37	c.1452	CCDS34791.1	7																																																																																			ESYT2	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000117868		0.458	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT2	HGNC	protein_coding	OTTHUMT00000322647.1	140	0.00	0	C	NM_020728		158552764	158552764	-1	no_errors	ENST00000251527	ensembl	human	known	69_37n	silent	108	28.95	44	SNP	0.000	T
HOXD11	3237	genome.wustl.edu	37	2	176973637	176973638	+	Frame_Shift_Ins	INS	-	-	C	rs369831126		TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr2:176973637_176973638insC	ENST00000249504.5	+	2	854_855	c.784_785insC	c.(784-786)gccfs	p.A262fs	AC009336.1_ENST00000401374.2_RNA|HOXD10_ENST00000490088.2_3'UTR|HOXD11_ENST00000498438.1_3'UTR	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11	262					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)							OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		CCTTGCAGTTGCCCCCCAGCGG	0.619			T	NUP98	AML																																	dbGAP		Dom	yes		2	2q31-q32	3237	homeo box D11		L	0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	ENST00000249504.5:c.790dupC	2.37:g.176973643_176973643dupC	ENSP00000249504:p.Ala262fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIS4|Q9NS02	Frame_Shift_Ins	INS	pfam_DUF3528,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.Q264fs	ENST00000249504.5	37	c.784_785	CCDS2265.1	2																																																																																			HOXD11	-	superfamily_Homeodomain-like,pfscan_Homeodomain	ENSG00000128713		0.619	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXD11	HGNC	protein_coding	OTTHUMT00000359250.2	101	0.00	0	-			176973637	176973638	+1	no_errors	ENST00000249504	ensembl	human	known	69_37n	frame_shift_ins	40	11.11	5	INS	0.999:1.000	C
HRNR	388697	genome.wustl.edu	37	1	152186699	152186699	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr1:152186699T>A	ENST00000368801.2	-	3	7481	c.7406A>T	c.(7405-7407)cAg>cTg	p.Q2469L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2469					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGAGGACTGTCCTGAGCG	0.557																																						dbGAP											0													1.0	1.0	1.0					1																	152186699		226	649	875	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7406A>T	1.37:g.152186699T>A	ENSP00000357791:p.Gln2469Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.Q2469L	ENST00000368801.2	37	c.7406	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	-	7.119	0.577571	0.13686	.	.	ENSG00000197915	ENST00000368801	T	0.01629	4.72	3.61	1.18	0.20946	.	.	.	.	.	T	0.00608	0.0020	L	0.43152	1.355	0.09310	N	1	P	0.47409	0.895	B	0.43838	0.433	T	0.36089	-0.9762	9	0.08599	T	0.76	.	6.706	0.23250	0.0:0.2023:0.0:0.7977	.	2469	Q86YZ3	HORN_HUMAN	L	2469	ENSP00000357791:Q2469L	ENSP00000357791:Q2469L	Q	-	2	0	HRNR	150453323	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	1.092000	0.30927	0.123000	0.18342	0.529000	0.55759	CAG	HRNR	-	NULL	ENSG00000197915		0.557	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	32	0.00	0	T	XM_373868		152186699	152186699	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.000	A
IL24	11009	genome.wustl.edu	37	1	207076353	207076354	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr1:207076353_207076354insG	ENST00000294984.2	+	7	844_845	c.570_571insG	c.(571-573)gggfs	p.G191fs	IL24_ENST00000367093.3_Frame_Shift_Ins_p.G139fs|IL24_ENST00000491169.1_3'UTR|IL24_ENST00000391929.3_Frame_Shift_Ins_p.G192fs|FAIM3_ENST00000528654.1_5'Flank	NM_001185156.1|NM_006850.3	NP_001172085.1|NP_006841.1	Q13007	IL24_HUMAN	interleukin 24	191					apoptotic process (GO:0006915)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|serine phosphorylation of STAT3 protein (GO:0033136)|wound healing (GO:0042060)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)		p.G191R(1)		endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12	Breast(84;0.201)					CCAAAGCCCTTGGGGAAGTGGA	0.495																																						dbGAP											1	Substitution - Missense(1)	lung(1)																																								-	-	-	SO:0001589	frameshift_variant	0			U16261	CCDS1471.1, CCDS53465.1, CCDS53466.1, CCDS73021.1	1q32	2011-07-15		2001-06-29	ENSG00000162892	ENSG00000162892		"""Interleukins and interleukin receptors"""	11346	protein-coding gene	gene with protein product	"""melanoma differentiation association protein 7"", ""suppression of tumorigenicity 16 (melanoma differentiation)"", ""IL-4-induced secreted protein"""	604136		ST16		8545104, 8799171	Standard	NM_001185156		Approved	mda-7, IL10B, Mob-5, C49A, FISP, IL-24	uc001heu.2	Q13007	OTTHUMG00000036459	ENST00000294984.2:c.574dupG	1.37:g.207076357_207076357dupG	ENSP00000294984:p.Gly191fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YHE5|Q53XZ7|Q5YLN8|Q96DB0|Q96KG4	Frame_Shift_Ins	INS	superfamily_4_helix_cytokine-like_core,prints_Interleukin-24	p.E191fs	ENST00000294984.2	37	c.570_571	CCDS1471.1	1																																																																																			IL24	-	superfamily_4_helix_cytokine-like_core,prints_Interleukin-24	ENSG00000162892		0.495	IL24-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL24	HGNC	protein_coding	OTTHUMT00000088680.2	93	0.00	0	-	NM_006850		207076353	207076354	+1	no_errors	ENST00000294984	ensembl	human	known	69_37n	frame_shift_ins	184	11.11	23	INS	0.996:1.000	G
IL24	11009	genome.wustl.edu	37	1	207076353	207076354	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr1:207076353_207076354insG	ENST00000294984.2	+	7	844_845	c.570_571insG	c.(571-573)gggfs	p.G191fs	IL24_ENST00000367093.3_Frame_Shift_Ins_p.G139fs|IL24_ENST00000491169.1_3'UTR|IL24_ENST00000391929.3_Frame_Shift_Ins_p.G192fs|FAIM3_ENST00000528654.1_5'Flank	NM_001185156.1|NM_006850.3	NP_001172085.1|NP_006841.1	Q13007	IL24_HUMAN	interleukin 24	191					apoptotic process (GO:0006915)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|serine phosphorylation of STAT3 protein (GO:0033136)|wound healing (GO:0042060)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)		p.G191R(1)		endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12	Breast(84;0.201)					CCAAAGCCCTTGGGGAAGTGGA	0.495																																						dbGAP											1	Substitution - Missense(1)	lung(1)																																								-	-	-	SO:0001589	frameshift_variant	0			U16261	CCDS1471.1, CCDS53465.1, CCDS53466.1, CCDS73021.1	1q32	2011-07-15		2001-06-29	ENSG00000162892	ENSG00000162892		"""Interleukins and interleukin receptors"""	11346	protein-coding gene	gene with protein product	"""melanoma differentiation association protein 7"", ""suppression of tumorigenicity 16 (melanoma differentiation)"", ""IL-4-induced secreted protein"""	604136		ST16		8545104, 8799171	Standard	NM_001185156		Approved	mda-7, IL10B, Mob-5, C49A, FISP, IL-24	uc001heu.2	Q13007	OTTHUMG00000036459	ENST00000294984.2:c.574dupG	1.37:g.207076357_207076357dupG	ENSP00000294984:p.Gly191fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YHE5|Q53XZ7|Q5YLN8|Q96DB0|Q96KG4	Frame_Shift_Ins	INS	superfamily_4_helix_cytokine-like_core,prints_Interleukin-24	p.E191fs	ENST00000294984.2	37	c.570_571	CCDS1471.1	1																																																																																			IL24	-	superfamily_4_helix_cytokine-like_core,prints_Interleukin-24	ENSG00000162892		0.495	IL24-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL24	HGNC	protein_coding	OTTHUMT00000088680.2	243	0.00	0	-	NM_006850		207076353	207076354	+1	no_errors	ENST00000294984	ensembl	human	known	69_37n	frame_shift_ins	184	11.11	23	INS	0.996:1.000	G
ISM2	145501	genome.wustl.edu	37	14	77948868	77948868	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr14:77948868T>C	ENST00000342219.4	-	4	826	c.770A>G	c.(769-771)gAa>gGa	p.E257G	ISM2_ENST00000393684.3_Missense_Mutation_p.E169G|ISM2_ENST00000493585.1_Intron|ISM2_ENST00000412904.1_Missense_Mutation_p.E176G|ISM2_ENST00000429906.1_Missense_Mutation_p.E176G	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	257						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						CCTGTCTTTTTCCTCTCCTTT	0.572																																						dbGAP											0													107.0	97.0	100.0					14																	77948868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.770A>G	14.37:g.77948868T>C	ENSP00000341490:p.Glu257Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Missense_Mutation	SNP	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.E257G	ENST00000342219.4	37	c.770	CCDS9864.1	14	.	.	.	.	.	.	.	.	.	.	T	9.411	1.080491	0.20309	.	.	ENSG00000100593	ENST00000342219;ENST00000412904;ENST00000429906;ENST00000393684;ENST00000554801	T;T;T;T	0.27104	1.69;1.73;1.74;2.04	4.98	3.84	0.44239	.	0.777813	0.11564	N	0.551403	T	0.20251	0.0487	L	0.36672	1.1	0.22610	N	0.998937	B;B	0.15930	0.015;0.004	B;B	0.13407	0.009;0.008	T	0.20840	-1.0263	10	0.42905	T	0.14	-6.7201	7.2076	0.25915	0.0:0.1786:0.0:0.8214	.	176;257	Q6H9L7-5;Q6H9L7	.;ISM2_HUMAN	G	257;176;176;169;176	ENSP00000341490:E257G;ENSP00000416773:E176G;ENSP00000395387:E176G;ENSP00000377289:E169G	ENSP00000341490:E257G	E	-	2	0	ISM2	77018621	1.000000	0.71417	0.001000	0.08648	0.006000	0.05464	2.461000	0.45040	0.759000	0.33084	0.379000	0.24179	GAA	ISM2	-	NULL	ENSG00000100593		0.572	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ISM2	HGNC	protein_coding	OTTHUMT00000351309.1	61	0.00	0	T	NM_182509		77948868	77948868	-1	no_errors	ENST00000342219	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.964	C
ISM2	145501	genome.wustl.edu	37	14	77948868	77948868	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr14:77948868T>C	ENST00000342219.4	-	4	826	c.770A>G	c.(769-771)gAa>gGa	p.E257G	ISM2_ENST00000393684.3_Missense_Mutation_p.E169G|ISM2_ENST00000493585.1_Intron|ISM2_ENST00000412904.1_Missense_Mutation_p.E176G|ISM2_ENST00000429906.1_Missense_Mutation_p.E176G	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	257						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						CCTGTCTTTTTCCTCTCCTTT	0.572																																						dbGAP											0													107.0	97.0	100.0					14																	77948868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.770A>G	14.37:g.77948868T>C	ENSP00000341490:p.Glu257Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Missense_Mutation	SNP	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.E257G	ENST00000342219.4	37	c.770	CCDS9864.1	14	.	.	.	.	.	.	.	.	.	.	T	9.411	1.080491	0.20309	.	.	ENSG00000100593	ENST00000342219;ENST00000412904;ENST00000429906;ENST00000393684;ENST00000554801	T;T;T;T	0.27104	1.69;1.73;1.74;2.04	4.98	3.84	0.44239	.	0.777813	0.11564	N	0.551403	T	0.20251	0.0487	L	0.36672	1.1	0.22610	N	0.998937	B;B	0.15930	0.015;0.004	B;B	0.13407	0.009;0.008	T	0.20840	-1.0263	10	0.42905	T	0.14	-6.7201	7.2076	0.25915	0.0:0.1786:0.0:0.8214	.	176;257	Q6H9L7-5;Q6H9L7	.;ISM2_HUMAN	G	257;176;176;169;176	ENSP00000341490:E257G;ENSP00000416773:E176G;ENSP00000395387:E176G;ENSP00000377289:E169G	ENSP00000341490:E257G	E	-	2	0	ISM2	77018621	1.000000	0.71417	0.001000	0.08648	0.006000	0.05464	2.461000	0.45040	0.759000	0.33084	0.379000	0.24179	GAA	ISM2	-	NULL	ENSG00000100593		0.572	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ISM2	HGNC	protein_coding	OTTHUMT00000351309.1	69	0.00	0	T	NM_182509		77948868	77948868	-1	no_errors	ENST00000342219	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.964	C
ITGA11	22801	genome.wustl.edu	37	15	68631959	68631959	+	Silent	SNP	G	G	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr15:68631959G>T	ENST00000315757.7	-	11	1241	c.1155C>A	c.(1153-1155)gtC>gtA	p.V385V	ITGA11_ENST00000423218.2_Silent_p.V385V	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	385					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						CATAGGCACCGACGGCTCCCA	0.592																																						dbGAP											0													66.0	72.0	70.0					15																	68631959		2042	4189	6231	-	-	-	SO:0001819	synonymous_variant	0			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1155C>A	15.37:g.68631959G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQM2|Q8WYI8|Q9UKQ1	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.V385	ENST00000315757.7	37	c.1155	CCDS45291.1	15																																																																																			ITGA11	-	NULL	ENSG00000137809		0.592	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		50	0.00	0	G	NM_012211		68631959	68631959	-1	no_errors	ENST00000315757	ensembl	human	known	69_37n	silent	22	33.33	11	SNP	0.014	T
KRT71	112802	genome.wustl.edu	37	12	52940265	52940265	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr12:52940265G>A	ENST00000267119.5	-	7	1199	c.1130C>T	c.(1129-1131)gCt>gTt	p.A377V		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	377	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		CTCAGCATCAGCGATGGCTGT	0.612																																						dbGAP											0													46.0	46.0	46.0					12																	52940265		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.1130C>T	12.37:g.52940265G>A	ENSP00000267119:p.Ala377Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.A377V	ENST00000267119.5	37	c.1130	CCDS8831.1	12	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665196	0.47677	.	.	ENSG00000139648	ENST00000267119	T	0.76839	-1.05	4.58	3.68	0.42216	Filament (1);	0.000000	0.43260	D	0.000591	D	0.86389	0.5921	M	0.88377	2.95	0.09310	N	1	P	0.51791	0.948	P	0.59643	0.861	T	0.78550	-0.2161	10	0.66056	D	0.02	.	8.8716	0.35320	0.0908:0.2607:0.6485:0.0	.	377	Q3SY84	K2C71_HUMAN	V	377	ENSP00000267119:A377V	ENSP00000267119:A377V	A	-	2	0	KRT71	51226532	0.835000	0.29415	0.071000	0.20095	0.430000	0.31655	4.519000	0.60517	1.233000	0.43693	0.561000	0.74099	GCT	KRT71	-	pfam_F,superfamily_Prefoldin	ENSG00000139648		0.612	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT71	HGNC	protein_coding	OTTHUMT00000396487.1	43	0.00	0	G	NM_033448		52940265	52940265	-1	no_errors	ENST00000267119	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	0.026	A
KRT71	112802	genome.wustl.edu	37	12	52940265	52940265	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr12:52940265G>A	ENST00000267119.5	-	7	1199	c.1130C>T	c.(1129-1131)gCt>gTt	p.A377V		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	377	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		CTCAGCATCAGCGATGGCTGT	0.612																																						dbGAP											0													46.0	46.0	46.0					12																	52940265		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.1130C>T	12.37:g.52940265G>A	ENSP00000267119:p.Ala377Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.A377V	ENST00000267119.5	37	c.1130	CCDS8831.1	12	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665196	0.47677	.	.	ENSG00000139648	ENST00000267119	T	0.76839	-1.05	4.58	3.68	0.42216	Filament (1);	0.000000	0.43260	D	0.000591	D	0.86389	0.5921	M	0.88377	2.95	0.09310	N	1	P	0.51791	0.948	P	0.59643	0.861	T	0.78550	-0.2161	10	0.66056	D	0.02	.	8.8716	0.35320	0.0908:0.2607:0.6485:0.0	.	377	Q3SY84	K2C71_HUMAN	V	377	ENSP00000267119:A377V	ENSP00000267119:A377V	A	-	2	0	KRT71	51226532	0.835000	0.29415	0.071000	0.20095	0.430000	0.31655	4.519000	0.60517	1.233000	0.43693	0.561000	0.74099	GCT	KRT71	-	pfam_F,superfamily_Prefoldin	ENSG00000139648		0.612	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT71	HGNC	protein_coding	OTTHUMT00000396487.1	162	0.00	0	G	NM_033448		52940265	52940265	-1	no_errors	ENST00000267119	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	0.026	A
MAPK3	5595	genome.wustl.edu	37	16	30129759	30129759	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr16:30129759G>A	ENST00000263025.4	-	3	538	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W	MAPK3_ENST00000322266.5_Missense_Mutation_p.R152W|MAPK3_ENST00000403394.1_Missense_Mutation_p.R152W|MAPK3_ENST00000395202.1_Missense_Mutation_p.R152W|MAPK3_ENST00000494643.1_5'Flank|MAPK3_ENST00000395200.1_Missense_Mutation_p.R123W|MAPK3_ENST00000395199.3_Missense_Mutation_p.R152W|MAPK3_ENST00000484663.1_Missense_Mutation_p.R38W	NM_002746.2	NP_002737.2	P27361	MK03_HUMAN	mitogen-activated protein kinase 3	152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage induced protein phosphorylation (GO:0006975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-1-mediated signaling pathway (GO:0070498)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apolipoprotein binding (GO:2000657)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to exogenous dsRNA (GO:0043330)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)									Arsenic trioxide(DB01169)|Sulindac(DB00605)	TTGAGGCCCCGCAGGATCTGG	0.532																																						dbGAP											0													160.0	133.0	142.0					16																	30129759		2197	4300	6497	-	-	-	SO:0001583	missense	0			M84490	CCDS10672.1, CCDS42148.1, CCDS42149.1	16p11.2	2011-06-10			ENSG00000102882	ENSG00000102882	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6877	protein-coding gene	gene with protein product		601795		PRKM3		9628824	Standard	NM_001109891		Approved	ERK1, p44mapk, p44erk1	uc002dws.3	P27361	OTTHUMG00000132149	ENST00000263025.4:c.454C>T	16.37:g.30129759G>A	ENSP00000263025:p.Arg152Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8CZ58|B0LPG3|Q8NHX1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.R152W	ENST00000263025.4	37	c.454	CCDS10672.1	16	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883095	0.91740	.	.	ENSG00000102882	ENST00000263025;ENST00000484663;ENST00000322266;ENST00000403394;ENST00000395200;ENST00000395202;ENST00000395199	T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85695	0.5756	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.88685	0.3205	10	0.87932	D	0	2.5691	13.5499	0.61726	0.0:0.0:0.844:0.156	.	152;152;152	P27361-2;P27361-3;P27361	.;.;MK03_HUMAN	W	152;38;152;152;123;152;152	ENSP00000263025:R152W;ENSP00000432742:R38W;ENSP00000327293:R152W;ENSP00000384895:R152W;ENSP00000378626:R123W;ENSP00000378628:R152W;ENSP00000378625:R152W	ENSP00000263025:R152W	R	-	1	2	MAPK3	30037260	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.695000	0.54749	2.688000	0.91661	0.563000	0.77884	CGG	MAPK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000102882		0.532	MAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK3	HGNC	protein_coding	OTTHUMT00000255196.2	52	0.00	0	G			30129759	30129759	-1	no_errors	ENST00000263025	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	A
MAPK3	5595	genome.wustl.edu	37	16	30129759	30129759	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr16:30129759G>A	ENST00000263025.4	-	3	538	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W	MAPK3_ENST00000322266.5_Missense_Mutation_p.R152W|MAPK3_ENST00000403394.1_Missense_Mutation_p.R152W|MAPK3_ENST00000395202.1_Missense_Mutation_p.R152W|MAPK3_ENST00000494643.1_5'Flank|MAPK3_ENST00000395200.1_Missense_Mutation_p.R123W|MAPK3_ENST00000395199.3_Missense_Mutation_p.R152W|MAPK3_ENST00000484663.1_Missense_Mutation_p.R38W	NM_002746.2	NP_002737.2	P27361	MK03_HUMAN	mitogen-activated protein kinase 3	152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage induced protein phosphorylation (GO:0006975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-1-mediated signaling pathway (GO:0070498)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apolipoprotein binding (GO:2000657)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to exogenous dsRNA (GO:0043330)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)									Arsenic trioxide(DB01169)|Sulindac(DB00605)	TTGAGGCCCCGCAGGATCTGG	0.532																																						dbGAP											0													160.0	133.0	142.0					16																	30129759		2197	4300	6497	-	-	-	SO:0001583	missense	0			M84490	CCDS10672.1, CCDS42148.1, CCDS42149.1	16p11.2	2011-06-10			ENSG00000102882	ENSG00000102882	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6877	protein-coding gene	gene with protein product		601795		PRKM3		9628824	Standard	NM_001109891		Approved	ERK1, p44mapk, p44erk1	uc002dws.3	P27361	OTTHUMG00000132149	ENST00000263025.4:c.454C>T	16.37:g.30129759G>A	ENSP00000263025:p.Arg152Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8CZ58|B0LPG3|Q8NHX1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.R152W	ENST00000263025.4	37	c.454	CCDS10672.1	16	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883095	0.91740	.	.	ENSG00000102882	ENST00000263025;ENST00000484663;ENST00000322266;ENST00000403394;ENST00000395200;ENST00000395202;ENST00000395199	T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85695	0.5756	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.88685	0.3205	10	0.87932	D	0	2.5691	13.5499	0.61726	0.0:0.0:0.844:0.156	.	152;152;152	P27361-2;P27361-3;P27361	.;.;MK03_HUMAN	W	152;38;152;152;123;152;152	ENSP00000263025:R152W;ENSP00000432742:R38W;ENSP00000327293:R152W;ENSP00000384895:R152W;ENSP00000378626:R123W;ENSP00000378628:R152W;ENSP00000378625:R152W	ENSP00000263025:R152W	R	-	1	2	MAPK3	30037260	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.695000	0.54749	2.688000	0.91661	0.563000	0.77884	CGG	MAPK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000102882		0.532	MAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK3	HGNC	protein_coding	OTTHUMT00000255196.2	90	0.00	0	G			30129759	30129759	-1	no_errors	ENST00000263025	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	A
MTHFD1L	25902	genome.wustl.edu	37	6	151247259	151247259	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr6:151247259G>A	ENST00000367321.3	+	11	1358	c.1084G>A	c.(1084-1086)Gac>Aac	p.D362N		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	362	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TCCCCTCAGTGACATTGAGAT	0.433																																						dbGAP											0													104.0	99.0	101.0					6																	151247259		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1083-1G>A	6.37:g.151247259G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.D362N	ENST00000367321.3	37	c.1084	CCDS5228.1	6	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969228	0.92855	.	.	ENSG00000120254	ENST00000367321;ENST00000441122	T;T	0.32753	1.44;1.44	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.67674	0.2918	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.77368	-0.2614	10	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	363;117;362	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	N	362;33	ENSP00000356290:D362N;ENSP00000407070:D33N	ENSP00000356290:D362N	D	+	1	0	MTHFD1L	151288952	1.000000	0.71417	0.958000	0.39756	0.643000	0.38383	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	GAC	MTHFD1L	-	pfam_Formate_THF_ligase	ENSG00000120254		0.433	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	HGNC	protein_coding	OTTHUMT00000042699.1	115	0.00	0	G	NM_015440	Missense_Mutation	151247259	151247259	+1	no_errors	ENST00000367321	ensembl	human	known	69_37n	missense	112	27.27	42	SNP	1.000	A
MTHFD1L	25902	genome.wustl.edu	37	6	151247259	151247259	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr6:151247259G>A	ENST00000367321.3	+	11	1358	c.1084G>A	c.(1084-1086)Gac>Aac	p.D362N		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	362	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TCCCCTCAGTGACATTGAGAT	0.433																																						dbGAP											0													104.0	99.0	101.0					6																	151247259		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1083-1G>A	6.37:g.151247259G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.D362N	ENST00000367321.3	37	c.1084	CCDS5228.1	6	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969228	0.92855	.	.	ENSG00000120254	ENST00000367321;ENST00000441122	T;T	0.32753	1.44;1.44	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.67674	0.2918	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.77368	-0.2614	10	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	363;117;362	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	N	362;33	ENSP00000356290:D362N;ENSP00000407070:D33N	ENSP00000356290:D362N	D	+	1	0	MTHFD1L	151288952	1.000000	0.71417	0.958000	0.39756	0.643000	0.38383	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	GAC	MTHFD1L	-	pfam_Formate_THF_ligase	ENSG00000120254		0.433	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	HGNC	protein_coding	OTTHUMT00000042699.1	240	0.00	0	G	NM_015440	Missense_Mutation	151247259	151247259	+1	no_errors	ENST00000367321	ensembl	human	known	69_37n	missense	112	27.27	42	SNP	1.000	A
NCAPD2	9918	genome.wustl.edu	37	12	6630248	6630248	+	Silent	SNP	C	C	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr12:6630248C>G	ENST00000315579.5	+	14	2485	c.1686C>G	c.(1684-1686)ctC>ctG	p.L562L	NCAPD2_ENST00000545962.1_Silent_p.L517L	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	562	Interactions with SMC2 and SMC4.				mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						AGACCAGGCTCTTGAATATCT	0.428																																						dbGAP											0													77.0	74.0	75.0					12																	6630248		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.1686C>G	12.37:g.6630248C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUR4|Q8N6U3	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	p.L562	ENST00000315579.5	37	c.1686	CCDS8548.1	12																																																																																			NCAPD2	-	superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	ENSG00000010292		0.428	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD2	HGNC	protein_coding	OTTHUMT00000399964.1	66	0.00	0	C	NM_014865		6630248	6630248	+1	no_errors	ENST00000315579	ensembl	human	known	69_37n	silent	48	26.15	17	SNP	0.649	G
NCAPD2	9918	genome.wustl.edu	37	12	6630248	6630248	+	Silent	SNP	C	C	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr12:6630248C>G	ENST00000315579.5	+	14	2485	c.1686C>G	c.(1684-1686)ctC>ctG	p.L562L	NCAPD2_ENST00000545962.1_Silent_p.L517L	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	562	Interactions with SMC2 and SMC4.				mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						AGACCAGGCTCTTGAATATCT	0.428																																						dbGAP											0													77.0	74.0	75.0					12																	6630248		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.1686C>G	12.37:g.6630248C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUR4|Q8N6U3	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	p.L562	ENST00000315579.5	37	c.1686	CCDS8548.1	12																																																																																			NCAPD2	-	superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	ENSG00000010292		0.428	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD2	HGNC	protein_coding	OTTHUMT00000399964.1	80	0.00	0	C	NM_014865		6630248	6630248	+1	no_errors	ENST00000315579	ensembl	human	known	69_37n	silent	48	26.15	17	SNP	0.649	G
OR8H2	390151	genome.wustl.edu	37	11	55872938	55872938	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr11:55872938C>T	ENST00000313503.1	+	1	420	c.420C>T	c.(418-420)ctC>ctT	p.L140L		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CCAAAAGGCTCTGCCTCGCTC	0.463										HNSCC(53;0.14)																												dbGAP											0													211.0	192.0	198.0					11																	55872938		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.420C>T	11.37:g.55872938C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFC1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L140	ENST00000313503.1	37	c.420	CCDS31518.1	11																																																																																			OR8H2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000181767		0.463	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H2	HGNC	protein_coding	OTTHUMT00000391540.1	258	0.00	0	C	NM_001005200		55872938	55872938	+1	no_errors	ENST00000313503	ensembl	human	known	69_37n	silent	327	32.16	155	SNP	0.000	T
OR8H2	390151	genome.wustl.edu	37	11	55872938	55872938	+	Silent	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr11:55872938C>T	ENST00000313503.1	+	1	420	c.420C>T	c.(418-420)ctC>ctT	p.L140L		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CCAAAAGGCTCTGCCTCGCTC	0.463										HNSCC(53;0.14)																												dbGAP											0													211.0	192.0	198.0					11																	55872938		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.420C>T	11.37:g.55872938C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFC1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L140	ENST00000313503.1	37	c.420	CCDS31518.1	11																																																																																			OR8H2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000181767		0.463	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H2	HGNC	protein_coding	OTTHUMT00000391540.1	584	0.00	0	C	NM_001005200		55872938	55872938	+1	no_errors	ENST00000313503	ensembl	human	known	69_37n	silent	327	32.16	155	SNP	0.000	T
OSCP1	127700	genome.wustl.edu	37	1	36915874	36915874	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr1:36915874C>G	ENST00000356637.5	-	1	160	c.97G>C	c.(97-99)Gac>Cac	p.D33H	OSCP1_ENST00000235532.5_Missense_Mutation_p.D33H|OSCP1_ENST00000354267.3_Missense_Mutation_p.D33H|OSCP1_ENST00000315643.9_Missense_Mutation_p.D33H			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1	33					transport (GO:0006810)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						CGGGCCTTGTCTCCCGGGATG	0.662											OREG0013369	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													36.0	40.0	39.0					1																	36915874		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.97G>C	1.37:g.36915874C>G	ENSP00000349052:p.Asp33His	Somatic	866	WXS	Illumina GAIIx	Phase_IV	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Missense_Mutation	SNP	pfam_OSCP1	p.D33H	ENST00000356637.5	37	c.97		1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698037	0.88830	.	.	ENSG00000116885	ENST00000235532;ENST00000356637;ENST00000445843;ENST00000315643;ENST00000354267	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	4.56	4.56	0.56223	.	0.051252	0.85682	D	0.000000	T	0.57858	0.2082	M	0.80982	2.52	0.80722	D	1	D;D;D	0.69078	0.997;0.993;0.995	D;D;D	0.71184	0.937;0.952;0.972	T	0.65611	-0.6126	10	0.87932	D	0	.	16.6927	0.85326	0.0:1.0:0.0:0.0	.	33;33;33	Q8WVF1-4;Q8WVF1-3;Q8WVF1	.;.;OSCP1_HUMAN	H	33;33;3;33;33	ENSP00000235532:D33H;ENSP00000349052:D33H;ENSP00000396417:D3H;ENSP00000314541:D33H;ENSP00000346216:D33H	ENSP00000235532:D33H	D	-	1	0	OSCP1	36688461	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.822000	0.75277	2.243000	0.73865	0.655000	0.94253	GAC	OSCP1	-	pfam_OSCP1	ENSG00000116885		0.662	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	OSCP1	HGNC	protein_coding	OTTHUMT00000389759.1	68	0.00	0	C	NM_145047		36915874	36915874	-1	no_errors	ENST00000235532	ensembl	human	known	69_37n	missense	24	39.02	16	SNP	1.000	G
PCNXL2	80003	genome.wustl.edu	37	1	233344363	233344363	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr1:233344363C>G	ENST00000258229.9	-	13	2998	c.2764G>C	c.(2764-2766)Gat>Cat	p.D922H	PCNXL2_ENST00000430153.1_Missense_Mutation_p.D221H|PCNXL2_ENST00000488780.2_Missense_Mutation_p.D55H	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	922						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GCCCCTGTATCAAGAAGCAAA	0.433																																						dbGAP											0													117.0	111.0	113.0					1																	233344363		1907	4129	6036	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2764G>C	1.37:g.233344363C>G	ENSP00000258229:p.Asp922His	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.D922H	ENST00000258229.9	37	c.2764	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853921	0.91355	.	.	ENSG00000135749	ENST00000258229;ENST00000488780;ENST00000518351;ENST00000430153	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.6	4.69	0.59074	.	.	.	.	.	T	0.69904	0.3163	L	0.51422	1.61	0.53688	D	0.999974	D;B	0.64830	0.994;0.033	P;B	0.58210	0.835;0.031	T	0.71852	-0.4467	9	0.52906	T	0.07	.	14.6318	0.68660	0.0:0.93:0.0:0.07	.	221;922	A6NKB5-2;A6NKB5	.;PCX2_HUMAN	H	922;55;91;221	ENSP00000258229:D922H;ENSP00000430820:D55H;ENSP00000429231:D91H;ENSP00000394703:D221H	ENSP00000258229:D922H	D	-	1	0	PCNXL2	231410986	1.000000	0.71417	0.979000	0.43373	0.995000	0.86356	5.737000	0.68606	1.361000	0.45981	0.655000	0.94253	GAT	PCNXL2	-	NULL	ENSG00000135749		0.433	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	90	0.00	0	C	NM_014801		233344363	233344363	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	217	22.22	62	SNP	1.000	G
PCNXL2	80003	genome.wustl.edu	37	1	233344363	233344363	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr1:233344363C>G	ENST00000258229.9	-	13	2998	c.2764G>C	c.(2764-2766)Gat>Cat	p.D922H	PCNXL2_ENST00000430153.1_Missense_Mutation_p.D221H|PCNXL2_ENST00000488780.2_Missense_Mutation_p.D55H	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	922						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GCCCCTGTATCAAGAAGCAAA	0.433																																						dbGAP											0													117.0	111.0	113.0					1																	233344363		1907	4129	6036	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2764G>C	1.37:g.233344363C>G	ENSP00000258229:p.Asp922His	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.D922H	ENST00000258229.9	37	c.2764	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853921	0.91355	.	.	ENSG00000135749	ENST00000258229;ENST00000488780;ENST00000518351;ENST00000430153	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.6	4.69	0.59074	.	.	.	.	.	T	0.69904	0.3163	L	0.51422	1.61	0.53688	D	0.999974	D;B	0.64830	0.994;0.033	P;B	0.58210	0.835;0.031	T	0.71852	-0.4467	9	0.52906	T	0.07	.	14.6318	0.68660	0.0:0.93:0.0:0.07	.	221;922	A6NKB5-2;A6NKB5	.;PCX2_HUMAN	H	922;55;91;221	ENSP00000258229:D922H;ENSP00000430820:D55H;ENSP00000429231:D91H;ENSP00000394703:D221H	ENSP00000258229:D922H	D	-	1	0	PCNXL2	231410986	1.000000	0.71417	0.979000	0.43373	0.995000	0.86356	5.737000	0.68606	1.361000	0.45981	0.655000	0.94253	GAT	PCNXL2	-	NULL	ENSG00000135749		0.433	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	155	0.00	0	C	NM_014801		233344363	233344363	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	217	22.22	62	SNP	1.000	G
PPARGC1A	10891	genome.wustl.edu	37	4	23814725	23814725	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr4:23814725C>T	ENST00000264867.2	-	9	1936	c.1817G>A	c.(1816-1818)aGc>aAc	p.S606N	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	606	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				TCTGTAGTGGCTTGACTCATA	0.502																																					Esophageal Squamous(29;694 744 13796 34866 44181)	dbGAP											0													170.0	162.0	164.0					4																	23814725		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1817G>A	4.37:g.23814725C>T	ENSP00000264867:p.Ser606Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S606N	ENST00000264867.2	37	c.1817	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	C	11.41	1.629309	0.28978	.	.	ENSG00000109819	ENST00000264867	T	0.24908	1.83	5.7	4.86	0.63082	.	0.162027	0.64402	D	0.000002	T	0.22589	0.0545	L	0.41961	1.31	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.03493	-1.1031	10	0.54805	T	0.06	-3.558	10.2514	0.43370	0.0:0.7929:0.1368:0.0703	.	606	Q9UBK2	PRGC1_HUMAN	N	606	ENSP00000264867:S606N	ENSP00000264867:S606N	S	-	2	0	PPARGC1A	23423823	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.383000	0.44354	1.411000	0.46957	-0.150000	0.13652	AGC	PPARGC1A	-	NULL	ENSG00000109819		0.502	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	HGNC	protein_coding	OTTHUMT00000214976.1	156	0.00	0	C	NM_013261		23814725	23814725	-1	no_errors	ENST00000264867	ensembl	human	known	69_37n	missense	159	33.19	79	SNP	1.000	T
PPARGC1A	10891	genome.wustl.edu	37	4	23814725	23814725	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr4:23814725C>T	ENST00000264867.2	-	9	1936	c.1817G>A	c.(1816-1818)aGc>aAc	p.S606N	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	606	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				TCTGTAGTGGCTTGACTCATA	0.502																																					Esophageal Squamous(29;694 744 13796 34866 44181)	dbGAP											0													170.0	162.0	164.0					4																	23814725		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1817G>A	4.37:g.23814725C>T	ENSP00000264867:p.Ser606Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S606N	ENST00000264867.2	37	c.1817	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	C	11.41	1.629309	0.28978	.	.	ENSG00000109819	ENST00000264867	T	0.24908	1.83	5.7	4.86	0.63082	.	0.162027	0.64402	D	0.000002	T	0.22589	0.0545	L	0.41961	1.31	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.03493	-1.1031	10	0.54805	T	0.06	-3.558	10.2514	0.43370	0.0:0.7929:0.1368:0.0703	.	606	Q9UBK2	PRGC1_HUMAN	N	606	ENSP00000264867:S606N	ENSP00000264867:S606N	S	-	2	0	PPARGC1A	23423823	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.383000	0.44354	1.411000	0.46957	-0.150000	0.13652	AGC	PPARGC1A	-	NULL	ENSG00000109819		0.502	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	HGNC	protein_coding	OTTHUMT00000214976.1	310	0.00	0	C	NM_013261		23814725	23814725	-1	no_errors	ENST00000264867	ensembl	human	known	69_37n	missense	159	33.19	79	SNP	1.000	T
SEPT10	151011	genome.wustl.edu	37	2	110301779	110301779	+	3'UTR	SNP	A	A	C	rs200598502	byFrequency	TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr2:110301779A>C	ENST00000397712.2	-	0	1850				SEPT10_ENST00000397714.2_3'UTR|SEPT10_ENST00000356688.4_Missense_Mutation_p.F519V|SEPT10_ENST00000468616.1_5'Flank|SEPT10_ENST00000334001.6_3'UTR	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10						cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						TGTTCACCAAATATAGAAGTG	0.338																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.*107T>G	2.37:g.110301779A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRQ9|Q86VP5|Q9HAH6	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd	p.F519V	ENST00000397712.2	37	c.1555	CCDS46383.1	2	.	.	.	.	.	.	.	.	.	.	A	8.972	0.973228	0.18736	.	.	ENSG00000186522	ENST00000356688	T	0.54279	0.58	5.37	1.66	0.24008	.	1.901300	0.02724	N	0.114273	T	0.40645	0.1125	.	.	.	0.20638	N	0.999879	B	0.06786	0.001	B	0.08055	0.003	T	0.31194	-0.9952	9	0.87932	D	0	.	2.1719	0.03852	0.5923:0.1635:0.0874:0.1567	.	519	B5ME97	.	V	519	ENSP00000349116:F519V	ENSP00000349116:F519V	F	-	1	0	SEPT10	109659068	0.087000	0.21565	0.491000	0.27477	0.028000	0.11728	0.685000	0.25378	0.099000	0.17552	0.482000	0.46254	TTT	SEPT10	-	NULL	ENSG00000186522		0.338	SEPT10-001	KNOWN	basic|CCDS	protein_coding	SEPT10	HGNC	protein_coding	OTTHUMT00000337804.1	26	0.00	0	A	NM_144710		110301779	110301779	-1	no_errors	ENST00000356688	ensembl	human	putative	69_37n	missense	31	34.04	16	SNP	0.348	C
SERPINC1	462	genome.wustl.edu	37	1	173886366	173886366	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr1:173886366G>A	ENST00000367698.3	-	1	150	c.32C>T	c.(31-33)tCt>tTt	p.S11F	SERPINC1_ENST00000494024.1_5'UTR	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	11					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	CCTTTTTCCAGAGGTTACAGT	0.502																																						dbGAP											0													122.0	106.0	112.0					1																	173886366		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.32C>T	1.37:g.173886366G>A	ENSP00000356671:p.Ser11Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.S11F	ENST00000367698.3	37	c.32	CCDS1313.1	1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.712913	0.30413	.	.	ENSG00000117601	ENST00000367698;ENST00000351522	D	0.84800	-1.9	5.17	4.2	0.49525	.	1.151750	0.06099	N	0.664993	T	0.67813	0.2933	N	0.22421	0.69	0.09310	N	1	B	0.28512	0.214	B	0.28784	0.094	T	0.63677	-0.6583	10	0.72032	D	0.01	.	12.5045	0.55973	0.0:0.184:0.816:0.0	.	11	P01008	ANT3_HUMAN	F	11	ENSP00000356671:S11F	ENSP00000307953:S11F	S	-	2	0	SERPINC1	172152989	0.019000	0.18553	0.011000	0.14972	0.009000	0.06853	2.107000	0.41844	2.397000	0.81536	0.313000	0.20887	TCT	SERPINC1	-	NULL	ENSG00000117601		0.502	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINC1	HGNC	protein_coding	OTTHUMT00000090734.1	78	0.00	0	G	NM_000488		173886366	173886366	-1	no_errors	ENST00000367698	ensembl	human	known	69_37n	missense	120	17.24	25	SNP	0.001	A
SERPINC1	462	genome.wustl.edu	37	1	173886366	173886366	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr1:173886366G>A	ENST00000367698.3	-	1	150	c.32C>T	c.(31-33)tCt>tTt	p.S11F	SERPINC1_ENST00000494024.1_5'UTR	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	11					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	CCTTTTTCCAGAGGTTACAGT	0.502																																						dbGAP											0													122.0	106.0	112.0					1																	173886366		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.32C>T	1.37:g.173886366G>A	ENSP00000356671:p.Ser11Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.S11F	ENST00000367698.3	37	c.32	CCDS1313.1	1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.712913	0.30413	.	.	ENSG00000117601	ENST00000367698;ENST00000351522	D	0.84800	-1.9	5.17	4.2	0.49525	.	1.151750	0.06099	N	0.664993	T	0.67813	0.2933	N	0.22421	0.69	0.09310	N	1	B	0.28512	0.214	B	0.28784	0.094	T	0.63677	-0.6583	10	0.72032	D	0.01	.	12.5045	0.55973	0.0:0.184:0.816:0.0	.	11	P01008	ANT3_HUMAN	F	11	ENSP00000356671:S11F	ENSP00000307953:S11F	S	-	2	0	SERPINC1	172152989	0.019000	0.18553	0.011000	0.14972	0.009000	0.06853	2.107000	0.41844	2.397000	0.81536	0.313000	0.20887	TCT	SERPINC1	-	NULL	ENSG00000117601		0.502	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINC1	HGNC	protein_coding	OTTHUMT00000090734.1	116	0.00	0	G	NM_000488		173886366	173886366	-1	no_errors	ENST00000367698	ensembl	human	known	69_37n	missense	120	17.24	25	SNP	0.001	A
SIM1	6492	genome.wustl.edu	37	6	100897266	100897266	+	Silent	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr6:100897266G>A	ENST00000369208.3	-	6	1298	c.516C>T	c.(514-516)aaC>aaT	p.N172N	SIM1_ENST00000262901.4_Silent_p.N172N			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	172					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TGAGGCCGGCGTTACGCTTGG	0.622																																						dbGAP											0													46.0	41.0	43.0					6																	100897266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.516C>T	6.37:g.100897266G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDP7	Silent	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd	p.N172	ENST00000369208.3	37	c.516	CCDS5045.1	6																																																																																			SIM1	-	NULL	ENSG00000112246		0.622	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	29	0.00	0	G	NM_005068		100897266	100897266	-1	no_errors	ENST00000262901	ensembl	human	known	69_37n	silent	17	43.33	13	SNP	0.816	A
SIM1	6492	genome.wustl.edu	37	6	100897266	100897266	+	Silent	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr6:100897266G>A	ENST00000369208.3	-	6	1298	c.516C>T	c.(514-516)aaC>aaT	p.N172N	SIM1_ENST00000262901.4_Silent_p.N172N			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	172					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TGAGGCCGGCGTTACGCTTGG	0.622																																						dbGAP											0													46.0	41.0	43.0					6																	100897266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.516C>T	6.37:g.100897266G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDP7	Silent	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd	p.N172	ENST00000369208.3	37	c.516	CCDS5045.1	6																																																																																			SIM1	-	NULL	ENSG00000112246		0.622	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	33	0.00	0	G	NM_005068		100897266	100897266	-1	no_errors	ENST00000262901	ensembl	human	known	69_37n	silent	17	43.33	13	SNP	0.816	A
TAS2R10	50839	genome.wustl.edu	37	12	10978407	10978407	+	Nonsense_Mutation	SNP	A	A	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr12:10978407A>C	ENST00000240619.2	-	1	550	c.462T>G	c.(460-462)taT>taG	p.Y154*		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	154					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TCTTCGTTTTATAATCATTAA	0.308																																						dbGAP											0													46.0	47.0	47.0					12																	10978407		2200	4293	6493	-	-	-	SO:0001587	stop_gained	0			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.462T>G	12.37:g.10978407A>C	ENSP00000240619:p.Tyr154*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIM9|Q6NTD9	Nonsense_Mutation	SNP	pfam_TAS2_rcpt	p.Y154*	ENST00000240619.2	37	c.462	CCDS8634.1	12	.	.	.	.	.	.	.	.	.	.	A	14.26	2.481369	0.44147	.	.	ENSG00000121318	ENST00000240619	.	.	.	4.82	-6.45	0.01914	.	4.136140	0.00465	N	0.000117	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.9917	0.14218	0.1873:0.0:0.3104:0.5023	.	.	.	.	X	154	.	ENSP00000240619:Y154X	Y	-	3	2	TAS2R10	10869674	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.789000	0.04609	-0.699000	0.05077	-1.146000	0.01853	TAT	TAS2R10	-	pfam_TAS2_rcpt	ENSG00000121318		0.308	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R10	HGNC	protein_coding	OTTHUMT00000399934.1	124	0.00	0	A			10978407	10978407	-1	no_errors	ENST00000240619	ensembl	human	known	69_37n	nonsense	189	13.96	31	SNP	0.000	C
TAS2R10	50839	genome.wustl.edu	37	12	10978407	10978407	+	Nonsense_Mutation	SNP	A	A	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr12:10978407A>C	ENST00000240619.2	-	1	550	c.462T>G	c.(460-462)taT>taG	p.Y154*		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	154					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TCTTCGTTTTATAATCATTAA	0.308																																						dbGAP											0													46.0	47.0	47.0					12																	10978407		2200	4293	6493	-	-	-	SO:0001587	stop_gained	0			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.462T>G	12.37:g.10978407A>C	ENSP00000240619:p.Tyr154*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIM9|Q6NTD9	Nonsense_Mutation	SNP	pfam_TAS2_rcpt	p.Y154*	ENST00000240619.2	37	c.462	CCDS8634.1	12	.	.	.	.	.	.	.	.	.	.	A	14.26	2.481369	0.44147	.	.	ENSG00000121318	ENST00000240619	.	.	.	4.82	-6.45	0.01914	.	4.136140	0.00465	N	0.000117	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.9917	0.14218	0.1873:0.0:0.3104:0.5023	.	.	.	.	X	154	.	ENSP00000240619:Y154X	Y	-	3	2	TAS2R10	10869674	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.789000	0.04609	-0.699000	0.05077	-1.146000	0.01853	TAT	TAS2R10	-	pfam_TAS2_rcpt	ENSG00000121318		0.308	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R10	HGNC	protein_coding	OTTHUMT00000399934.1	234	0.00	0	A			10978407	10978407	-1	no_errors	ENST00000240619	ensembl	human	known	69_37n	nonsense	189	13.96	31	SNP	0.000	C
TLR7	51284	genome.wustl.edu	37	X	12903835	12903835	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chrX:12903835C>T	ENST00000380659.3	+	3	347	c.208C>T	c.(208-210)Ctc>Ttc	p.L70F		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	70					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	CACCACGAACCTCACCCTCAC	0.478																																						dbGAP											0													165.0	151.0	156.0					X																	12903835		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.208C>T	X.37:g.12903835C>T	ENSP00000370034:p.Leu70Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D1CS69|Q9NR98	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L70F	ENST00000380659.3	37	c.208	CCDS14151.1	X	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899393	0.52227	.	.	ENSG00000196664	ENST00000380659	T	0.13420	2.59	5.79	4.92	0.64577	.	0.000000	0.64402	D	0.000002	T	0.27967	0.0689	M	0.88640	2.97	0.58432	D	0.999999	B	0.30326	0.276	B	0.33890	0.172	T	0.09618	-1.0666	10	0.72032	D	0.01	.	15.2477	0.73517	0.1414:0.8585:0.0:0.0	.	70	Q9NYK1	TLR7_HUMAN	F	70	ENSP00000370034:L70F	ENSP00000370034:L70F	L	+	1	0	TLR7	12813756	1.000000	0.71417	0.999000	0.59377	0.810000	0.45777	2.042000	0.41222	1.169000	0.42739	0.500000	0.49745	CTC	TLR7	-	NULL	ENSG00000196664		0.478	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	HGNC	protein_coding	OTTHUMT00000055769.1	402	0.00	0	C	NM_016562		12903835	12903835	+1	no_errors	ENST00000380659	ensembl	human	known	69_37n	missense	383	32.28	183	SNP	1.000	T
TLR7	51284	genome.wustl.edu	37	X	12903835	12903835	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chrX:12903835C>T	ENST00000380659.3	+	3	347	c.208C>T	c.(208-210)Ctc>Ttc	p.L70F		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	70					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	CACCACGAACCTCACCCTCAC	0.478																																						dbGAP											0													165.0	151.0	156.0					X																	12903835		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.208C>T	X.37:g.12903835C>T	ENSP00000370034:p.Leu70Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D1CS69|Q9NR98	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L70F	ENST00000380659.3	37	c.208	CCDS14151.1	X	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899393	0.52227	.	.	ENSG00000196664	ENST00000380659	T	0.13420	2.59	5.79	4.92	0.64577	.	0.000000	0.64402	D	0.000002	T	0.27967	0.0689	M	0.88640	2.97	0.58432	D	0.999999	B	0.30326	0.276	B	0.33890	0.172	T	0.09618	-1.0666	10	0.72032	D	0.01	.	15.2477	0.73517	0.1414:0.8585:0.0:0.0	.	70	Q9NYK1	TLR7_HUMAN	F	70	ENSP00000370034:L70F	ENSP00000370034:L70F	L	+	1	0	TLR7	12813756	1.000000	0.71417	0.999000	0.59377	0.810000	0.45777	2.042000	0.41222	1.169000	0.42739	0.500000	0.49745	CTC	TLR7	-	NULL	ENSG00000196664		0.478	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	HGNC	protein_coding	OTTHUMT00000055769.1	747	0.13	1	C	NM_016562		12903835	12903835	+1	no_errors	ENST00000380659	ensembl	human	known	69_37n	missense	383	32.28	183	SNP	1.000	T
TMEM106A	113277	genome.wustl.edu	37	17	41368593	41368593	+	Silent	SNP	T	T	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr17:41368593T>C	ENST00000331615.3	+	6	792	c.555T>C	c.(553-555)ccT>ccC	p.P185P	TMEM106A_ENST00000541594.1_Silent_p.P137P|LINC00854_ENST00000595400.1_RNA|LINC00854_ENST00000427995.1_RNA|TMEM106A_ENST00000588659.1_Silent_p.P185P|LINC00854_ENST00000593624.1_RNA|TMEM106A_ENST00000536052.1_Intron	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	185						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		ACATTGGCCCTTTGGCCAGTG	0.587																																						dbGAP											0													159.0	145.0	150.0					17																	41368593		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.555T>C	17.37:g.41368593T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2X2|B7Z698	Silent	SNP	pfam_DUF1356_TMEM106	p.P185	ENST00000331615.3	37	c.555	CCDS11462.1	17																																																																																			TMEM106A	-	pfam_DUF1356_TMEM106	ENSG00000184988		0.587	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM106A	HGNC	protein_coding	OTTHUMT00000453470.2	232	0.43	1	T	NM_145041		41368593	41368593	+1	no_errors	ENST00000331615	ensembl	human	known	69_37n	silent	124	38.31	77	SNP	1.000	C
TMEM167A	153339	genome.wustl.edu	37	5	82352947	82352947	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr5:82352947C>T	ENST00000502346.1	-	4	347	c.175G>A	c.(175-177)Gta>Ata	p.V59I	TMEM167A_ENST00000511450.1_5'UTR	NM_174909.4	NP_777569.1	Q8TBQ9	KISHA_HUMAN	transmembrane protein 167A	59						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(1)	2						ATACAGCATACTGCAACATAA	0.413																																						dbGAP											0													128.0	114.0	118.0					5																	82352947		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC107575, AK055070	CCDS34198.1	5q14.2	2008-06-06	2008-06-06	2008-06-06	ENSG00000174695	ENSG00000174695			28330	protein-coding gene	gene with protein product			"""transmembrane protein 167"""	TMEM167		1316117	Standard	NM_174909		Approved	FLJ30508, MGC23909	uc003khx.4	Q8TBQ9	OTTHUMG00000162570	ENST00000502346.1:c.175G>A	5.37:g.82352947C>T	ENSP00000424707:p.Val59Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P692	Missense_Mutation	SNP	pfam_DUF1242	p.V59I	ENST00000502346.1	37	c.175	CCDS34198.1	5	.	.	.	.	.	.	.	.	.	.	C	0.109	-1.141332	0.01728	.	.	ENSG00000174695	ENST00000502346	.	.	.	5.72	2.98	0.34508	.	0.511829	0.20832	N	0.084862	T	0.15132	0.0365	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31024	-0.9958	8	0.02654	T	1	.	9.97	0.41747	0.0:0.7803:0.0:0.2197	.	59	Q8TBQ9	KISHA_HUMAN	I	59	.	ENSP00000424707:V59I	V	-	1	0	TMEM167A	82388703	0.133000	0.22466	0.007000	0.13788	0.443000	0.32047	2.018000	0.40991	0.439000	0.26476	0.655000	0.94253	GTA	TMEM167A	-	NULL	ENSG00000174695		0.413	TMEM167A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM167A	HGNC	protein_coding	OTTHUMT00000369631.2	75	0.00	0	C	NM_174909		82352947	82352947	-1	no_errors	ENST00000502346	ensembl	human	known	69_37n	missense	100	21.88	28	SNP	0.023	T
TMEM167A	153339	genome.wustl.edu	37	5	82352947	82352947	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr5:82352947C>T	ENST00000502346.1	-	4	347	c.175G>A	c.(175-177)Gta>Ata	p.V59I	TMEM167A_ENST00000511450.1_5'UTR	NM_174909.4	NP_777569.1	Q8TBQ9	KISHA_HUMAN	transmembrane protein 167A	59						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(1)	2						ATACAGCATACTGCAACATAA	0.413																																						dbGAP											0													128.0	114.0	118.0					5																	82352947		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC107575, AK055070	CCDS34198.1	5q14.2	2008-06-06	2008-06-06	2008-06-06	ENSG00000174695	ENSG00000174695			28330	protein-coding gene	gene with protein product			"""transmembrane protein 167"""	TMEM167		1316117	Standard	NM_174909		Approved	FLJ30508, MGC23909	uc003khx.4	Q8TBQ9	OTTHUMG00000162570	ENST00000502346.1:c.175G>A	5.37:g.82352947C>T	ENSP00000424707:p.Val59Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P692	Missense_Mutation	SNP	pfam_DUF1242	p.V59I	ENST00000502346.1	37	c.175	CCDS34198.1	5	.	.	.	.	.	.	.	.	.	.	C	0.109	-1.141332	0.01728	.	.	ENSG00000174695	ENST00000502346	.	.	.	5.72	2.98	0.34508	.	0.511829	0.20832	N	0.084862	T	0.15132	0.0365	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31024	-0.9958	8	0.02654	T	1	.	9.97	0.41747	0.0:0.7803:0.0:0.2197	.	59	Q8TBQ9	KISHA_HUMAN	I	59	.	ENSP00000424707:V59I	V	-	1	0	TMEM167A	82388703	0.133000	0.22466	0.007000	0.13788	0.443000	0.32047	2.018000	0.40991	0.439000	0.26476	0.655000	0.94253	GTA	TMEM167A	-	NULL	ENSG00000174695		0.413	TMEM167A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM167A	HGNC	protein_coding	OTTHUMT00000369631.2	136	0.00	0	C	NM_174909		82352947	82352947	-1	no_errors	ENST00000502346	ensembl	human	known	69_37n	missense	100	21.88	28	SNP	0.023	T
UBR4	23352	genome.wustl.edu	37	1	19468234	19468234	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr1:19468234C>G	ENST00000375254.3	-	56	8244	c.8217G>C	c.(8215-8217)gaG>gaC	p.E2739D	UBR4_ENST00000375217.2_Missense_Mutation_p.E2767D|UBR4_ENST00000375226.2_Missense_Mutation_p.E2750D|UBR4_ENST00000375267.2_Missense_Mutation_p.E2739D	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2739					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACTGCATTTTCTCATCTGCAT	0.507																																						dbGAP											0													167.0	141.0	150.0					1																	19468234		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8217G>C	1.37:g.19468234C>G	ENSP00000364403:p.Glu2739Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E2739D	ENST00000375254.3	37	c.8217	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	5.591	0.293831	0.10567	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.23147	1.94;1.94;1.92;1.93	5.96	4.09	0.47781	.	0.310603	0.33591	N	0.004741	T	0.13841	0.0335	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10177	-1.0641	10	0.12766	T	0.61	.	6.7493	0.23477	0.113:0.4243:0.3938:0.0689	.	2739	Q5T4S7	UBR4_HUMAN	D	2739;2739;2767;2750;382;1460	ENSP00000364403:E2739D;ENSP00000364416:E2739D;ENSP00000364365:E2767D;ENSP00000364374:E2750D	ENSP00000364365:E2767D	E	-	3	2	UBR4	19340821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.383000	0.34385	0.854000	0.35336	0.579000	0.79373	GAG	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.507	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	104	0.00	0	C	NM_020765		19468234	19468234	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	96	35.57	53	SNP	1.000	G
UBR4	23352	genome.wustl.edu	37	1	19468234	19468234	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr1:19468234C>G	ENST00000375254.3	-	56	8244	c.8217G>C	c.(8215-8217)gaG>gaC	p.E2739D	UBR4_ENST00000375217.2_Missense_Mutation_p.E2767D|UBR4_ENST00000375226.2_Missense_Mutation_p.E2750D|UBR4_ENST00000375267.2_Missense_Mutation_p.E2739D	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2739					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACTGCATTTTCTCATCTGCAT	0.507																																						dbGAP											0													167.0	141.0	150.0					1																	19468234		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8217G>C	1.37:g.19468234C>G	ENSP00000364403:p.Glu2739Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E2739D	ENST00000375254.3	37	c.8217	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	5.591	0.293831	0.10567	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.23147	1.94;1.94;1.92;1.93	5.96	4.09	0.47781	.	0.310603	0.33591	N	0.004741	T	0.13841	0.0335	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10177	-1.0641	10	0.12766	T	0.61	.	6.7493	0.23477	0.113:0.4243:0.3938:0.0689	.	2739	Q5T4S7	UBR4_HUMAN	D	2739;2739;2767;2750;382;1460	ENSP00000364403:E2739D;ENSP00000364416:E2739D;ENSP00000364365:E2767D;ENSP00000364374:E2750D	ENSP00000364365:E2767D	E	-	3	2	UBR4	19340821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.383000	0.34385	0.854000	0.35336	0.579000	0.79373	GAG	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.507	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	169	0.59	1	C	NM_020765		19468234	19468234	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	96	35.57	53	SNP	1.000	G
UFC1	51506	genome.wustl.edu	37	1	161127913	161127913	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr1:161127913G>C	ENST00000368003.5	+	5	581	c.335G>C	c.(334-336)gGt>gCt	p.G112A	UFC1_ENST00000473766.1_3'UTR|RP11-297K8.2_ENST00000420498.1_RNA|USP21_ENST00000368001.1_5'Flank|USP21_ENST00000368002.3_5'Flank|USP21_ENST00000289865.8_5'Flank	NM_016406.3	NP_057490.2	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1	112					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	extracellular vesicular exosome (GO:0070062)	UFM1 conjugating enzyme activity (GO:0071568)			endometrium(1)|lung(9)	10	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TCTCATAGGGGTGGCAAAATA	0.468																																						dbGAP											0													86.0	81.0	83.0					1																	161127913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161504	CCDS1220.1	1q23.3	2008-02-05			ENSG00000143222	ENSG00000143222			26941	protein-coding gene	gene with protein product		610554				15071506, 11042152	Standard	NM_016406		Approved	HSPC155	uc001fyd.4	Q9Y3C8	OTTHUMG00000033155	ENST00000368003.5:c.335G>C	1.37:g.161127913G>C	ENSP00000356982:p.Gly112Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9R1|D3DVF9|Q549X0|Q5VTX1|Q9BS96|Q9P009	Missense_Mutation	SNP	pfam_Ufc1,superfamily_UBQ-conjugating_enzyme/RWD,pirsf_Ufc1	p.G112A	ENST00000368003.5	37	c.335	CCDS1220.1	1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785672	0.70337	.	.	ENSG00000143222	ENST00000368003	T	0.61510	0.1	5.38	5.38	0.77491	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.85682	D	0.000000	T	0.67692	0.2920	M	0.91972	3.26	0.80722	D	1	B	0.30361	0.277	B	0.41202	0.35	T	0.73630	-0.3922	10	0.87932	D	0	-9.8802	17.923	0.88973	0.0:0.0:1.0:0.0	.	112	Q9Y3C8	UFC1_HUMAN	A	112	ENSP00000356982:G112A	ENSP00000356982:G112A	G	+	2	0	UFC1	159394537	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.915000	0.92740	2.514000	0.84764	0.655000	0.94253	GGT	UFC1	-	pfam_Ufc1,superfamily_UBQ-conjugating_enzyme/RWD,pirsf_Ufc1	ENSG00000143222		0.468	UFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFC1	HGNC	protein_coding	OTTHUMT00000080810.1	78	0.00	0	G	NM_016406		161127913	161127913	+1	no_errors	ENST00000368003	ensembl	human	known	69_37n	missense	93	14.68	16	SNP	1.000	C
UFC1	51506	genome.wustl.edu	37	1	161127913	161127913	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr1:161127913G>C	ENST00000368003.5	+	5	581	c.335G>C	c.(334-336)gGt>gCt	p.G112A	UFC1_ENST00000473766.1_3'UTR|RP11-297K8.2_ENST00000420498.1_RNA|USP21_ENST00000368001.1_5'Flank|USP21_ENST00000368002.3_5'Flank|USP21_ENST00000289865.8_5'Flank	NM_016406.3	NP_057490.2	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1	112					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	extracellular vesicular exosome (GO:0070062)	UFM1 conjugating enzyme activity (GO:0071568)			endometrium(1)|lung(9)	10	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TCTCATAGGGGTGGCAAAATA	0.468																																						dbGAP											0													86.0	81.0	83.0					1																	161127913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161504	CCDS1220.1	1q23.3	2008-02-05			ENSG00000143222	ENSG00000143222			26941	protein-coding gene	gene with protein product		610554				15071506, 11042152	Standard	NM_016406		Approved	HSPC155	uc001fyd.4	Q9Y3C8	OTTHUMG00000033155	ENST00000368003.5:c.335G>C	1.37:g.161127913G>C	ENSP00000356982:p.Gly112Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9R1|D3DVF9|Q549X0|Q5VTX1|Q9BS96|Q9P009	Missense_Mutation	SNP	pfam_Ufc1,superfamily_UBQ-conjugating_enzyme/RWD,pirsf_Ufc1	p.G112A	ENST00000368003.5	37	c.335	CCDS1220.1	1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785672	0.70337	.	.	ENSG00000143222	ENST00000368003	T	0.61510	0.1	5.38	5.38	0.77491	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.85682	D	0.000000	T	0.67692	0.2920	M	0.91972	3.26	0.80722	D	1	B	0.30361	0.277	B	0.41202	0.35	T	0.73630	-0.3922	10	0.87932	D	0	-9.8802	17.923	0.88973	0.0:0.0:1.0:0.0	.	112	Q9Y3C8	UFC1_HUMAN	A	112	ENSP00000356982:G112A	ENSP00000356982:G112A	G	+	2	0	UFC1	159394537	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.915000	0.92740	2.514000	0.84764	0.655000	0.94253	GGT	UFC1	-	pfam_Ufc1,superfamily_UBQ-conjugating_enzyme/RWD,pirsf_Ufc1	ENSG00000143222		0.468	UFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFC1	HGNC	protein_coding	OTTHUMT00000080810.1	153	0.00	0	G	NM_016406		161127913	161127913	+1	no_errors	ENST00000368003	ensembl	human	known	69_37n	missense	93	14.68	16	SNP	1.000	C
VAMP2	6844	genome.wustl.edu	37	17	8064834	8064834	+	Silent	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr17:8064834G>A	ENST00000316509.6	-	4	386	c.291C>T	c.(289-291)atC>atT	p.I97I	VAMP2_ENST00000481878.1_Silent_p.I97I|VAMP2_ENST00000404970.3_Silent_p.I52I|RP11-599B13.6_ENST00000498285.1_Silent_p.I97I|VAMP2_ENST00000488857.1_Silent_p.I99I	NM_014232.2	NP_055047.2	P63027	VAMP2_HUMAN	vesicle-associated membrane protein 2 (synaptobrevin 2)	97					cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|glutamate secretion (GO:0014047)|membrane organization (GO:0061024)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	calcium-dependent protein binding (GO:0048306)|protein self-association (GO:0043621)									Botulinum Toxin Type B(DB00042)	CTCCCAAGATGATCATCATCT	0.527																																						dbGAP											0													142.0	114.0	124.0					17																	8064834		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32561.1	17p13.1	2013-09-19			ENSG00000220205	ENSG00000220205		"""Vesicle-associated membrane proteins"""	12643	protein-coding gene	gene with protein product		185881		SYB2		1976629	Standard	NM_014232		Approved	VAMP-2	uc010cnt.1	P63027	OTTHUMG00000150254	ENST00000316509.6:c.291C>T	17.37:g.8064834G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P19065|Q9BUC2	Silent	SNP	pfam_Synaptobrevin,pirsf_Synaptobrevin_met/fun,pfscan_Synaptobrevin,prints_Synaptobrevin	p.I97	ENST00000316509.6	37	c.291	CCDS32561.1	17																																																																																			VAMP2	-	pfam_Synaptobrevin,pirsf_Synaptobrevin_met/fun,prints_Synaptobrevin	ENSG00000220205		0.527	VAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VAMP2	HGNC	protein_coding	OTTHUMT00000317118.1	67	0.00	0	G			8064834	8064834	-1	no_errors	ENST00000316509	ensembl	human	known	69_37n	silent	28	36.36	16	SNP	0.998	A
VAMP2	6844	genome.wustl.edu	37	17	8064834	8064834	+	Silent	SNP	G	G	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr17:8064834G>A	ENST00000316509.6	-	4	386	c.291C>T	c.(289-291)atC>atT	p.I97I	VAMP2_ENST00000481878.1_Silent_p.I97I|VAMP2_ENST00000404970.3_Silent_p.I52I|RP11-599B13.6_ENST00000498285.1_Silent_p.I97I|VAMP2_ENST00000488857.1_Silent_p.I99I	NM_014232.2	NP_055047.2	P63027	VAMP2_HUMAN	vesicle-associated membrane protein 2 (synaptobrevin 2)	97					cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|glutamate secretion (GO:0014047)|membrane organization (GO:0061024)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	calcium-dependent protein binding (GO:0048306)|protein self-association (GO:0043621)									Botulinum Toxin Type B(DB00042)	CTCCCAAGATGATCATCATCT	0.527																																						dbGAP											0													142.0	114.0	124.0					17																	8064834		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32561.1	17p13.1	2013-09-19			ENSG00000220205	ENSG00000220205		"""Vesicle-associated membrane proteins"""	12643	protein-coding gene	gene with protein product		185881		SYB2		1976629	Standard	NM_014232		Approved	VAMP-2	uc010cnt.1	P63027	OTTHUMG00000150254	ENST00000316509.6:c.291C>T	17.37:g.8064834G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P19065|Q9BUC2	Silent	SNP	pfam_Synaptobrevin,pirsf_Synaptobrevin_met/fun,pfscan_Synaptobrevin,prints_Synaptobrevin	p.I97	ENST00000316509.6	37	c.291	CCDS32561.1	17																																																																																			VAMP2	-	pfam_Synaptobrevin,pirsf_Synaptobrevin_met/fun,prints_Synaptobrevin	ENSG00000220205		0.527	VAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VAMP2	HGNC	protein_coding	OTTHUMT00000317118.1	108	0.00	0	G			8064834	8064834	-1	no_errors	ENST00000316509	ensembl	human	known	69_37n	silent	28	36.36	16	SNP	0.998	A
VPS13B	157680	genome.wustl.edu	37	8	100520093	100520093	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr8:100520093T>C	ENST00000358544.2	+	28	4364	c.4253T>C	c.(4252-4254)aTc>aCc	p.I1418T	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Intron	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1418					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTTCGACCCATCAGCAAGCAG	0.463																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													209.0	183.0	192.0					8																	100520093		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4253T>C	8.37:g.100520093T>C	ENSP00000351346:p.Ile1418Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.I1418T	ENST00000358544.2	37	c.4253	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	T	14.10	2.435989	0.43224	.	.	ENSG00000132549	ENST00000358544	T	0.49139	0.79	5.64	4.45	0.53987	.	0.747990	0.12742	N	0.442936	T	0.34019	0.0883	N	0.14661	0.345	0.80722	D	1	B;B	0.17038	0.01;0.02	B;B	0.21151	0.033;0.024	T	0.06409	-1.0828	10	0.51188	T	0.08	.	12.6497	0.56753	0.0:0.0:0.1383:0.8617	.	1417;1418	Q7Z7G8-6;Q7Z7G8	.;VP13B_HUMAN	T	1418	ENSP00000351346:I1418T	ENSP00000351346:I1418T	I	+	2	0	VPS13B	100589269	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.889000	0.63171	0.920000	0.36970	0.482000	0.46254	ATC	VPS13B	-	NULL	ENSG00000132549		0.463	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	89	0.00	0	T	NM_184042		100520093	100520093	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	184	11.96	25	SNP	1.000	C
VPS13B	157680	genome.wustl.edu	37	8	100520093	100520093	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr8:100520093T>C	ENST00000358544.2	+	28	4364	c.4253T>C	c.(4252-4254)aTc>aCc	p.I1418T	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Intron	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1418					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTTCGACCCATCAGCAAGCAG	0.463																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													209.0	183.0	192.0					8																	100520093		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4253T>C	8.37:g.100520093T>C	ENSP00000351346:p.Ile1418Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.I1418T	ENST00000358544.2	37	c.4253	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	T	14.10	2.435989	0.43224	.	.	ENSG00000132549	ENST00000358544	T	0.49139	0.79	5.64	4.45	0.53987	.	0.747990	0.12742	N	0.442936	T	0.34019	0.0883	N	0.14661	0.345	0.80722	D	1	B;B	0.17038	0.01;0.02	B;B	0.21151	0.033;0.024	T	0.06409	-1.0828	10	0.51188	T	0.08	.	12.6497	0.56753	0.0:0.0:0.1383:0.8617	.	1417;1418	Q7Z7G8-6;Q7Z7G8	.;VP13B_HUMAN	T	1418	ENSP00000351346:I1418T	ENSP00000351346:I1418T	I	+	2	0	VPS13B	100589269	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.889000	0.63171	0.920000	0.36970	0.482000	0.46254	ATC	VPS13B	-	NULL	ENSG00000132549		0.463	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	107	0.00	0	T	NM_184042		100520093	100520093	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	184	11.96	25	SNP	1.000	C
ZBTB22	9278	genome.wustl.edu	37	6	33284027	33284027	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr6:33284027C>T	ENST00000431845.2	-	2	818	c.667G>A	c.(667-669)Gag>Aag	p.E223K	TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000456592.2_5'Flank|ZBTB22_ENST00000418724.1_Missense_Mutation_p.E223K|TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						GCAAATGCCTCTTGGGAGGAA	0.602																																						dbGAP											0													48.0	54.0	52.0					6																	33284027		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.667G>A	6.37:g.33284027C>T	ENSP00000407545:p.Glu223Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E223K	ENST00000431845.2	37	c.667	CCDS4775.1	6	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045391	0.36085	.	.	ENSG00000236104	ENST00000418724;ENST00000431845	T;T	0.05925	3.37;3.37	4.37	4.37	0.52481	.	0.237925	0.21768	N	0.069414	T	0.01156	0.0038	N	0.14661	0.345	0.28814	N	0.898045	B	0.27498	0.18	B	0.24155	0.051	T	0.41858	-0.9485	10	0.07644	T	0.81	.	12.3638	0.55217	0.0:1.0:0.0:0.0	.	223	O15209	ZBT22_HUMAN	K	223	ENSP00000404403:E223K;ENSP00000407545:E223K	ENSP00000404403:E223K	E	-	1	0	ZBTB22	33392005	0.999000	0.42202	0.996000	0.52242	0.950000	0.60333	3.039000	0.49791	2.277000	0.76020	0.545000	0.68477	GAG	ZBTB22	-	NULL	ENSG00000236104		0.602	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB22	HGNC	protein_coding	OTTHUMT00000076183.2	50	0.00	0	C			33284027	33284027	-1	no_errors	ENST00000418724	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	0.990	T
ZBTB22	9278	genome.wustl.edu	37	6	33284027	33284027	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr6:33284027C>T	ENST00000431845.2	-	2	818	c.667G>A	c.(667-669)Gag>Aag	p.E223K	TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000456592.2_5'Flank|ZBTB22_ENST00000418724.1_Missense_Mutation_p.E223K|TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						GCAAATGCCTCTTGGGAGGAA	0.602																																						dbGAP											0													48.0	54.0	52.0					6																	33284027		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.667G>A	6.37:g.33284027C>T	ENSP00000407545:p.Glu223Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E223K	ENST00000431845.2	37	c.667	CCDS4775.1	6	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045391	0.36085	.	.	ENSG00000236104	ENST00000418724;ENST00000431845	T;T	0.05925	3.37;3.37	4.37	4.37	0.52481	.	0.237925	0.21768	N	0.069414	T	0.01156	0.0038	N	0.14661	0.345	0.28814	N	0.898045	B	0.27498	0.18	B	0.24155	0.051	T	0.41858	-0.9485	10	0.07644	T	0.81	.	12.3638	0.55217	0.0:1.0:0.0:0.0	.	223	O15209	ZBT22_HUMAN	K	223	ENSP00000404403:E223K;ENSP00000407545:E223K	ENSP00000404403:E223K	E	-	1	0	ZBTB22	33392005	0.999000	0.42202	0.996000	0.52242	0.950000	0.60333	3.039000	0.49791	2.277000	0.76020	0.545000	0.68477	GAG	ZBTB22	-	NULL	ENSG00000236104		0.602	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB22	HGNC	protein_coding	OTTHUMT00000076183.2	104	0.00	0	C			33284027	33284027	-1	no_errors	ENST00000418724	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	0.990	T
ZNF513	130557	genome.wustl.edu	37	2	27601436	27601437	+	Frame_Shift_Ins	INS	-	-	G	rs371424464	byFrequency	TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	e1bc14b6-02fc-4f82-89c6-c08d7482449f	g.chr2:27601436_27601437insG	ENST00000323703.6	-	3	894_895	c.696_697insC	c.(694-699)cccactfs	p.T233fs	ZNF513_ENST00000407879.1_Frame_Shift_Ins_p.T171fs|ZNF513_ENST00000491924.1_5'UTR	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	233					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGAGGAGTGGGGGGCCCTG	0.708																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.697dupC	2.37:g.27601442_27601442dupG	ENSP00000318373:p.Thr233fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T232fs	ENST00000323703.6	37	c.697_696	CCDS1751.1	2																																																																																			ZNF513	-	pfscan_Znf_C2H2	ENSG00000163795		0.708	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF513	HGNC	protein_coding	OTTHUMT00000215026.2	23	0.00	0	-	NM_144631		27601436	27601437	-1	no_errors	ENST00000323703	ensembl	human	known	69_37n	frame_shift_ins	11	15.38	2	INS	0.997:0.998	G
ZNF513	130557	genome.wustl.edu	37	2	27601436	27601437	+	Frame_Shift_Ins	INS	-	-	G	rs371424464	byFrequency	TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr2:27601436_27601437insG	ENST00000323703.6	-	3	894_895	c.696_697insC	c.(694-699)cccactfs	p.T233fs	ZNF513_ENST00000407879.1_Frame_Shift_Ins_p.T171fs|ZNF513_ENST00000491924.1_5'UTR	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	233					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGAGGAGTGGGGGGCCCTG	0.708																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.697dupC	2.37:g.27601442_27601442dupG	ENSP00000318373:p.Thr233fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T232fs	ENST00000323703.6	37	c.697_696	CCDS1751.1	2																																																																																			ZNF513	-	pfscan_Znf_C2H2	ENSG00000163795		0.708	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF513	HGNC	protein_coding	OTTHUMT00000215026.2	24	0.00	0	-	NM_144631		27601436	27601437	-1	no_errors	ENST00000323703	ensembl	human	known	69_37n	frame_shift_ins	11	15.38	2	INS	0.997:0.998	G
ZNF880	400713	genome.wustl.edu	37	19	52888437	52888438	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A0E1-01A-11W-A071-09	TCGA-BH-A0E1-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	48706085-54be-4ea7-922e-46757a0b2979	11397279-b38a-4ec6-b121-21fda5625386	g.chr19:52888437_52888438insA	ENST00000422689.2	+	4	1619_1620	c.1604_1605insA	c.(1603-1608)ctaaaafs	p.LK535fs		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	535					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						AAGTTATACCTAAAAAAACATG	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1611dupA	19.37:g.52888444_52888444dupA	ENSP00000406318:p.Leu535fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNA6	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H538fs	ENST00000422689.2	37	c.1604_1605	CCDS46164.1	19																																																																																			ZNF880	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000221923		0.401	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	73	0.00	0	-	NM_001145434		52888437	52888438	+1	no_errors	ENST00000422689	ensembl	human	known	69_37n	frame_shift_ins	17	10.53	2	INS	0.005:0.000	A
