#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCY5	111	genome.wustl.edu	37	3	123166519	123166519	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr3:123166519C>T	ENST00000462833.1	-	1	2086	c.874G>A	c.(874-876)Gcc>Acc	p.A292T		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	292					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		TGGTGGAAGGCGGCGCGGTTG	0.721																																						dbGAP											0													16.0	19.0	18.0					3																	123166519		2192	4296	6488	-	-	-	SO:0001583	missense	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.874G>A	3.37:g.123166519C>T	ENSP00000419361:p.Ala292Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A292T	ENST00000462833.1	37	c.874	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013862	0.35511	.	.	ENSG00000173175	ENST00000462833	T	0.22134	1.97	5.13	2.95	0.34219	.	0.429062	0.20526	N	0.090616	T	0.10252	0.0251	N	0.12746	0.255	0.80722	D	1	B	0.31100	0.308	B	0.23716	0.048	T	0.20273	-1.0280	10	0.26408	T	0.33	.	10.62	0.45474	0.0:0.7072:0.0:0.2928	.	292	O95622	ADCY5_HUMAN	T	292	ENSP00000419361:A292T	ENSP00000419361:A292T	A	-	1	0	ADCY5	124649209	1.000000	0.71417	0.984000	0.44739	0.955000	0.61496	2.520000	0.45554	1.156000	0.42514	0.561000	0.74099	GCC	ADCY5	-	NULL	ENSG00000173175		0.721	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	16	0.00	0	C	XM_171048		123166519	123166519	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	1.000	T
ANKRD62	342850	genome.wustl.edu	37	18	12115509	12115509	+	Missense_Mutation	SNP	G	G	A	rs4519391	byFrequency	TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr18:12115509G>A	ENST00000587848.2	+	10	1381	c.1216G>A	c.(1216-1218)Gaa>Aaa	p.E406K	ANKRD62_ENST00000314074.8_Missense_Mutation_p.E392K|ANKRD62_ENST00000418274.2_3'UTR			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	406			E -> K (in dbSNP:rs4519391). {ECO:0000269|PubMed:17974005}.							breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						GTTACTCATTGAACAAAGTGG	0.388													G|||	2641	0.527356	0.5764	0.5692	5008	,	,		20516	0.252		0.669	False		,,,				2504	0.5695					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.1216G>A	18.37:g.12115509G>A	ENSP00000467740:p.Glu406Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E392K	ENST00000587848.2	37	c.1174		18	1164	0.532967032967033	296	0.6016260162601627	202	0.5580110497237569	156	0.2727272727272727	510	0.6728232189973615	G	12.58	1.979289	0.34942	.	.	ENSG00000181626	ENST00000314074;ENST00000418274	T;T	0.29655	1.56;1.56	1.51	1.51	0.23008	.	.	.	.	.	T	0.00012	0.0000	L	0.60067	1.865	0.80722	P	0.0	D	0.57571	0.98	P	0.59288	0.855	T	0.37174	-0.9717	8	0.39692	T	0.17	.	6.4356	0.21821	0.0:0.0:1.0:0.0	rs4519391;rs17522802;rs52803757;rs58362001;rs4519391	406	A6NC57	ANR62_HUMAN	K	392;128	ENSP00000326572:E392K;ENSP00000405628:E128K	ENSP00000326572:E392K	E	+	1	0	ANKRD62	12105509	1.000000	0.71417	0.180000	0.23079	0.025000	0.11179	4.660000	0.61511	1.130000	0.42092	0.313000	0.20887	GAA	ANKRD62	-	NULL	ENSG00000181626		0.388	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	10	0.00	0	G	XM_001715728		12115509	12115509	+1	no_errors	ENST00000314074	ensembl	human	known	69_37n	missense	24	46.67	21	SNP	0.253	A
ANP32BP1	646791	genome.wustl.edu	37	15	75614127	75614127	+	RNA	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr15:75614127C>T	ENST00000564205.1	-	0	907									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		atcatcttctccttcatcatc	0.393																																						dbGAP											0																																										-	-	-			0					15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614127C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			ANP32BP1	-	-	ENSG00000259790		0.393	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	HGNC	pseudogene	OTTHUMT00000419801.1	313	0.00	0	C			75614127	75614127	-1	no_errors	ENST00000564205	ensembl	human	known	69_37n	rna	201	29.86	86	SNP	0.935	T
ARHGEF12	23365	genome.wustl.edu	37	11	120347958	120347958	+	Silent	SNP	A	A	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr11:120347958A>T	ENST00000397843.2	+	35	3562	c.3396A>T	c.(3394-3396)gcA>gcT	p.A1132A	ARHGEF12_ENST00000356641.3_Silent_p.A1113A|ARHGEF12_ENST00000532993.1_Silent_p.A1029A	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1132	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GGATGGCTGCATCAGTGAAGG	0.383			T	MLL	AML																																	dbGAP		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													86.0	82.0	84.0					11																	120347958		1940	4136	6076	-	-	-	SO:0001819	synonymous_variant	0			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.3396A>T	11.37:g.120347958A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15086|Q6P526	Silent	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.A1113	ENST00000397843.2	37	c.3339	CCDS41727.1	11																																																																																			ARHGEF12	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000196914		0.383	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	213	0.00	0	A	NM_015313		120347958	120347958	+1	no_errors	ENST00000356641	ensembl	human	known	69_37n	silent	165	13.16	25	SNP	0.290	T
ARID1A	8289	genome.wustl.edu	37	1	27089586	27089586	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:27089586C>T	ENST00000324856.7	+	8	2913	c.2542C>T	c.(2542-2544)Cca>Tca	p.P848S	RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000457599.2_Missense_Mutation_p.P848S|ARID1A_ENST00000374152.2_Missense_Mutation_p.P465S	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	848					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCTGGCATCCCACCTTATGG	0.582			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													95.0	74.0	81.0					1																	27089586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2542C>T	1.37:g.27089586C>T	ENSP00000320485:p.Pro848Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.P848S	ENST00000324856.7	37	c.2542	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812858	0.50527	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.02369	4.53;4.32;4.37	5.65	5.65	0.86999	.	0.237328	0.42294	D	0.000730	T	0.03095	0.0091	L	0.27053	0.805	0.80722	D	1	B;B;B	0.34200	0.214;0.319;0.441	B;B;B	0.34652	0.091;0.187;0.091	T	0.50750	-0.8791	10	0.06494	T	0.89	-6.123	19.9142	0.97043	0.0:1.0:0.0:0.0	.	848;848;502	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	S	848;848;465	ENSP00000320485:P848S;ENSP00000387636:P848S;ENSP00000363267:P465S	ENSP00000320485:P848S	P	+	1	0	ARID1A	26962173	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.580000	0.67464	2.941000	0.99782	0.655000	0.94253	CCA	ARID1A	-	NULL	ENSG00000117713		0.582	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	59	0.00	0	C	NM_139135		27089586	27089586	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	missense	57	19.72	14	SNP	1.000	T
ATG7	10533	genome.wustl.edu	37	3	11596291	11596291	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr3:11596291G>A	ENST00000354449.3	+	19	2111	c.2086G>A	c.(2086-2088)Gac>Aac	p.D696N	ATG7_ENST00000354956.5_Missense_Mutation_p.D669N|ATG7_ENST00000446450.2_Missense_Mutation_p.D616N	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	696					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						GCAGATCTGGGACATGAGCGA	0.627																																						dbGAP											0													89.0	80.0	83.0					3																	11596291		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.2086G>A	3.37:g.11596291G>A	ENSP00000346437:p.Asp696Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_E1-like_Apg7	p.D696N	ENST00000354449.3	37	c.2086	CCDS2605.1	3	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008794	0.93346	.	.	ENSG00000197548	ENST00000446450;ENST00000354956;ENST00000354449	T;T;T	0.51574	0.7;0.85;0.85	5.51	5.51	0.81932	.	0.149917	0.42172	D	0.000750	T	0.55955	0.1953	M	0.84219	2.685	0.58432	D	0.999998	P;B;B	0.42871	0.792;0.27;0.058	B;B;B	0.40329	0.326;0.099;0.03	T	0.65467	-0.6161	10	0.72032	D	0.01	-5.8175	16.918	0.86156	0.0:0.0:1.0:0.0	.	616;669;696	E9PB95;O95352-2;O95352	.;.;ATG7_HUMAN	N	616;669;696	ENSP00000412580:D616N;ENSP00000347042:D669N;ENSP00000346437:D696N	ENSP00000346437:D696N	D	+	1	0	ATG7	11571291	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.149000	0.77396	2.590000	0.87494	0.561000	0.74099	GAC	ATG7	-	tigrfam_E1-like_Apg7	ENSG00000197548		0.627	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	73	0.00	0	G	NM_006395		11596291	11596291	+1	no_errors	ENST00000354449	ensembl	human	known	69_37n	missense	39	18.37	9	SNP	1.000	A
ASTE1	28990	genome.wustl.edu	37	3	130743358	130743358	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr3:130743358G>T	ENST00000264992.3	-	3	1234	c.793C>A	c.(793-795)Cat>Aat	p.H265N	NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000356918.4_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000383366.4_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.H265N|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000412440.2_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	265					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTGGCAAAATGAGACAACCAA	0.443																																						dbGAP											0													78.0	74.0	75.0					3																	130743358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.793C>A	3.37:g.130743358G>T	ENSP00000264992:p.His265Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	pfam_XPG_DNA_repair_N	p.H265N	ENST00000264992.3	37	c.793	CCDS3068.1	3	.	.	.	.	.	.	.	.	.	.	G	9.004	0.980880	0.18812	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	.	.	.	5.54	4.66	0.58398	.	0.851980	0.11217	N	0.587071	T	0.23766	0.0575	N	0.12182	0.205	0.27702	N	0.945746	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.003	T	0.14392	-1.0474	9	0.07482	T	0.82	-0.2846	11.2588	0.49069	0.0:0.1373:0.7202:0.1425	.	265;265	D6RG30;Q2TB18	.;ASTE1_HUMAN	N	265	.	ENSP00000264992:H265N	H	-	1	0	ASTE1	132226048	0.009000	0.17119	0.832000	0.32986	0.987000	0.75469	0.680000	0.25306	1.311000	0.45024	0.561000	0.74099	CAT	ASTE1	-	NULL	ENSG00000034533		0.443	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1	85	0.00	0	G	NM_014065		130743358	130743358	-1	no_errors	ENST00000264992	ensembl	human	known	69_37n	missense	67	15.00	12	SNP	0.946	T
BIRC6	57448	genome.wustl.edu	37	2	32673930	32673930	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr2:32673930delA	ENST00000421745.2	+	22	4686	c.4552delA	c.(4552-4554)aaafs	p.K1518fs		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1518					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTCTTCTTGTAAAAATGTTTA	0.323																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													121.0	124.0	123.0					2																	32673930		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.4552delA	2.37:g.32673930delA	ENSP00000393596:p.Lys1518fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULD1	Frame_Shift_Del	DEL	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.N1519fs	ENST00000421745.2	37	c.4552	CCDS33175.2	2																																																																																			BIRC6	-	NULL	ENSG00000115760		0.323	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	290	0.00	0	A	NM_016252		32673930	32673930	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	frame_shift_del	71	37.39	43	DEL	1.000	-
CACNA2D3	55799	genome.wustl.edu	37	3	54603876	54603876	+	Missense_Mutation	SNP	G	G	A	rs555199325		TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr3:54603876G>A	ENST00000474759.1	+	7	779	c.731G>A	c.(730-732)cGa>cAa	p.R244Q	CACNA2D3_ENST00000288197.5_Missense_Mutation_p.R244Q|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.R150Q|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.R244Q	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	244						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TGCAGGAACCGAAAATGGTAG	0.383																																						dbGAP											0													70.0	67.0	68.0					3																	54603876		1861	4105	5966	-	-	-	SO:0001583	missense	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.731G>A	3.37:g.54603876G>A	ENSP00000419101:p.Arg244Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R244Q	ENST00000474759.1	37	c.731	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.353256	0.95830	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624;ENST00000438476	T;T;T;T	0.15256	2.44;2.44;2.44;2.48	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.46698	0.1406	M	0.81112	2.525	0.53688	D	0.999977	D	0.89917	1.0	D	0.69824	0.966	T	0.46569	-0.9182	10	0.66056	D	0.02	.	19.5514	0.95322	0.0:0.0:1.0:0.0	.	244	Q8IZS8	CA2D3_HUMAN	Q	244;244;244;150;150;149	ENSP00000389506:R244Q;ENSP00000419101:R244Q;ENSP00000288197:R244Q;ENSP00000417279:R150Q	ENSP00000288197:R244Q	R	+	2	0	CACNA2D3	54578916	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.751000	0.98889	2.705000	0.92388	0.650000	0.86243	CGA	CACNA2D3	-	NULL	ENSG00000157445		0.383	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	144	0.00	0	G			54603876	54603876	+1	no_errors	ENST00000288197	ensembl	human	known	69_37n	missense	117	26.42	42	SNP	1.000	A
CCT2	10576	genome.wustl.edu	37	12	69981336	69981336	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr12:69981336G>C	ENST00000299300.6	+	4	384	c.196G>C	c.(196-198)Gat>Cat	p.D66H	MIR3913-2_ENST00000577744.1_RNA|CCT2_ENST00000543146.2_Missense_Mutation_p.D19H|CCT2_ENST00000544368.2_Missense_Mutation_p.D66H	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	66					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GGTAACCAATGATGGTGCCAC	0.363																																						dbGAP											0													114.0	100.0	104.0					12																	69981336		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.196G>C	12.37:g.69981336G>C	ENSP00000299300:p.Asp66His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_beta	p.D66H	ENST00000299300.6	37	c.196	CCDS8991.1	12	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968264	0.92855	.	.	ENSG00000166226	ENST00000299300;ENST00000544368;ENST00000543146	T;T;T	0.21932	1.98;1.98;1.98	6.06	6.06	0.98353	Chaperonin TCP-1, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.71476	0.3344	H	0.99811	4.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84903	0.0843	9	.	.	.	-9.7939	20.6397	0.99537	0.0:0.0:1.0:0.0	.	66;66	F5GWF6;P78371	.;TCPB_HUMAN	H	66;66;19	ENSP00000299300:D66H;ENSP00000441847:D66H;ENSP00000445471:D19H	.	D	+	1	0	CCT2	68267603	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.222000	0.95196	2.880000	0.98712	0.650000	0.86243	GAT	CCT2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_beta	ENSG00000166226		0.363	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT2	HGNC	protein_coding	OTTHUMT00000403818.1	84	0.00	0	G	NM_006431		69981336	69981336	+1	no_errors	ENST00000299300	ensembl	human	known	69_37n	missense	55	19.12	13	SNP	1.000	C
CDC25B	994	genome.wustl.edu	37	20	3782704	3782704	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr20:3782704G>A	ENST00000245960.5	+	10	1752	c.1055G>A	c.(1054-1056)cGg>cAg	p.R352Q	CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000379598.5_Missense_Mutation_p.R261Q|CDC25B_ENST00000344256.6_Missense_Mutation_p.R288Q|CDC25B_ENST00000340833.4_Missense_Mutation_p.R311Q|CDC25B_ENST00000439880.2_Missense_Mutation_p.R338Q	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	352					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						AAGCGGAGGCGGAGCGTGACC	0.657																																						dbGAP											0													31.0	26.0	28.0					20																	3782704		2194	4283	6477	-	-	-	SO:0001583	missense	0				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1055G>A	20.37:g.3782704G>A	ENSP00000245960:p.Arg352Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.R352Q	ENST00000245960.5	37	c.1055	CCDS13067.1	20	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890147	0.52014	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	4.62	-1.61	0.08399	.	0.324362	0.30492	N	0.009518	T	0.31199	0.0789	M	0.62723	1.935	0.31376	N	0.679538	D;D;D;D;D;P	0.63880	0.993;0.993;0.993;0.97;0.97;0.905	P;P;P;P;P;B	0.53689	0.732;0.732;0.732;0.49;0.49;0.254	T	0.36261	-0.9755	10	0.39692	T	0.17	-10.493	8.6113	0.33804	0.6964:0.0:0.3036:0.0	.	261;274;288;311;338;352	B4DQZ3;B4DRC3;B4DIG0;P30305-3;P30305-2;P30305	.;.;.;.;.;MPIP2_HUMAN	Q	288;261;352;338;311	ENSP00000339125:R288Q;ENSP00000368918:R261Q;ENSP00000245960:R352Q;ENSP00000405972:R338Q;ENSP00000339170:R311Q	ENSP00000245960:R352Q	R	+	2	0	CDC25B	3730704	0.013000	0.17824	0.931000	0.37212	0.657000	0.38888	-0.072000	0.11486	-0.088000	0.12506	-0.218000	0.12543	CGG	CDC25B	-	pfam_MPI_Phosphatase	ENSG00000101224		0.657	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25B	HGNC	protein_coding	OTTHUMT00000077779.2	55	0.00	0	G	NM_021874		3782704	3782704	+1	no_errors	ENST00000245960	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	0.998	A
CNKSR2	22866	genome.wustl.edu	37	X	21458841	21458841	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chrX:21458841C>G	ENST00000379510.3	+	4	497	c.461C>G	c.(460-462)tCa>tGa	p.S154*	CNKSR2_ENST00000425654.2_Nonsense_Mutation_p.S154*|CNKSR2_ENST00000279451.4_Nonsense_Mutation_p.S154*|CNKSR2_ENST00000543067.1_Nonsense_Mutation_p.S154*	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	154	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ACAGACTATTCAGTTACAAGA	0.348																																						dbGAP											0													90.0	76.0	81.0					X																	21458841		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.461C>G	X.37:g.21458841C>G	ENSP00000368824:p.Ser154*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Nonsense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.S154*	ENST00000379510.3	37	c.461	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.468979	0.97590	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-1.3786	16.3238	0.82964	0.0:1.0:0.0:0.0	.	.	.	.	X	154	.	ENSP00000279451:S154X	S	+	2	0	CNKSR2	21368762	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.154000	0.77437	2.223000	0.72356	0.506000	0.49869	TCA	CNKSR2	-	pfam_CRIC_domain_Chordata	ENSG00000149970		0.348	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	195	0.00	0	C	NM_014927		21458841	21458841	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	nonsense	176	11.06	22	SNP	1.000	G
CORO7	79585	genome.wustl.edu	37	16	4412087	4412088	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr16:4412087_4412088insC	ENST00000251166.4	-	16	1621_1622	c.1476_1477insG	c.(1474-1479)gggctcfs	p.L493fs	CORO7_ENST00000539968.1_Frame_Shift_Ins_p.L273fs|CORO7-PAM16_ENST00000572467.1_Frame_Shift_Ins_p.L493fs|CORO7_ENST00000574025.1_Frame_Shift_Ins_p.L408fs|CORO7_ENST00000423908.2_Frame_Shift_Ins_p.L325fs|CORO7-PAM16_ENST00000572274.1_5'Flank|CORO7_ENST00000537233.2_Frame_Shift_Ins_p.L475fs	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	493					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						GTGAGGTTGAGCCCCTTGAGGT	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.1477dupG	16.37:g.4412091_4412091dupC	ENSP00000251166:p.Leu493fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFD6|B4DL18|I3L416|Q17RK4	Frame_Shift_Ins	INS	pfam_DUF1900,pfam_Protein_transpt,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L492fs	ENST00000251166.4	37	c.1477_1476	CCDS10513.1	16																																																																																			CORO7	-	NULL	ENSG00000103426		0.629	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7	HGNC	protein_coding	OTTHUMT00000251628.2	18	0.00	0	-	NM_024535		4412087	4412088	-1	no_errors	ENST00000572467	ensembl	human	known	69_37n	frame_shift_ins	14	26.32	5	INS	1.000:0.975	C
CNOT1	23019	genome.wustl.edu	37	16	58577381	58577381	+	Intron	SNP	A	A	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr16:58577381A>C	ENST00000317147.5	-	31	4767				CNOT1_ENST00000441024.2_Missense_Mutation_p.S1522A|CNOT1_ENST00000245138.4_Intron|CNOT1_ENST00000569240.1_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		atgatggaagacatcaaacaa	0.313																																						dbGAP											0													43.0	47.0	46.0					16																	58577381		1225	2250	3475	-	-	-	SO:0001627	intron_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+129T>G	16.37:g.58577381A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S1522A	ENST00000317147.5	37	c.4564	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	A	11.12	1.545076	0.27652	.	.	ENSG00000125107	ENST00000441024	T	0.44083	0.93	3.72	-5.34	0.02705	.	.	.	.	.	T	0.22437	0.0541	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29822	-0.9999	8	0.87932	D	0	.	0.3086	0.00284	0.2262:0.2921:0.1951:0.2866	.	1522	A5YKK6-4	.	A	1522	ENSP00000413113:S1522A	ENSP00000413113:S1522A	S	-	1	0	CNOT1	57134882	0.036000	0.19791	0.000000	0.03702	0.001000	0.01503	0.581000	0.23819	-0.998000	0.03446	-0.347000	0.07816	TCT	CNOT1	-	NULL	ENSG00000125107		0.313	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	51	0.00	0	A	NM_016284		58577381	58577381	-1	no_errors	ENST00000441024	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	0.000	C
COX10	1352	genome.wustl.edu	37	17	14110529	14110529	+	Nonstop_Mutation	SNP	G	G	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr17:14110529G>T	ENST00000261643.3	+	7	1408	c.1331G>T	c.(1330-1332)tGa>tTa	p.*444L	COX10_ENST00000536205.1_Nonstop_Mutation_p.*252L|COX10_ENST00000537334.1_Nonstop_Mutation_p.*227L	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	0					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		CCTCCCAGCTGAGAGCACTGG	0.622																																						dbGAP											0													11.0	13.0	12.0					17																	14110529		2169	4251	6420	-	-	-	SO:0001578	stop_lost	0			U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.1331G>T	17.37:g.14110529G>T	ENSP00000261643:p.*444Leuext*45	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6U5|B4DJ50|O15334|Q969F7	Nonstop_Mutation	SNP	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	p.*444L	ENST00000261643.3	37	c.1331	CCDS11166.1	17	.	.	.	.	.	.	.	.	.	.	G	5.665	0.307286	0.10733	.	.	ENSG00000006695	ENST00000261643;ENST00000536205;ENST00000537334	.	.	.	4.19	0.998	0.19857	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.6406	0.17562	0.0802:0.1379:0.6392:0.1427	.	.	.	.	L	444;252;227	.	.	X	+	2	2	COX10	14051254	0.316000	0.24580	0.001000	0.08648	0.000000	0.00434	0.887000	0.28254	0.137000	0.18759	-2.070000	0.00385	TGA	COX10	-	NULL	ENSG00000006695		0.622	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX10	HGNC	protein_coding	OTTHUMT00000130003.1	22	0.00	0	G	NM_001303		14110529	14110529	+1	no_errors	ENST00000261643	ensembl	human	known	69_37n	nonstop	2	71.43	5	SNP	0.009	T
CUL3	8452	genome.wustl.edu	37	2	225368461	225368461	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr2:225368461C>T	ENST00000264414.4	-	9	1623	c.1285G>A	c.(1285-1287)Gaa>Aaa	p.E429K	CUL3_ENST00000344951.4_Missense_Mutation_p.E363K|CUL3_ENST00000409777.1_Missense_Mutation_p.E405K|CUL3_ENST00000409096.1_Missense_Mutation_p.E405K	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	429					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TAATAACGTTCAAATACATCT	0.308																																						dbGAP											0													131.0	118.0	122.0					2																	225368461		2202	4295	6497	-	-	-	SO:0001583	missense	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1285G>A	2.37:g.225368461C>T	ENSP00000264414:p.Glu429Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.E429K	ENST00000264414.4	37	c.1285	CCDS2462.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.710775	0.96821	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.67	5.67	0.87782	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.92964	0.7761	H	0.97440	4.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.94962	0.8109	10	0.87932	D	0	.	19.7689	0.96353	0.0:1.0:0.0:0.0	.	363;407;429	Q13618-3;Q53S54;Q13618	.;.;CUL3_HUMAN	K	429;363;405;405	ENSP00000264414:E429K;ENSP00000343601:E363K;ENSP00000387200:E405K;ENSP00000386525:E405K	ENSP00000264414:E429K	E	-	1	0	CUL3	225076705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.656000	0.90262	0.650000	0.86243	GAA	CUL3	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	ENSG00000036257		0.308	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2	202	0.00	0	C			225368461	225368461	-1	no_errors	ENST00000264414	ensembl	human	known	69_37n	missense	75	43.61	58	SNP	1.000	T
PBDC1	51260	genome.wustl.edu	37	X	75397565	75397565	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chrX:75397565G>A	ENST00000373358.3	+	6	727	c.524G>A	c.(523-525)gGa>gAa	p.G175E	PBDC1_ENST00000373357.3_Missense_Mutation_p.E138K	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	175																	aacaatggaggagaaaaaaga	0.423																																						dbGAP											0													97.0	87.0	90.0					X																	75397565		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.524G>A	X.37:g.75397565G>A	ENSP00000362456:p.Gly175Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Put_polysacc_synth	p.G175E	ENST00000373358.3	37	c.524	CCDS14432.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.540|7.540	0.660519|0.660519	0.14645|0.14645	.|.	.|.	ENSG00000102390|ENSG00000102390	ENST00000373357|ENST00000373358	.|.	.|.	.|.	4.02|4.02	-2.63|-2.63	0.06133|0.06133	.|.	.|1.543430	.|0.03688	.|N	.|0.246651	T|T	0.27731|0.27731	0.0682|0.0682	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.18116|0.18116	-1.0347|-1.0347	6|9	0.11485|0.23891	T|T	0.65|0.37	-2.5279|-2.5279	9.5127|9.5127	0.39087|0.39087	0.736:0.0:0.264:0.0|0.736:0.0:0.264:0.0	.|.	.|175	.|Q9BVG4	.|CX026_HUMAN	K|E	138|175	.|.	ENSP00000362455:E138K|ENSP00000362456:G175E	E|G	+|+	1|2	0|0	CXorf26|CXorf26	75313968|75313968	0.013000|0.013000	0.17824|0.17824	0.000000|0.000000	0.03702|0.03702	0.045000|0.045000	0.14185|0.14185	0.131000|0.131000	0.15870|0.15870	-0.759000|-0.759000	0.04684|0.04684	-0.439000|-0.439000	0.05793|0.05793	GAG|GGA	CXorf26	-	NULL	ENSG00000102390		0.423	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf26	HGNC	protein_coding	OTTHUMT00000057294.1	523	0.00	0	G	NM_016500		75397565	75397565	+1	no_errors	ENST00000373358	ensembl	human	known	69_37n	missense	441	15.84	83	SNP	0.000	A
CUL4B	8450	genome.wustl.edu	37	X	119679331	119679331	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chrX:119679331G>T	ENST00000404115.3	-	7	1343	c.942C>A	c.(940-942)taC>taA	p.Y314*	CUL4B_ENST00000371322.5_Nonsense_Mutation_p.Y296*|snoU13_ENST00000605987.1_RNA|CUL4B_ENST00000336592.6_Nonsense_Mutation_p.Y301*	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	314					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TCTGAAGAACGTAAGTTCTAT	0.308																																						dbGAP											0													44.0	42.0	43.0					X																	119679331		2191	4270	6461	-	-	-	SO:0001587	stop_gained	0			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.942C>A	X.37:g.119679331G>T	ENSP00000384109:p.Tyr314*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Nonsense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.Y314*	ENST00000404115.3	37	c.942	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849285	0.91277	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115;ENST00000371323	.	.	.	5.79	-3.09	0.05331	.	0.108809	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1122	13.9374	0.64034	0.7185:0.0:0.2815:0.0	.	.	.	.	X	296;301;314;118	.	.	Y	-	3	2	CUL4B	119563359	0.017000	0.18338	0.971000	0.41717	0.992000	0.81027	-0.626000	0.05527	-0.657000	0.05373	-0.295000	0.09555	TAC	CUL4B	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	ENSG00000158290		0.308	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	115	0.86	1	G	NM_003588		119679331	119679331	-1	no_errors	ENST00000404115	ensembl	human	known	69_37n	nonsense	142	23.66	44	SNP	0.809	T
DOT1L	84444	genome.wustl.edu	37	19	2202727	2202727	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr19:2202727G>A	ENST00000398665.3	+	9	772	c.736G>A	c.(736-738)Ggt>Agt	p.G246S		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	246	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTTGCCTTTGGTCCTGAGGT	0.522																																						dbGAP											0													175.0	185.0	182.0					19																	2202727		2001	4165	6166	-	-	-	SO:0001583	missense	0			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.736G>A	19.37:g.2202727G>A	ENSP00000381657:p.Gly246Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O60379|Q96JL1	Missense_Mutation	SNP	pfam_DOT1,pirsf_Histone_H3-K79_MeTrfase_met	p.G246S	ENST00000398665.3	37	c.736	CCDS42460.1	19	.	.	.	.	.	.	.	.	.	.	G	33	5.247610	0.95305	.	.	ENSG00000104885	ENST00000398665;ENST00000221482	T	0.21734	1.99	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.44664	0.1304	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47058	-0.9146	10	0.87932	D	0	-10.5123	16.1689	0.81788	0.0:0.0:1.0:0.0	.	246	Q8TEK3-2	.	S	246	ENSP00000381657:G246S	ENSP00000221482:G246S	G	+	1	0	DOT1L	2153727	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.335000	0.96500	2.043000	0.60533	0.462000	0.41574	GGT	DOT1L	-	pfam_DOT1,pirsf_Histone_H3-K79_MeTrfase_met	ENSG00000104885		0.522	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	HGNC	protein_coding	OTTHUMT00000318066.1	149	0.00	0	G	NM_032482		2202727	2202727	+1	no_errors	ENST00000398665	ensembl	human	known	69_37n	missense	68	31.31	31	SNP	1.000	A
RIPPLY3	53820	genome.wustl.edu	37	21	38390475	38390475	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr21:38390475T>G	ENST00000329553.2	+	4	751	c.541T>G	c.(541-543)Tca>Gca	p.S181A	RIPPLY3_ENST00000485272.1_3'UTR	NM_018962.2	NP_061835.1	P57055	DSCR6_HUMAN	ripply transcriptional repressor 3	181					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pharyngeal system development (GO:0060037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											AGGTGTCTCCTCAAGGGGTGG	0.637																																						dbGAP											0													42.0	39.0	40.0					21																	38390475		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037158	CCDS13648.1	21q22.2	2013-07-23	2013-07-23	2013-06-04	ENSG00000183145	ENSG00000183145			3047	protein-coding gene	gene with protein product		609892	"""Down syndrome critical region gene 6"", ""ripply3 homolog (zebrafish)"""	DSCR6		10814524, 22354841	Standard	NM_018962		Approved			P57055	OTTHUMG00000086639	ENST00000329553.2:c.541T>G	21.37:g.38390475T>G	ENSP00000331734:p.Ser181Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S181A	ENST00000329553.2	37	c.541	CCDS13648.1	21	.	.	.	.	.	.	.	.	.	.	T	3.130	-0.178697	0.06380	.	.	ENSG00000183145	ENST00000329553	.	.	.	4.59	-1.93	0.07594	.	1.106060	0.07061	N	0.833760	T	0.12220	0.0297	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.24584	-1.0156	9	0.02654	T	1	0.2031	0.945	0.01363	0.1601:0.2846:0.1574:0.3979	.	181	P57055	DSCR6_HUMAN	A	181	.	ENSP00000331734:S181A	S	+	1	0	DSCR6	37312345	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.320000	0.08028	-0.275000	0.09219	-0.441000	0.05720	TCA	DSCR6	-	NULL	ENSG00000183145		0.637	RIPPLY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR6	HGNC	protein_coding	OTTHUMT00000194703.1	28	0.00	0	T			38390475	38390475	+1	no_errors	ENST00000329553	ensembl	human	known	69_37n	missense	42	23.21	13	SNP	0.000	G
EFNB3	1949	genome.wustl.edu	37	17	7612855	7612856	+	Frame_Shift_Ins	INS	-	-	C	rs532773147	byFrequency	TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr17:7612855_7612856insC	ENST00000226091.2	+	5	1381_1382	c.984_985insC	c.(985-987)cccfs	p.P329fs		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	329					adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				TGCAGGATGGGCCCCCCCAGAG	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.991dupC	17.37:g.7612862_7612862dupC	ENSP00000226091:p.Pro329fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Frame_Shift_Ins	INS	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.Q330fs	ENST00000226091.2	37	c.984_985	CCDS11120.1	17																																																																																			EFNB3	-	NULL	ENSG00000108947		0.574	EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB3	HGNC	protein_coding	OTTHUMT00000226965.1	42	0.00	0	-	NM_001406		7612855	7612856	+1	no_errors	ENST00000226091	ensembl	human	known	69_37n	frame_shift_ins	27	10.00	3	INS	1.000:1.000	C
ELF2	1998	genome.wustl.edu	37	4	139980483	139980483	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr4:139980483G>C	ENST00000394235.2	-	10	1902	c.1400C>G	c.(1399-1401)aCt>aGt	p.T467S	ELF2_ENST00000358635.3_Missense_Mutation_p.T419S|ELF2_ENST00000515489.1_Intron|ELF2_ENST00000265495.4_Missense_Mutation_p.T467S|ELF2_ENST00000510408.1_Missense_Mutation_p.T407S|ELF2_ENST00000379549.2_Missense_Mutation_p.T390S|ELF2_ENST00000379550.1_Missense_Mutation_p.T479S	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)											endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					TCCTGATCCAGTCAGATTTGA	0.443																																						dbGAP											0													84.0	76.0	78.0					4																	139980483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.1400C>G	4.37:g.139980483G>C	ENSP00000377782:p.Thr467Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.T479S	ENST00000394235.2	37	c.1436	CCDS3744.1	4	.	.	.	.	.	.	.	.	.	.	G	8.699	0.909348	0.17833	.	.	ENSG00000109381	ENST00000358635;ENST00000394235;ENST00000379550;ENST00000265495;ENST00000379549;ENST00000540754;ENST00000510408	T;T;T;T;T;T	0.12465	2.68;2.87;2.87;2.87;2.86;2.68	5.8	5.8	0.92144	.	0.399426	0.32473	N	0.006047	T	0.09202	0.0227	N	0.14661	0.345	0.35010	D	0.756823	B;B;B;B;B	0.11235	0.0;0.0;0.003;0.0;0.004	B;B;B;B;B	0.08055	0.001;0.001;0.003;0.001;0.003	T	0.26849	-1.0091	9	.	.	.	.	15.534	0.75986	0.0:0.1374:0.8626:0.0	.	282;467;390;407;419	B7Z8R4;Q15723-1;E9PCX3;B7Z720;Q15723-3	.;.;.;.;.	S	419;467;479;467;390;282;407	ENSP00000351458:T419S;ENSP00000377782:T467S;ENSP00000368868:T479S;ENSP00000265495:T467S;ENSP00000368867:T390S;ENSP00000426997:T407S	.	T	-	2	0	ELF2	140199933	1.000000	0.71417	0.929000	0.37066	0.990000	0.78478	4.807000	0.62576	2.751000	0.94390	0.650000	0.86243	ACT	ELF2	-	NULL	ENSG00000109381		0.443	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF2	HGNC	protein_coding	OTTHUMT00000257233.2	160	0.00	0	G	NM_006874		139980483	139980483	-1	no_errors	ENST00000379550	ensembl	human	known	69_37n	missense	142	30.39	62	SNP	0.994	C
EML5	161436	genome.wustl.edu	37	14	89178714	89178714	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr14:89178714C>T	ENST00000380664.5	-	10	1557	c.1558G>A	c.(1558-1560)Gat>Aat	p.D520N	EML5_ENST00000352093.5_Missense_Mutation_p.D520N|EML5_ENST00000554922.1_Missense_Mutation_p.D520N			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	520						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GAATTTATATCGTTGATATCT	0.338																																						dbGAP											0													72.0	71.0	72.0					14																	89178714		1825	4085	5910	-	-	-	SO:0001583	missense	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.1558G>A	14.37:g.89178714C>T	ENSP00000370039:p.Asp520Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D520N	ENST00000380664.5	37	c.1558	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176835	0.78564	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.59364	0.5;0.27;5.04	4.97	4.97	0.65823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	H	0.94808	3.585	0.58432	D	0.999997	B	0.28291	0.206	B	0.21546	0.035	T	0.75408	-0.3328	10	0.56958	D	0.05	-20.0339	18.4169	0.90574	0.0:1.0:0.0:0.0	.	520	Q05BV3	EMAL5_HUMAN	N	520	ENSP00000451998:D520N;ENSP00000298315:D520N;ENSP00000370039:D520N	ENSP00000298315:D520N	D	-	1	0	EML5	88248467	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.320000	0.79064	2.562000	0.86427	0.650000	0.86243	GAT	EML5	-	superfamily_WD40_repeat_dom	ENSG00000165521		0.338	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	114	0.00	0	C			89178714	89178714	-1	no_errors	ENST00000554922	ensembl	human	known	69_37n	missense	114	32.75	56	SNP	1.000	T
EPHA7	2045	genome.wustl.edu	37	6	93969111	93969111	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr6:93969111C>G	ENST00000369303.4	-	10	2069	c.1885G>C	c.(1885-1887)Gat>Cat	p.D629H		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	629					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CAGGAGGCATCTAGCTCCTTG	0.428																																						dbGAP											0													195.0	174.0	181.0					6																	93969111		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1885G>C	6.37:g.93969111C>G	ENSP00000358309:p.Asp629His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.D629H	ENST00000369303.4	37	c.1885	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261256	0.59431	.	.	ENSG00000135333	ENST00000369303	T	0.21932	1.98	5.9	5.9	0.94986	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	M	0.66439	2.03	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.948;0.999;0.997	T	0.05666	-1.0871	10	0.48119	T	0.1	.	20.2821	0.98520	0.0:1.0:0.0:0.0	.	625;624;629	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	H	629	ENSP00000358309:D629H	ENSP00000358309:D629H	D	-	1	0	EPHA7	94025832	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.786000	0.95864	0.563000	0.77884	GAT	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Kinase-like_dom	ENSG00000135333		0.428	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	122	0.00	0	C			93969111	93969111	-1	no_errors	ENST00000369303	ensembl	human	known	69_37n	missense	163	12.83	24	SNP	1.000	G
ERBB4	2066	genome.wustl.edu	37	2	212652791	212652791	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr2:212652791G>C	ENST00000342788.4	-	4	825	c.515C>G	c.(514-516)cCt>cGt	p.P172R	ERBB4_ENST00000402597.1_Missense_Mutation_p.P172R|ERBB4_ENST00000436443.1_Missense_Mutation_p.P172R|ERBB4_ENST00000484474.1_5'UTR	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	172					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CAAGTTGGAAGGCCATGGGTT	0.373										TSP Lung(8;0.080)																												dbGAP											0													107.0	100.0	102.0					2																	212652791		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.515C>G	2.37:g.212652791G>C	ENSP00000342235:p.Pro172Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P172R	ENST00000342788.4	37	c.515	CCDS2394.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.266|9.266	1.044425|1.044425	0.19748|0.19748	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597;ENST00000435846	.|T;T;T;T	.|0.81415	.|-1.49;-1.49;-1.49;-1.49	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.360508	.|0.32970	.|N	.|0.005423	T|T	0.63640|0.63640	0.2528|0.2528	N|N	0.12569|0.12569	0.235|0.235	0.36708|0.36708	D|D	0.880468|0.880468	.|P;B;B;P;B	.|0.35844	.|0.524;0.001;0.008;0.524;0.389	.|B;B;B;B;B	.|0.29862	.|0.108;0.001;0.003;0.108;0.081	T|T	0.67480|0.67480	-0.5660|-0.5660	5|10	.|0.14656	.|T	.|0.56	.|.	17.169|17.169	0.86824|0.86824	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|172;172;31;172;172	.|Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.|.;.;.;.;ERBB4_HUMAN	V|R	172|172;172;172;113	.|ENSP00000342235:P172R;ENSP00000403204:P172R;ENSP00000385565:P172R;ENSP00000405564:P113R	.|ENSP00000342235:P172R	L|P	-|-	1|2	0|0	ERBB4|ERBB4	212361036|212361036	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.471000|4.471000	0.60182|0.60182	2.482000|2.482000	0.83794|0.83794	0.484000|0.484000	0.47621|0.47621	CTT|CCT	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000178568		0.373	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	130	0.00	0	G	NM_001042599		212652791	212652791	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	missense	93	12.26	13	SNP	1.000	C
ERGIC1	57222	genome.wustl.edu	37	5	172359501	172359502	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr5:172359501_172359502insCT	ENST00000393784.3	+	8	743_744	c.604_605insCT	c.(604-606)aagfs	p.K202fs		NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	202					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAAGAGTGGCAAGCAGCGGTAC	0.639											OREG0017050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	Exception_encountered	5.37:g.172359501_172359502insCT	ENSP00000377374:p.Lys202fs	Somatic	237	WXS	Illumina GAIIx	Phase_IV	Q9H0L0|Q9H2J2|Q9ULN9	Frame_Shift_Ins	INS	pfam_DUF1692	p.K202fs	ENST00000393784.3	37	c.604_605	CCDS34292.1	5																																																																																			ERGIC1	-	pfam_DUF1692	ENSG00000113719		0.639	ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC1	HGNC	protein_coding	OTTHUMT00000252938.3	61	0.00	0	-	NM_020462		172359501	172359502	+1	no_errors	ENST00000393784	ensembl	human	known	69_37n	frame_shift_ins	52	18.75	12	INS	1.000:1.000	CT
FBLN1	2192	genome.wustl.edu	37	22	45996240	45996241	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr22:45996240_45996241delCT	ENST00000327858.6	+	17	2121_2122	c.2026_2027delCT	c.(2026-2028)ctgfs	p.L676fs	FBLN1_ENST00000348697.2_Frame_Shift_Del_p.L676fs	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	676					embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CGTCCTGAAGCTGGAGATGAAC	0.594																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.2026_2027delCT	22.37:g.45996240_45996241delCT	ENSP00000331544:p.Leu676fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Frame_Shift_Del	DEL	pfam_EGF-like_Ca-bd,pfam_Anaphylatoxin/fibulin,smart_Anaphylatoxin/fibulin,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibulin-1,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.L676fs	ENST00000327858.6	37	c.2026_2027	CCDS14067.1	22																																																																																			FBLN1	-	pirsf_Fibulin-1	ENSG00000077942		0.594	FBLN1-001	KNOWN	basic|CCDS	protein_coding	FBLN1	HGNC	protein_coding	OTTHUMT00000322287.1	51	0.00	0	CT	NM_006486		45996240	45996241	+1	no_errors	ENST00000327858	ensembl	human	known	69_37n	frame_shift_del	38	33.33	19	DEL	1.000:1.000	-
FN3KRP	79672	genome.wustl.edu	37	17	80676816	80676816	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr17:80676816T>C	ENST00000269373.6	+	2	249	c.176T>C	c.(175-177)tTa>tCa	p.L59S	RP11-388C12.1_ENST00000574471.1_lincRNA|FN3KRP_ENST00000535965.1_Missense_Mutation_p.L9S	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	59							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			ATGGCAAGTTTAACTGCCATC	0.512																																						dbGAP											0													104.0	98.0	100.0					17																	80676816		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.176T>C	17.37:g.80676816T>C	ENSP00000269373:p.Leu59Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969F4|Q9H0U7	Missense_Mutation	SNP	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase	p.L59S	ENST00000269373.6	37	c.176	CCDS11817.1	17	.	.	.	.	.	.	.	.	.	.	T	24.3	4.521590	0.85600	.	.	ENSG00000141560	ENST00000269373;ENST00000535965	T;T	0.70749	-0.51;-0.51	5.73	5.73	0.89815	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000001	D	0.90222	0.6943	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93780	0.7083	10	0.87932	D	0	-12.103	16.0183	0.80460	0.0:0.0:0.0:1.0	.	59	Q9HA64	KT3K_HUMAN	S	59;9	ENSP00000269373:L59S;ENSP00000444994:L9S	ENSP00000269373:L59S	L	+	2	0	FN3KRP	78270105	0.990000	0.36364	0.099000	0.21106	0.990000	0.78478	7.702000	0.84576	2.187000	0.69744	0.533000	0.62120	TTA	FN3KRP	-	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase	ENSG00000141560		0.512	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FN3KRP	HGNC	protein_coding	OTTHUMT00000439219.1	64	0.00	0	T	NM_024619		80676816	80676816	+1	no_errors	ENST00000269373	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.861	C
FOXRED1	55572	genome.wustl.edu	37	11	126147521	126147521	+	Silent	SNP	G	G	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr11:126147521G>T	ENST00000263578.5	+	11	1472	c.1398G>T	c.(1396-1398)ctG>ctT	p.L466L	FOXRED1_ENST00000534011.1_3'UTR|FOXRED1_ENST00000442061.2_Silent_p.L296L|FOXRED1_ENST00000532125.1_Silent_p.L452L	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	466						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		CCATCGACCTGAGCCCCTTCC	0.562																																						dbGAP											0													120.0	102.0	108.0					11																	126147521		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0				CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.1398G>T	11.37:g.126147521G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Silent	SNP	pfam_FAD-dep_OxRdtase	p.L466	ENST00000263578.5	37	c.1398	CCDS8471.1	11																																																																																			FOXRED1	-	NULL	ENSG00000110074		0.562	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXRED1	HGNC	protein_coding	OTTHUMT00000386434.1	24	0.00	0	G	NM_017547		126147521	126147521	+1	no_errors	ENST00000263578	ensembl	human	known	69_37n	silent	19	17.39	4	SNP	0.995	T
GAS8	2622	genome.wustl.edu	37	16	90097863	90097863	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr16:90097863G>A	ENST00000268699.4	+	3	369	c.247G>A	c.(247-249)Gag>Aag	p.E83K	C16orf3_ENST00000408886.2_5'Flank|GAS8_ENST00000540721.1_3'UTR|GAS8_ENST00000536122.1_Missense_Mutation_p.E58K	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8	83	Regulates microtubule-binding. {ECO:0000250}.				cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		CAAAGACCGGGAGATGGAAGA	0.602																																						dbGAP											0													94.0	106.0	102.0					16																	90097863		2192	4296	6488	-	-	-	SO:0001583	missense	0			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.247G>A	16.37:g.90097863G>A	ENSP00000268699:p.Glu83Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	NULL	p.E83K	ENST00000268699.4	37	c.247	CCDS10992.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.970486	0.97156	.	.	ENSG00000141013	ENST00000536122;ENST00000268699;ENST00000540721;ENST00000537797	T;T	0.39229	1.13;1.09	5.88	5.88	0.94601	.	0.087896	0.85682	D	0.000000	T	0.73575	0.3604	M	0.90922	3.16	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.992	D;D;P	0.74348	0.983;0.952;0.878	T	0.77991	-0.2379	9	.	.	.	-44.6096	20.2366	0.98359	0.0:0.0:1.0:0.0	.	54;83;83	B7Z1X3;B7Z9B0;O95995	.;.;GAS8_HUMAN	K	58;83;54;83	ENSP00000440977:E58K;ENSP00000268699:E83K	.	E	+	1	0	GAS8	88625364	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.416000	0.73332	2.792000	0.96026	0.557000	0.71058	GAG	GAS8	-	NULL	ENSG00000141013		0.602	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS8	HGNC	protein_coding	OTTHUMT00000272877.2	227	0.00	0	G			90097863	90097863	+1	no_errors	ENST00000268699	ensembl	human	known	69_37n	missense	165	15.74	31	SNP	1.000	A
GLUD1	2746	genome.wustl.edu	37	10	88820732	88820732	+	Silent	SNP	A	A	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr10:88820732A>G	ENST00000277865.4	-	7	1095	c.999T>C	c.(997-999)tcT>tcC	p.S333S	GLUD1_ENST00000465164.1_5'UTR|GLUD1_ENST00000544149.1_Silent_p.S200S|GLUD1_ENST00000537649.1_Silent_p.S166S	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	333					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	TACTCCCATCAGACTCACCAA	0.353																																						dbGAP											0													189.0	193.0	192.0					10																	88820732		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.999T>C	10.37:g.88820732A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV55|B4DGN5|Q5TBU3	Silent	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.S333	ENST00000277865.4	37	c.999	CCDS7382.1	10																																																																																			GLUD1	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C	ENSG00000148672		0.353	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD1	HGNC	protein_coding	OTTHUMT00000049188.1	345	0.00	0	A	NM_005271		88820732	88820732	-1	no_errors	ENST00000277865	ensembl	human	known	69_37n	silent	217	25.85	76	SNP	0.996	G
GPA33	10223	genome.wustl.edu	37	1	167024317	167024317	+	Silent	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:167024317G>A	ENST00000367868.3	-	6	1066	c.723C>T	c.(721-723)atC>atT	p.I241I	RP11-102C16.3_ENST00000417644.1_RNA|GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	241						extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						CGCCCACCGCGATGCCCACAT	0.582																																						dbGAP											0													99.0	79.0	86.0					1																	167024317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.723C>T	1.37:g.167024317G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZP6	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.I241	ENST00000367868.3	37	c.723	CCDS1258.1	1																																																																																			GPA33	-	NULL	ENSG00000143167		0.582	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPA33	HGNC	protein_coding	OTTHUMT00000083245.1	111	0.00	0	G	NM_005814		167024317	167024317	-1	no_errors	ENST00000367868	ensembl	human	known	69_37n	silent	180	10.89	22	SNP	0.167	A
GRID2IP	392862	genome.wustl.edu	37	7	6541514	6541514	+	Silent	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr7:6541514C>T	ENST00000457091.2	-	20	3296	c.3297G>A	c.(3295-3297)ctG>ctA	p.L1099L	GRID2IP_ENST00000435185.1_Silent_p.L915L|GRID2IP_ENST00000452113.1_Silent_p.L908L	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	1099	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GGTCACTGGTCAGGGCCCGTT	0.602																																						dbGAP											0													55.0	54.0	54.0					7																	6541514		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.3297G>A	7.37:g.6541514C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_FH2_actin-bd,pfam_PDZ,superfamily_FH2_actin-bd,superfamily_PDZ,smart_PDZ,smart_Actin-bd_FH2/DRF_autoreg,pfscan_PDZ	p.L1099	ENST00000457091.2	37	c.3297	CCDS47537.1	7																																																																																			GRID2IP	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000215045		0.602	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	23	0.00	0	C	XM_294249		6541514	6541514	-1	no_errors	ENST00000457091	ensembl	human	putative	69_37n	silent	19	20.83	5	SNP	1.000	T
GRIN2B	2904	genome.wustl.edu	37	12	13722841	13722841	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr12:13722841C>A	ENST00000609686.1	-	11	2491	c.2282G>T	c.(2281-2283)gGc>gTc	p.G761V		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	761					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AATGCCATAGCCAGTGGAAGC	0.512																																						dbGAP											0													80.0	65.0	70.0					12																	13722841		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2282G>T	12.37:g.13722841C>A	ENSP00000477455:p.Gly761Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G761V	ENST00000609686.1	37	c.2282	CCDS8662.1	12	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724023	0.89298	.	.	ENSG00000150086	ENST00000279593	T	0.56103	0.48	5.55	5.55	0.83447	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.117230	0.56097	D	0.000022	T	0.77987	0.4213	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81600	-0.0859	10	0.87932	D	0	.	19.5042	0.95108	0.0:1.0:0.0:0.0	.	761	Q13224	NMDE2_HUMAN	V	761	ENSP00000279593:G761V	ENSP00000279593:G761V	G	-	2	0	GRIN2B	13614108	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	7.771000	0.85420	2.590000	0.87494	0.655000	0.94253	GGC	GRIN2B	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000150086		0.512	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	65	0.00	0	C			13722841	13722841	-1	no_errors	ENST00000279593	ensembl	human	known	69_37n	missense	49	19.67	12	SNP	1.000	A
HEPH	9843	genome.wustl.edu	37	X	65408292	65408292	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chrX:65408292G>T	ENST00000343002.2	+	4	1381	c.717G>T	c.(715-717)tgG>tgT	p.W239C	HEPH_ENST00000336279.5_5'UTR|HEPH_ENST00000419594.1_Missense_Mutation_p.W242C|HEPH_ENST00000519389.1_Missense_Mutation_p.W293C|HEPH_ENST00000374727.3_Missense_Mutation_p.W242C|HEPH_ENST00000441993.2_Missense_Mutation_p.W242C			Q9BQS7	HEPH_HUMAN	hephaestin	239	Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						ACCTCAGCTGGCATCTCAATG	0.498																																						dbGAP											0													130.0	93.0	106.0					X																	65408292		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.717G>T	X.37:g.65408292G>T	ENSP00000343939:p.Trp239Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.W293C	ENST00000343002.2	37	c.879		X	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774089	0.69992	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	4.78	4.78	0.61160	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	H	0.95224	3.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	D	0.96055	0.9034	10	0.87932	D	0	.	15.461	0.75356	0.0:0.0:1.0:0.0	.	293;242;239	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	C	293;242;242;242;239;239	ENSP00000430620:W293C;ENSP00000363859:W242C;ENSP00000411687:W242C;ENSP00000413211:W242C;ENSP00000343939:W239C;ENSP00000398078:W239C	ENSP00000343939:W239C	W	+	3	0	HEPH	65325017	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	9.262000	0.95591	1.944000	0.56390	0.594000	0.82650	TGG	HEPH	-	superfamily_Cupredoxin	ENSG00000089472		0.498	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	208	0.00	0	G	NM_138737		65408292	65408292	+1	no_errors	ENST00000519389	ensembl	human	known	69_37n	missense	208	21.51	57	SNP	1.000	T
HMHA1	23526	genome.wustl.edu	37	19	1084279	1084279	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr19:1084279delC	ENST00000313093.2	+	22	3229	c.2998delC	c.(2998-3000)ccgfs	p.P1000fs	HMHA1_ENST00000539243.2_Frame_Shift_Del_p.P1016fs|HMHA1_ENST00000586866.1_Frame_Shift_Del_p.P1004fs|HMHA1_ENST00000591169.1_3'UTR|HMHA1_ENST00000536472.1_Frame_Shift_Del_p.P868fs|HMHA1_ENST00000590214.1_Frame_Shift_Del_p.P1027fs|HMHA1_ENST00000543365.1_Frame_Shift_Del_p.P883fs|HMHA1_ENST00000590577.1_Frame_Shift_Del_p.P635fs	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	1000					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCCAGGTGCCGTACCTGGA	0.637																																						dbGAP											0													59.0	60.0	60.0					19																	1084279		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2998delC	19.37:g.1084279delC	ENSP00000316772:p.Pro1000fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.P1000fs	ENST00000313093.2	37	c.2998	CCDS32863.1	19																																																																																			HMHA1	-	NULL	ENSG00000180448		0.637	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	41	0.00	0	C			1084279	1084279	+1	no_errors	ENST00000313093	ensembl	human	known	69_37n	frame_shift_del	42	10.42	5	DEL	0.069	-
HPS3	84343	genome.wustl.edu	37	3	148871407	148871407	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr3:148871407G>A	ENST00000296051.2	+	7	1512	c.1372G>A	c.(1372-1374)Gag>Aag	p.E458K	HPS3_ENST00000460120.1_Missense_Mutation_p.E293K	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	458					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AGCCATTCCAGAGAGAAGACA	0.423									Hermansky-Pudlak syndrome																													dbGAP											0													93.0	97.0	96.0					3																	148871407		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1372G>A	3.37:g.148871407G>A	ENSP00000296051:p.Glu458Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps3_subunit	p.E458K	ENST00000296051.2	37	c.1372	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.194987	0.94960	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.64438	-0.1;-0.1	5.97	5.97	0.96955	.	0.224070	0.44483	N	0.000444	T	0.72890	0.3517	M	0.61703	1.905	0.50171	D	0.999859	P;P	0.51791	0.948;0.802	P;P	0.52646	0.705;0.506	T	0.73519	-0.3957	10	0.62326	D	0.03	-11.9439	20.4136	0.99023	0.0:0.0:1.0:0.0	.	293;458	G5E9V4;Q969F9	.;HPS3_HUMAN	K	458;293	ENSP00000296051:E458K;ENSP00000418230:E293K	ENSP00000296051:E458K	E	+	1	0	HPS3	150354097	1.000000	0.71417	0.982000	0.44146	0.957000	0.61999	7.368000	0.79567	2.819000	0.97034	0.655000	0.94253	GAG	HPS3	-	pirsf_BLOC-2_complex_Hps3_subunit	ENSG00000163755		0.423	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	200	0.00	0	G	NM_032383		148871407	148871407	+1	no_errors	ENST00000296051	ensembl	human	known	69_37n	missense	202	11.35	26	SNP	1.000	A
ICAM4	3386	genome.wustl.edu	37	19	10397718	10397719	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr19:10397718_10397719insT	ENST00000380770.3	+	1	76_77	c.30_31insT	c.(31-33)tttfs	p.F11fs	CTD-2369P2.5_ENST00000592893.1_RNA|ICAM5_ENST00000221980.4_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA|ICAM4_ENST00000393717.2_Frame_Shift_Ins_p.F11fs|ICAM4_ENST00000340992.4_Frame_Shift_Ins_p.F11fs	NM_001544.4	NP_001535.1	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)	11					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)	p.L13fs*40(1)		breast(1)|large_intestine(3)|lung(2)|pancreas(1)	7			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TGTCGCTGCTGTTTTTTTTGGC	0.673																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X93093	CCDS12232.1, CCDS32904.1, CCDS42500.1	19p13.2	2014-07-19	2006-02-23		ENSG00000105371	ENSG00000105371		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5347	protein-coding gene	gene with protein product		614088	"""intercellular adhesion molecule 4, Landsteiner-Wiener blood group"", ""Landsteiner-Wiener blood group"", ""intercellular adhesion molecule 4 (LW blood group)"""	LW		8639917, 6431896	Standard	NM_001039132		Approved	CD242	uc002mnr.2	Q14773	OTTHUMG00000180405	ENST00000380770.3:c.38dupT	19.37:g.10397726_10397726dupT	ENSP00000370147:p.Phe11fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8X2|Q14771|Q14772|Q16375|Q9BWR0	Frame_Shift_Ins	INS	pfam_ICAM_N	p.L12fs	ENST00000380770.3	37	c.30_31	CCDS12232.1	19																																																																																			ICAM4	-	NULL	ENSG00000105371		0.673	ICAM4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICAM4	HGNC	protein_coding	OTTHUMT00000451214.1	25	0.00	0	-	NM_001544		10397718	10397719	+1	no_errors	ENST00000340992	ensembl	human	known	69_37n	frame_shift_ins	5	28.57	2	INS	0.002:0.004	T
IPO8	10526	genome.wustl.edu	37	12	30814170	30814170	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr12:30814170C>G	ENST00000256079.4	-	16	2124	c.1786G>C	c.(1786-1788)Gat>Cat	p.D596H	IPO8_ENST00000544829.1_Missense_Mutation_p.D391H	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	596					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCATATTCATCACTTTGAAGA	0.338																																						dbGAP											0													112.0	107.0	108.0					12																	30814170		2201	4300	6501	-	-	-	SO:0001583	missense	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1786G>C	12.37:g.30814170C>G	ENSP00000256079:p.Asp596His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7M3	Missense_Mutation	SNP	pfam_Importin-beta_N,pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.D596H	ENST00000256079.4	37	c.1786	CCDS8719.1	12	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934548	0.73442	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.70869	-0.52;-0.52	4.42	4.42	0.53409	Armadillo-like helical (1);Armadillo-type fold (1);	0.161460	0.53938	D	0.000057	T	0.80439	0.4623	L	0.54323	1.7	0.49687	D	0.999812	D;D;P	0.63046	0.991;0.992;0.928	D;D;P	0.66979	0.948;0.924;0.67	T	0.81775	-0.0778	10	0.51188	T	0.08	-16.1504	17.3785	0.87399	0.0:1.0:0.0:0.0	.	391;72;596	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	H	596;72;391	ENSP00000256079:D596H;ENSP00000444520:D391H	ENSP00000256079:D596H	D	-	1	0	IPO8	30705437	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.325000	0.65869	2.154000	0.67381	0.491000	0.48974	GAT	IPO8	-	superfamily_ARM-type_fold	ENSG00000133704		0.338	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	223	0.00	0	C	NM_006390		30814170	30814170	-1	no_errors	ENST00000256079	ensembl	human	known	69_37n	missense	136	19.88	34	SNP	1.000	G
IPO8	10526	genome.wustl.edu	37	12	30815380	30815380	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr12:30815380C>T	ENST00000256079.4	-	15	1974	c.1636G>A	c.(1636-1638)Gaa>Aaa	p.E546K	IPO8_ENST00000544829.1_Missense_Mutation_p.E341K	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	546					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TGCAACAGTTCCTGCATAATA	0.348																																						dbGAP											0													139.0	115.0	123.0					12																	30815380		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1636G>A	12.37:g.30815380C>T	ENSP00000256079:p.Glu546Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7M3	Missense_Mutation	SNP	pfam_Importin-beta_N,pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.E546K	ENST00000256079.4	37	c.1636	CCDS8719.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.285509	0.95517	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.64803	-0.12;-0.12	4.5	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.104876	0.64402	D	0.000005	T	0.70962	0.3284	L	0.49640	1.575	0.80722	D	1	D;D;B	0.67145	0.996;0.986;0.25	D;P;B	0.68621	0.959;0.86;0.109	T	0.65459	-0.6163	10	0.09843	T	0.71	-19.7093	17.5541	0.87885	0.0:1.0:0.0:0.0	.	341;22;546	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	K	546;22;341	ENSP00000256079:E546K;ENSP00000444520:E341K	ENSP00000256079:E546K	E	-	1	0	IPO8	30706647	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.466000	0.80914	2.225000	0.72522	0.655000	0.94253	GAA	IPO8	-	superfamily_ARM-type_fold	ENSG00000133704		0.348	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	182	0.00	0	C	NM_006390		30815380	30815380	-1	no_errors	ENST00000256079	ensembl	human	known	69_37n	missense	126	28.41	50	SNP	1.000	T
IPO8	10526	genome.wustl.edu	37	12	30819121	30819121	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr12:30819121C>G	ENST00000256079.4	-	11	1547	c.1209G>C	c.(1207-1209)aaG>aaC	p.K403N	IPO8_ENST00000544829.1_Missense_Mutation_p.K198N	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	403					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CTTTTCTTTTCTTTGCAGCAG	0.328																																						dbGAP											0													46.0	51.0	50.0					12																	30819121		2203	4295	6498	-	-	-	SO:0001583	missense	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1209G>C	12.37:g.30819121C>G	ENSP00000256079:p.Lys403Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7M3	Missense_Mutation	SNP	pfam_Importin-beta_N,pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.K403N	ENST00000256079.4	37	c.1209	CCDS8719.1	12	.	.	.	.	.	.	.	.	.	.	C	11.57	1.676707	0.29783	.	.	ENSG00000133704	ENST00000256079;ENST00000544829	T;T	0.68181	-0.31;-0.31	4.31	3.42	0.39159	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.048600	0.85682	D	0.000000	T	0.58764	0.2145	L	0.47716	1.5	0.45318	D	0.998317	B;B	0.24092	0.097;0.009	B;B	0.30105	0.111;0.02	T	0.57365	-0.7824	10	0.45353	T	0.12	-22.5917	9.5234	0.39149	0.0:0.8234:0.0:0.1766	.	198;403	B7Z7M3;O15397	.;IPO8_HUMAN	N	403;198	ENSP00000256079:K403N;ENSP00000444520:K198N	ENSP00000256079:K403N	K	-	3	2	IPO8	30710388	0.938000	0.31826	1.000000	0.80357	0.994000	0.84299	0.181000	0.16880	1.156000	0.42514	0.585000	0.79938	AAG	IPO8	-	pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold	ENSG00000133704		0.328	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	81	0.00	0	C	NM_006390		30819121	30819121	-1	no_errors	ENST00000256079	ensembl	human	known	69_37n	missense	41	37.88	25	SNP	1.000	G
IRF9	10379	genome.wustl.edu	37	14	24631474	24631474	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr14:24631474C>A	ENST00000396864.3	+	2	408	c.121C>A	c.(121-123)Ccc>Acc	p.P41T	RP11-468E2.4_ENST00000558468.1_3'UTR|IRF9_ENST00000557894.1_Intron	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	41					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		GTTCCGGATTCCCTGGAAACA	0.562																																						dbGAP											0													128.0	115.0	120.0					14																	24631474		2203	4300	6503	-	-	-	SO:0001583	missense	0			M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.121C>A	14.37:g.24631474C>A	ENSP00000380073:p.Pro41Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS61	Missense_Mutation	SNP	pfam_Interferon_reg_fact_DNA-bd_dom,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.P41T	ENST00000396864.3	37	c.121	CCDS9615.1	14	.	.	.	.	.	.	.	.	.	.	C	34	5.296325	0.95574	.	.	ENSG00000213928	ENST00000396864	D	0.99503	-6.03	5.64	5.64	0.86602	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.64402	U	0.000003	D	0.99582	0.9849	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98358	1.0547	10	0.87932	D	0	-12.4967	18.4869	0.90833	0.0:1.0:0.0:0.0	.	41	Q00978	IRF9_HUMAN	T	41	ENSP00000380073:P41T	ENSP00000380073:P41T	P	+	1	0	IRF9	23701314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.185000	0.77714	2.664000	0.90586	0.655000	0.94253	CCC	IRF9	-	pfam_Interferon_reg_fact_DNA-bd_dom,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	ENSG00000213928		0.562	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF9	HGNC	protein_coding	OTTHUMT00000071927.2	199	0.00	0	C			24631474	24631474	+1	no_errors	ENST00000396864	ensembl	human	known	69_37n	missense	165	10.81	20	SNP	1.000	A
JRK	8629	genome.wustl.edu	37	8	143746086	143746086	+	RNA	DEL	T	T	-			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr8:143746086delT	ENST00000507178.2	-	0	1724							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				ttttctgaactccacacacaa	0.672																																						dbGAP											0													19.0	21.0	20.0					8																	143746086		2007	4146	6153	-	-	-			0			AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143746086delT		Somatic		WXS	Illumina GAIIx	Phase_IV	O75565	RNA	DEL	-	NULL	ENST00000507178.2	37	NULL		8																																																																																			JRK	-	-	ENSG00000234616		0.672	JRK-003	KNOWN	basic	processed_transcript	JRK	HGNC	processed_transcript	OTTHUMT00000362914.1	9	0.00	0	T	NM_003724		143746086	143746086	-1	no_errors	ENST00000422119	ensembl	human	known	69_37n	rna	4	33.33	2	DEL	0.000	-
KCND2	3751	genome.wustl.edu	37	7	119915571	119915571	+	Silent	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr7:119915571C>T	ENST00000331113.4	+	1	1850	c.885C>T	c.(883-885)ttC>ttT	p.F295F		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	295					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCCGAGTCTTCCGGGTCTTCA	0.522																																						dbGAP											0													96.0	83.0	88.0					7																	119915571		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.885C>T	7.37:g.119915571C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.F295	ENST00000331113.4	37	c.885	CCDS5776.1	7																																																																																			KCND2	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000184408		0.522	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	47	0.00	0	C	NM_012281		119915571	119915571	+1	no_errors	ENST00000331113	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	1.000	T
KIAA0232	9778	genome.wustl.edu	37	4	6865866	6865866	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr4:6865866C>G	ENST00000307659.5	+	7	4212	c.3757C>G	c.(3757-3759)Cct>Gct	p.P1253A	KIAA0232_ENST00000425103.1_Missense_Mutation_p.P1253A	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	1253							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TTGTCAGTTTCCTGCTTATGA	0.378																																						dbGAP											0													80.0	73.0	75.0					4																	6865866		1854	4108	5962	-	-	-	SO:0001583	missense	0			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.3757C>G	4.37:g.6865866C>G	ENSP00000303928:p.Pro1253Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D2	Missense_Mutation	SNP	NULL	p.P1253A	ENST00000307659.5	37	c.3757	CCDS43209.1	4	.	.	.	.	.	.	.	.	.	.	C	15.87	2.959268	0.53400	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.50820	0.1638	L	0.27053	0.805	0.45056	D	0.998072	D	0.56035	0.974	P	0.52189	0.692	T	0.54289	-0.8316	9	0.87932	D	0	-20.2875	13.1766	0.59630	0.1596:0.8404:0.0:0.0	.	1253	Q92628	K0232_HUMAN	A	1253	.	ENSP00000303928:P1253A	P	+	1	0	KIAA0232	6916767	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.400000	0.52594	2.708000	0.92522	0.655000	0.94253	CCT	KIAA0232	-	NULL	ENSG00000170871		0.378	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	HGNC	protein_coding	OTTHUMT00000359102.2	77	0.00	0	C	NM_014743		6865866	6865866	+1	no_errors	ENST00000307659	ensembl	human	known	69_37n	missense	73	24.49	24	SNP	0.998	G
KIF5B	3799	genome.wustl.edu	37	10	32326302	32326302	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr10:32326302C>T	ENST00000302418.4	-	8	1048	c.591G>A	c.(589-591)atG>atA	p.M197I		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	197	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				TATGTTCATTCATATCTGCAA	0.328			T	"""RET, ALK"""	NSCLC																																	dbGAP		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	0													101.0	91.0	94.0					10																	32326302		2203	4298	6501	-	-	-	SO:0001583	missense	0			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.591G>A	10.37:g.32326302C>T	ENSP00000307078:p.Met197Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVB2|Q5VZ85	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.M197I	ENST00000302418.4	37	c.591	CCDS7171.1	10	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023441	0.93462	.	.	ENSG00000170759	ENST00000302418	T	0.75260	-0.92	5.18	5.18	0.71444	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	D	0.89132	0.6628	M	0.91510	3.215	0.80722	D	1	D	0.67145	0.996	D	0.68765	0.96	D	0.91452	0.5182	10	0.87932	D	0	.	19.0624	0.93099	0.0:1.0:0.0:0.0	.	197	P33176	KINH_HUMAN	I	197	ENSP00000307078:M197I	ENSP00000307078:M197I	M	-	3	0	KIF5B	32366308	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.811000	0.86092	2.552000	0.86080	0.557000	0.71058	ATG	KIF5B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000170759		0.328	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1	166	0.00	0	C	NM_004521		32326302	32326302	-1	no_errors	ENST00000302418	ensembl	human	known	69_37n	missense	188	10.90	23	SNP	1.000	T
LHCGR	3973	genome.wustl.edu	37	2	48982717	48982717	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr2:48982717C>T	ENST00000294954.7	-	1	115	c.94G>A	c.(94-96)Gag>Aag	p.E32K	LHCGR_ENST00000401907.1_Missense_Mutation_p.E32K|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_Missense_Mutation_p.E32K|LHCGR_ENST00000344775.3_Missense_Mutation_p.E32K|LHCGR_ENST00000405626.1_Missense_Mutation_p.E32K	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	32	LRRNT.				activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TTGCAGGGCTCAGGGCAGAGC	0.731																																						dbGAP											0													4.0	7.0	6.0					2																	48982717		1562	2743	4305	-	-	-	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.94G>A	2.37:g.48982717C>T	ENSP00000294954:p.Glu32Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.E32K	ENST00000294954.7	37	c.94	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	C	8.658	0.899811	0.17686	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	4.31	4.31	0.51392	Leucine-rich repeat-containing N-terminal (1);	0.649492	0.15318	N	0.268671	T	0.66036	0.2749	N	0.08118	0	0.38816	D	0.955528	B	0.20887	0.049	B	0.16722	0.016	T	0.61946	-0.6958	9	.	.	.	.	12.1237	0.53905	0.0:1.0:0.0:0.0	.	32	P22888	LSHR_HUMAN	K	32	ENSP00000344301:E32K;ENSP00000294954:E32K;ENSP00000386033:E32K;ENSP00000385847:E32K;ENSP00000385406:E32K	.	E	-	1	0	LHCGR	48836221	0.906000	0.30813	0.923000	0.36655	0.374000	0.29953	1.656000	0.37355	2.213000	0.71641	0.609000	0.83330	GAG	LHCGR	-	prints_LSH_rcpt	ENSG00000138039		0.731	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	8	0.00	0	C	NM_000233.3		48982717	48982717	-1	no_errors	ENST00000294954	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.955	T
LRTOMT	220074	genome.wustl.edu	37	11	71804648	71804648	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr11:71804648T>A	ENST00000289488.2	+	4	567	c.189T>A	c.(187-189)gaT>gaA	p.D63E	LRTOMT_ENST00000539271.1_De_novo_Start_OutOfFrame|LRTOMT_ENST00000435085.1_De_novo_Start_OutOfFrame|LRTOMT_ENST00000541614.1_Missense_Mutation_p.D63E|LRTOMT_ENST00000307198.7_De_novo_Start_OutOfFrame|LRTOMT_ENST00000423494.2_Missense_Mutation_p.D45E|LRTOMT_ENST00000536917.1_Missense_Mutation_p.D63E|LRTOMT_ENST00000538478.1_Missense_Mutation_p.D63E|LAMTOR1_ENST00000545249.1_Intron|LRTOMT_ENST00000447974.1_Missense_Mutation_p.D63E|LRTOMT_ENST00000419228.1_De_novo_Start_OutOfFrame|LRTOMT_ENST00000324866.7_Missense_Mutation_p.D63E|LRTOMT_ENST00000539587.1_Intron|LRTOMT_ENST00000440313.2_5'Flank|LRTOMT_ENST00000439209.1_Missense_Mutation_p.D63E	NM_001271471.2|NM_145309.5	NP_001258400.1|NP_660352.1	Q96E66	LRC51_HUMAN	leucine rich transmembrane and O-methyltransferase domain containing	63						cytoplasm (GO:0005737)				large_intestine(2)|lung(1)|ovary(1)	4						TTCTCAATGATCTGAGAGACT	0.507																																						dbGAP											0													141.0	114.0	123.0					11																	71804648		2200	4293	6493	-	-	-	SO:0001583	missense	0				CCDS8208.1, CCDS44667.1, CCDS44668.1, CCDS55778.1, CCDS59227.1	11q13.4	2014-09-05	2013-08-19	2008-11-27	ENSG00000184154	ENSG00000184154			25033	protein-coding gene	gene with protein product		612414	"""leucine rich repeat containing 51"", ""deafness, autosomal recessive 63"""	LRRC51, DFNB63		18794526, 18953341	Standard	NM_145309		Approved	COMT2, CFAP111	uc010rqw.2	Q8WZ04	OTTHUMG00000154887	ENST00000289488.2:c.189T>A	11.37:g.71804648T>A	ENSP00000289488:p.Asp63Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7X1|B6CZ35|B6CZ36|B6CZ37|B6CZ38|B6CZ39|B7Z5I4	Missense_Mutation	SNP	NULL	p.D63E	ENST00000289488.2	37	c.189	CCDS8208.1	11	.	.	.	.	.	.	.	.	.	.	T	12.74	2.030024	0.35797	.	.	ENSG00000184154	ENST00000538413;ENST00000289488;ENST00000447974;ENST00000423494;ENST00000538478;ENST00000324866;ENST00000439209;ENST00000542846;ENST00000541614;ENST00000536917	T;T;T;T;T	0.30981	2.02;2.02;2.02;1.51;1.98	5.6	0.267	0.15622	.	0.094298	0.64402	N	0.000001	T	0.17066	0.0410	L	0.41573	1.285	0.80722	D	1	B;B;B	0.15930	0.003;0.015;0.003	B;B;B	0.17722	0.012;0.019;0.007	T	0.12426	-1.0548	10	0.18276	T	0.48	-13.5321	1.5483	0.02569	0.2303:0.4306:0.1274:0.2117	.	45;63;63	Q96E66-6;Q96E66-2;Q96E66	.;.;LRC51_HUMAN	E	63;63;63;45;63;63;63;63;63;63	ENSP00000289488:D63E;ENSP00000441249:D45E;ENSP00000444583:D63E;ENSP00000395139:D63E;ENSP00000440248:D63E	ENSP00000289488:D63E	D	+	3	2	LRTOMT	71482296	0.908000	0.30866	0.957000	0.39632	0.358000	0.29455	-0.098000	0.11024	-0.200000	0.10300	-0.385000	0.06624	GAT	LRTOMT	-	NULL	ENSG00000184154		0.507	LRTOMT-001	KNOWN	basic|CCDS	protein_coding	LRTOMT	HGNC	protein_coding	OTTHUMT00000337504.1	111	0.00	0	T	NM_145309		71804648	71804648	+1	no_errors	ENST00000427369	ensembl	human	known	69_37n	missense	107	16.41	21	SNP	0.984	A
MARK3	4140	genome.wustl.edu	37	14	103969315	103969315	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr14:103969315T>G	ENST00000429436.2	+	18	2523	c.2013T>G	c.(2011-2013)gaT>gaG	p.D671E	MARK3_ENST00000553942.1_Missense_Mutation_p.D662E|MARK3_ENST00000303622.9_Missense_Mutation_p.D647E|MARK3_ENST00000561071.1_3'UTR|MARK3_ENST00000416682.2_Missense_Mutation_p.D670E|MARK3_ENST00000216288.7_Missense_Mutation_p.D631E|MARK3_ENST00000440884.3_Missense_Mutation_p.D577E|MARK3_ENST00000335102.5_Missense_Mutation_p.D694E	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	671						plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			GTTCAATGGATCCCGGGGACA	0.502																																						dbGAP											0													72.0	75.0	74.0					14																	103969315		2052	4214	6266	-	-	-	SO:0001583	missense	0			M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.2013T>G	14.37:g.103969315T>G	ENSP00000411397:p.Asp671Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D671E	ENST00000429436.2	37	c.2013	CCDS45165.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.119|0.119	-1.128416|-1.128416	0.01756|0.01756	.|.	.|.	ENSG00000075413|ENSG00000075413	ENST00000335102;ENST00000411530;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942;ENST00000556744|ENST00000554627	T;T;T;T;T;T;T;T|.	0.52526|.	0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66|.	6.08|6.08	-12.2|-12.2	0.00006|0.00006	Kinase-associated KA1 (2);|.	0.129772|.	0.64402|.	N|.	0.000001|.	T|T	0.16685|0.16685	0.0401|0.0401	N|N	0.03903|0.03903	-0.33|-0.33	0.29708|0.29708	N|N	0.839607|0.839607	B;B;B;B;B;B;B;B;B|.	0.09022|.	0.0;0.0;0.0;0.0;0.002;0.0;0.001;0.0;0.0|.	B;B;B;B;B;B;B;B;B|.	0.10450|.	0.005;0.0;0.005;0.0;0.003;0.001;0.001;0.005;0.003|.	T|T	0.41270|0.41270	-0.9518|-0.9518	10|5	0.17832|.	T|.	0.49|.	.|.	16.0773|16.0773	0.80976|0.80976	0.0:0.6056:0.158:0.2364|0.0:0.6056:0.158:0.2364	.|.	678;249;670;380;631;671;577;662;647|.	P27448-7;A2SY06;P27448-2;B4DKN1;P27448-6;P27448;Q86TT8;P27448-4;P27448-3|.	.;.;.;.;.;MARK3_HUMAN;.;.;.|.	E|S	694;363;577;670;671;647;631;662;249|423	ENSP00000335347:D694E;ENSP00000402104:D577E;ENSP00000408092:D670E;ENSP00000411397:D671E;ENSP00000303698:D647E;ENSP00000216288:D631E;ENSP00000450772:D662E;ENSP00000451623:D249E|.	ENSP00000216288:D662E|.	D|I	+|+	3|2	2|0	MARK3|MARK3	103039068|103039068	0.063000|0.063000	0.20901|0.20901	0.013000|0.013000	0.15412|0.15412	0.252000|0.252000	0.25951|0.25951	-0.769000|-0.769000	0.04710|0.04710	-3.690000|-3.690000	0.00120|0.00120	-0.250000|-0.250000	0.11733|0.11733	GAT|ATC	MARK3	-	superfamily_Kinase-assoc_KA1	ENSG00000075413		0.502	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK3	HGNC	protein_coding	OTTHUMT00000415144.1	46	0.00	0	T	NM_001128918		103969315	103969315	+1	no_errors	ENST00000429436	ensembl	human	known	69_37n	missense	55	38.89	35	SNP	0.021	G
FOCAD	54914	genome.wustl.edu	37	9	20716150	20716150	+	Intron	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr9:20716150C>T	ENST00000380249.1	+	4	421				MIR491_ENST00000384877.1_RNA|FOCAD_ENST00000338382.6_Intron	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin							focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											GAGTAGAACACTCCTTATGCA	0.463																																						dbGAP											0													130.0	119.0	123.0					9																	20716150		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.57+741C>T	9.37:g.20716150C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	RNA	SNP	-	NULL	ENST00000380249.1	37	NULL	CCDS34993.1	9																																																																																			MIR491	-	-	ENSG00000207609		0.463	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR491	HGNC	protein_coding	OTTHUMT00000143442.1	269	0.00	0	C	NM_017794		20716150	20716150	+1	no_errors	ENST00000384877	ensembl	human	known	69_37n	rna	489	10.75	59	SNP	1.000	T
MRFAP1	93621	genome.wustl.edu	37	4	6642662	6642662	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr4:6642662G>A	ENST00000320912.4	+	2	726	c.73G>A	c.(73-75)Gag>Aag	p.E25K	MRFAP1_ENST00000382581.4_Missense_Mutation_p.E25K|MRFAP1_ENST00000507420.1_Missense_Mutation_p.E25K	NM_001272053.1	NP_001258982.1			Morf4 family associated protein 1											lung(1)	1						GGAGGATTTCGAGCAGTTTCT	0.647																																						dbGAP											0													68.0	74.0	72.0					4																	6642662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116272	CCDS3389.1	4p16.1	2011-01-27	2011-01-27		ENSG00000179010	ENSG00000179010			24549	protein-coding gene	gene with protein product						15367658	Standard	NM_033296		Approved	PAM14, PGR1	uc003gjh.2	Q9Y605	OTTHUMG00000125504	ENST00000320912.4:c.73G>A	4.37:g.6642662G>A	ENSP00000318352:p.Glu25Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E25K	ENST00000320912.4	37	c.73	CCDS3389.1	4	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585801	0.86748	.	.	ENSG00000179010	ENST00000320912;ENST00000507420;ENST00000382581	.	.	.	3.76	0.995	0.19838	.	0.000000	0.32819	N	0.005609	T	0.17959	0.0431	N	0.24115	0.695	0.25356	N	0.988823	B	0.24368	0.102	B	0.15870	0.014	T	0.09840	-1.0656	9	0.32370	T	0.25	-0.2176	3.824	0.08846	0.2298:0.2028:0.5674:0.0	.	25	Q9Y605	MOFA1_HUMAN	K	25	.	ENSP00000318352:E25K	E	+	1	0	MRFAP1	6693563	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	2.862000	0.48388	0.184000	0.20083	0.561000	0.74099	GAG	MRFAP1	-	NULL	ENSG00000179010		0.647	MRFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRFAP1	HGNC	protein_coding	OTTHUMT00000246831.1	46	0.00	0	G	NM_033296		6642662	6642662	+1	no_errors	ENST00000320912	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	0.997	A
MTOR	2475	genome.wustl.edu	37	1	11204742	11204742	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:11204742C>G	ENST00000361445.4	-	34	4911	c.4835G>C	c.(4834-4836)cGa>cCa	p.R1612P	MTOR-AS1_ENST00000420480.1_RNA|MTOR_ENST00000495435.1_5'UTR|MTOR-AS1_ENST00000445982.1_RNA	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1612	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GATGATCTCTCGTCGCTCGGG	0.552																																						dbGAP											0													96.0	88.0	91.0					1																	11204742		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4835G>C	1.37:g.11204742C>G	ENSP00000354558:p.Arg1612Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R1612P	ENST00000361445.4	37	c.4835	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.297646	0.95574	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.67865	-0.29	5.81	5.81	0.92471	PIK-related kinase (1);PIK-related kinase, FAT (1);Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	D	0.87309	0.6145	M	0.93678	3.445	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	D	0.89721	0.3919	10	0.87932	D	0	-8.9924	20.0826	0.97783	0.0:1.0:0.0:0.0	.	1612	P42345	MTOR_HUMAN	P	1612	ENSP00000354558:R1612P	ENSP00000354558:R1612P	R	-	2	0	MTOR	11127329	1.000000	0.71417	0.725000	0.30721	0.997000	0.91878	7.365000	0.79537	2.746000	0.94184	0.655000	0.94253	CGA	MTOR	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT	ENSG00000198793		0.552	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	92	0.00	0	C	NM_004958		11204742	11204742	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	83	21.70	23	SNP	0.995	G
NLRP2	55655	genome.wustl.edu	37	19	55501561	55501561	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr19:55501561G>A	ENST00000543010.1	+	9	2680		c.e9+1		NLRP2_ENST00000391721.4_Splice_Site|NLRP2_ENST00000427260.2_Splice_Site|NLRP2_ENST00000538819.1_Splice_Site|NLRP2_ENST00000448584.2_Splice_Site|NLRP2_ENST00000537859.1_Splice_Site|NLRP2_ENST00000263437.6_Splice_Site|NLRP2_ENST00000339757.7_Splice_Site	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AGAGGTTGTCGTAAGTCTCTC	0.517																																						dbGAP											0													87.0	74.0	78.0					19																	55501561		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2537+1G>A	19.37:g.55501561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Splice_Site	SNP	-	e8+1	ENST00000543010.1	37	c.2537+1	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	g	10.78	1.447401	0.25987	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	.	.	.	2.55	2.55	0.30701	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7444	0.34578	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NLRP2	60193373	0.988000	0.35896	0.757000	0.31301	0.062000	0.15995	2.156000	0.42310	1.725000	0.51514	0.655000	0.94253	.	NLRP2	-	-	ENSG00000022556		0.517	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	56	0.00	0	G	NM_017852	Intron	55501561	55501561	+1	no_errors	ENST00000448584	ensembl	human	known	69_37n	splice_site	81	14.74	14	SNP	0.862	A
NOL4	8715	genome.wustl.edu	37	18	31599298	31599298	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr18:31599298C>G	ENST00000261592.5	-	6	1337	c.1040G>C	c.(1039-1041)aGa>aCa	p.R347T	NOL4_ENST00000535475.1_Missense_Mutation_p.R192T|NOL4_ENST00000535384.1_Missense_Mutation_p.R62T|NOL4_ENST00000269185.4_Missense_Mutation_p.R233T|NOL4_ENST00000589544.1_Missense_Mutation_p.R347T|NOL4_ENST00000538587.1_Missense_Mutation_p.R273T	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	347						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TCCATTTTCTCTCGCCTCTCG	0.353																																						dbGAP											0													111.0	97.0	102.0					18																	31599298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1040G>C	18.37:g.31599298C>G	ENSP00000261592:p.Arg347Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	NULL	p.R347T	ENST00000261592.5	37	c.1040	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	C	7.995	0.754237	0.15778	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	D;D;T;D;T	0.82803	-1.65;-1.65;-1.21;-1.65;-1.21	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000001	T	0.80576	0.4649	L	0.40543	1.245	0.44539	D	0.997492	P;P;P;B;B;P;P;B	0.50528	0.905;0.763;0.928;0.082;0.073;0.928;0.936;0.287	P;B;P;B;B;P;P;B	0.47744	0.475;0.234;0.526;0.036;0.053;0.526;0.556;0.074	T	0.78321	-0.2249	10	0.30854	T	0.27	-18.8679	14.135	0.65281	0.0:0.9284:0.0:0.0716	.	233;96;62;273;347;62;347;192	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	T	347;233;96;62;192;273	ENSP00000261592:R347T;ENSP00000269185:R233T;ENSP00000445733:R62T;ENSP00000438190:R192T;ENSP00000443472:R273T	ENSP00000261592:R347T	R	-	2	0	NOL4	29853296	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.075000	0.57584	2.730000	0.93505	0.542000	0.68232	AGA	NOL4	-	NULL	ENSG00000101746		0.353	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	HGNC	protein_coding	OTTHUMT00000255386.1	84	0.00	0	C	NM_003787		31599298	31599298	-1	no_errors	ENST00000261592	ensembl	human	known	69_37n	missense	103	24.26	33	SNP	1.000	G
NUP98	4928	genome.wustl.edu	37	11	3697418	3697418	+	Silent	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr11:3697418G>A	ENST00000324932.7	-	33	5794	c.5374C>T	c.(5374-5376)Ctg>Ttg	p.L1792L	NUP98_ENST00000359171.4_3'UTR|NUP98_ENST00000355260.3_Silent_p.L1718L	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1809					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AGTTCTCGCAGATAGGACTGG	0.577			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																	dbGAP		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	0													67.0	61.0	63.0					11																	3697418		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.5374C>T	11.37:g.3697418G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	pfam_Nup96	p.S744F	ENST00000324932.7	37	c.2231	CCDS7746.1	11	.	.	.	.	.	.	.	.	.	.	G	7.790	0.711271	0.15239	.	.	ENSG00000110713	ENST00000429801	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	T	0.74612	0.3739	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72577	-0.4251	4	.	.	.	-7.5817	18.3324	0.90274	0.0:0.0:1.0:0.0	.	.	.	.	F	744	.	.	S	-	2	0	NUP98	3653994	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.490000	0.45294	2.680000	0.91292	0.561000	0.74099	TCT	NUP98	-	NULL	ENSG00000110713		0.577	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	HGNC	protein_coding	OTTHUMT00000032766.3	48	0.00	0	G	NM_016320		3697418	3697418	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429801	ensembl	human	novel	69_37n	missense	40	23.08	12	SNP	1.000	A
OLFML3	56944	genome.wustl.edu	37	1	114523758	114523758	+	Silent	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:114523758G>A	ENST00000320334.4	+	3	662	c.588G>A	c.(586-588)cgG>cgA	p.R196R	OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000393300.2_Silent_p.R176R|OLFML3_ENST00000369551.1_Silent_p.R176R	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	196	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGCTGCCCGGAAAGCTTCCC	0.562																																						dbGAP											0													43.0	45.0	44.0					1																	114523758		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.588G>A	1.37:g.114523758G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Silent	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.R196	ENST00000320334.4	37	c.588	CCDS870.1	1																																																																																			OLFML3	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000116774		0.562	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	100	0.00	0	G	NM_020190		114523758	114523758	+1	no_errors	ENST00000320334	ensembl	human	known	69_37n	silent	113	36.87	66	SNP	0.553	A
OR13F1	138805	genome.wustl.edu	37	9	107267045	107267045	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr9:107267045C>T	ENST00000334726.2	+	1	591	c.502C>T	c.(502-504)Ctc>Ttc	p.L168F		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						GCCACTGTCTCTCTGTGGTAA	0.473																																						dbGAP											0													185.0	175.0	178.0					9																	107267045		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.502C>T	9.37:g.107267045C>T	ENSP00000334452:p.Leu168Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF50	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L168F	ENST00000334726.2	37	c.502	CCDS35087.1	9	.	.	.	.	.	.	.	.	.	.	C	0	-2.757426	0.00084	.	.	ENSG00000186881	ENST00000334726	T	0.00158	8.65	4.29	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.645612	0.13537	N	0.380534	T	0.00039	0.0001	N	0.00140	-2.01	0.24320	N	0.995049	B	0.06786	0.001	B	0.19666	0.026	T	0.35051	-0.9804	10	0.02654	T	1	.	4.9679	0.14100	0.0:0.4766:0.3382:0.1852	.	168	Q8NGS4	O13F1_HUMAN	F	168	ENSP00000334452:L168F	ENSP00000334452:L168F	L	+	1	0	OR13F1	106306866	0.013000	0.17824	0.842000	0.33263	0.032000	0.12392	0.787000	0.26858	0.320000	0.23234	-0.909000	0.02823	CTC	OR13F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186881		0.473	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13F1	HGNC	protein_coding	OTTHUMT00000053475.1	141	0.00	0	C			107267045	107267045	+1	no_errors	ENST00000334726	ensembl	human	known	69_37n	missense	161	35.20	88	SNP	0.703	T
PCDHGA1	56114	genome.wustl.edu	37	5	140712210	140712210	+	Silent	SNP	G	G	A	rs62378403	byFrequency	TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr5:140712210G>A	ENST00000517417.1	+	1	1959	c.1959G>A	c.(1957-1959)ccG>ccA	p.P653P	PCDHGA1_ENST00000378105.3_Silent_p.P653P	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	653	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCAGCCCCCGCTCTCCGCCA	0.697																																						dbGAP											0													31.0	41.0	37.0					5																	140712210		2180	4292	6472	-	-	-	SO:0001819	synonymous_variant	0			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1959G>A	5.37:g.140712210G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M273|Q9Y5D6	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P653	ENST00000517417.1	37	c.1959	CCDS54922.1	5																																																																																			PCDHGA1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204956		0.697	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	51	0.00	0	G	NM_018912		140712210	140712210	+1	no_errors	ENST00000517417	ensembl	human	known	69_37n	silent	34	49.25	33	SNP	0.993	A
PCYT1B	9468	genome.wustl.edu	37	X	24580504	24580504	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chrX:24580504G>A	ENST00000379144.2	-	8	1146	c.1016C>T	c.(1015-1017)tCa>tTa	p.S339L	PCYT1B_ENST00000356768.4_Intron|PCYT1B_ENST00000379145.1_Missense_Mutation_p.S321L	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	339					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	TGGAAGCCATGAGAAGGTGGG	0.617																																						dbGAP											0													65.0	52.0	57.0					X																	24580504		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.1016C>T	X.37:g.24580504G>A	ENSP00000368439:p.Ser339Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	p.S339L	ENST00000379144.2	37	c.1016	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805818	0.50421	.	.	ENSG00000102230	ENST00000379145;ENST00000379144	.	.	.	5.67	4.81	0.61882	.	0.474682	0.23268	N	0.050049	T	0.21674	0.0522	N	0.03608	-0.345	0.29385	N	0.863051	B;B	0.19331	0.0;0.035	B;B	0.15052	0.0;0.012	T	0.10451	-1.0629	9	0.35671	T	0.21	-23.7356	12.7242	0.57162	0.0827:0.0:0.9173:0.0	.	321;339	E9PD84;Q9Y5K3	.;PCY1B_HUMAN	L	321;339	.	ENSP00000368439:S339L	S	-	2	0	PCYT1B	24490425	1.000000	0.71417	0.729000	0.30791	0.896000	0.52359	4.152000	0.58111	1.159000	0.42565	0.544000	0.68410	TCA	PCYT1B	-	NULL	ENSG00000102230		0.617	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	195	0.00	0	G	NM_004845		24580504	24580504	-1	no_errors	ENST00000379144	ensembl	human	known	69_37n	missense	123	15.75	23	SNP	0.995	A
PIK3CA	5290	genome.wustl.edu	37	3	178942489	178942489	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr3:178942489C>T	ENST00000263967.3	+	16	2453	c.2296C>T	c.(2296-2298)Ctt>Ttt	p.L766F		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	766					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ATTTTAAAGGCTTGAAGAGTG	0.313		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													96.0	89.0	91.0					3																	178942489		1808	4068	5876	-	-	-	SO:0001630	splice_region_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2295-1C>T	3.37:g.178942489C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.L766F	ENST00000263967.3	37	c.2296	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202389	0.79127	.	.	ENSG00000121879	ENST00000263967	D	0.81996	-1.56	5.52	5.52	0.82312	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81931	0.4927	L	0.46157	1.445	0.80722	D	1	P	0.48694	0.914	B	0.43413	0.419	T	0.83138	-0.0110	10	0.52906	T	0.07	-15.1455	19.8034	0.96518	0.0:1.0:0.0:0.0	.	766	P42336	PK3CA_HUMAN	F	766	ENSP00000263967:L766F	ENSP00000263967:L766F	L	+	1	0	PIK3CA	180425183	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.969000	0.49232	2.760000	0.94817	0.655000	0.94253	CTT	PIK3CA	-	superfamily_Kinase-like_dom	ENSG00000121879		0.313	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	76	0.00	0	C		Missense_Mutation	178942489	178942489	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	84	14.29	14	SNP	1.000	T
PPP2R2B	5521	genome.wustl.edu	37	5	145969747	145969747	+	Silent	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr5:145969747G>A	ENST00000394413.3	-	9	1665	c.1095C>T	c.(1093-1095)ttC>ttT	p.F365F	PPP2R2B_ENST00000336640.6_Silent_p.F368F|PPP2R2B_ENST00000394411.4_Silent_p.F365F|PPP2R2B_ENST00000453001.1_Silent_p.F365F|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000356826.3_Silent_p.F365F|PPP2R2B_ENST00000394410.2_Silent_p.F354F|PPP2R2B_ENST00000504198.1_Silent_p.F371F|PPP2R2B_ENST00000394414.1_Silent_p.F431F|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000508545.2_Silent_p.F354F|PPP2R2B_ENST00000394409.3_Silent_p.F423F			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	365					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTTTCTGTCGAACATCCTGA	0.502																																						dbGAP											0													73.0	66.0	68.0					5																	145969747		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.1095C>T	5.37:g.145969747G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.F431	ENST00000394413.3	37	c.1293	CCDS4284.1	5																																																																																			PPP2R2B	-	superfamily_WD40_repeat_dom,pirsf_PP2A_PR55,prints_PP2A_PR55	ENSG00000156475		0.502	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	HGNC	protein_coding	OTTHUMT00000251893.2	127	0.00	0	G	NM_181678		145969747	145969747	-1	no_errors	ENST00000394414	ensembl	human	known	69_37n	silent	150	13.29	23	SNP	0.995	A
PTGFRN	5738	genome.wustl.edu	37	1	117527304	117527304	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:117527304G>C	ENST00000393203.2	+	8	2317	c.2170G>C	c.(2170-2172)Gac>Cac	p.D724H		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	724	Ig-like C2-type 6.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		ATCCGTAGATGACATGGCCTT	0.532																																						dbGAP											0													233.0	181.0	198.0					1																	117527304		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.2170G>C	1.37:g.117527304G>C	ENSP00000376899:p.Asp724His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.D724H	ENST00000393203.2	37	c.2170	CCDS890.1	1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066081	0.55539	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.54866	0.55	5.59	3.68	0.42216	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.052090	0.85682	D	0.000000	T	0.47563	0.1452	M	0.72894	2.215	0.50313	D	0.999861	D	0.65815	0.995	P	0.57548	0.823	T	0.50110	-0.8866	10	0.39692	T	0.17	-21.0266	5.1153	0.14831	0.1697:0.0:0.6628:0.1675	.	724	Q9P2B2	FPRP_HUMAN	H	724;583	ENSP00000376899:D724H	ENSP00000376899:D724H	D	+	1	0	PTGFRN	117328827	1.000000	0.71417	0.882000	0.34594	0.845000	0.48019	4.738000	0.62073	0.696000	0.31696	0.561000	0.74099	GAC	PTGFRN	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000134247		0.532	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1	285	0.00	0	G	NM_020440		117527304	117527304	+1	no_errors	ENST00000393203	ensembl	human	known	69_37n	missense	352	12.59	51	SNP	0.892	C
RASAL3	64926	genome.wustl.edu	37	19	15565183	15565183	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr19:15565183C>T	ENST00000343625.7	-	13	2234	c.2149G>A	c.(2149-2151)Gag>Aag	p.E717K		NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	717					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						TGGTCAAGCTCAGCAAAAATT	0.562											OREG0025322	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													44.0	51.0	49.0					19																	15565183		2136	4250	6386	-	-	-	SO:0001583	missense	0				CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.2149G>A	19.37:g.15565183C>T	ENSP00000341905:p.Glu717Lys	Somatic	703	WXS	Illumina GAIIx	Phase_IV	Q8N2T9|Q9H735	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGAP,pfscan_RasGAP	p.E717K	ENST00000343625.7	37	c.2149	CCDS46006.1	19	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945107	0.53079	.	.	ENSG00000105122	ENST00000343625	D	0.82344	-1.6	5.55	5.55	0.83447	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.988437	0.08216	N	0.979960	T	0.78214	0.4248	L	0.27053	0.805	0.37955	D	0.93278	P;P	0.47910	0.902;0.842	B;B	0.40066	0.318;0.169	T	0.77736	-0.2476	10	0.66056	D	0.02	.	17.009	0.86400	0.0:1.0:0.0:0.0	.	717;717	Q86YV0-2;Q86YV0	.;RASL3_HUMAN	K	717	ENSP00000341905:E717K	ENSP00000341905:E717K	E	-	1	0	RASAL3	15426183	0.727000	0.28069	1.000000	0.80357	0.607000	0.37147	1.513000	0.35823	2.630000	0.89119	0.561000	0.74099	GAG	RASAL3	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP	ENSG00000105122		0.562	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASAL3	HGNC	protein_coding	OTTHUMT00000461331.3	55	0.00	0	C	NM_022904		15565183	15565183	-1	no_errors	ENST00000343625	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.997	T
RBM15	64783	genome.wustl.edu	37	1	110884723	110884723	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:110884723A>G	ENST00000369784.3	+	1	3596	c.2696A>G	c.(2695-2697)cAg>cGg	p.Q899R	RBM15_ENST00000487146.2_Missense_Mutation_p.Q899R|RBM15_ENST00000602849.1_Missense_Mutation_p.Q899R|RP5-1074L1.1_ENST00000449169.1_RNA	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	899	SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		AAGCAAAAGCAGGCAGCCGGG	0.547			T	MKL1	acute megakaryocytic leukemia																																	dbGAP		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0													72.0	77.0	75.0					1																	110884723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.2696A>G	1.37:g.110884723A>G	ENSP00000358799:p.Gln899Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	pfam_SPOC_C,pfam_RRM_dom,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.Q899R	ENST00000369784.3	37	c.2696	CCDS822.1	1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019965	0.75275	.	.	ENSG00000162775	ENST00000369784	T	0.21932	1.98	5.25	5.25	0.73442	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);Spen paralogue/orthologue C-terminal, metazoa (1);Spen paralogue and orthologue SPOC, C-terminal (1);	0.000000	0.43260	D	0.000595	T	0.30417	0.0764	M	0.67700	2.07	0.54753	D	0.999988	P;D	0.63046	0.936;0.992	P;P	0.58013	0.475;0.831	T	0.10019	-1.0648	10	0.87932	D	0	-11.638	15.1284	0.72500	1.0:0.0:0.0:0.0	.	899;899	Q96T37-3;Q96T37	.;RBM15_HUMAN	R	899	ENSP00000358799:Q899R	ENSP00000358799:Q899R	Q	+	2	0	RBM15	110686246	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.265000	0.95647	1.982000	0.57802	0.533000	0.62120	CAG	RBM15	-	pfam_SPOC_C,superfamily_SPOC-like,pfscan_SPOC_met	ENSG00000162775		0.547	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	HGNC	protein_coding	OTTHUMT00000031114.2	102	0.00	0	A	NM_022768		110884723	110884723	+1	no_errors	ENST00000369784	ensembl	human	known	69_37n	missense	80	10.11	9	SNP	1.000	G
RGS9	8787	genome.wustl.edu	37	17	63221447	63221447	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr17:63221447G>A	ENST00000262406.9	+	18	1802	c.1735G>A	c.(1735-1737)Gct>Act	p.A579T	RGS9_ENST00000443584.3_Missense_Mutation_p.A576T|RGS9_ENST00000449996.3_Missense_Mutation_p.A576T	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	579					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						GGCCCGCATGGCTCTGTCCTT	0.677																																						dbGAP											0													74.0	78.0	77.0					17																	63221447		1936	4127	6063	-	-	-	SO:0001583	missense	0			AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1735G>A	17.37:g.63221447G>A	ENSP00000262406:p.Ala579Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.A579T	ENST00000262406.9	37	c.1735	CCDS42373.1	17	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914226	0.52546	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.38887	1.14;1.11	4.76	2.67	0.31697	.	0.206528	0.39834	N	0.001260	T	0.32556	0.0833	L	0.44542	1.39	0.39724	D	0.971514	B;P;B	0.38788	0.295;0.647;0.141	B;B;B	0.34722	0.188;0.091;0.041	T	0.19257	-1.0311	10	0.51188	T	0.08	.	11.5591	0.50766	0.0:0.1357:0.7233:0.141	.	579;579;576	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	T	579;576	ENSP00000262406:A579T;ENSP00000396329:A576T	ENSP00000262406:A579T	A	+	1	0	RGS9	60651909	0.983000	0.35010	0.007000	0.13788	0.996000	0.88848	1.859000	0.39418	0.628000	0.30357	0.561000	0.74099	GCT	RGS9	-	NULL	ENSG00000108370		0.677	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS9	HGNC	protein_coding	OTTHUMT00000445885.1	76	0.00	0	G	NM_003835		63221447	63221447	+1	no_errors	ENST00000262406	ensembl	human	known	69_37n	missense	37	54.88	45	SNP	0.857	A
RPS6KA6	27330	genome.wustl.edu	37	X	83361977	83361977	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chrX:83361977T>C	ENST00000262752.2	-	14	1190	c.1183A>G	c.(1183-1185)Att>Gtt	p.I395V	RPS6KA6_ENST00000495332.1_5'Flank|RPS6KA6_ENST00000543399.1_Missense_Mutation_p.I395V	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	395	AGC-kinase C-terminal.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TCTTCTGCAATAGAAGTTGCA	0.338																																						dbGAP											0													76.0	70.0	72.0					X																	83361977		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1183A>G	X.37:g.83361977T>C	ENSP00000262752:p.Ile395Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	p.I395V	ENST00000262752.2	37	c.1183	CCDS14451.1	X	.	.	.	.	.	.	.	.	.	.	T	9.191	1.026073	0.19512	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.69306	-0.39;-0.38	4.93	-0.698	0.11280	AGC-kinase, C-terminal (1);	0.539296	0.20895	N	0.083749	T	0.34803	0.0910	N	0.04959	-0.14	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.11792	-1.0573	10	0.21540	T	0.41	.	4.0479	0.09781	0.2756:0.3877:0.0:0.3367	.	395;395	B7ZL90;Q9UK32	.;KS6A6_HUMAN	V	395	ENSP00000262752:I395V;ENSP00000440830:I395V	ENSP00000262752:I395V	I	-	1	0	RPS6KA6	83248633	0.000000	0.05858	0.949000	0.38748	0.993000	0.82548	-0.577000	0.05847	-0.121000	0.11787	0.486000	0.48141	ATT	RPS6KA6	-	pirsf_Ribosomal_S6_kinase_II	ENSG00000072133		0.338	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	HGNC	protein_coding	OTTHUMT00000057372.1	140	0.00	0	T	NM_014496		83361977	83361977	-1	no_errors	ENST00000262752	ensembl	human	known	69_37n	missense	116	18.31	26	SNP	0.137	C
SBNO1	55206	genome.wustl.edu	37	12	123789180	123789180	+	Silent	SNP	C	C	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr12:123789180C>A	ENST00000602398.1	-	29	3844	c.3717G>T	c.(3715-3717)ggG>ggT	p.G1239G	SBNO1_ENST00000420886.2_Silent_p.G1239G|SBNO1_ENST00000602750.1_Silent_p.G1238G|SBNO1_ENST00000267176.4_Silent_p.G1238G			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1239					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TGAGCTGCTTCCCAGTATTTG	0.279																																						dbGAP											0													42.0	44.0	44.0					12																	123789180		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3717G>T	12.37:g.123789180C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Silent	SNP	pfam_Helicase/UvrB_dom,superfamily_Prismane-like	p.G1239	ENST00000602398.1	37	c.3717	CCDS53844.1	12																																																																																			SBNO1	-	superfamily_Prismane-like	ENSG00000139697		0.279	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	112	0.00	0	C	NM_018183		123789180	123789180	-1	no_errors	ENST00000420886	ensembl	human	known	69_37n	silent	63	16.00	12	SNP	1.000	A
SEMA3C	10512	genome.wustl.edu	37	7	80434993	80434993	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr7:80434993G>A	ENST00000265361.3	-	7	1181	c.620C>T	c.(619-621)gCg>gTg	p.A207V	SEMA3C_ENST00000536800.1_Missense_Mutation_p.A59V|SEMA3C_ENST00000544525.1_Missense_Mutation_p.A225V|SEMA3C_ENST00000419255.2_Missense_Mutation_p.A207V	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	207	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGTTCTGACCGCATTCCTCTT	0.323																																						dbGAP											0													96.0	86.0	89.0					7																	80434993		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.620C>T	7.37:g.80434993G>A	ENSP00000265361:p.Ala207Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRL8	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ig_I-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.A225V	ENST00000265361.3	37	c.674	CCDS5596.1	7	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259682	0.59321	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525;ENST00000536800	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.159786	0.56097	D	0.000037	T	0.12178	0.0296	L	0.33137	0.985	0.80722	D	1	B;B;P	0.34815	0.065;0.415;0.47	B;B;B	0.39152	0.025;0.193;0.292	T	0.19353	-1.0308	10	0.17832	T	0.49	.	18.6689	0.91502	0.0:0.0:1.0:0.0	.	59;225;207	B4DRL8;F5H1Z7;Q99985	.;.;SEM3C_HUMAN	V	207;207;225;59	ENSP00000265361:A207V;ENSP00000411193:A207V;ENSP00000445649:A225V;ENSP00000438258:A59V	ENSP00000265361:A207V	A	-	2	0	SEMA3C	80272929	1.000000	0.71417	0.969000	0.41365	0.932000	0.56968	9.835000	0.99442	2.403000	0.81681	0.591000	0.81541	GCG	SEMA3C	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075223		0.323	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	HGNC	protein_coding	OTTHUMT00000253279.1	103	0.00	0	G	NM_006379		80434993	80434993	-1	no_errors	ENST00000544525	ensembl	human	known	69_37n	missense	68	26.09	24	SNP	1.000	A
SEMA6A	57556	genome.wustl.edu	37	5	115782654	115782654	+	Silent	SNP	A	A	G			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr5:115782654A>G	ENST00000343348.6	-	19	3535	c.2748T>C	c.(2746-2748)taT>taC	p.Y916Y	SEMA6A_ENST00000282394.6_Silent_p.Y393Y|SEMA6A_ENST00000503865.1_Silent_p.Y295Y|CTB-118N6.3_ENST00000512128.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000257414.8_Silent_p.Y933Y|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000508424.1_RNA|SEMA6A_ENST00000510263.1_Silent_p.Y916Y|SEMA6A_ENST00000513137.1_Silent_p.Y343Y	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	916					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AGCTCCTCTTATAGTCAACCC	0.577																																						dbGAP											0													54.0	61.0	59.0					5																	115782654		1996	4174	6170	-	-	-	SO:0001819	synonymous_variant	0			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2748T>C	5.37:g.115782654A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2H9	Missense_Mutation	SNP	pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.I431T	ENST00000343348.6	37	c.1292	CCDS47256.1	5	.	.	.	.	.	.	.	.	.	.	A	4.049	0.006732	0.07866	.	.	ENSG00000092421	ENST00000515129	.	.	.	5.22	1.49	0.22878	.	.	.	.	.	T	0.54615	0.1869	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44528	-0.9322	4	.	.	.	.	7.1339	0.25517	0.5236:0.0:0.4764:0.0	.	.	.	.	T	431	.	.	I	-	2	0	SEMA6A	115810553	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	2.058000	0.41374	0.294000	0.22547	0.460000	0.39030	ATA	SEMA6A	-	NULL	ENSG00000092421		0.577	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	102	0.00	0	A	NM_020796		115782654	115782654	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000515129	ensembl	human	putative	69_37n	missense	75	27.18	28	SNP	1.000	G
SLC38A4	55089	genome.wustl.edu	37	12	47173627	47173627	+	Silent	SNP	G	G	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr12:47173627G>T	ENST00000447411.1	-	8	800	c.594C>A	c.(592-594)ggC>ggA	p.G198G	SLC38A4_ENST00000266579.4_Silent_p.G198G	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	198					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					TGAGGTAGTTGCCATTGAGGT	0.343																																						dbGAP											0													89.0	80.0	83.0					12																	47173627		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.594C>A	12.37:g.47173627G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K553	Silent	SNP	pfam_AA_transpt_TM	p.G198	ENST00000447411.1	37	c.594	CCDS8750.1	12																																																																																			SLC38A4	-	pfam_AA_transpt_TM	ENSG00000139209		0.343	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A4	HGNC	protein_coding	OTTHUMT00000404574.1	127	0.00	0	G			47173627	47173627	-1	no_errors	ENST00000266579	ensembl	human	known	69_37n	silent	93	13.89	15	SNP	1.000	T
SMC3	9126	genome.wustl.edu	37	10	112340713	112340713	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr10:112340713G>A	ENST00000361804.4	+	8	607	c.481G>A	c.(481-483)Gaa>Aaa	p.E161K	SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	161					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GCTATTAAGAGAAGTAGCTGG	0.338																																						dbGAP											0													88.0	88.0	88.0					10																	112340713		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.481G>A	10.37:g.112340713G>A	ENSP00000354720:p.Glu161Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K156|O60464|Q5T482	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	p.E161K	ENST00000361804.4	37	c.481	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.619123	0.96649	.	.	ENSG00000108055	ENST00000361804	D	0.91237	-2.81	5.63	5.63	0.86233	RecF/RecN/SMC (1);	0.095419	0.64402	D	0.000001	D	0.96830	0.8965	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97390	0.9988	10	0.87932	D	0	.	19.7394	0.96219	0.0:0.0:1.0:0.0	.	161	Q9UQE7	SMC3_HUMAN	K	161	ENSP00000354720:E161K	ENSP00000354720:E161K	E	+	1	0	SMC3	112330703	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.320000	0.96346	2.673000	0.90976	0.579000	0.79373	GAA	SMC3	-	pfam_RecF/RecN/SMC	ENSG00000108055		0.338	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	HGNC	protein_coding	OTTHUMT00000050337.1	122	0.00	0	G	NM_005445		112340713	112340713	+1	no_errors	ENST00000361804	ensembl	human	known	69_37n	missense	60	28.57	24	SNP	1.000	A
SNX7	51375	genome.wustl.edu	37	1	99164273	99164273	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:99164273G>A	ENST00000306121.3	+	6	859	c.850G>A	c.(850-852)Gaa>Aaa	p.E284K	SNX7_ENST00000370189.5_Missense_Mutation_p.E220K|SNX7_ENST00000529992.1_Missense_Mutation_p.E229K	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	220					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		ATATTTTGATGAAATGAAAGA	0.343																																						dbGAP											0													41.0	43.0	42.0					1																	99164273		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.850G>A	1.37:g.99164273G>A	ENSP00000304429:p.Glu284Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.E284K	ENST00000306121.3	37	c.850	CCDS755.2	1	.	.	.	.	.	.	.	.	.	.	G	30	5.053613	0.93793	.	.	ENSG00000162627	ENST00000370189;ENST00000529992;ENST00000306121	T;T;T	0.31510	1.96;1.49;1.49	5.28	5.28	0.74379	.	0.043907	0.85682	D	0.000000	T	0.42607	0.1210	M	0.72894	2.215	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.995	D;D;D	0.68483	0.958;0.948;0.944	T	0.20438	-1.0275	10	0.11485	T	0.65	-28.3415	19.2819	0.94055	0.0:0.0:1.0:0.0	.	229;284;220	E9PNL2;Q9UNH6-3;Q9UNH6-2	.;.;.	K	220;229;284	ENSP00000359208:E220K;ENSP00000434731:E229K;ENSP00000304429:E284K	ENSP00000304429:E284K	E	+	1	0	SNX7	98936861	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.218000	0.95166	2.639000	0.89480	0.555000	0.69702	GAA	SNX7	-	NULL	ENSG00000162627		0.343	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX7	HGNC	protein_coding	OTTHUMT00000029609.2	92	0.00	0	G			99164273	99164273	+1	no_errors	ENST00000306121	ensembl	human	known	69_37n	missense	96	12.73	14	SNP	1.000	A
TLL2	7093	genome.wustl.edu	37	10	98165021	98165021	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr10:98165021C>T	ENST00000357947.3	-	10	1460	c.1235G>A	c.(1234-1236)cGg>cAg	p.R412Q	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	412	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R412L(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GTAACCATCCCGGACCTCCAC	0.438																																						dbGAP											1	Substitution - Missense(1)	lung(1)											136.0	136.0	136.0					10																	98165021		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1235G>A	10.37:g.98165021C>T	ENSP00000350630:p.Arg412Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.R412Q	ENST00000357947.3	37	c.1235	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	C	34	5.400064	0.96030	.	.	ENSG00000095587	ENST00000357947	T	0.35973	1.28	5.31	5.31	0.75309	CUB (5);	0.000000	0.40818	N	0.001017	T	0.67287	0.2877	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.72633	-0.4234	10	0.62326	D	0.03	.	18.1507	0.89674	0.0:1.0:0.0:0.0	.	412	Q9Y6L7	TLL2_HUMAN	Q	412	ENSP00000350630:R412Q	ENSP00000350630:R412Q	R	-	2	0	TLL2	98155011	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.575000	0.82447	2.764000	0.94973	0.655000	0.94253	CGG	TLL2	-	pfam_CUB,superfamily_CUB,smart_CUB,pirsf_BMP_1/tolloid-like,pfscan_CUB	ENSG00000095587		0.438	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	165	0.00	0	C			98165021	98165021	-1	no_errors	ENST00000357947	ensembl	human	known	69_37n	missense	90	20.18	23	SNP	1.000	T
TNR	7143	genome.wustl.edu	37	1	175365873	175365873	+	Silent	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr1:175365873C>T	ENST00000367674.2	-	5	1755	c.1047G>A	c.(1045-1047)ccG>ccA	p.P349P	TNR_ENST00000263525.2_Silent_p.P349P			Q92752	TENR_HUMAN	tenascin R	349	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TCACTGCCATCGGCCCGTCCC	0.597																																						dbGAP											0													84.0	85.0	84.0					1																	175365873		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1047G>A	1.37:g.175365873C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D74N	ENST00000367674.2	37	c.220	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	9.638	1.138128	0.21123	.	.	ENSG00000116147	ENST00000422274	.	.	.	5.96	5.04	0.67666	.	.	.	.	.	T	0.56790	0.2009	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54077	-0.8347	4	.	.	.	.	6.6596	0.23007	0.0:0.6887:0.1538:0.1576	.	.	.	.	N	74	.	.	D	-	1	0	TNR	173632496	0.096000	0.21769	1.000000	0.80357	0.999000	0.98932	-0.541000	0.06099	2.826000	0.97356	0.655000	0.94253	GAT	TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.597	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	53	0.00	0	C	NM_003285		175365873	175365873	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000422274	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	1.000	T
TTC21B	79809	genome.wustl.edu	37	2	166771856	166771856	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr2:166771856G>T	ENST00000243344.7	-	15	2130	c.1993C>A	c.(1993-1995)Cta>Ata	p.L665I		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	665					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						CCTTGGGCTAGAGCAAGGTCT	0.413																																						dbGAP											0													165.0	165.0	165.0					2																	166771856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.1993C>A	2.37:g.166771856G>T	ENSP00000243344:p.Leu665Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L665I	ENST00000243344.7	37	c.1993	CCDS33315.1	2	.	.	.	.	.	.	.	.	.	.	G	12.32	1.903034	0.33628	.	.	ENSG00000123607	ENST00000243344	T	0.79554	-1.28	5.69	3.91	0.45181	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.064498	0.64402	D	0.000006	T	0.71896	0.3394	L	0.47016	1.485	0.80722	D	1	B	0.27594	0.182	B	0.28011	0.085	T	0.64015	-0.6506	10	0.29301	T	0.29	-8.1758	8.1709	0.31254	0.1394:0.0:0.7252:0.1353	.	665	Q7Z4L5	TT21B_HUMAN	I	665	ENSP00000243344:L665I	ENSP00000243344:L665I	L	-	1	2	TTC21B	166480102	1.000000	0.71417	1.000000	0.80357	0.254000	0.26022	4.019000	0.57181	0.781000	0.33589	-0.251000	0.11542	CTA	TTC21B	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000123607		0.413	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	HGNC	protein_coding	OTTHUMT00000333770.1	177	0.00	0	G	NM_024753		166771856	166771856	-1	no_errors	ENST00000243344	ensembl	human	known	69_37n	missense	126	15.44	23	SNP	1.000	T
TWF2	11344	genome.wustl.edu	37	3	52265976	52265976	+	Missense_Mutation	SNP	G	G	A	rs376043177		TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr3:52265976G>A	ENST00000305533.5	-	3	509	c.266C>T	c.(265-267)tCg>tTg	p.S89L	TWF2_ENST00000499914.2_Missense_Mutation_p.S89L|TLR9_ENST00000597542.1_5'UTR|TLR9_ENST00000494383.1_5'Flank	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	89	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GTTATCAGGCGACCAGGCGAG	0.652											OREG0015610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													99.0	95.0	97.0					3																	52265976		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.266C>T	3.37:g.52265976G>A	ENSP00000303908:p.Ser89Leu	Somatic	983	WXS	Illumina GAIIx	Phase_IV	Q9Y3F5	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.S89L	ENST00000305533.5	37	c.266	CCDS2849.1	3	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896550	0.72639	.	.	ENSG00000247596	ENST00000305533;ENST00000499914	T;T	0.39056	1.1;1.1	5.61	5.61	0.85477	Actin-binding, cofilin/tropomyosin type (3);	.	.	.	.	T	0.72104	0.3419	M	0.91406	3.205	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.78314	0.983;0.991	T	0.72704	-0.4213	9	0.27785	T	0.31	.	19.6089	0.95594	0.0:0.0:1.0:0.0	.	89;89	D6RG15;Q6IBS0	.;TWF2_HUMAN	L	89	ENSP00000303908:S89L;ENSP00000426464:S89L	ENSP00000303908:S89L	S	-	2	0	TWF2	52241016	1.000000	0.71417	0.994000	0.49952	0.018000	0.09664	9.855000	0.99526	2.644000	0.89710	0.455000	0.32223	TCG	TWF2	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	ENSG00000247596		0.652	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWF2	HGNC	protein_coding	OTTHUMT00000350199.2	42	0.00	0	G			52265976	52265976	-1	no_errors	ENST00000305533	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	A
UPB1	51733	genome.wustl.edu	37	22	24898389	24898389	+	Intron	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr22:24898389G>A	ENST00000326010.5	+	3	708				UPB1_ENST00000382760.2_Missense_Mutation_p.R150H|UPB1_ENST00000413389.2_Intron	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta						beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					TTCCCACATCGttctgaatcc	0.552																																						dbGAP											0													97.0	89.0	92.0					22																	24898389		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.364+208G>A	22.37:g.24898389G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMF8|Q9UIR3	Missense_Mutation	SNP	superfamily_C-N_Hydrolase	p.R150H	ENST00000326010.5	37	c.449	CCDS13827.1	22	.	.	.	.	.	.	.	.	.	.	G	4.670	0.124621	0.08931	.	.	ENSG00000100024	ENST00000382760;ENST00000426507	D	0.85411	-1.98	2.14	-3.2	0.05156	.	.	.	.	.	T	0.75664	0.3880	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.65784	-0.6084	6	0.59425	D	0.04	.	0.3067	0.00281	0.2838:0.2018:0.3097:0.2048	.	.	.	.	H	150	ENSP00000372208:R150H	ENSP00000372208:R150H	R	+	2	0	UPB1	23228389	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.372000	0.07504	-0.696000	0.05098	-0.952000	0.02654	CGT	UPB1	-	NULL	ENSG00000100024		0.552	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPB1	HGNC	protein_coding	OTTHUMT00000319869.1	47	0.00	0	G			24898389	24898389	+1	no_errors	ENST00000382760	ensembl	human	putative	69_37n	missense	21	29.03	9	SNP	0.000	A
VCAN	1462	genome.wustl.edu	37	5	82837218	82837218	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr5:82837218T>C	ENST00000265077.3	+	8	8961	c.8396T>C	c.(8395-8397)aTg>aCg	p.M2799T	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.M1812T|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2799	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CCTGATGTGATGGAAGGATCC	0.443																																						dbGAP											0													136.0	128.0	131.0					5																	82837218		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8396T>C	5.37:g.82837218T>C	ENSP00000265077:p.Met2799Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.M2799T	ENST00000265077.3	37	c.8396	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	T	10.51	1.369723	0.24771	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.30981	1.51;1.51	6.17	1.12	0.20585	.	1.140650	0.06235	N	0.689299	T	0.18676	0.0448	N	0.25647	0.755	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.001;0.002	T	0.28839	-1.0031	10	0.16896	T	0.51	.	3.6974	0.08369	0.1655:0.3436:0.0:0.491	.	1812;2799	P13611-2;P13611	.;CSPG2_HUMAN	T	2799;1812	ENSP00000265077:M2799T;ENSP00000340062:M1812T	ENSP00000265077:M2799T	M	+	2	0	VCAN	82872974	0.000000	0.05858	0.000000	0.03702	0.718000	0.41266	-0.977000	0.03782	0.173000	0.19788	0.533000	0.62120	ATG	VCAN	-	NULL	ENSG00000038427		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	80	0.00	0	T	NM_004385		82837218	82837218	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	187	14.09	31	SNP	0.000	C
TBC1D31	93594	genome.wustl.edu	37	8	124141389	124141389	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr8:124141389G>A	ENST00000287380.1	+	15	2291	c.2201G>A	c.(2200-2202)cGt>cAt	p.R734H	TBC1D31_ENST00000518805.1_Missense_Mutation_p.R288H|TBC1D31_ENST00000309336.3_Missense_Mutation_p.R734H|TBC1D31_ENST00000522420.1_Missense_Mutation_p.R629H|TBC1D31_ENST00000327098.5_Missense_Mutation_p.R734H|TBC1D31_ENST00000378080.2_Missense_Mutation_p.V628I|TBC1D31_ENST00000521676.1_Missense_Mutation_p.R611H	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	734						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										GAGCTGCTTCGTAAAGCTGAA	0.378																																						dbGAP											0													103.0	106.0	105.0					8																	124141389		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.2201G>A	8.37:g.124141389G>A	ENSP00000287380:p.Arg734His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.R734H	ENST00000287380.1	37	c.2201	CCDS6338.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.04|11.04	1.521246|1.521246	0.27211|0.27211	.|.	.|.	ENSG00000156787|ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000518805|ENST00000378080	D;T;T;D;D;T|T	0.85955|0.77229	-2.05;-0.24;-0.22;-2.05;-2.05;0.81|-1.08	5.91|5.91	5.04|5.04	0.67666|0.67666	.|.	0.260843|.	0.39210|.	N|.	0.001434|.	T|T	0.77315|0.77315	0.4112|0.4112	L|L	0.54323|0.54323	1.7|1.7	0.19300|0.19300	N|N	0.999975|0.999975	B;B;B;B|.	0.31640|.	0.016;0.015;0.333;0.009|.	B;B;B;B|.	0.17979|.	0.003;0.013;0.02;0.003|.	T|T	0.66709|0.66709	-0.5855|-0.5855	10|7	0.51188|0.30078	T|T	0.08|0.28	-6.4626|-6.4626	11.0412|11.0412	0.47831|0.47831	0.1408:0.0:0.8592:0.0|0.1408:0.0:0.8592:0.0	.|.	734;734;629;734|.	B7ZL19;Q96DN5-2;E7ERK7;Q96DN5|.	.;.;.;WDR67_HUMAN|.	H|I	734;734;734;629;611;288|628	ENSP00000287380:R734H;ENSP00000308358:R734H;ENSP00000312701:R734H;ENSP00000429334:R629H;ENSP00000430628:R611H;ENSP00000429494:R288H|ENSP00000367320:V628I	ENSP00000287380:R734H|ENSP00000367320:V628I	R|V	+|+	2|1	0|0	WDR67|WDR67	124210570|124210570	1.000000|1.000000	0.71417|0.71417	0.942000|0.942000	0.38095|0.38095	0.015000|0.015000	0.08874|0.08874	1.878000|1.878000	0.39608|0.39608	1.503000|1.503000	0.48686|0.48686	0.655000|0.655000	0.94253|0.94253	CGT|GTA	WDR67	-	NULL	ENSG00000156787		0.378	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	HGNC	protein_coding	OTTHUMT00000381721.1	220	0.00	0	G	NM_145647		124141389	124141389	+1	no_errors	ENST00000287380	ensembl	human	known	69_37n	missense	281	21.73	78	SNP	0.922	A
WT1-AS	51352	genome.wustl.edu	37	11	32460430	32460430	+	RNA	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr11:32460430G>A	ENST00000395900.1	+	0	1308				WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000442957.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000525436.1_RNA	NR_023920.1		Q06250	WIT1_HUMAN	WT1 antisense RNA											endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6						CTAATGGGATGCAGAGGCGAG	0.527																																						dbGAP											0													43.0	45.0	44.0					11																	32460430		2202	4299	6501	-	-	-			0			BC002734		11p13	2012-10-19	2012-08-15	2012-01-25	ENSG00000183242	ENSG00000183242		"""Long non-coding RNAs"", ""-"""	18135	non-coding RNA	RNA, long non-coding	"""Wilms tumor associated protein"""	607899	"""Wilms tumor upstream neighbor 1"", ""WT1 antisense RNA (non-protein coding)"""	WIT1		2173145, 8406502, 17210670	Standard	NR_120546		Approved	WIT-1, WT1AS, WT1-AS1	uc010red.2	Q06250	OTTHUMG00000039557		11.37:g.32460430G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMY0|Q96A27	RNA	SNP	-	NULL	ENST00000395900.1	37	NULL		11																																																																																			WT1-AS	-	-	ENSG00000183242		0.527	WT1-AS-001	KNOWN	basic	antisense	WT1-AS	HGNC	antisense	OTTHUMT00000095437.1	90	0.00	0	G	NR_023920		32460430	32460430	+1	no_errors	ENST00000395900	ensembl	human	known	69_37n	rna	36	41.94	26	SNP	0.000	A
ZCCHC12	170261	genome.wustl.edu	37	X	117959442	117959442	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chrX:117959442G>A	ENST00000310164.2	+	4	742	c.235G>A	c.(235-237)Gag>Aag	p.E79K		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	79					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						gaatatgtctgaggaggaaaa	0.552																																						dbGAP											0													81.0	82.0	82.0					X																	117959442		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.235G>A	X.37:g.117959442G>A	ENSP00000308921:p.Glu79Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	superfamily_Znf_CCHC	p.E79K	ENST00000310164.2	37	c.235	CCDS14574.1	X	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684832	0.68157	.	.	ENSG00000174460	ENST00000310164	T	0.14144	2.53	3.09	3.09	0.35607	.	0.000000	0.33180	N	0.005186	T	0.37544	0.1007	M	0.87682	2.9	0.30932	N	0.726818	D	0.67145	0.996	D	0.77557	0.99	T	0.42120	-0.9470	10	0.72032	D	0.01	-19.3465	8.7855	0.34818	0.0:0.0:1.0:0.0	.	79	Q6PEW1	ZCH12_HUMAN	K	79	ENSP00000308921:E79K	ENSP00000308921:E79K	E	+	1	0	ZCCHC12	117843470	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.765000	0.55272	1.801000	0.52704	0.594000	0.82650	GAG	ZCCHC12	-	NULL	ENSG00000174460		0.552	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	HGNC	protein_coding	OTTHUMT00000058014.1	199	0.50	1	G	NM_173798		117959442	117959442	+1	no_errors	ENST00000310164	ensembl	human	known	69_37n	missense	202	12.17	28	SNP	0.996	A
ZSCAN21	7589	genome.wustl.edu	37	7	99662422	99662422	+	3'UTR	SNP	C	C	T			TCGA-BH-A0EE-01A-11W-A050-09	TCGA-BH-A0EE-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68d16e6a-20a5-428f-89d0-a8a0deda80cc	f4528a3f-aa6b-4964-80fd-afa642427616	g.chr7:99662422C>T	ENST00000292450.4	+	0	1768				ZSCAN21_ENST00000543588.1_3'UTR|ZNF3_ENST00000413658.2_Missense_Mutation_p.D129N|ZSCAN21_ENST00000456748.2_3'UTR	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21						positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CAGAAGGTGTCAGGAGGTTCC	0.537																																						dbGAP											0													115.0	125.0	121.0					7																	99662422		2153	4254	6407	-	-	-	SO:0001624	3_prime_UTR_variant	0			AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.*182C>T	7.37:g.99662422C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A6|D6W5T9|Q9H0B5	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.D129N	ENST00000292450.4	37	c.385	CCDS5681.1	7	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707153	0.30232	.	.	ENSG00000166526	ENST00000413658	T	0.01767	4.65	2.93	1.1	0.20463	.	.	.	.	.	T	0.01287	0.0042	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48714	-0.9011	8	0.25106	T	0.35	.	4.8691	0.13624	0.0:0.7064:0.0:0.2936	.	129	P17036-2	.	N	129	ENSP00000399951:D129N	ENSP00000399951:D129N	D	-	1	0	ZNF3	99500358	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	-0.907000	0.04067	0.291000	0.22468	0.555000	0.69702	GAC	ZNF3	-	pfscan_Krueppel-associated_box	ENSG00000166526		0.537	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF3	HGNC	protein_coding	OTTHUMT00000336166.1	121	0.00	0	C	NM_145914		99662422	99662422	-1	no_errors	ENST00000413658	ensembl	human	known	69_37n	missense	115	12.21	16	SNP	0.000	T
