#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL6B	51412	genome.wustl.edu	37	7	100245130	100245131	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr7:100245130_100245131insG	ENST00000160382.5	-	8	801_802	c.695_696insC	c.(694-696)ccafs	p.P232fs		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	232					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TCTTCCAGTTTGGGGGGGCACC	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.696dupC	7.37:g.100245137_100245137dupG	ENSP00000160382:p.Pro232fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2D0|O75421	Frame_Shift_Ins	INS	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.N233fs	ENST00000160382.5	37	c.696_695	CCDS5702.1	7																																																																																			ACTL6B	-	pfam_Actin-like,smart_Actin-like	ENSG00000077080		0.609	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	20	0.00	0	-	NM_016188		100245130	100245131	-1	no_errors	ENST00000160382	ensembl	human	known	69_37n	frame_shift_ins	18	14.29	3	INS	1.000:1.000	G
ADAMTSL4	54507	genome.wustl.edu	37	1	150530505	150530506	+	Frame_Shift_Ins	INS	-	-	G	rs149280379		TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr1:150530505_150530506insG	ENST00000369038.2	+	12	2463_2464	c.2262_2263insG	c.(2263-2265)gggfs	p.G755fs	ADAMTSL4_ENST00000271643.4_Frame_Shift_Ins_p.G755fs|ADAMTSL4_ENST00000369041.5_Frame_Shift_Ins_p.G755fs|ADAMTSL4_ENST00000369039.5_Frame_Shift_Ins_p.G778fs|RP11-54A4.2_ENST00000442435.2_RNA			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	755	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)	p.F754L(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GGCAGGAATTTGGGGGGGGTGG	0.693																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2270dupG	1.37:g.150530513_150530513dupG	ENSP00000358034:p.Gly755fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Frame_Shift_Ins	INS	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.G780fs	ENST00000369038.2	37	c.2331_2332	CCDS955.1	1																																																																																			ADAMTSL4	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143382		0.693	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ADAMTSL4	HGNC	protein_coding	OTTHUMT00000084395.4	26	0.00	0	-	NM_019032		150530505	150530506	+1	no_errors	ENST00000369039	ensembl	human	known	69_37n	frame_shift_ins	31	11.43	4	INS	1.000:1.000	G
BMPER	168667	genome.wustl.edu	37	7	34192803	34192803	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr7:34192803G>T	ENST00000297161.2	+	16	2350	c.1976G>T	c.(1975-1977)tGc>tTc	p.C659F	BMPER_ENST00000426693.1_Missense_Mutation_p.C659F	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	659	TIL.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						AACAAGCCGTGCGTTGCTGGG	0.527																																						dbGAP											0													185.0	150.0	162.0					7																	34192803		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1976G>T	7.37:g.34192803G>T	ENSP00000297161:p.Cys659Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1P8|Q8TF36	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_VWF_C,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_C,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,pfscan_VWF_C	p.C659F	ENST00000297161.2	37	c.1976	CCDS5442.1	7	.	.	.	.	.	.	.	.	.	.	G	15.45	2.835893	0.50951	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	D;D	0.97941	-4.62;-4.62	5.91	5.91	0.95273	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.000000	0.85682	D	0.000000	D	0.99375	0.9780	H	0.98664	4.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98404	1.0569	10	0.87932	D	0	.	20.2956	0.98549	0.0:0.0:1.0:0.0	.	659	Q8N8U9	BMPER_HUMAN	F	659	ENSP00000297161:C659F;ENSP00000393950:C659F	ENSP00000297161:C659F	C	+	2	0	BMPER	34159328	1.000000	0.71417	0.101000	0.21167	0.002000	0.02628	9.476000	0.97823	2.805000	0.96524	0.460000	0.39030	TGC	BMPER	-	pfam_TIL_dom,superfamily_TIL_dom	ENSG00000164619		0.527	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPER	HGNC	protein_coding	OTTHUMT00000250570.2	232	0.00	0	G	NM_133468		34192803	34192803	+1	no_errors	ENST00000297161	ensembl	human	known	69_37n	missense	150	39.76	99	SNP	0.997	T
AOAH	313	genome.wustl.edu	37	7	36552857	36552857	+	3'UTR	SNP	C	C	T			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr7:36552857C>T	ENST00000258749.5	-	0	2128				AOAH_ENST00000431169.1_Silent_p.E616E|AOAH_ENST00000535891.1_3'UTR|AOAH_ENST00000538464.1_3'UTR	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)						inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						TCCTGAGAGGCTCAGTGCCCG	0.582																																						dbGAP											0													89.0	89.0	89.0					7																	36552857		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.*1G>A	7.37:g.36552857C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Y5|B7Z490|Q53F13	Silent	SNP	pfam_Lipase_GDSL,pfam_SapB_2,superfamily_Saposin-like,superfamily_Esterase_SGNH_hydro-type,smart_SaposinB,pfscan_SaposinB	p.E616	ENST00000258749.5	37	c.1848	CCDS5448.1	7																																																																																			AOAH	-	NULL	ENSG00000136250		0.582	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AOAH	HGNC	protein_coding	OTTHUMT00000219829.2	233	0.00	0	C	NM_001637		36552857	36552857	-1	no_errors	ENST00000431169	ensembl	human	putative	69_37n	silent	218	31.45	100	SNP	0.604	T
CADPS	8618	genome.wustl.edu	37	3	62423869	62423869	+	Silent	SNP	C	C	G			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr3:62423869C>G	ENST00000383710.4	-	28	4036	c.3687G>C	c.(3685-3687)gtG>gtC	p.V1229V	CADPS_ENST00000357948.3_Silent_p.V1150V|CADPS_ENST00000283269.9_Silent_p.V1190V	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1229	Mediates targeting and association with DCVs. {ECO:0000250}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		AGGCGTCGGCCACGTCCATCC	0.438																																						dbGAP											0													78.0	73.0	74.0					3																	62423869		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3687G>C	3.37:g.62423869C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	NULL	p.W221S	ENST00000383710.4	37	c.662	CCDS46858.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.329|5.329	0.245974|0.245974	0.10077|0.10077	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000466621|ENST00000473635	.|.	.|.	.|.	5.65|5.65	2.45|2.45	0.29901|0.29901	.|.	.|.	.|.	.|.	.|.	T|T	0.57198|0.57198	0.2037|0.2037	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.54036|0.54036	-0.8353|-0.8353	4|4	.|.	.|.	.|.	.|.	9.0026|9.0026	0.36092|0.36092	0.5488:0.3441:0.107:0.0|0.5488:0.3441:0.107:0.0	.|.	.|.	.|.	.|.	R|S	130|221	.|.	.|.	G|W	-|-	1|2	0|0	CADPS|CADPS	62398909|62398909	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	0.354000|0.354000	0.20146|0.20146	1.390000|1.390000	0.46547|0.46547	-0.164000|-0.164000	0.13417|0.13417	GGC|TGG	CADPS	-	NULL	ENSG00000163618		0.438	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	141	0.00	0	C	NM_003716, NM_183393, NM_183394		62423869	62423869	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000473635	ensembl	human	known	69_37n	missense	104	35.80	58	SNP	0.999	G
DCAF8L2	347442	genome.wustl.edu	37	X	27765025	27765025	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chrX:27765025G>A	ENST00000451261.2	+	5	412	c.13G>A	c.(13-15)Gaa>Aaa	p.E5K		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	5										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GTCCCACCAAGAAGGCAGCAC	0.562																																						dbGAP											0													53.0	38.0	42.0					X																	27765025		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.13G>A	X.37:g.27765025G>A	ENSP00000462745:p.Glu5Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXH9|J3KT06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E5K	ENST00000451261.2	37	c.13	CCDS59162.1	X																																																																																			DCAF8L2	-	NULL	ENSG00000189186		0.562	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	11	0.00	0	G	XM_293354		27765025	27765025	+1	no_errors	ENST00000451261	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.000	A
OR1N1	138883	genome.wustl.edu	37	9	125289198	125289198	+	Silent	SNP	G	G	A			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr9:125289198G>A	ENST00000304880.2	-	1	374	c.375C>T	c.(373-375)tgC>tgT	p.C125C		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						AGAGGGGGTGGCAAATGGCCA	0.522																																						dbGAP											0													95.0	81.0	86.0					9																	125289198		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.375C>T	9.37:g.125289198G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFM1|O43870|Q6IF16|Q96R93	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C125	ENST00000304880.2	37	c.375	CCDS6844.1	9																																																																																			OR1N1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171505		0.522	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N1	HGNC	protein_coding	OTTHUMT00000053938.1	132	0.00	0	G			125289198	125289198	-1	no_errors	ENST00000304880	ensembl	human	known	69_37n	silent	77	45.00	63	SNP	0.163	A
OR6V1	346517	genome.wustl.edu	37	7	142749782	142749782	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr7:142749782C>A	ENST00000418316.1	+	1	366	c.345C>A	c.(343-345)gaC>gaA	p.D115E		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					TCCTGACAGACATGGCCCTTG	0.582																																						dbGAP											0													119.0	124.0	122.0					7																	142749782		2163	4282	6445	-	-	-	SO:0001583	missense	0				CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.345C>A	7.37:g.142749782C>A	ENSP00000396085:p.Asp115Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D115E	ENST00000418316.1	37	c.345	CCDS47728.1	7	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923695	0.52653	.	.	ENSG00000225781	ENST00000418316	T	0.01323	5.01	4.41	1.0	0.19881	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01454	0.0047	N	0.22421	0.69	0.20926	N	0.999822	P	0.45634	0.863	P	0.46885	0.53	T	0.48822	-0.9001	9	0.87932	D	0	.	0.9497	0.01373	0.1721:0.4152:0.1682:0.2444	.	115	Q8N148	OR6V1_HUMAN	E	115	ENSP00000396085:D115E	ENSP00000396085:D115E	D	+	3	2	OR6V1	142459904	0.000000	0.05858	0.017000	0.16124	0.965000	0.64279	-0.303000	0.08210	-0.006000	0.14370	-0.137000	0.14449	GAC	OR6V1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000225781		0.582	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6V1	HGNC	protein_coding	OTTHUMT00000350860.1	311	0.00	0	C			142749782	142749782	+1	no_errors	ENST00000418316	ensembl	human	known	69_37n	missense	128	44.59	103	SNP	0.991	A
PCMTD2	55251	genome.wustl.edu	37	20	62896720	62896720	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr20:62896720G>A	ENST00000308824.6	+	4	647	c.520G>A	c.(520-522)Gaa>Aaa	p.E174K	PCMTD2_ENST00000369758.4_Missense_Mutation_p.E174K|PCMTD2_ENST00000609372.1_Intron|PCMTD2_ENST00000299468.7_Missense_Mutation_p.E174K	NM_018257.2	NP_060727.2	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2	174						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|upper_aerodigestive_tract(1)	17	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GAAAGAGCATGAAGAGTACAT	0.463																																						dbGAP											0													173.0	156.0	162.0					20																	62896720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001745	CCDS13559.1, CCDS46631.1	20q13.33	2012-10-02	2005-10-06	2005-10-06	ENSG00000203880	ENSG00000203880			15882	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 36"""	C20orf36			Standard	NM_018257		Approved	FLJ10883	uc002yil.4	Q9NV79	OTTHUMG00000033029	ENST00000308824.6:c.520G>A	20.37:g.62896720G>A	ENSP00000307854:p.Glu174Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5H3|Q8IW60|Q9H4K2	Missense_Mutation	SNP	pfam_PCMT	p.E174K	ENST00000308824.6	37	c.520	CCDS13559.1	20	.	.	.	.	.	.	.	.	.	.	.	9.511	1.105678	0.20632	.	.	ENSG00000203880	ENST00000369758;ENST00000299468;ENST00000308824	T;T;T	0.43688	0.94;0.94;0.94	5.34	5.34	0.76211	.	0.045287	0.85682	D	0.000000	T	0.35828	0.0945	L	0.41573	1.285	0.58432	D	0.999993	B;B	0.14012	0.007;0.009	B;B	0.24701	0.012;0.055	T	0.11348	-1.0591	10	0.32370	T	0.25	-34.614	12.3953	0.55380	0.0774:0.0:0.9226:0.0	.	174;174	Q9NV79-2;Q9NV79	.;PCMD2_HUMAN	K	174	ENSP00000358773:E174K;ENSP00000299468:E174K;ENSP00000307854:E174K	ENSP00000299468:E174K	E	+	1	0	PCMTD2	62367164	1.000000	0.71417	0.763000	0.31416	0.004000	0.04260	7.613000	0.82986	2.494000	0.84150	0.460000	0.39030	GAA	PCMTD2	-	pfam_PCMT	ENSG00000203880		0.463	PCMTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCMTD2	HGNC	protein_coding	OTTHUMT00000080301.1	91	0.00	0	G	NM_018257		62896720	62896720	+1	no_errors	ENST00000308824	ensembl	human	known	69_37n	missense	143	40.91	99	SNP	1.000	A
POTEM	641455	genome.wustl.edu	37	14	19990641	19990641	+	Silent	SNP	C	C	T	rs138327719		TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr14:19990641C>T	ENST00000551509.1	-	10	1485	c.1434G>A	c.(1432-1434)aaG>aaA	p.K478K		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	478										endometrium(4)|kidney(1)|lung(4)	9						CAGAAAGTTGCTTCTGAGTAT	0.358																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.1434G>A	14.37:g.19990641C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.K478	ENST00000551509.1	37	c.1434	CCDS45076.1	14																																																																																			POTEM	-	NULL	ENSG00000187537		0.358	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	18	0.00	0	C	NM_001145442		19990641	19990641	-1	no_errors	ENST00000551509	ensembl	human	novel	69_37n	silent	19	24.00	6	SNP	0.978	T
PROK2	60675	genome.wustl.edu	37	3	71821981	71821981	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr3:71821981T>C	ENST00000295619.3	-	4	294		c.e4-2		PROK2_ENST00000353065.3_Splice_Site	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2						activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		AAATGGAACCTAAATAAAAAA	0.378																																						dbGAP											0													42.0	47.0	45.0					3																	71821981		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.286-2A>G	3.37:g.71821981T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Z79|Q6ISR0	Splice_Site	SNP	-	e4-2	ENST00000295619.3	37	c.286-2	CCDS46868.1	3	.	.	.	.	.	.	.	.	.	.	T	17.84	3.487750	0.64074	.	.	ENSG00000163421	ENST00000353065;ENST00000295619	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2117	0.73230	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PROK2	71904671	1.000000	0.71417	0.991000	0.47740	0.667000	0.39255	6.585000	0.74062	2.238000	0.73509	0.528000	0.53228	.	PROK2	-	-	ENSG00000163421		0.378	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROK2	HGNC	protein_coding	OTTHUMT00000352302.1	38	0.00	0	T	NM_001126128	Intron	71821981	71821981	-1	no_errors	ENST00000295619	ensembl	human	known	69_37n	splice_site	86	37.68	52	SNP	0.999	C
PPM1L	151742	genome.wustl.edu	37	3	160783305	160783305	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr3:160783305A>C	ENST00000498165.1	+	3	790	c.689A>C	c.(688-690)gAt>gCt	p.D230A	PPM1L_ENST00000480117.1_3'UTR|PPM1L_ENST00000295839.9_Missense_Mutation_p.D103A|PPM1L_ENST00000464260.1_Missense_Mutation_p.D51A	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	230	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TTGTCTCATGATCACAAGCCT	0.488																																					Pancreas(86;250 1994 13715 43211)	dbGAP											0													112.0	104.0	106.0					3																	160783305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.689A>C	3.37:g.160783305A>C	ENSP00000417659:p.Asp230Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3J2|Q96NM7	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.D230A	ENST00000498165.1	37	c.689	CCDS33886.1	3	.	.	.	.	.	.	.	.	.	.	A	25.1	4.598482	0.87055	.	.	ENSG00000163590	ENST00000498165;ENST00000464260;ENST00000295839	T;T;T	0.17370	2.28;2.28;2.28	5.12	5.12	0.69794	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.52273	0.1724	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65578	-0.6134	10	0.87932	D	0	.	14.2558	0.66051	1.0:0.0:0.0:0.0	.	103;230	Q5SGD2-3;Q5SGD2	.;PPM1L_HUMAN	A	230;51;103	ENSP00000417659:D230A;ENSP00000420746:D51A;ENSP00000295839:D103A	ENSP00000295839:D103A	D	+	2	0	PPM1L	162265999	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.735000	0.91549	2.166000	0.68216	0.459000	0.35465	GAT	PPM1L	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000163590		0.488	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1L	HGNC	protein_coding	OTTHUMT00000353019.1	228	0.00	0	A	NM_139245		160783305	160783305	+1	no_errors	ENST00000498165	ensembl	human	known	69_37n	missense	172	43.28	132	SNP	1.000	C
RICTOR	253260	genome.wustl.edu	37	5	38958580	38958580	+	Silent	SNP	G	G	A			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr5:38958580G>A	ENST00000357387.3	-	24	2415	c.2385C>T	c.(2383-2385)tcC>tcT	p.S795S	RICTOR_ENST00000503698.1_5'UTR|RICTOR_ENST00000296782.5_Silent_p.S795S	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CTCCAAGGTGGGATAACGCTG	0.318																																						dbGAP											0													89.0	95.0	93.0					5																	38958580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2385C>T	5.37:g.38958580G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_ARM-type_fold	p.S795	ENST00000357387.3	37	c.2385	CCDS34148.1	5																																																																																			RICTOR	-	superfamily_ARM-type_fold	ENSG00000164327		0.318	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	157	0.00	0	G	NM_152756		38958580	38958580	-1	no_errors	ENST00000296782	ensembl	human	known	69_37n	silent	121	42.38	89	SNP	0.731	A
RNASE3	6037	genome.wustl.edu	37	14	21359857	21359857	+	Silent	SNP	A	A	G			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr14:21359857A>G	ENST00000304639.3	+	2	70	c.12A>G	c.(10-12)aaA>aaG	p.K4K		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	4					antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	TGGTTCCAAAACTGTTCACTT	0.502																																						dbGAP											0													110.0	125.0	120.0					14																	21359857		2191	4298	6489	-	-	-	SO:0001819	synonymous_variant	0			X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.12A>G	14.37:g.21359857A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Silent	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.K4	ENST00000304639.3	37	c.12	CCDS9560.1	14																																																																																			RNASE3	-	NULL	ENSG00000169397		0.502	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE3	HGNC	protein_coding	OTTHUMT00000073795.2	368	0.00	0	A	NM_002935		21359857	21359857	+1	no_errors	ENST00000304639	ensembl	human	known	69_37n	silent	200	43.54	155	SNP	0.000	G
SORCS2	57537	genome.wustl.edu	37	4	7714487	7714487	+	Silent	SNP	C	C	T	rs534523889		TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr4:7714487C>T	ENST00000507866.2	+	15	2005	c.1896C>T	c.(1894-1896)tcC>tcT	p.S632S	SORCS2_ENST00000329016.9_Silent_p.S460S	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	632					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						GCTTCCGCTCCGATTGGGAGC	0.592																																						dbGAP											0													54.0	60.0	58.0					4																	7714487		2032	4201	6233	-	-	-	SO:0001819	synonymous_variant	0			AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.1896C>T	4.37:g.7714487C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L7	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.S632	ENST00000507866.2	37	c.1896	CCDS47008.1	4																																																																																			SORCS2	-	smart_VPS10	ENSG00000184985		0.592	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS2	HGNC	protein_coding	OTTHUMT00000358685.4	46	0.00	0	C	NM_020777		7714487	7714487	+1	no_errors	ENST00000507866	ensembl	human	known	69_37n	silent	50	13.79	8	SNP	0.593	T
TLE2	7089	genome.wustl.edu	37	19	3013795	3013796	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr19:3013795_3013796insG	ENST00000262953.6	-	11	1006_1007	c.744_745insC	c.(742-747)cccagcfs	p.S249fs	TLE2_ENST00000591529.1_Frame_Shift_Ins_p.S263fs|TLE2_ENST00000426948.2_Frame_Shift_Ins_p.S263fs|TLE2_ENST00000443826.3_Frame_Shift_Ins_p.S127fs|TLE2_ENST00000447365.2_5'UTR|TLE2_ENST00000455444.2_Frame_Shift_Ins_p.S127fs|TLE2_ENST00000586422.1_Intron|TLE2_ENST00000590536.1_Frame_Shift_Ins_p.S250fs|TLE2_ENST00000587217.1_5'UTR	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	249	CCN domain.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTAGCCGGGCTGGGGGGCTCTG	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.745dupC	19.37:g.3013801_3013801dupG	ENSP00000262953:p.Ser249fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Frame_Shift_Ins	INS	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Groucho_enhance,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S248fs	ENST00000262953.6	37	c.745_744	CCDS45911.1	19																																																																																			TLE2	-	NULL	ENSG00000065717		0.609	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TLE2	HGNC	protein_coding	OTTHUMT00000452194.2	36	0.00	0	-	NM_003260		3013795	3013796	-1	no_errors	ENST00000262953	ensembl	human	known	69_37n	frame_shift_ins	11	21.43	3	INS	1.000:1.000	G
TMEM155	132332	genome.wustl.edu	37	4	122681612	122681612	+	Missense_Mutation	SNP	C	C	T	rs549013423	byFrequency	TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr4:122681612C>T	ENST00000337677.5	-	6	788	c.230G>A	c.(229-231)cGc>cAc	p.R77H	TMEM155_ENST00000394396.1_Missense_Mutation_p.R77H|TMEM155_ENST00000394394.1_Missense_Mutation_p.R77H	NM_152399.2	NP_689612.2	Q4W5P6	TM155_HUMAN	transmembrane protein 155	77						extracellular region (GO:0005576)				breast(1)|lung(5)	6						tggggtgctgcggggaccatc	0.532																																						dbGAP											0													36.0	33.0	34.0					4																	122681612		2114	4096	6210	-	-	-	SO:0001583	missense	0			AK055396	CCDS3721.1	4q27	2008-02-05			ENSG00000164112	ENSG00000164112			26418	protein-coding gene	gene with protein product							Standard	NM_152399		Approved	FLJ30834	uc003idx.1	Q4W5P6	OTTHUMG00000133035	ENST00000337677.5:c.230G>A	4.37:g.122681612C>T	ENSP00000336987:p.Arg77His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNW9|Q96NI2	Missense_Mutation	SNP	NULL	p.R77H	ENST00000337677.5	37	c.230	CCDS3721.1	4	.	.	.	.	.	.	.	.	.	.	C	7.620	0.676562	0.14841	.	.	ENSG00000164112	ENST00000394396;ENST00000337677;ENST00000394394	T;T;T	0.56444	0.46;0.46;0.46	4.27	-4.78	0.03209	.	0.384381	0.19181	N	0.120665	T	0.21062	0.0507	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.05273	-1.0895	10	0.87932	D	0	.	0.1612	0.00103	0.2361:0.2128:0.2327:0.3184	.	77	Q4W5P6	TM155_HUMAN	H	77	ENSP00000377919:R77H;ENSP00000336987:R77H;ENSP00000377917:R77H	ENSP00000336987:R77H	R	-	2	0	TMEM155	122901062	0.000000	0.05858	0.000000	0.03702	0.099000	0.18886	-1.445000	0.02401	-1.245000	0.02513	-0.145000	0.13849	CGC	TMEM155	-	NULL	ENSG00000164112		0.532	TMEM155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM155	HGNC	protein_coding	OTTHUMT00000256637.2	16	0.00	0	C	NM_152399		122681612	122681612	-1	no_errors	ENST00000337677	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.000	T
TMEM71	137835	genome.wustl.edu	37	8	133764098	133764098	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr8:133764098C>T	ENST00000356838.3	-	4	389	c.247G>A	c.(247-249)Gac>Aac	p.D83N	TMEM71_ENST00000517538.1_5'UTR|TMEM71_ENST00000377901.4_Missense_Mutation_p.D83N|TMEM71_ENST00000523829.1_Missense_Mutation_p.D83N	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	83						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			CCATCTTTGTCGCACAGGAAG	0.463																																						dbGAP											0													176.0	158.0	164.0					8																	133764098		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.247G>A	8.37:g.133764098C>T	ENSP00000349296:p.Asp83Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	NULL	p.D83N	ENST00000356838.3	37	c.247	CCDS6366.1	8	.	.	.	.	.	.	.	.	.	.	C	10.86	1.471021	0.26423	.	.	ENSG00000165071	ENST00000523829;ENST00000356838;ENST00000377901;ENST00000519187;ENST00000519304	.	.	.	5.81	4.04	0.47022	.	0.057243	0.64402	N	0.000002	T	0.40570	0.1122	L	0.49455	1.56	0.37335	D	0.91015	P;B;P	0.44090	0.651;0.295;0.826	B;B;B	0.32211	0.142;0.056;0.142	T	0.48969	-0.8987	9	0.54805	T	0.06	-16.7034	10.5791	0.45244	0.0:0.8518:0.0:0.1482	.	83;83;83	Q6P5X7;Q6P5X7-3;Q6P5X7-2	TMM71_HUMAN;.;.	N	83	.	ENSP00000349296:D83N	D	-	1	0	TMEM71	133833280	0.961000	0.32948	0.174000	0.22961	0.006000	0.05464	3.082000	0.50128	0.818000	0.34468	-0.751000	0.03497	GAC	TMEM71	-	NULL	ENSG00000165071		0.463	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM71	HGNC	protein_coding	OTTHUMT00000379591.1	277	0.00	0	C	NM_144649		133764098	133764098	-1	no_errors	ENST00000356838	ensembl	human	known	69_37n	missense	281	68.74	620	SNP	0.923	T
TTLL3	26140	genome.wustl.edu	37	3	9859333	9859333	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr3:9859333G>T	ENST00000547186.1	+	5	536	c.320G>T	c.(319-321)gGt>gTt	p.G107V	TTLL3_ENST00000430793.1_5'Flank|TTLL3_ENST00000455274.1_5'Flank|TTLL3_ENST00000397241.1_5'UTR|TTLL3_ENST00000383827.1_5'Flank|ARPC4-TTLL3_ENST00000397256.1_Missense_Mutation_p.G201V|TTLL3_ENST00000427853.3_5'UTR|TTLL3_ENST00000426895.4_Missense_Mutation_p.G250V	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	107					axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					CCGTAGGTGGGTCTATGTCTC	0.542																																						dbGAP											0													143.0	138.0	139.0					3																	9859333		2112	4228	6340	-	-	-	SO:0001583	missense	0				CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.320G>T	3.37:g.9859333G>T	ENSP00000446659:p.Gly107Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.G250V	ENST00000547186.1	37	c.749		3	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711860	0.89112	.	.	ENSG00000250151;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021	ENST00000397256;ENST00000419081;ENST00000438596;ENST00000417065;ENST00000426895;ENST00000547186;ENST00000426827;ENST00000443148	T;T;T;T;T;T;T	0.59638	2.78;0.76;0.25;2.96;2.96;0.76;0.76	5.06	5.06	0.68205	.	0.320529	0.27159	N	0.020645	T	0.82185	0.4982	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	D	0.87025	0.2131	10	0.87932	D	0	.	18.0543	0.89360	0.0:0.0:1.0:0.0	.	46;107	B4DM47;Q9Y4R7	.;TTLL3_HUMAN	V	201;107;149;107;250;107;150;45	ENSP00000380427:G201V;ENSP00000414965:G149V;ENSP00000408128:G107V;ENSP00000392549:G250V;ENSP00000446659:G107V;ENSP00000389904:G150V;ENSP00000398097:G45V	ENSP00000380427:G201V	G	+	2	0	ARPC4-TTLL3;TTLL3	9834333	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	8.792000	0.91856	2.344000	0.79699	0.591000	0.81541	GGT	TTLL3	-	NULL	ENSG00000214021		0.542	TTLL3-203	KNOWN	basic	protein_coding	TTLL3	HGNC	protein_coding		98	0.00	0	G	NM_001025930.2		9859333	9859333	+1	no_errors	ENST00000426895	ensembl	human	known	69_37n	missense	95	38.71	60	SNP	1.000	T
XPNPEP2	7512	genome.wustl.edu	37	X	128887190	128887190	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chrX:128887190A>G	ENST00000371106.3	+	11	1265	c.1073A>G	c.(1072-1074)aAc>aGc	p.N358S		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	358						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GCAGTGAAGAACAGCAAGGAG	0.552																																						dbGAP											0													174.0	139.0	150.0					X																	128887190		2203	4299	6502	-	-	-	SO:0001583	missense	0			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1073A>G	X.37:g.128887190A>G	ENSP00000360147:p.Asn358Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV16|O75994	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.N358S	ENST00000371106.3	37	c.1073	CCDS14613.1	X	.	.	.	.	.	.	.	.	.	.	a	15.17	2.752675	0.49362	.	.	ENSG00000122121	ENST00000371106	T	0.78003	-1.14	5.49	4.3	0.51218	Peptidase M24, structural domain (2);	0.134929	0.64402	D	0.000002	T	0.67392	0.2888	L	0.58583	1.82	0.28443	N	0.916698	P	0.36874	0.572	B	0.29598	0.104	T	0.64373	-0.6423	10	0.52906	T	0.07	-9.8372	5.7618	0.18205	0.7436:0.169:0.0874:0.0	.	358	O43895	XPP2_HUMAN	S	358	ENSP00000360147:N358S	ENSP00000360147:N358S	N	+	2	0	XPNPEP2	128714871	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.546000	0.60705	0.692000	0.31613	0.483000	0.47432	AAC	XPNPEP2	-	superfamily_Pept_M24_structural-domain	ENSG00000122121		0.552	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	HGNC	protein_coding	OTTHUMT00000058210.1	171	0.00	0	A	NM_003399		128887190	128887190	+1	no_errors	ENST00000371106	ensembl	human	known	69_37n	missense	147	24.62	48	SNP	1.000	G
ZNF354B	117608	genome.wustl.edu	37	5	178310408	178310408	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0H0-01A-11W-A071-09	TCGA-BH-A0H0-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69110467-4cf5-4b5d-a2dd-b1c91e786959	49c66d20-3515-4425-a51a-975e2ce61b0c	g.chr5:178310408A>C	ENST00000322434.3	+	5	1181	c.955A>C	c.(955-957)Atc>Ctc	p.I319L	RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACATCAAAAAATCCATGCTCA	0.388																																						dbGAP											0													59.0	61.0	60.0					5																	178310408		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.955A>C	5.37:g.178310408A>C	ENSP00000327143:p.Ile319Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0V2|Q5U5Z4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I319L	ENST00000322434.3	37	c.955	CCDS4439.1	5	.	.	.	.	.	.	.	.	.	.	A	11.28	1.592100	0.28357	.	.	ENSG00000178338	ENST00000322434	T	0.48522	0.81	3.46	3.46	0.39613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54095	0.1837	L	0.45698	1.435	0.28090	N	0.93184	P	0.50369	0.934	P	0.56563	0.801	T	0.46303	-0.9201	9	0.59425	D	0.04	-4.4211	9.9616	0.41699	1.0:0.0:0.0:0.0	.	319	Q96LW1	Z354B_HUMAN	L	319	ENSP00000327143:I319L	ENSP00000327143:I319L	I	+	1	0	ZNF354B	178243014	0.000000	0.05858	1.000000	0.80357	0.447000	0.32167	0.860000	0.27871	1.449000	0.47699	0.459000	0.35465	ATC	ZNF354B	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178338		0.388	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354B	HGNC	protein_coding	OTTHUMT00000253482.1	183	0.00	0	A	NM_058230		178310408	178310408	+1	no_errors	ENST00000322434	ensembl	human	known	69_37n	missense	122	34.76	65	SNP	1.000	C
